WO2018160592A1 - Translatable molecules and synthesis thereof - Google Patents
Translatable molecules and synthesis thereof Download PDFInfo
- Publication number
- WO2018160592A1 WO2018160592A1 PCT/US2018/020018 US2018020018W WO2018160592A1 WO 2018160592 A1 WO2018160592 A1 WO 2018160592A1 US 2018020018 W US2018020018 W US 2018020018W WO 2018160592 A1 WO2018160592 A1 WO 2018160592A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- rna
- protein
- template
- translatable
- nucleotides
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- A61K38/1703—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- A61K38/1709—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/475—Growth factors; Growth regulators
- C07K14/505—Erythropoietin [EPO]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/7115—Nucleic acids or oligonucleotides having modified bases, i.e. other than adenine, guanine, cytosine, uracil or thymine
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- A61K38/18—Growth factors; Growth regulators
- A61K38/1816—Erythropoietin [EPO]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/43—Enzymes; Proenzymes; Derivatives thereof
- A61K38/46—Hydrolases (3)
- A61K38/48—Hydrolases (3) acting on peptide bonds (3.4)
- A61K38/482—Serine endopeptidases (3.4.21)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/43—Enzymes; Proenzymes; Derivatives thereof
- A61K38/46—Hydrolases (3)
- A61K38/48—Hydrolases (3) acting on peptide bonds (3.4)
- A61K38/482—Serine endopeptidases (3.4.21)
- A61K38/4846—Factor VII (3.4.21.21); Factor IX (3.4.21.22); Factor Xa (3.4.21.6); Factor XI (3.4.21.27); Factor XII (3.4.21.38)
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/575—Hormones
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/745—Blood coagulation or fibrinolysis factors
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/81—Protease inhibitors
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Definitions
- This invention relates to the fields of molecular biology
- this invention relates to methods, structures and compositions for synthesis of molecules having translational activity for making active polypeptides or proteins, for use in vivo and as therapeutics.
- RNA molecules could be manipulated to affect or treat rare diseases that are not as readily approached by other means. It would be useful to utilize synthetic RNA to control or enhance the production and purity of a polypeptide or protein, especially one directly associated with a disease. However, realizing the potential of RNA therapeutics has long been difficult.
- RNA molecules as medicinal agents include the general lack of control or ability to vary the structure to enhance therapeutic properties. There is a general lack of predictability for modifications or changes in chemical structures to modulate properties that are pertinent to drug success.
- compositions and methods to increase the translation efficiency of an RNA, and specifically increase the amount of a translated polypeptide or protein is a desirable result.
- structural modification that increases the efficiency of generating a translatable RNA can improve the apparent and/or inherent activity of the RNA, thus contributing new therapeutic effects.
- translatable molecules and methods of synthesis thereof, that can have increased specific activity, lifetime or other properties over native mRNA, to be used in methods and compositions for producing and delivering active polypeptides and proteins in medicines.
- This invention provides methods and compositions for a wide reaching platform to design and implement RNA agents for rare diseases, and other therapeutic modalities.
- This disclosure includes methods and compositions for novel molecules having translational activity, which can be used to provide active polypeptides, proteins, or fragments thereof, in various settings.
- this invention provides processes for making an RNA including steps for providing a DNA molecule that can be transcribed to provide the RNA.
- certain codons in an open reading frame of the DNA can be replaced with alternative codons, and codon in-frame position in a reading frame.
- the DNA molecule can be transcribed in the presence of nucleoside triphosphates, a 5' cap, and one or more chemically-modified nucleoside triphosphates to form a product mixture.
- An RNA can be isolated and purified from the mixture.
- the RNA may contain natural and chemically-modified nucleotides.
- this invention provides methods for synthesis of an
- RNA RNA.
- Processes for making an RNA can include steps for providing a DNA molecule that can be transcribed to provide the RNA.
- certain deoxyadenosine nucleotides in an open reading frame of the DNA can be replaced with non- deoxyadenosine nucleotides.
- the DNA may further comprise a promoter for transcribing the non-coding strand.
- the DNA molecule can be transcribed in the presence of nucleoside triphosphates, a 5' cap, and one or more chemically-modified nucleoside triphosphates to form a product mixture.
- An RNA can be isolated and purified from the mixture.
- the RNA may contain natural and chemically-modified nucleotides.
- RNA product molecules made by a process of this invention can have functional cytoplasmic half-life for producing polypeptides and proteins.
- the peptides and proteins can be active for therapeutic modalities, as well as for use in vaccines and immunotherapies.
- RNA molecules made by a process of this invention can be translatable messenger molecules, which can have long half-life, particularly in the cytoplasm of a cell.
- the longer duration of the translatable messenger molecules of this invention can be significant for providing a translation product that is active for ameliorating, preventing or treating disease.
- translatable molecules of this invention can be used in medicines, and for methods and compositions for producing and delivering active peptides and proteins.
- This invention further provides processes for making translatable RNA molecules having enhanced properties for providing and delivering polypeptides and proteins.
- Embodiments of this disclosure can provide a wide range of novel, translatable messenger RNA molecules.
- the translatable messenger molecules can contain various chemically modified nucleotides.
- the translatable molecules of this invention can be used to provide polypeptides or proteins in vitro, ex vivo, or in vivo.
- the translatable messenger molecules of this invention can be designed to provide high-efficiency expression of an expression product, polypeptide, protein, or fragment thereof. The expression can be in vitro, ex vivo, or in vivo.
- the messenger molecules of this invention have increased cytoplasmic half-life over a native, mature mRNA that provides the same expression product.
- the structures and compositions of this invention can provide increased functional half-life with respect to native, mature mRNAs.
- a translatable messenger molecule of this invention can provide increased activity as a drug providing a polypeptide or protein product, as compared to a native, mature mRNA.
- a translatable molecule can reduce the expected dose level that would be required for efficacious therapy.
- this invention provides methods for ameliorating, preventing or treating a disease or condition in a subject comprising administering to the subject a composition containing a translatable molecule of this invention.
- the disease or condition can be a rare disease, a chronic disease, a liver disease, or a cancer, among others.
- this invention provides methods for producing a polypeptide or protein in vivo, by administering to a mammal a composition containing a translatable RNA molecule.
- the polypeptide or protein may be deficient in a disease or condition of a subject or mammal.
- This invention further provides methods for producing a therapeutic polypeptide or protein in vitro, or in vivo, by transfecting a cell with a translatable molecule.
- the polypeptide or protein can be deficient in a disease or condition of a subject or mammal.
- Embodiments of this invention include the following:
- a RNA that is expressible to provide a target polypeptide or protein wherein the occurrence of uridines in a coding sequence region of the RNA is reduced by at least 20% as compared to a wild type mRNA that is expressible to provide the target polypeptide or protein, and wherein the RNA contains one or more 5-methoxyuridines.
- RNA above wherein 10-100% of the uridines in the RNA are 5- methoxyuri dines.
- the RNA above, wherein 10-100% of the cyti dines in the RNA are 5- methylcytidines.
- RNA above wherein the occurrence of uridines in a coding sequence region of the RNA is reduced by at least 35% as compared to a wild type mRNA that is expressible to provide the target polypeptide or protein.
- RNA is translatable for expression of a polypeptide or protein having at least 75% identity to the target polypeptide or protein.
- RNA is translatable for expression of a polypeptide or protein having at least 85% identity, or 90% identity, or 95% identity to the target polypeptide or protein.
- RNA above wherein the RNA comprises a 5' cap, a 5' untranslated region, a coding region, a 3' untranslated region, and a tail region.
- RNA above wherein the RNA comprises a translation enhancer in a 5 Or 3' untranslated region.
- RNA above wherein the RNA is translatable in vitro, ex vivo, or in vivo.
- the RNA above, wherein the target polypeptide or protein is a polypeptide, a protein, a protein fragment, an antibody, an antibody fragment, a vaccine immunogen, or a vaccine toxoid.
- RNA above wherein the RNA has at least 2-fold increased translation efficiency in vivo as compared to a native mRNA that expresses the target polypeptide or protein.
- RNA above wherein the RNA has at least 5-fold reduced immunogenicity as compared to a native mRNA that expresses the target polypeptide or protein.
- RNA above wherein the target polypeptide or protein is an expression product, or a fragment thereof, of a gene selected from EPO, AAT, ADIPOQ, F9, TTR, and BIRC5.
- Embodiments of this invention further contemplate a DNA encoding the
- this invention provides a composition comprising an
- RNA above and a pharmaceutically acceptable carrier may comprise a transfection reagent, a nanoparticle, or a liposome.
- This invention includes methods for preventing, treating, or ameliorating at least one symptom of a disease or condition in a subject in need thereof, the method comprising administering to the subject a composition above.
- the composition can be used in medical therapy, or in the treatment of the human or animal body.
- this invention includes a range of DNA templates that can be transcribable for expression of a target polypeptide or protein, the DNA template comprising a non-coding sequence template region, wherein deoxyadenosine nucleotides in the non-coding sequence template region are replaced with non- deoxyadenosine nucleotides, and wherein the occurrence of deoxyadenosines in the template region is reduced by at least 20% as compared to a wild type gene that is transcribable for expression of the target polypeptide or protein.
- a DNA template may be double stranded, and comprise a coding non- template strand complementary to a non-coding template strand.
- a DNA template may have the occurrence of deoxyadenosines in the template region reduced by at least 35% as compared to a wild type gene that is transcribable for expression of the target polypeptide or protein.
- a DNA template may be transcribable for expression of a polypeptide or protein having at least 75% identity to the target polypeptide or protein.
- a DNA template can be transcribable for expression of a polypeptide or protein having at least 85%) identity, or 90% identity, or 95% identity to the target polypeptide or protein.
- a DNA template may have a target polypeptide or protein being an expression product, or a fragment thereof, of a gene selected from EPO, AAT, ADIPOQ, F9, TTR, and BIRC5.
- a DNA template may comprise a plasmid, a linear polynucleotide, a PCR product, a synthetic oligonucleotide, a cloned oligonucleotide, or a reverse transcribed RNA.
- RNA having an RNA coding region for expressing a target polypeptide or protein comprising:
- DNA further comprises a promoter for transcribing the template region
- RNA transcribing the template region in the presence of nucleoside triphosphates and one or more chemically-modified nucleoside triphosphates to form a product mixture; isolating the RNA, wherein the RNA comprises natural and chemically-modified nucleotides.
- the chemically-modified nucleosides can be 5- methoxyuridines.
- the chemically-modified nucleosides may be 5-methoxyuridines and 5-methylcytidines.
- the chemically -modified nucleosides can be selected from 5-hydroxyuridine, 5-methyluridine, 5,6-dihydro-5-methyluridine, 2'-0- methyluridine, 2'-0-methyl-5-methyluridine, 2'-fluoro-2'-deoxyuridine, 2'-amino-2'- deoxyuridine, 2'-azido-2'-deoxyuridine, 4-thiouridine, 5-hydroxymethyluridine, 5- carboxyuridine, 5-carboxymethylesteruridine, 5-formyluridine, 5-methoxyuridine, 5- propynyluridine, 5-bromouridine, 5-iodouridine, 5-fluorouridine, pseudouridine, 2'-0- methyl-pseudouridine, N ⁇ hydroxypseudouridine, N ⁇ methylpseudouridine, 2'-0-methyl- N ⁇ methylpseudouridine, N ⁇ ethylpseudouridine, N ⁇ hydroxy
- the chemically-modified nucleosides can replace 10- 100% of the same, but non-chemically-modified nucleotides in the RNA, or 50-100% of the same, but non-chemically-modified nucleotides in the RNA, or 10-80%) of the same, but non-chemically-modified nucleotides in the RNA, or 50-80%) of the same, but non- chemically-modified nucleotides in the RNA.
- the occurrence of deoxyadenosines in the template region can be reduced by at least 20% as compared to a wild type gene that is
- the occurrence of deoxyadenosines in the template region is reduced by at least 35% as compared to a wild type gene that is transcribable for expression of the target polypeptide or protein.
- the step of transcribing the DNA can be performed along with a 5' cap.
- the RNA may comprise a 5' cap, a 5' untranslated region, a coding region, a 3' untranslated region, and a tail region.
- the step of transcribing may be performed with an RNA polymerase, such as SP6, T7, or T3 phage RNA polymerase.
- the promoter can be double stranded.
- the level of double-stranded RNA impurities in the product mixture can be reduced at least 2-fold as compared to the same process without replacing the deoxyadenosine nucleotides.
- the level of double-stranded RNA impurities in the product mixture may be less than 5%, or less than 1%, or less than 0.1% of the total RNA.
- Embodiments of this invention also contemplate a synthetic RNA comprising a product of a process above.
- compositions comprising an RNA above and a pharmaceutically acceptable carrier.
- the carrier can comprise a transfection reagent, a nanoparticle, or a liposome.
- this invention includes methods for preventing, treating, or ameliorating at least one symptom of a disease or condition in a subject in need thereof, by administering to the subject a composition of an RNA above.
- a composition may be used for medical therapy, or in the treatment of the human or animal body.
- a composition may be used for preparing or manufacturing a medicament for preventing, ameliorating, delaying onset or treating a disease or condition in a subject in need.
- FIG. 1 shows a process for production of a translatable ARC -RNA molecule of this invention.
- a double stranded DNA molecule is provided having a non- coding template strand of nucleotides that can be transcribed to provide a targeted product RNA.
- the double stranded DNA contains an open reading frame in the template strand, which template is an alternative variation from a wild type or native version.
- certain deoxyadenosine nucleotides may be replaced in the template by non-deoxyadenosine nucleotides, while codon assignment to a target product may be preserved (SlOl).
- the double stranded DNA further includes a double stranded promoter for transcribing the template strand, such as a T7 promoter.
- the DNA can be transcribed in the presence of nucleoside triphosphates, including optionally a 5' cap (shown), and along with one or more chemically modified nucleoside triphosphates to form a product mixture (SI 03).
- the ARC -RNA product can be isolated and purified from the product mixture (SI 05).
- the ARC -RNA product is a translatable molecule that contains natural and chemically modified nucleotides, with enhanced translational efficiency and properties.
- FIG. 2 shows a process for production of a translatable ARC -RNA molecule of this invention.
- a single stranded DNA molecule is provided having a non- coding template strand of nucleotides that can be transcribed to provide the product RNA.
- the DNA contains an open reading frame in the template strand, which template is an alternative variation from a wild type or native version. As shown in FIG. 2, certain deoxyadenosine nucleotides may be replaced by non-deoxyadenosine nucleotides in the template, while codon assignment to a target product may be preserved (SlOl).
- the DNA further includes a promoter.
- the DNA can be transcribed in the presence of nucleoside triphosphates, including optionally a 5' cap, and along with one or more chemically modified nucleoside triphosphates to form a product mixture (SI 03).
- the ARC -RNA product can be isolated and purified from the product mixture (SI 05).
- FIG. 3 shows embodiments of methods for providing templates for translatable molecules of this invention.
- certain deoxyadenosine nucleotides may be replaced in the template by non- deoxyadenosine nucleotides, while codon assignment to a target product may be preserved.
- the deoxyadenosine nucleotides may be replaced beginning from the 5' end of the ORF.
- the deoxyadenosine nucleotides may be replaced beginning from the 3' end of the ORF.
- the deoxyadenosine nucleotides may be replaced beginning from the 3' end of the ORF.
- deoxyadenosine nucleotides may be replaced randomly throughout the ORF.
- FIG. 4 shows the results of surprisingly increased human EPO protein production for a translatable molecule of this invention.
- Human EPO ARC-RNA was synthesized using a DNA template having reduced deoxyadenosine nucleotides in an open reading frame of the template strand, as well as reduced deoxythymidine
- FIG. 4 shows surprisingly high translational efficiency of the ARC- RNA (5MeOU) compared to the wild type hEPO mRNA (UTP).
- FIG. 5 shows the results of surprisingly increased human F9 protein production for a translatable molecule of this invention.
- Human F9 ARC-RNA was synthesized using a DNA template having reduced deoxyadenosine nucleotides in an open reading frame of the template strand, as well as reduced deoxythymidine
- FIG. 5 shows surprisingly high translational efficiency of the ARC- RNA (5MeOU) compared to the wild type hF9 mRNA (UTP).
- FIG. 6 shows the results of surprisingly reduced impurity levels in a process for synthesizing an hF9 translatable molecule of this invention.
- FIG. 6 shows the results of a dot blot for detecting double strand RNA impurity in the synthesis mixture (nitro cellulose membrane, J2 antibody to detect dsRNA).
- the ARC -RNA (5MeOU) synthesis product which was translatable for hF9, showed surprisingly reduced dot blot intensity as compared to a wild type mRNA synthesis product, without 5MeOU, and with similarly reduced T.
- the ARC -RNA (5MeOU) synthesis process with template reduced T composition, surprisingly reduced double strand RNA impurity levels in the synthesis mixture.
- the process for synthesizing the ARC -RNA (5MeOU) molecules of this invention provided a surprisingly reduced level of double strand RNA impurity.
- FIG. 7 shows the results of surprisingly reduced impurity levels in a process for synthesizing an hAAT translatable molecule of this invention.
- FIG. 7 shows the results of a dot blot for detecting double strand RNA impurity in the synthesis mixture (nitro cellulose membrane, J2 antibody to detect dsRNA).
- the ARC -RNA (5MeOU) synthesis product which was translatable for hAAT, showed surprisingly reduced dot blot intensity as compared to a wild type mRNA synthesis product, without 5MeOU, and with similarly reduced T.
- the ARC-RNA (5MeOU) synthesis process with template reduced T composition, surprisingly reduced double strand RNA impurity levels in the synthesis mixture.
- the process for synthesizing the ARC-RNA (5MeOU) molecules of this invention provided a surprisingly reduced level of double strand RNA impurity.
- FIG. 8 shows the results of surprisingly increased human adiponectin protein production for a translatable molecule of this invention.
- Human adiponectin ARC-RNA was synthesized using a DNA template having reduced deoxyadenosine nucleotides in an open reading frame of the template strand, as well as reduced deoxythymidine nucleotides in the complementary non-template strand ("reduced T"). The synthesis was also carried out with 5-methoxyuri dines (5MeOU, 100%).
- the ARC- RNA was transfected into HEPA1-6 cells using MESSENGERMAX transfection reagents. The cell culture medium was collected 24 hrs after transfection.
- FIG. 8 shows surprisingly high translational efficiency of the ARC-RNA (5MeOU) compared to the wild type human adiponectin mRNA (UTP).
- the translational efficiency of the ARC-RNA (5MeOU) was also surprisingly higher as compared to human adiponectin mRNA (NIMPU), a similar RNA made with N ⁇ methylpseudouridine (100%).
- FIG. 9 shows the results of surprisingly reduced impurity levels in a process for synthesizing a human adiponectin translatable molecule of this invention.
- FIG. 9 shows the results of a dot blot for detecting double strand RNA impurity in the synthesis mixture (nitro cellulose membrane, J2 antibody to detect dsRNA).
- the ARC- RNA (5MeOU) synthesis product which was translatable for human adiponectin, showed surprisingly reduced dot blot intensity as compared to a wild type mRNA synthesis product, without 5MeOU, and with similarly reduced T.
- the ARC-RNA (5MeOU) synthesis process with template reduced T composition, surprisingly reduced double strand RNA impurity levels in the synthesis mixture.
- the process for synthesizing the ARC-RNA (5MeOU) molecules of this invention provided a surprisingly reduced level of double strand RNA impurity.
- FIG. 10 shows the results of surprisingly increased cynomolgus monkey
- Cynomolgus monkey cmEPO ARC-RNA was synthesized using a DNA template having reduced deoxyadenosine nucleotides in an open reading frame of the template strand, as well as reduced complementary deoxythymidine nucleotides in the non-template strand
- FIG. 10 shows surprisingly high translational efficiency of the ARC-RNA (5MeOU) compared to the wild type cynomolgus monkey cmEPO mRNA (UTP).
- the translational efficiency of the ARC- RNA (5MeOU) was also surprisingly higher as compared to cmEPO mRNA (NIMPU), a similar RNA made with N ⁇ methylpseudouridine (100%).
- FIG. 11 shows the results of surprisingly reduced impurity levels in a process for synthesizing a mouse EPO translatable molecule of this invention.
- FIG. 11 shows the results of a dot blot for detecting double strand RNA impurity in the synthesis mixture (nitro cellulose membrane, J2 antibody to detect dsRNA).
- the ARC-RNA (5MeOU) synthesis product which was translatable for mouse EPO, showed surprisingly reduced dot blot intensity as compared to a wild type mRNA synthesis product, without 5MeOU, and with similarly reduced T.
- the ARC-RNA (5MC/5MeOU) synthesis product which was translatable for mouse EPO, also showed surprisingly further reduced dot blot intensity as compared to a wild type mRNA synthesis product, without 5MC/5MeOU.
- the ARC-RNA (5MC/5MeOU) synthesis process with template reduced T composition, surprisingly reduced double strand RNA impurity levels in the synthesis mixture.
- similar advantageously reduced double strand RNA impurity levels were found in synthesis mixtures for monkey mAdipo mRNA and mfEPO mRNA.
- FIG. 12 shows the results of reduced immunogenicity for a translatable molecule of this invention.
- FIG. 12 shows the results of a cytokine assay for IFN-a as generated in human dendritic cells (DC) with cmEPO ARC-RNA of this invention.
- the ARC-RNA was synthesized with only UTP along with other NTPs, or with 5MeOU along with other NTPs, or with a combination of 5MC/5MeOU along with other NTPs. 5MC and 5MeOU were used at 100% in the synthesis.
- the ARC-RNAs synthesized with 5MeOU or with a combination of 5MC/5MeOU showed markedly reduced
- FIG. 13 shows the results of reduced immunogenicity for a translatable molecule of this invention.
- FIG. 13 shows the results of a cytokine assay for RANTES as generated in human dendritic cells (DC) with cmEPO ARC-RNA of this invention.
- the ARC-RNA was synthesized with only UTP along with other NTPs, or with 5MeOU along with other NTPs, or with a combination of 5MC/5MeOU along with other NTPs. 5MC and 5MeOU were used at 100%. in the synthesis.
- the ARC-RNAs synthesized with 5MeOU or with a combination of 5MC/5MeOU showed markedly reduced
- FIG. 14 shows the results of reduced immunogenicity for a translatable molecule of this invention.
- FIG. 14 shows the results of a cytokine assay for IL-6 as generated in human dendritic cells (DC) with cmEPO ARC-RNA of this invention.
- the ARC-RNA was synthesized with only UTP along with other NTPs, or with 5MeOU along with other NTPs, or with a combination of 5MC/5MeOU along with other NTPs. 5MC and 5MeOU were used at 100% in the synthesis.
- the ARC-RNAs synthesized with 5MeOU or with a combination of 5MC/5MeOU showed markedly reduced
- FIG. 15 shows the results of reduced immunogenicity for a translatable molecule of this invention.
- FIG. 15 shows the results of a cytokine assay for MIP-la as generated in human dendritic cells (DC) with cmEPO ARC-RNA of this invention.
- the ARC-RNA was synthesized with only UTP along with other NTPs, or with 5MeOU along with other NTPs, or with a combination of 5MC/5MeOU along with other NTPs. 5MC and 5MeOU were used at 100%. in the synthesis.
- the ARC-RNAs synthesized with 5MeOU or with a combination of 5MC/5MeOU showed markedly reduced
- FIG. 16 shows the results of surprisingly increased human EPO protein production in vivo for a translatable molecule of this invention.
- FIG. 16 shows the results for hEPO protein expression after hEPO ARC-mRNA was injected into mice at 0.3 mg/kg dose. hEPO in mouse serum was measured by ELISA.
- the ARC-RNA was synthesized with reduced T composition templates, using 5MeOU along with other NTPs. 5MeOU was used at 100% in the synthesis.
- the ARC-RNAs synthesized with 5MeOU using a reduced T composition template showed markedly increased protein production in vivo, increased about 2-fold.
- FIG. 17 shows the results of surprisingly increased cynomolgus monkey
- FIG. 17 shows the results for cmEPO protein expression after cmEPO ARC-mRNA was injected into mice at 0.3 mg/kg dose. cmEPO in mouse serum was measured by ELISA.
- the ARC-RNA was synthesized with reduced T composition templates, using 5MeOU along with other NTPs. 5MeOU was used at 100% in the synthesis.
- the ARC-RNAs synthesized with 5MeOU using a reduced T composition template showed markedly increased protein production in vivo, increased greater than 3 -fold.
- FIG. 18 shows the results of surprisingly increased human F9 protein production in vivo for a translatable molecule of this invention.
- FIG. 19 shows the results of surprisingly increased human adiponectin protein production in vivo for a translatable molecule of this invention.
- FIG. 19 shows the results for hAdipo protein expression after hAdipo ARC-mRNA was injected into mice at 0.3 mg/kg dose. hAdipo in mouse serum was measured by ELISA.
- the ARC- RNA was synthesized with reduced T composition templates, using 5MeOU along with other NTPs. 5MeOU was used at 100% in the synthesis.
- the ARC-RNAs synthesized with 5MeOU using a reduced T composition template showed markedly increased protein production in vivo, increased about 2-fold.
- FIG. 20 shows the results of surprisingly increased human AAT protein production in vivo for a translatable molecule of this invention.
- FIG. 20 shows the results for hAAT protein expression after hAAT ARC-mRNA was injected into mice at 0.3 mg/kg dose. hAAT in mouse serum was measured by ELISA.
- the ARC-RNA was synthesized with reduced T composition templates, using 5MeOU along with other NTPs. 5MeOU was used at 100% in the synthesis.
- the ARC-RNAs synthesized with 5MeOU using a reduced T composition template showed markedly increased protein production in vivo, increased upto about 4-fold.
- FIG. 21 shows the results of reduced immunogenicity for a translatable molecule of this invention in vivo.
- FIG. 21 shows the results of a cytokine assay as generated in mouse using an hEPO ARC-RNA (5MeOU) of this invention, detected in serum 6 hrs post injection.
- the ARC-RNAs synthesized with 5MeOU and a reduced T composition template showed markedly reduced immunogenicity as compared to a synthetic mRNA with the same sequence and containing only natural nucleotides.
- the hEPO ARC-RNA (5MeOU) did not stimulate cytokine responses in vivo as compared to the UTP control.
- This invention provides a range of novel agents and compositions to be used for therapeutic applications.
- the molecules and compositions of this invention can be used for ameliorating, preventing or treating a disease, including, for example, rare diseases, and chronic diseases, among others.
- this invention encompasses synthetic, purified, and/or isolated translatable polynucleotide molecules for expressing a human
- polypeptide, protein, or fragment thereof wherein the polynucleotide molecules comprise natural and chemically-modified nucleotides and encode the polypeptide, protein, or fragment.
- Embodiments of this invention can provide nucleic acids that, when introduced into cells, can have improved properties such as increased expression levels, reduced immune response, and increased lifetime as compared to wild type nucleic acids.
- a translatable molecule of this invention can provide a modified mRNA.
- a modified mRNA can encode one or more biologically active peptides, polypeptides, or proteins.
- a modified mRNA can comprise one or more modifications as compared to wild type mRNA. Modifications of an mRNA may be located in any region of the molecule, including a coding region, an untranslated region, or a cap or tail region.
- translatable may be used interchangeably with the term “expressible.” These terms can refer to the ability of polynucleotide, or a portion thereof, to provide a polypeptide, by transcription and/or translation events in a process using biological molecules, or in a cell, or in a natural biological setting.
- translation is a process that can occur when a ribosome creates a polypeptide in a cell.
- a messenger RNA (mRNA) can be decoded by a ribosome to produce a specific amino acid chain, or polypeptide.
- a translatable oligomer or polynucleotide can provide a coding sequence region (usually, CDS), or portion thereof, that can be processed to provide a polypeptide, protein, or fragment thereof.
- a translatable oligomer or polynucleotide of this invention can provide a coding sequence region, and can comprise various untranslated sequences, such as a 5' cap, a 5' untranslated region (5' UTR), a 3' untranslated region (3' UTR), and a tail region.
- various untranslated sequences such as a 5' cap, a 5' untranslated region (5' UTR), a 3' untranslated region (3' UTR), and a tail region.
- a translatable molecule may include a 5' cap , a 5' UTR, a translation initiation sequence such as a Kozak sequence, a CDS, a 3' UTR, and a tail region.
- a translatable molecule may include a 5' cap (m7GpppGm), a 5' UTR of tobacco etch virus (TEV), a Kozak sequence, a human CDS, a 3' UTR of xenopus beta-globin (XbG), and a tail region.
- a human CDS may comprise a codon- modified sequence.
- the level of G or C nucleotides of a region of a modified mRNA may be increased as compared to the level in the same region of the wild type mRNA, while codon assignment of the modified mRNA and the encoded amino acid sequence may be preserved.
- the increased level of G or C may be in any region of the molecule, including a coding region.
- the level of GC content of a modified mRNA may be increased by at least 1%, or by at least 2%, or by at least 3%, or by at least 4%, or by at least 5%, or by at least 6%, or by at least 7%, or by at least 8%, or by at least 9%, or by at least 10%, or by at least 11%, or by at least 12%, or by at least 13%, or by at least 14%, or by at least 15%, or by at least 16%, or by at least 17%, or by at least 18%, as compared to the wild type mRNA.
- the level of GC content of a modified mRNA may be increased by 1-3%, or by 4-6%, or by 7-9%, or by 10-12%, or by 13-15%, or by 16-20%, as compared to the wild type mRNA.
- the level of U nucleotides of a region of a modified mRNA may be decreased as compared to the level in the same region of the wild type mRNA, while codon assignment of the modified mRNA and the encoded amino acid sequence may be preserved.
- the decreased level of U may be in any region of the molecule, including a coding region.
- the level of U content of a modified mRNA may be decreased by at least 1%, or by at least 2%, or by at least 3%, or by at least 4%, or by at least 5%, or by at least 6%, or by at least 7%, or by at least 8%, or by at least 9%, or by at least 10%, or by at least 12%), as compared to the wild type mRNA.
- the level of U content of a modified mRNA may be decreased by 1%, or by 2%, or by 3%, or by 4%, or by 5%, or by 6%, or by 7%, or by 8%, or by 9%, or by 10%), as compared to the wild type mRNA.
- a translatable molecule of this invention may comprise a coding sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%), 97%), 98%), 99%) or more identical to a portion of a reference mRNA sequence, such as a human wild type mRNA sequence.
- a translatable molecule of this invention may comprise a coding sequence that has one, or two, or three, or four, or five, or six, or seven, or eight, or nine, or ten, or fifteen, or twenty or more synonymous or non- synonymous codon replacements as compared to a reference mRNA sequence, such as a human wild type mRNA sequence.
- a non-coding template sequence that is transcribable to provide a translatable molecule of this invention when transcribed may provide a translatable molecule that is at least 80%>, or 85%>, or 90%, or 91%, or 92%, or 93%, or 94%, or 95%, or 96%, or 97%, or 98%, or 99% identical to a portion of a reference mRNA sequence, such as a human wild type mRNA sequence.
- a non-coding template sequence that is transcribable to provide a translatable molecule of this invention when transcribed may provide a translatable molecule that has one, or two, or three, or four, or five, or six, or seven, or eight, or nine, or ten, or fifteen, or twenty or more synonymous or non- synonymous codon replacements as compared to a reference mRNA sequence, such as a human wild type mRNA sequence.
- a translatable molecule of this invention may be used to express a polypeptide that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%), 96%), 97%), 98%), 99% or more identical to a portion of a reference polypeptide or protein sequence, such as a human wild type protein sequence.
- a translatable molecule of this invention may be used to express a polypeptide that has one, or two, or three, or four, or five, or six, or seven, or eight, or nine, or ten, or fifteen, or twenty or more variant amino acid residues as compared to a reference polypeptide or protein sequence, such as a human wild type protein sequence.
- a translatable molecule of the invention may encode a fusion protein comprising a full length, or fragment or portion of a native human protein fused to another sequence, for example by N or C terminal fusion.
- the N or C terminal sequence can be a signal sequence or a cellular targeting sequence.
- a translatable molecule may comprise one or more LNA monomers.
- the translatable molecules of this invention can be used in methods for ameliorating, preventing or treating a disease or condition associated with a polypeptide or protein.
- the translation efficiency of a translatable molecule of this invention can be increased as compared to a native mRNA.
- a translatable molecule of this invention which has one or more chemically modified nucleotides, can have reduced immunogenicity as compared to a native mRNA, or a synthetic mRNA with the same sequence and containing only natural nucleotides.
- a translatable molecule of this invention can have reduced immunogenicity as compared to a native mRNA.
- a translatable molecule can be less immunogenic than a synthetic RNA molecule with the same sequence and containing only natural nucleotides.
- Some methods for measuring immunogenicity include secretion of cytokines, for example, IL-12, IFN-a, T F-a, RANTES, MIP-la or b, IL-6, IFN-b, IFN-g or IL-8, and measuring expression of DC activation markers, for example, CD83, HLA-DR, CD80 and CD86.
- the immunogenicity of a translatable molecule can be reduced by 2-fold, or 3-fold, or 5-fold, or 10-fold, or 20-fold, or more, as compared to a native mRNA, or as compared to a synthetic RNA molecule with the same sequence and containing only natural nucleotides.
- a translatable molecule of this invention which has one or more chemically modified nucleotides, can have increased translation efficiency as compared to a native mRNA, or a synthetic mRNA with the same sequence and containing only natural nucleotides.
- the translation efficiency of a translatable molecule can be increased by 30%, or 50%, or 70%, or 100%, or 150%, or 200%, or more, as compared to a native mRNA, or as compared to a synthetic RNA molecule with the same sequence and containing only natural nucleotides.
- the translation efficiency may be performed in vitro, ex vivo, or in vivo.
- Embodiments of this invention further encompass processes for making an RNA molecule for expressing a polypeptide or protein, wherein the RNA molecule comprises natural and chemically-modified nucleotides, and encodes the polypeptide or protein, or a fragment thereof.
- the processes can include transcribing a DNA template in the presence of chemically-modified nucleoside triphosphates to form a product mixture, and purifying the product mixture to isolate the RNA product. These processes may advantageously reduce the level of double-stranded RNA impurities in the product.
- a translatable molecule of this invention can be synthesized with UTP replaced by 5-methoxy-UTP.
- the level of replacement can be 30% of UTP replaced by 5-methoxy-UTP, or 40% of UTP replaced by 5-methoxy-UTP, or 50% of UTP replaced by 5-methoxy-UTP, or 60% of UTP replaced by 5-methoxy- UTP, or 70% of UTP replaced by 5-methoxy-UTP, or 80% of UTP replaced by 5- methoxy-UTP, or 90% of UTP replaced by 5-methoxy-UTP, or or 100% of UTP replaced by 5-methoxy-UTP.
- a translatable molecule of this invention can be synthesized with CTP replaced by 5-methyl-CTP.
- the level of replacement can be 30% of CTP replaced by 5-methyl-CTP, or 40% of CTP replaced by 5-methyl-CTP, or 50% of CTP replaced by 5-methyl-CTP, or 60% of CTP replaced by 5-methyl-CTP, or 70% of CTP replaced by 5-methyl-CTP, or 80% of CTP replaced by 5-methyl-CTP, or 90% of CTP replaced by 5-methyl-CTP, or or 100% of CTP replaced by 5-methyl-CTP.
- the molecules of this invention can be translatable messenger RNA molecules.
- the RNA agents can have long half-life, particularly in the cytoplasm.
- the long duration messenger molecules can be used for ameliorating, preventing, or treating disease associated with a polypeptide or protein level in a subject.
- this invention provides processes for production of a translatable product RNA molecule.
- a double stranded DNA molecule can be provided having a non-coding template strand of nucleotides that can be transcribed to provide the product RNA.
- the double stranded DNA may contain an open reading frame in the template strand, which template is an alternative variation from a wild type or native version.
- certain deoxyadenosine nucleotides may be replaced by non- deoxyadenosine nucleotides, while codon assignment to a target RNA product may be preserved.
- the double stranded DNA may further include a double stranded promoter for transcribing the template strand, such as a T7 promoter.
- the DNA can be transcribed in the presence of nucleoside triphosphates, including optionally a 5' cap, and along with one or more chemically modified nucleoside triphosphates to form a product mixture.
- the product RNA product can be isolated and purified from the product mixture.
- the product RNA can be a translatable molecule that contains natural and chemically modified nucleotides, and enhanced translational efficiency and resulting activity.
- this invention provides processes for production of a translatable RNA molecule.
- a single stranded DNA molecule can be provided having a non-coding template strand of nucleotides that can be transcribed to provide the product RNA.
- the DNA may contain an open reading frame in the template strand, which template is an alternative variation from a wild type or native version.
- certain deoxyadenosine nucleotides may be replaced by non-deoxyadenosine nucleotides, while codon assignment to a target RNA product may be preserved.
- the DNA may further include a promoter.
- the DNA can be transcribed in the presence of nucleoside triphosphates, including optionally a 5' cap, and along with one or more chemically modified nucleoside triphosphates to form a product mixture.
- the product RNA can be isolated and purified from the product mixture.
- translatable compounds of this invention arise according to their molecular structure, and the structure of the molecule in its entirety, as a whole, can provide significant benefits based on those properties.
- Embodiments of this invention can provide translatable molecules having one or more properties that advantageously provide enhanced effectiveness in regulating protein expression or concentration, or modulating protein activity.
- the molecules and compositions of this invention can provide formulations for therapeutic agents for various diseases and conditions, which can provide clinical agents.
- This invention provides a range of translatable molecules that are surprisingly translatable to provide active peptide or protein, in vitro and in vivo.
- the translatable structures and compositions can have increased translational activity and cytoplasmic half-life.
- the translatable structures and compositions can provide increased functional half-life in the cytoplasm of mammalian cells over native mRNA molecules.
- the inventive translatable molecules can have increased half-life of activity with respect to a corresponding native mRNA.
- linker groups can be attached in a chain in the translatable molecule.
- Each linker group can also be attached to a nucleobase.
- FIG. 1 Processes for production of a translatable RNA molecule of this invention are illustrated in FIG. 1.
- a double stranded DNA molecule is provided having a non- coding template strand of nucleotides that can be transcribed to provide a targeted product RNA.
- the double stranded DNA contains an open reading frame in the template strand, which template is an alternative variation from a wild type or native version. As shown in FIG. 1, certain deoxyadenosine nucleotides may be replaced by non- deoxyadenosine nucleotides, while codon assignment to a target product may be preserved.
- the double stranded DNA further includes a double stranded promoter for transcribing the template strand, such as a T7 promoter.
- the DNA can be transcribed in the presence of nucleoside triphosphates, including optionally a 5' cap, and along with one or more chemically modified nucleoside triphosphates to form a product mixture.
- the RNA product can be isolated and purified from the product mixture.
- the RNA product is a translatable molecule that contains natural and chemically
- modified nucleotides and enhanced translational efficiency and resulting activity.
- FIG. 2 Processes for production of a translatable RNA molecule of this invention are illustrated in FIG. 2.
- a single stranded DNA molecule is provided having a non- coding template strand of nucleotides that can be transcribed to provide the product RNA.
- the DNA contains an open reading frame in the template strand, which template is an alternative variation from a wild type or native version. As shown in FIG. 2, certain deoxyadenosine nucleotides may be replaced by non-deoxyadenosine nucleotides in the template, while codon assignment to a target product may be preserved.
- the DNA further includes a promoter.
- the DNA can be transcribed in the presence of nucleoside triphosphates, including optionally a 5' cap, and along with one or more chemically modified nucleoside triphosphates to form a product mixture.
- the RNA product can be isolated and purified from the product mixture.
- FIG. 3 shows embodiments of methods for providing templates for translatable molecules of this invention.
- certain deoxyadenosine nucleotides may be replaced in the template by non- deoxyadenosine nucleotides, while codon assignment to a target product may be preserved.
- the deoxyadenosine nucleotides may be replaced beginning from the 5' end of the ORF.
- the deoxyadenosine nucleotides may be replaced beginning from the 3' end of the ORF.
- the deoxyadenosine nucleotides may be replaced beginning from the 3' end of the ORF.
- a linker group can be a monomer. Monomers can be attached to form a chain molecule. In a chain molecule of this invention, a linker group monomer can be attached at any point in the chain.
- linker group monomers can be attached in a chain molecule of this invention so that the linker group monomers reside near the ends of the chain, or at any position in the chain.
- a chain molecule can also be referred to as an oligomer.
- the linker groups of a chain molecule can each be attached to a nucleobase.
- the presence of nucleobases in the chain molecule can provide a sequence of nucleobases in the chain molecule.
- this invention provides translatable oligomer molecules having chain structures that incorporate novel combinations of the linker group monomers, along with certain natural nucleotides, or non-natural nucleotides, or modified nucleotides, or chemically-modified nucleotides.
- the oligomer oligomer molecules of this invention can display a sequence of nucleobases, and can be designed to express a polypeptide or protein, in vitro, ex vivo, or in vivo.
- the expressed polypeptide or protein can have activity in various forms, including activity corresponding to protein expressed from natural mRNA, or activity corresponding to a negative or dominant negative protein.
- this invention can provide active, translatable oligomer molecules having a base sequence that is complementary to at least a fragment of a native nucleic acid molecule of a cell.
- the cell can be a eukaryotic cell, a mammalian cell, or a human cell.
- This invention provides structures, methods and compositions for translatable oligomeric agents that incorporate the linker group monomers.
- the oligomeric molecules of this invention can be used as active agents in formulations for therapeutics.
- This invention provides a range of translatable molecules that are useful for providing therapeutic effects because of their longevity of activity in providing an expressed peptide or protein.
- a translatable molecule can be structured as an oligomer composed of monomers.
- the oligomeric structures of this invention may contain one or more linker group monomers, along with certain nucleotides.
- a translatable molecule may contain a sequence of nucleobases, and can be designed to express a peptide or protein of any isoform, in part by having sufficient homology with a native polynucleotide sequence.
- a translatable molecule can be from about 200 to about 12,000 monomers in length, or more. In certain embodiments, a translatable molecule can be from 200 to 12,000 monomers in length, or 200 to 10,000 monomers, or 200 to 8,000 monomers, or 200 to 6000 monomers, or 200 to 5000 monomers, or 200 to 4000 monomers, or 200 to 3600 monomers, or 200 to 3200 monomers, or 200 to 3000 monomers, or 200 to 2800 monomers, or 200 to 2600 monomers, or 200 to 2400 monomers, or 200 to 2200 monomers, or 600 to 3200 monomers, or 600 to 3000 monomers, or 600 to 2600 monomers.
- a translatable molecule can be from about 200 to about 12,000 bases in length, or more. In certain embodiments, a translatable molecule can be from 200 to 12,000 bases in length, or 200 to 10,000 bases, or 200 to 8,000 bases, or 200 to 6000 bases, or 200 to 5000 bases, or 200 to 4000 bases, or 200 to 3600 bases, or 200 to 3200 bases, or 200 to 3000 bases, or 200 to 2800 bases, or 200 to 2600 bases, or 200 to 2400 bases, or 200 to 2200 bases, or 600 to 3200 bases, or 600 to 3000 bases, or 600 to 2600 bases.
- a translatable molecule of this invention may comprise a 5' cap, a 5' untranslated region of monomers, a coding region of monomers, a 3' untranslated region of monomers, and a tail region of monomers.
- a translatable molecule of this invention may comprise regions of sequences or structures that are operable for translation in a cell, or which have the functionality of regions of an mRNA including, for example, a 5' cap, a 5' untranslated region, a coding region, a 3' untranslated region, and a polyA tail.
- This invention further contemplates methods for delivering one or more vectors, or one or more translatable molecules to a cell.
- one or more translatable molecules can be delivered to a cell, in vitro, ex vivo, or in vivo. Viral and non-viral transfer methods as are known in the art can be used to introduce translatable molecules in mammalian cells.
- Translatable molecules can be delivered with a pharmaceutically acceptable vehicle, or for example, encapsulated in a liposome.
- translatable structures and compositions of this invention can reduce the number and frequency of transfections required for cell-fate manipulation in culture as compared to utilizing native compositions.
- this invention provides increased activity for mRNA-based drugs as compared to utilizing native compositions, and can reduce the dose levels required for efficacious therapy.
- this invention provides increased activity for translatable or mRNA-based molecules, as compared to utilizing a native mRNA as active agent.
- this invention can provide translatable molecules that may reduce the cellular innate immune response, as compared to that induced by a natural nucleic acid, peptide or protein.
- This invention can provide synthetic translatable molecules that are refractory to deadenylation as compared to native molecules.
- this invention can provide synthetic translatable molecules with increased specific activity and longer functional half-life as compared to native molecules.
- the synthetic translatable molecules of this invention can provide increased levels of ectopic protein expression.
- cellular-delivery can be at increased levels, and cytotoxic innate immune responses can be restrained so that higher levels of ectopic protein expression can be achieved.
- the translatable molecules of this invention can have increased specific activity and longer functional half-life than mRNAs.
- a translatable molecule may have a number of mutations from a native mRNA, or from a disease associated mRNA.
- this invention can provide translatable molecules having cleavable delivery and targeting moieties attached at a 3' end.
- the specific activity for a synthetic translatable molecule delivered by transfection can be viewed as the number of molecules of protein expressed per delivered transcript per unit time.
- translation efficiency refers to a measure of the production of a protein or polypeptide by translation of a messenger molecule in vitro or in vivo.
- This invention provides a range of translatable molecules, which can contain one or more UNA monomers, and a number of nucleic acid monomers, wherein the translatable molecule can be translated to express a polypeptide or protein.
- UNA monomers are described in WO/2017/070166.
- this invention includes a range of translatable molecules, which may contain one or more UNA monomers in a tail region, wherein the translatable molecule can be translated to express a polypeptide or protein.
- a translatable molecule may comprise a 3' polyA tail containing one or more UNA monomers.
- a 3' polyA tail may contain 2, 3, 4, 5, 10, or more UNA monomers.
- a translatable molecule can contain a modified 5' cap.
- a translatable molecule can contain a translation enhancing 5' untranslated region of monomers.
- a translatable molecule can contain a translation enhancing 3' untranslated region of monomers.
- a translatable molecule of this invention can exhibit increased translation efficiency in vivo as compared to a native mRNA that encodes the same translation product.
- the translation efficiency can be increased by 10%, or 20%, or 30%), or 40%), or 50%> or 100%>, or more, as compared to a reference mRNA such as a native mRNA or human wild type mRNA.
- a translatable molecule of this invention can exhibit at least 2-fold, 3-fold, 5-fold, or 10-fold increased translation efficiency in vivo as compared to a reference mRNA such as a native mRNA or human wild type mRNA.
- a translatable molecule can provide increased levels of a polypeptide or protein in vivo as compared to a native mRNA that encodes the same polypeptide or protein.
- the level of a polypeptide or protein can be increased by 10%>, or 20%, or 30%>, or 40%, or 50%> or 100%, or more in vivo as compared to a reference mRNA such as a native mRNA or human wild type mRNA.
- a translatable molecule can produce at least 2-fold, 3- fold, 5-fold, or 10-fold increased levels of a polypeptide or protein in vivo as compared to a native mRNA or reference mRNA.
- this invention provides methods for treating a disease or condition in a subject by administering to the subject a composition containing a translatable molecule.
- a variant DNA template of this disclosure may exhibit advantages in processes for making a translatable molecule, and the efficiency of the translatable molecule. Variation of the template can be utilized to enhance incorporation of modified nucleotides or monomers in an RNA product of this invention. In certain aspects, variation of the template can be utilized to enhance the structural features of the translatable molecule. The enhanced structural features of the translatable molecule can provide unexpectedly advantageous properties, including translation efficiency to provide a polypeptide or protein product.
- variation of the template may include reducing the occurrence or frequency of appearance of certain nucleotides in the template strand. Reducing the occurrence of a certain nucleotide can alter the structures and processes of this disclosure to provide forms, which achieve surprisingly improved properties of a translatable RNA product.
- a DNA molecule can have a non-coding template strand of nucleotides that can be transcribed to provide a target RNA.
- a target RNA can be any RNA, whether native or unknown, synthetic or derived from a natural source.
- a variant DNA template can be used for which an open reading frame of the template strand is transformed to an alternative form.
- a DNA template can be used for which alternative nucleotides are used based on codon degeneracy.
- a DNA template may have deoxyadenosine nucleotides replaced with non-deoxyadenosine nucleotides, while codon assignment may be preserved.
- Embodiments of this invention advantageously utilize alternative codons in a DNA template of this invention to be used in processes for making a translatable RNA molecule.
- the variations that can be achieved in a DNA template of this invention can be far greater in scope than for cells and organisms, which may require preferred codons in many processes.
- a wide range of alternative codons and positions can be used in a DNA template for transcribing an RNA molecule.
- variation of the template may include reducing the occurrence or frequency of appearance of certain nucleotides in the template strand.
- the occurrence of deoxyadenosine in a template may be reduced to a level below 25% of nucleotides in the template.
- the occurrence of deoxyadenosine in a template may be reduced to a level below 20% of nucleotides in the template.
- the occurrence of deoxyadenosine in a template may be reduced to a level below 16%, or 14% of nucleotides in the template.
- the occurrence of deoxyadenosine in a template may be reduced to a level below 12%) of nucleotides in the template.
- Inherent codon redundancy allows up to six different codons for a single amino acid.
- synonymous codons may not have equivalent preference in cells and organisms. Further, codon preference can vary among different genes, and may have functional effects. Codon degeneracy is in general poorly understood, with unpredictable effects on nucleic acid structures and processes. It is not generally known how codon alternatives affect ribosomes, protein folding, translation, and degradation of an RNA.
- the level of T can be reduced in a non-template strand, i.e. a coding strand, by replacing a triplet codon containing more than one T to another synonymous codon containing less T than the original triplet.
- a non-template strand i.e. a coding strand
- valine encoded by GTT can be replaced by GTC, GTA, or GTG.
- Serine encoded by TCT, TCC, TCA, TCG, AGT can be replaced by AGC. Complementary changes would be made in the template strand.
- the level of T can be reduced in a non-template strand, i.e. a coding strand, by replacing all codons with synonymous codons where each replacement reduces the level of T.
- a variant template in order to increase expression levels, can have a reduced number of rare codons. See, e.g. Mauro, A critical analysis of codon optimization in human therapeutics, Trends Mol Med 2014, Vol. 20(11), pp. 604-613.
- any combination of synonymous codon replacements can be made in a variant template of this invention.
- codon replacements in a coding non-template strand are shown in Table 1.
- complementary replacements are made in the template strand.
- a functional variant DNA template of this disclosure may have a structure reflecting enhanced arrangement of alternative codons.
- a functional variant template of this invention can be utilized to enhance incorporation of modified nucleotides or monomers in an RNA product.
- a functional variant template can be utilized to enhance the structural features of a translatable molecule.
- Examples of enhanced structural features of a translatable molecule include translation efficiency.
- a functional variant template may have reduced occurrence or frequency of appearance of certain nucleotides in the non-coding template strand. Reducing the occurrence of a certain nucleotide can alter the structures and processes of this disclosure to provide forms, which achieve surprisingly improved properties of a translatable RNA product.
- a functional variant template of this invention may have reduced occurrence or frequency of appearance of deoxyadenosine nucleotides in a non- coding template strand, where the deoxyadenosine nucleotides are reduced beginning at the 5' end of the template, and extending toward the 3' end.
- a functional variant template of this invention may have reduced occurrence or frequency of appearance of deoxyadenosine nucleotides in a non- coding template strand, where the deoxyadenosine nucleotides are reduced beginning at the 3' end of the template, and extending toward the 5' end.
- a functional variant template of this invention may have reduced occurrence or frequency of appearance of deoxyadenosine nucleotides in a non-coding template strand, where the deoxyadenosine nucleotides are randomly reduced in the template structure.
- a functional variant template of this invention may have all deoxyadenosine nucleotides in a non-coding template strand replaced by non-deoxyadenosine nucleotides in the template structure.
- a DNA template that is transcribable for expression of a target polypeptide or protein can have a non-coding sequence template region, in which deoxyadenosine nucleotides in the non-coding sequence template region are replaced with non-deoxyadenosine nucleotides while codon assignment may be preserved, and in which the occurrence of deoxyadenosines in the template region is reduced by at least 20% as compared to a wild type gene that is transcribable for expression of the target polypeptide or protein. In some embodiments, the occurrence of deoxyadenosines in the template region is reduced by at least 25% as compared to a wild type gene that is transcribable for expression of the target polypeptide or protein.
- the occurrence of deoxyadenosines in the template region is reduced by at least 30% as compared to a wild type gene that is transcribable for expression of the target polypeptide or protein. In additional embodiments, the occurrence of deoxyadenosines in the template region is reduced by at least 35% as compared to a wild type gene that is transcribable for expression of the target polypeptide or protein. The occurrence of deoxyadenosines in the template region may be reduced by at least 40%, or 45%, or 50% as compared to a wild type gene that is transcribable for expression of the target polypeptide or protein.
- the occurrence of deoxythymidine in a non-template sequence region may be reduced by at least 20%, or 25%, or 30%>, or 35%, or 40%, or 45%), or 50%) as compared to a wild type gene that is transcribable for expression of the target polypeptide or protein.
- codon replacements in a coding non-template strand are shown in Table 2.
- complementary replacements are made in the template strand.
- Embodiments of this invention can provide processes for production of translatable molecules, wherein the translatable molecules can comprise one or more kinds of chemically-modified nucleotides.
- Embodiments of this invention contemplate processes for production of translatable molecules, where the translatable molecules incorporate one or more kinds of chemically-modified nucleotides, and the translatable molecules are produced with reduced levels of impurities, such as double stranded impurities.
- the level of double stranded impurities in a process of this invention can be reduced by 2-fold, or 3-fold, or 5-fold, or 10-fold, or 20- fold, or more, as compared to a process using only natural NTPs.
- this invention can provide processes for production of translatable molecules, where the translatable molecules incorporate one or more kinds of chemically-modified nucleotides, and the translatable molecules are produced with advantageously reduced levels of impurities, such as double stranded impurities, so that the product translatable molecules can be utilized without further purification.
- Translatable molecules of this invention having chemically-modified nucleotides can provide enhanced properties for therapeutic use of the translatable molecules.
- a translatable molecule of this invention having chemically -modified nucleotides can provide advantageously increased expression levels in vitro, ex vivo, or in vivo, as compared to a reference such as wild type mRNA.
- a translatable molecule of this invention having chemically-modified nucleotides can provide advantageously reduced immune response in vitro, ex vivo, or in vivo, as compared to a reference such as wild type mRNA.
- a translatable molecule of this invention having chemically-modified nucleotides can provide advantageously increased intracellular lifetime in vitro, ex vivo, or in vivo, as compared to a reference such as wild type mRNA.
- Examples of chemically-modified nucleotides include 5-methoxyuridine (5MeOU).
- a translatable molecule of this invention can have uridines replaced by 5-methoxyuridines.
- the level of replacement can be 30% of uridines replaced by 5-methoxyuridine, or 40% of uridines replaced by 5- methoxyuridine, or 50% of uridines replaced by 5-methoxyuridine, or 60% of uridines replaced by 5-methoxyuridine, or 70% of uridines replaced by 5-methoxyuridine, or 80% of uridines replaced by 5-methoxyuridine, or 90% of uridines replaced by 5- methoxyuridine, or or 100% of uridines replaced by 5-methoxyuridine.
- Examples of combinations of chemically-modified nucleotides include the combination of 5-methoxyuridine (5MeOU) and 5-methylcytidine (5MC). In a combination of chemically-modified nucleotides, both kinds of chemically-modified nucleotides are incorporated into the same polynucleotide.
- 5MeOU 5-methoxyuridine
- 5MC 5-methylcytidine
- N can represent any natural nucleotide monomer, or any modified nucleotide monomer.
- Additional examples of chemically-modified nucleotides include 5- hydroxyuridines, 5-alkyluridines, 5-hydroxyalkyluridines, 5-carboxyuridines, 5- carboxyalkylesteruridines, 5-formyluridines, 5-alkoxyuridines, 5-alkynyluridines, 5- halouridines, 2-thiouridines, and 6-alkyluridines.
- Additional examples of chemically-modified nucleotides include 5- hydroxyuridine, 5-methyluridine, 5-hydroxymethyluridine, 5-carboxyuridine, 5- carboxymethylesteruridine, 5-formyluridine, 5-methoxyuridine, 5-propynyluridine, 5- bromouridine, 5-fluorouridine, 5-iodouridine, 2-thiouridine, and 6-methyluridine.
- Additional examples of chemically-modified nucleotides include 5- methoxycarbonylmethyl-2-thiouridine, 5-methylaminomethyl-2-thiouridine, 5- carbamoylmethyluridine, 5-carbamoylmethyl-2'-0-methyluridine, l-methyl-3-(3-amino- 3-carboxypropy)pseudouridine, 5-methylaminomethyl-2-selenouridine, 5- carboxymethyluridine, 5-methyldihydrouridine, 5-taurinomethyluridine, 5-taurinomethyl- 2-thiouridine, 5-(isopentenylaminomethyl)uridine, 2'-0-methylpseudouridine, 2-thio-2'- O-methyluridine, and 3,2'-0-dimethyluridine.
- Additional examples of chemically-modified nucleotides include 5- hydroxycytidines, 5-alkylcytidines, 5-hydroxyalkylcytidines, 5-carboxycytidines, 5- formylcytidines, 5-alkoxycytidines, 5-alkynylcytidines, 5-halocytidines, 2-thiocytidines, N 4 -alkylcytidines, N 4 -aminocytidines, N 4 -acetylcytidines, and N 4 ,N 4 -dialkylcytidines.
- Additional examples of chemically-modified nucleotides include 5- hydroxycytidine, 5-methylcytidine, 5-hydroxymethylcytidine, 5-carboxycytidine, 5- formylcytidine, 5-methoxycytidine, 5-propynylcytidine, 5-bromocytidine, 5-iodocytidine, 2-thiocytidine; N 4 -methylcytidine, N 4 -aminocytidine, N 4 -acetylcytidine, and N 4 ,N 4 - dimethylcytidine.
- Additional examples of chemically-modified nucleotides include N 6 - methyladenosine, 2-aminoadenosine, 3 -methyladenosine, 8-azaadenosine, 7- deazaadenosine, 8-oxoadenosine, 8-bromoadenosine, 2-methylthio-N 6 -methyladenosine, N 6 -isopentenyladenosine, 2-methylthio-N 6 -isopentenyladenosine, N 6 -(cis- hydroxyisopentenyl)adenosine, 2-methylthio-N 6 -(cis-hydroxyisopentenyl)adenosine, N 6 - glycinylcarbamoyladenosine, N6-threonylcarbamoyl-adenosine, N 6 -methyl-N 6 - threonylcarbamoyl-adenosine, N
- N -alkylguanosines include N -alkylguanosines, N -alkylguanosines, thienoguanosines, 7-deazaguanosines, 8-oxoguanosines, 8-bromoguanosines, 0 6 -alkylguanosines, xanthosines, inosines, and N 1 - alkylinosines.
- Additional examples of chemically-modified nucleotides include N 1 - methylguanosine, N 2 -methylguanosine, thienoguanosine, 7-deazaguanosine, 8- oxoguanosine, 8-bromoguanosine, 0 6 -methylguanosine, xanthosine, inosine, and N 1 - methylinosine.
- pseudouridines include N ⁇ alkylpseudouridines, N 1 - cycloalkylpseudouridines, N ⁇ hydroxypseudouridines, N ⁇ hydroxyalkylpseudouridines, N ⁇ phenylpseudouridines, N ⁇ phenylalkylpseudouridines, N ⁇ aminoalkylpseudouridines, N -alkylpseudouridines, N 6 -alkylpseudouridines, N 6 -alkoxypseudouridines, N 6 - hydroxypseudouridines, N 6 -hydroxyalkylpseudouridines, N 6 -morpholinopseudouridines, N 6 -phenylpseudouridines, and N 6 -halopse
- pseudouridines examples include N ⁇ alkyl-N ⁇ -alkylpseudouridines, N ⁇ alkyl-N ⁇ alkoxypseudouridines, N ⁇ alkyl-N 6 - hydroxypseudouridines, N ⁇ alkyl-N 6 -hydroxyalkylpseudouridines, N ⁇ alkyl-N 6 - morpholinopseudouridines, N ⁇ alkyl-lN ⁇ -phenylpseudouridines, and N ⁇ alkyl-N 6 - halopseudouridines.
- the alkyl, cycloalkyl, and phenyl substituents may be unsubstituted, or further substituted with alkyl, halo, haloalkyl, amino, or nitro substituents.
- pseudouridines include N ⁇ methylpseudouridine, N ⁇ propylpseudouridine, N ⁇ cyclopropylpseudouridine, N 1 -
- Additional examples of chemically-modified nucleotides include 5- hydroxyuridine, 5-methyluridine, 5,6-dihydro-5-methyluridine, 2'-0-methyluridine, 2'-0- methyl-5-methyluridine, 2'-fluoro-2'-deoxyuridine, 2'-amino-2'-deoxyuridine, 2'-azido-2'- deoxyuridine, 5-hydroxymethyluridine, 5-carboxyuridine, 5-carboxymethylesteruridine, 5-formyluridine, 5-methoxyuridine, 5-propynyluridine, 5-bromouridine, 5-iodouridine, 5- fluorouridine, pseudouridine, 2'-0-methyl-pseudouridine, N ⁇ hydroxypseudouridine, N 1 - methylpseudouridine, 2'-0-methyl-N 1 -methylpseudouridine, N 1 - hydroxymethylpseudouridine, and Arauridine.
- non-natural, modified, and chemically-modified nucleotide monomers include any such nucleotides known in the art, for example, 2'-0- methyl ribonucleotides, 2'-0-methyl purine nucleotides, 2'-deoxy-2'-fluoro
- ribonucleotides 2'-deoxy-2'-fluoro pyrimidine nucleotides, 2'-deoxy ribonucleotides, 2'- deoxy purine nucleotides, universal base nucleotides, 5-C-methyl-nucleotides, and inverted deoxyabasic monomer residues.
- non-natural, modified, and chemically-modified nucleotide monomers include 3 '-end stabilized nucleotides, 3 '-glyceryl nucleotides, 3'- inverted abasic nucleotides, and 3 '-inverted thymidine.
- Non-natural, modified, and chemically-modified nucleotide monomers include locked nucleic acid nucleotides (LNA), glycol nucleic acids (GNA), 2'-0,4'-C-methylene-(D-ribofuranosyl) nucleotides, 2'-methoxyethoxy (MOE) nucleotides, 2'-methyl-thio-ethyl, 2'-deoxy-2'-fluoro nucleotides, and 2'-0-methyl nucleotides.
- LNA locked nucleic acid nucleotides
- GAA glycol nucleic acids
- MOE 2'-methoxyethoxy
- nucleotide monomers include 2 ',4 '-Constrained 2'-0-Methoxyethyl (cMOE) and 2'-0- Ethyl (cEt) Modified DNAs.
- cMOE 2'-0-Methoxyethyl
- cEt 2'-0- Ethyl
- non-natural, modified, and chemically-modified nucleotide monomers include 2'-amino nucleotides, 2'-0-amino nucleotides, 2'-C-allyl nucleotides, and 2'-0-allyl nucleotides.
- nucleotide monomers with modified bases such as 5-(3- amino)propyluridine and 5-(2-mercapto)ethyluridine.
- nucleotide monomers include 2'-0-aminopropyl substituted nucleotides.
- nucleotide monomers include replacing the 2'-OH group of a nucleotide with a 2'-R, a 2'- OR, a 2'-halogen, a 2'-SR, or a 2'-amino, where R can be H, alkyl, alkenyl, or alkynyl.
- nucleotide monomers include pseudouridine (psi- Uridine) and 1-methylpseudouridine.
- Additional examples of chemically-modified nucleotide monomers include nucleotides having base modifications, nucleoside or nucleotide structure modifications, sugar modifications, or linkage modifications.
- nucleic acid monomers include non-natural, modified, and chemically-modified nucleotides, including any such nucleotides known in the art.
- modified nucleotides are given in Saenger, Principles of Nucleic Acid Structure, Springer- Verlag, 1984; Rozenski J., Crain P.F., McCloskey J.A., The RNA Modification Database: 1999 update, Nucleic Acids Res., 1999; Vol. 27, pp. 196-197.
- RNA molecule of this invention may be used for ameliorating, preventing or treating a disease through protein or enzyme modulation or replacement.
- An RNA molecule of this invention can be administered to regulate, modulate, increase, or decrease the concentration or effectiveness of a natural enzyme in a subject.
- the protein can be an unmodified, natural enzyme for which the subject has an abnormal quantity.
- an RNA molecule can be delivered to cells or subjects, and translated to supply increased levels of a natural polypeptide or protein.
- RNA molecule of this invention may be used for ameliorating, preventing or treating a disease through modulation or introduction of a polypeptide or protein.
- a translatable molecule of this invention can be administered to regulate, modulate, increase, or decrease the concentration or effectiveness of a peptide or protein in a subject, where the peptide or protein is non- natural or mutated, as compared to a native peptide or protein.
- a polypeptide or protein delivered by an RNA molecule of this disclosure can be a modified, non-natural, exogenous, or synthetic polypeptide or protein, which has a pharmacological effect in a subject.
- an RNA molecule can be delivered to cells or subjects, and translated to supply a secretion or concentration of a peptide or protein.
- a subject can be a human subject, a human patient, or a mammal.
- a polypeptide, protein, or protein fragment provided by a polynucleotide of this disclosure can be a variant of a polypeptide or protein of interest.
- a variant of a polypeptide or protein can have at least about 50%, or 60%>, or 70%, or 80%>, or 90%, or 95%) sequence identity to the polypeptide or protein of interest.
- a translatable molecule of this invention may encode a homolog, variant, or fragment thereof, of a human protein.
- a homolog or variant may have one or more amino acid substitutions, deletions, and/or insertions as compared to a wild type or naturally-occurring human protein, while retaining protein activity.
- a translatable molecule of this invention may encode a protein that is identical to human protein, or nearly identical.
- a translatable molecule may encode an amino acid sequence that is at least 80%, or 85%, or 90%, or 91%, or 92%, or 93%, or 94%, or 95%, or 96%, or 97%), or 98%>, or 99% or more identical to the amino acid sequence of a reference polypeptide or protein, such as a human wild type protein.
- a translatable molecule may encode an amino acid sequence that may have one, or two, or three, or four, or five, or six, or seven, or eight, or nine, or ten, or fifteen, or twenty or more amino acid substitutions, deletions, and/or insertions as compared to the amino acid sequence of a reference polypeptide or protein, such as a human wild type protein.
- a reference polypeptide or protein such as a human wild type protein.
- Examples of polypeptides and proteins of this disclosure include human EPO, human Factor IX (hF9), human alpha- 1 -antitrypsin (hAAT), and human adiponectin (hAdipo), among others.
- diseases for enzyme modulation include lysosomal diseases, for example, Gaucher disease, Fabry disease, Mucopolysaccharidoses (MPS) and related diseases including MPS I, MPS II (Hunter syndrome), and MPS VI, as well as Glycogen storage disease type II.
- lysosomal diseases for example, Gaucher disease, Fabry disease, Mucopolysaccharidoses (MPS) and related diseases including MPS I, MPS II (Hunter syndrome), and MPS VI, as well as Glycogen storage disease type II.
- diseases for enzyme modulation include hematologic diseases, for example, sickle-cell disease, thalassemia, methemoglobinemia, anemia due to deficiency of hemoglobin or Bi 2 intrinsic factor, spherocytosis, glucose-6-phosphate dehydrogenase deficiency, and pyruvate kinase deficiency.
- hematologic diseases for example, sickle-cell disease, thalassemia, methemoglobinemia, anemia due to deficiency of hemoglobin or Bi 2 intrinsic factor, spherocytosis, glucose-6-phosphate dehydrogenase deficiency, and pyruvate kinase deficiency.
- diseases for enzyme modulation include hemophilia, Von Willebrand disease, Protein S deficiency, age-related macular degeneration, trinucleotide repeat disorders, muscular dystrophy, insertion mutation diseases, DNA repair-deficiency disorders, and deletion mutation diseases.
- Examples of diseases and/or conditions for which the translatable molecules of this invention can be translatable to provide an active agent include those in Table 3.
- Alpha 1 -antitrypsin deficiency Alpha 1 -antitrypsin
- Apolipoprotein C 21 deficiency Apolipoprotein C 21
- Pulmonary surfactant protein B Pulmonary surfactant protein B
- Pulmonary surfactant protein B Pulmonary surfactant protein B
- Aminoacylase 1 deficiency Aminoacylase 1
- Neurological disorder brain dysfunction (encephalopathy)
- Myxoid tumor involving the blood vessels may be a non-
- Cowden Syndrome growths called hamartomas Cowden Syndrome growths called cowden Syndrome growths called hamartomas and an increased risk of
- DEND Syndrome characterized by a triad of developmental delay, epilepsy, and neonatal diabetes
- Dercum's Disease lipomas mainly occur on the trunk, the upper arms and upper legs
- Physical features may include an unusually small head and additional abnormalities of the head and facial area;
- X-linked recessive enzyme defect that is heterozygous in nature, responsible gene in a region containing genes in
- Glycogen Storage Disease type 9 different forms of the condition can affect glycogen
- Stage III contractures, and immobility.
- Stage III is defined as
- a vascular tumor leads to decreased platelet counts
- Kniest Dysplasia (dwarfism) with other skeletal abnormalities and problems with vision and hearing
- Type of epilepsy with multiple different types of seizures particularly tonic (stiffening) and atonic (drop) seizures.
- the central nervous system (including the brain)
- TSC Lymphangiomiomytosis tuberous sclerosis complex
- Severe liver disease of fetal or perinatal onset associated with deposition of stainable iron in extrahepatic sites
- the encoded enzyme may play a role in the proteasome-
- Opsoclonus Myoclonus Syndrome be the result of an autoimmune process involving the
- liver failure In people with PFIC, liver hematoma, liver hematoma, liver hematoma, liver hematoma, liver hematoma, liver hematoma, liver hematoma, liver hematoma, liver hematoma, liver hematoma, liver hematoma, liver hematoma, liver hematoma, liver hematoma, liver hematoma, liver hematoma, liver hematoma, liver hematoma, liver hematoma, liver hematoma, liver hematoma, liver hematoma, liver hematoma, liver hematoma, liver hematoma, liver hematoma, liver hematoma, liver hematoma, liver hematoma, liver hematoma, liver hematoma, liver hematoma, liver hematoma, liver hematoma, liver hematoma, liver hematoma, liver hematoma, liver hematoma, liver hematoma, liver hematoma, liver hematoma
- liver disease causes liver disease in affected individuals
- PTEN Hamartoma Tumor The gene was identified as a tumor suppressor that is Syndrome mutated in a large number of cancers at high frequency
- Holoprosencephany birth defect of the brain, which often can also affect facial features, including closely spaced eyes, small head size, and sometimes clefts of the lip and
- Semilobar holoprosencephaly is a subtype of holoprosencephaly characterised by an incomplete forebrain division
- Trigeminal Trophic Syndrome nostril. Trigeminal trophic syndrome is due to damage to the trigeminal nerve
- rickets or osteomalacia
- vitamin D is relatively ineffective. It can cause bone deformity including short stature and genu varum
- RNA molecules of this invention can be translatable to provide an active protein.
- a translatable RNA molecule can provide an active RNA immunization agent, or an RNA vaccine component.
- Embodiments of this invention can provide vaccination with RNA molecules that encode a target antigen.
- the RNA molecules can induce immune response following capture by antigen-presenting cells.
- Synthetic, isolated RNA molecules of this invention can provide control of immunogenic response parameters, as well as pharmacokinetic properties.
- this disclosure provides methods for RNA vaccines.
- Synthetic, isolated RNA molecules of this invention can be delivered to cells or subjects in molecular form, or in various carriers.
- carriers include liposomes, coated nanoparticles, or cells transfected with RNA agents.
- a RNA agent can be used as an adjuvant, or for stimulating an innate immune response.
- RNA agents of this invention can provide therapeutics effective at a low dose.
- RNA vaccine of this disclosure can advantageously provide a safe and efficacious genetic vaccine by inducing an immune response having both cellular and humoral components.
- protein can be expressed using an RNA vaccine of this invention.
- an RNA vaccine can advantageously provide protein synthesis in the cytoplasm.
- an RNA vaccine of this invention can provide internalization, release and transport of an exogenous translatable RNA in the cytoplasm.
- an RNA vaccine of this invention can encode for a protein antigen that can be translated by host cells.
- RNA vaccines of this disclosure can encode for tumor antigens, viral antigens, or allergens.
- Modalities for administering an RNA vaccine of this invention can include intravenous, intranodal, intradermal, subcutaneous and intrasplenic.
- Embodiments of this invention further provide RNA vaccines having increased half-life of translation, which can be used to reduce the necessary dose and exposure to antigen, and reduce the risk of inducing tolerance.
- RNA vaccine of this invention can provide an immunological effect without the risk of integration of a component into the genome, and may reduce the risk of mutagenesis as compared to other genetic vaccines.
- RNA molecules having translational activity where the translational activity can be described by a cytoplasmic half-life in a mammalian cell. The half-life can be determined by the time required for 50% of the translatable molecule to be degraded in the cell.
- a translatable molecule of this invention can be a precursor of an active molecule, which can be used in the treatment of a condition or disease in a subject.
- a translatable molecule of this invention can be a pharmacologically active molecule having increased half-life in the cytoplasm of mammalian cells.
- translatable molecules that are oligomeric compounds.
- the translatable compounds can be active agents for pharmaceutical compositions.
- Oligomeric molecules of this invention can be used as active agents in formulations for supplying peptide and protein therapeutics.
- Oligomeric compounds of this invention can have a length of from about 200 to about 12,000 bases in length.
- Translatable oligomeric compounds of this invention can have a length of about 1800, or about 1900, or about 2000, or about 2100, or about 2200, or about 2300, or about 2400, or about 2500 bases.
- the oligomeric, translatable compounds of this invention can be pharmacologically active molecules.
- a translatable molecule can be used as an active pharmaceutical ingredient for generating a peptide or protein active agent in vitro, in vivo, or ex vivo.
- a translatable molecule of this invention can have any number of phosphorothioate intermonomer linkages in any intermonomer location.
- any one or more of the intermonomer linkages of a translatable molecule can be a phosphodiester, a phosphorothioate including dithioates, a chiral phosphorothioate, and other chemically modified forms.
- a translatable molecule of this invention can incorporate a region that enhances the translational efficiency of the molecule.
- translational enhancer regions as known in the art can be incorporated into the structure of a translatable molecule to increase peptide or protein yields.
- a translatable molecule containing a translation enhancer region can provide increased production of peptide or protein.
- a translation enhancer region can comprise, or be located in a 5 Or 3' untranslated region of a translatable molecule.
- translation enhancer regions include naturally-occurring enhancer regions from TEV 5'UTR and Xenopus beta-globin 3'UTR.
- a translatable molecule can be designed to express a target peptide or protein.
- the target peptide or protein can be associated with a condition or disease in a subject.
- the base sequence of a translatable molecule can include a portion that is identical to at least an effective portion or domain of a base sequence of an mRNA, where an effective portion is sufficient to impart a therapeutic activity to a translation product of the translatable molecule.
- this invention provides active translatable oligomer molecules having a base sequence identical to at least a fragment of a native nucleic acid molecule of a cell.
- the base sequence of a translatable molecule can include a portion that is identical to a base sequence of an mRNA, except for one or more base mutations.
- the number of mutations for the translatable molecule should not exceed an amount that would produce a translation product of the translatable molecule having substantially less activity than the mRNA.
- the oligomeric, translatable molecules of this invention can display a sequence of nucleobases, and can be designed to express a peptide or protein, in vitro, ex vivo, or in vivo.
- the expressed peptide or protein can have activity in various forms, including activity corresponding to protein expressed from a native or natural mRNA.
- a translatable molecule of this invention may have a chain length of about 200 to 15,000 monomers.
- a translatable molecule of this invention may have a 5'-end capped with one of various groups as are known in the art.
- a 5' cap may be a m7GpppGm cap.
- a 5' cap may be selected from m7GpppA, m7GpppC; unmethylated cap analogs (e.g., GpppG); dimethylated cap analog (e.g., m2,7GpppG), a trimethylated cap analog (e.g., m2,2,7GpppG), dimethylated symmetrical cap analogs (e.g., m7Gpppm7G), or anti reverse cap analogs (e.g., ARC A; m7, 2'OmeGpppG, m72'dGpppG, m7,3'OmeGpppG, m7,3'dGpppG and their tetraphosphate derivatives) (see, e.g., Jemielity, J. et al., RNA 9: 1108-1122 (2003).
- a 5' cap may be an ARC A cap (3'-OMe- m7G(5')pppG).
- the 5' cap may be an mCAP (m7G(5')ppp(5')G, N 7 -Methyl-Guanosine-5'- Triphosphate-5 ' -Guanosine) .
- the 5' cap may be resistant to hydrolysis.
- a translatable molecule may comprise a 5' untranslated region (5' UTR) and/or a 3' untranslated region (3' UTR).
- a translatable molecule may comprise a 5' UTR that is at least about 25, 50, 75, 100, 125, 150, 175, 200, 300, 400, or 500 nucleotides in length.
- a 5' UTR may contain about 50 to 300 nucleotides, for example about 75 to 250 nucleotides, or about 100 to 200 nucleotides, or about 120 to 150 nucleotides, or about 135 nucleotides.
- a 5' UTR may be derived from a reference mRNA.
- a 5' UTR can be derived from an mRNA for a histone, a tubulin, a globin, a GAPDH, an actin, or a citric acid cycle enzyme.
- a 5' UTR sequence may include a partial sequence of a CMV immediate-early 1 (TE1) gene.
- TE1 CMV immediate-early 1
- a 5' UTR may comprise a sequence selected from the 5' UTR of human IL-6, alanine aminotransferase 1, human apolipoprotein E, human fibrinogen alpha chain, human transthyretin, human haptoglobin, human alpha- 1- antichymotrypsin, human antithrombin, human alpha- 1 -antitrypsin, human albumin, human beta globin, human complement C3, human complement C5, SynK, AT1G58420, mouse beta globin, mouse albumin, and a tobacco etch virus, or fragments of any of the foregoing.
- a 5' UTR may be derived from a tobacco etch virus (TEV).
- TEV tobacco etch virus
- the translatable oligomeric molecule may comprise an internal ribosome entry site (IRES).
- IRES can allow for translation initiation in an end-independent manner.
- an IRES can be in a 5' UTR. In other embodiments, an IRES may be outside a 5' UTR.
- a translatable molecule may comprise a 3' UTR that is at least about 25, 50, 75, 100, 125, 150, 175, 200, 300, 400, or 500 nucleotides in length.
- a 3' UTR may contain about 50 to 300 nucleotides, for example, about 75 to 250 nucleotides, or about 100 to 200 nucleotides, or about 140 to 175 nucleotides, or about 160 nucleotides.
- a 3' UTR can comprise a sequence selected from a 3' UTR of alanine aminotransferase 1, human apolipoprotein E, human fibrinogen alpha chain, human haptoglobin, human antithrombin, human alpha globin, human beta globin, human complement C3, human growth factor, human hepcidin, MALAT-1, mouse beta globin, mouse albumin, and xenopus beta globin, or fragments of any of the foregoing.
- a 3' UTR can be derived from xenopus beta globin.
- UTRs may be found in US Patent No. 9,149,506.
- a translatable molecule may comprise a sequence downstream of a CDS that creates a triple stop codon.
- a transatable molecule may comprise the sequence AUAAGUGAA (SEQ ID NO: 1) downstream of a CDS.
- a translatable molecule may comprise a translation initiation site.
- a translation initiation site can be a Kozak sequence. Some examples are found in Kozak, Marilyn (1988) Mol. and Cell Biol., 8:2737-2744; Kozak, Marilyn (1991) J. Biol. Chem., 266: 19867-19870; Kozak, Marilyn (1990) Proc Natl. Acad. Sci. USA, 87:8301-8305; and Kozak, Marilyn (1989) J. Cell Biol., 108:229-241.
- a translation initiation site can be inserted upstream of a CDS.
- a translation initiation site can be inserted downstream of a 5' UTR.
- a translatable molecule can comprise a tail region, which can serve to protect the molecule from exonuclease degradation.
- the tail region can be a polyA tail.
- a PolyA tail can be connected to a translatable molecule using a variety of methods known in the art. For example, using poly A polymerase to add tails to synthetic or in vitro transcribed RNA. Other methods include the use of a transcription vector to encode poly A tails or the use of a ligase (e.g., via splint ligation using a T4 RNA ligase and/or T4 DNA ligase), wherein polyA may be ligated to the 3' end of a sense RNA. In some embodiments, a combination of any of the above methods can be utilized.
- a translatable molecule can comprise a 3' polyA tail structure.
- the length of a polyA tail can be 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 100, 200, or 300 nucleotides, or longer.
- a 3' polyA tail can contain about 5 to 300 adenosine nucleotides, e.g., about 30 to 250 adenosine nucleotides, or about 60 to 220 adenosine nucleotides, or about 80 to 200 adenosine nucleotides, or about 90 to about 150 adenosine nucleotides, or about 100 to about 120 adenosine nucleotides.
- a 3' polyA tail can be about 100 nucleotides in length, or 115 nucleotides in length.
- a translatable molecule may comprise a 3' polyC tail structure.
- the length of the polyC tail can be at least about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 100, 200, or 300 nucleotides, or more.
- a 3' polyC tail may contain about 5 to 300 cytosine nucleotides, for example, about 30 to 250 cytosine nucleotides, or about 60 to 220 cytosine nucleotides, or about 80 to about 200 cytosine nucleotides, or about 90 to 150 cytosine nucleotides, or about 100 to about 120 cytosine nucleotides.
- a 3' polyC tail can be about 100 nucleotides in length, or 115 nucleotides in length.
- a polyC tail may be connected to a polyA tail.
- a polyC tail may connect to the 5' end of a polyA tail, or to the 3' end of a polyA tail.
- the length of the poly A and/or poly C tail can be varied to affect the stability of a translatable molecule.
- the translatable molecules of this invention can be structured to provide peptides or proteins that are nominally expressed by any portion of a genome.
- genes for which a translatable molecule can be used to express the corresponding peptide or protein are set forth below.
- Examples of genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Neoplasia, PTEN; ATM; ATR; EGFR; ERBB2; ERBB3; ERBB4; Notchl; Notch2; Notch3; Notch4; AKT; AKT2;
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Age-related Macular Degeneration, Schizophrenia, Aber; Ccl2; Cc2; cp (ceruloplasmin); Timp3; cathepsinD; Vldlr; Ccr2 Neuregulinl (Nrgl); Erb4 (receptor for Neuregulin); Complexinl (Cplxl); Tphl
- Tryptophan hydroxylase Tph2 Tryptophan hydroxylase 2; Neurexin 1; GSK3; GSK3a; GSK3b.
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: 5-HTT (Slc6a4); COMT; DRD (Drdla); SLC6A3; DAOA; DTNBP1; Dao (Daol).
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Trinucleotide Repeat Disorders, HTT (Huntington's Dx); SBMA/SMAXl/AR (Kennedy's Dx); FXN/X25 (Friedrich's Ataxia); ATX3 (Machado- Joseph's Dx); ATXN1 and ATXN2 (spinocerebellar ataxias); DMPK (myotonic dystrophy); Atrophin-1 and Atn 1 (DRPLA Dx); CBP (Creb-BP-global instability); VLDLR (Alzheimer's); Atxn7; AtxnlO.
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Fragile X Syndrome, FMR2;
- Examples of genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Secretase Related Disorders, APH- 1 (alpha and beta); Presenilin (Psenl); nicastrin (Ncstn); PEN-2. [00315] Examples of genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Nosl .
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Parpl .
- translatable molecule examples include: Natl; Nat2.
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Prion-related disorders, Prp.
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: ALS disease, SOD1; ALS2;
- VEGF VEGF-a; VEGF-b; VEGF-c).
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Drug addiction, Prkce (alcohol); Drd2; Drd4; ABAT (alcohol); GRIA2; Grm5; Grinl; Htrlb; Grin2a; Drd3; Pdyn; Grial (alcohol).
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Autism, Mecp2; BZRAPl;
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Alzheimer's Disease, El; CHIP; UCH; UBB; Tau; LRP; PICALM; Clusterin; PSl; SORLl; CRl; Vldlr; Ubal; Uba3; CHIP28 (Aqpl, Aquaporin 1); Uchll; Uchl3; APP.
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Inflammation, lL-10; IL-1 (lL-la; IL-lb); 1L-13; IL-17 (IL-17a (CTLA8); IL-17b; IL-17c; IL-17d; IL-17f); 11-23; Cx3erl; ptpn22; TNFa; NOD2/CARD15 for IBD; IL- 6; 1L-12 (1L-I2a; 1L-I2b); CTLA4;
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Parkinson's Disease, x-Synuclein; DJ-1; LRRK2; Parkin; PINK1.
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Blood and coagulation diseases and disorders, Anemia (CDAN1, CDA1, RPS19, DBA, PKLR, PK1, NT5C3, UMPH1, PSN1, RHAG, RH50A, RAMP2, SPTB, ALAS2, ANH1, ASB, ABCB7, ABC7, ASAT); Bare lymphocyte syndrome (TAPBP, TPSN, TAP2, ABCB3, PSF2, RING11, MHC2TA, C2TA, RFX5, RFXAP, RFX5), Bleeding disorders (TBXA2R, P2RX1, P2X1); Factor H and factor H-like 1 (HF1, CFH, HUS); Factor V and factor VIII (MCFD2); Factor VII deficiency (F7); Factor X deficiency (F10); Factor XI deficiency (Fl 1); Factor XII
- Factor XIIIB deficiency F13B
- Fanconi anemia FANCA, FACA, FA1, FA, FAA, FAAP95, FAAP90, FLJ34064, FANCB, FANCC, FACC, BRCA2, FANCDl, FANCD2, FANCD, FACD, FAD, FANCE, FACE, FANCF, XRCC9, FANCG, BRIP1, BACH1, FANCJ, PHF9, FANCL, FANCM, KIAA1596
- Hemophagocytic lymphohistiocytosis disorders PRFl, HPLH2, UNCI 3D, MUNC13-4, HPLH3, HLH3, FHL3)
- Hemophilia A F8, F8C, HEMA
- Hemophilia B F9 Factor IX, HEMB
- Hemorrhagic disorders PI, ATT, F5)
- Leukocyde deficiencies and disorders IGB2, CD 18, LCAMB, LAD, EIF2
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Cell dysregulation and oncology diseases and disorders, B-cell non-Hodgkin lymphoma (BCL7A, BCL7); Leukemia (TALI TCL5, SCL, TAL2, FLT3, NBS1, NBS, ZNFN1A1, IK1, LYF1, HOXD4, HOX4B, BCR, CML, PHL, ALL, ARNT, KRAS2, RASK2, GMPS, AFIO, ARHGEF12, LARG, KIAA0382, CALM, CLTH, CEBPA, CEBP, CHIC2, BTL, FLT3, KIT, PBT, LPP, NPMl, NUP214, D9S46E, CAN, CAIN, RUNX1, CBFA2, AML1, WHSC1L1, NSD3, FLT3, AFIQ, NPMl, NUMA1, ZNF145, PLZF, PML
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Inflammation and immune related diseases and disorders, AIDS (KIR3DL1, NKAT3, NKB1, AMB11, KIR3DS1, IFNG, CXCL12, SDF1); Autoimmune lymphoproliferative syndrome (TNFRSF6, APT1, FAS, CD95, ALPS1A); Combined immuno- deficiency, (IL2RG, SCIDX1, SCIDX, IMD4); HIV-1 (CCL5, SCYA5, D17S136E, TCP228), HIV susceptibility or infection (IL10, CSIF, CMKBR2, CCR2, CMKBR5, CCCKR5 (CCR5)); Immuno- deficiencies (CD3E, CD3G, AICDA, AID, HIGM2, TNFRSF5, CD40, UNG, DGU, HIGM4, TNFSF5, CD40LG, HIGM1, IGM, FOXP3, IPE
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Metabolic, liver, kidney and protein diseases and disorders, Amyloid neuropathy (TTR, PALB); Amyloidosis
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Lipoprotein lipase, APOA1, APOC3 and APOA4.
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Muscular/skeletal diseases and disorders, Becker muscular dystrophy (DMD, BMD, MYF6), Duchenne Muscular Dystrophy (DMD, BMD); Emery-Dreifuss muscular dystrophy (LMNA, LMNl, EMD2, FPLD, CMD1A, HGPS, LGMD1B, LMNA, LMNl, EMD2, FPLD, CMD1A); Facioscapulohumeral muscular dystrophy (FSHMDIA, FSFID1A); Muscular dystrophy (FKRP, MDC1C, LGMD2I, LAMA2, LAMM, LARGE, KIAA0609, MDC1D, FCMD, TTID, MYOT, CAPN3, CANP3, DYSF, LGMD2B, SGCG, LGMD2C, DMDAl, SCG3, SGCA, ADL, DAG2, LGMD
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Neurological and neuronal diseases and disorders, ALS (SOD1, ALS2, STEX, FUS, TARDBP, VEGF (VEGF-a, VEGF-b, VEGF-c); Alzheimer's Disease (APP, AAA, CVAP, ADl, APOE, AD2, PSEN2, AD4, STM2, APBB2, FE65L1, NOS3, PLAU, URK, ACE, DCP1, ACE1, MPO, PACIP1, PAXIP1L, PTIP, A2M, BLMH, BMH, PSEN1, AD3); Autism (Mecp2, BZRAPl, MDGA2, Sema5A, Neurexin 1, GLOl, MECP2, RTT, PPMX, MRX16, MRX79, NLGN3, NLGN4, KIAA1260, AUTSX2); Fragile X Syndrome (FMR2,
- Presenilin Psenl
- Ncstn nicastrin
- PEN-2 Nosl, Parpl, Natl, Nat2
- Trinucleotide Repeat Disorders HAT (Huntington's Dx), SBMA/SMAXl/AR (Kennedy's Dx), FXN/X25 (Friedrich's Ataxia), ATX3 (Machado- Joseph's Dx), ATXN1 and ATXN2 (spinocerebellar ataxias), DMPK (myotonic dystrophy), Atrophin-1 and Atnl (DRPLA Dx), CBP (Creb-BP - global instability), VLDLR (Alzheimer's), Atxn7, AtxnlO).
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Occular diseases and disorders, Age-related macular degeneration (Aber, Ccl2, Cc2, cp (ceruloplasmin), Timp3, cathepsinD, Vldlr, Ccr2); Cataract (CRYAA, CRYAl, CRYBB2, CRYB2, PITX3, BFSP2, CP49, CP47, CRYAA, CRYAl, PAX6, AN2, MGDA, CRYBAl, CRYBl, CRYGC, CRYG3, CCL, LIM2, MP19, CRYGD, CRYG4, BFSP2, CP49, CP47, HSF4, CTM, HSF4, CTM, MIP, AQPO, CRYAB, CRYA2, CTPP2, CRYBBl, CRYGD, CRYG4, CRYBB2, CRYB2, CRYGC, CRYG3, CCL, CRY
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Epilepsy, myoclonic, EPM2A, MELF, EPM2 Lafora type, 254780 Epilepsy, myoclonic, HLRC1, EPM2A, EPM2B Lafora type, 254780.
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Duchenne muscular DMD, BMD dystrophy, 310200 (3) AIDS, delayed/rapid KIR3DL1, KAT3, NKB l, AMB11, KIR3DS1 progression to (3).
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: AIDS, delayed/rapid KIR3DL1, NKAT3, NKBl, AMBl 1, KIR3DS1 progression to (3) AIDS, rapid IFNG progression to, 609423 (3) AIDS, resistance to CXCL12, SDF1 (3).
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Alpha-1 -Antitrypsin Deficiency, SERPINAl [serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 1]; SERPIN A2 [serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 2]; SERPINA3 [serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3]; SERPINA5 [serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 5]; SERPINA6 [serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 6]; SERPINA7 [serpin peptidase
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: PI3K/AKT Signaling, PRKCE; ITGAM; ITGA5; IRAKI; PRKAA2; EIF2AK2; PTEN; EIF4E; PRKCZ; GRK6;
- GSK3B AKT3; FOXOl; SGK; HSP90AA1; RPS6KB 1.
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: ERK/MAPK Signaling, PRKCE; ITGAM; ITGA5; HSPBl; IRAKI; PRKAA2; EIF2AK2; RACl; RAPIA; TLNl; EIF4E; ELK1; GRK6; MAPKl; RAC2; PLK1; AKT2; PIK3CA; CDK8; CREBl; PRKCI;
- PTK2 FOS
- RPS6KA4 PIK3CB
- PPP2R1A PIK3C3
- MAPK8 MAPK3
- ITGA1 ITGA1
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Serine/Threonine-Protein Kinase, CDK16; PCTK1; CDK5R1.
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Glucocorticoid Receptor Signaling, RACl; TAF4B; EP300; SMAD2; TRAF6; PCAF; ELK1; MAPKl; SMAD3; AKT2; IKBKB; NCOR2; UBE2I; PIK3CA; CREBl; FOS; HSPA5; NFKB2; BCL2; MAP3K14; STAT5B; PIK3CB; PIK3C3; MAPK8; BCL2L1; MAPK3; TSC22D3; MAPKIO; NRIPl; KRAS; MAPK13; RELA; STAT5A; MAPK9; NOS2A; PBX1; NR3C1; PIK3C2A;
- CDKN1C CDKN1C; TRAF2; SERPINEl; NCOA3; MAPKl 4; TNF; RAFl; IKBKG; MAP3K7; CREBBP; CDKN1A; MAP2K2; JAKl; IL8; NCOA2; AKTl; JAK2; PIK3R1; CHUK; STAT3; MAP2K1; NFKB l; TGFBR1; ESR1; SMAD4; CEBPB; JUN; AR; AKT3;
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Axonal Guidance Signaling, PRKCE; ITGAM; ROCK1; ITGA5; CXCR4; ADAM12; IGF1; RACl; RAPIA; E1F4E; PRKCZ; NRP1; NTRK2; ARHGEF7; SMO; ROCK2; MAPKl; PGF; RAC2; PTPN11; GNAS; AKT2; PIK3CA; ERBB2; PRKCI; PTK2; CFL1; GNAQ; PIK3CB; CXCL12; PIK3C3; WNT11; PRKD1; GNB2L1; ABLl; MAPK3; ITGAl; KRAS; RHOA;
- PRKCD PRKCD
- PIK3C2A ITGB7; GLI2; PXN; VASP; RAFl; FYN; ITGB l; MAP2K2;
- PAK4 AD AMI 7; AKTl; PIK3R1; GLI1; WNT5A; ADAMIO; MAP2K1; PAK3;
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Ephrin Receptor Signaling, PRKCE; ITGAM; ROCKl; ITGA5; CXCR4; IRAKI; PRKAA2; EIF2AK2; RACl; RAPIA; GRK6; ROCK2; MAPK1; PGF; RAC2; PTPN11; GNAS; PLK1; AKT2;
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Actin Cytoskeleton Signaling, ACTN4; PRKCE; ITGAM; ROCKl; ITGA5; IRAKI; PRKAA2; EIF2AK2; RACl; INS; ARHGEF7; GRK6; ROCK2; MAPKl; RAC2; PLK1; AKT2; PIK3CA; CDK8; PTK2; CFL1; PIK3CB; MYH9; DIAPHl; PIK3C3; MAPK8; F2R; MAPK3; SLC9A1; ITGAl; KRAS; RHOA; PRKCD; PRKAAl; MAPK9; CDK2; PIMl; PIK3C2A; ITGB7;
- PPP1CC PXN; VIL2; RAFl; GSN; DYRKIA; ITGBl; MAP2K2; PAK4; PIP5K1A; PIK3R1; MAP2K1; PAK3; ITGB3; CDC42; APC; ITGA2; TTK; CSNKIAI; CRKL; BRAF; VAV3; SGK.
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Huntington's Disease Signaling, PRKCE; IGF1; EP300; RCOR1.; PRKCZ; HDAC4; TGM2; MAPKl; CAPNSl; AKT2; EGFR; NCOR2; SP1; CAPN2; PIK3CA; HDAC5; CREB1; PRKC1; HSPA5; REST; GNAQ; PIK3CB; PIK3C3; MAPK8; IGF1R; PRKD1; GNB2L1; BCL2L1; CAPNl; MAPK3; CASP8; HDAC2; HDAC7A; PRKCD; HDAC11; MAPK9; HDAC9;
- PIK3C2A HDAC3; TP53; CASP9; CREBBP; AKTl; PIK3R1; PDPK1; CASP1; APAFl; FRAP1; CASP2; JUN; BAX; ATF4; AKT3; PRKCA; CLTC; SGK; HDAC6; CASP3.
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Apoptosis Signaling, PRKCE; ROCKl; BID; IRAKI; PRKAA2; EIF2AK2; BAKl; BIRC4; GRK6; MAPKl; CAPNSl; PLK1; AKT2; IKBKB; CAPN2; CDK8; FAS; NFKB2; BCL2; MAP3K14; MAPK8; BCL2L1; CAPN1; MAPK3; CASP8; KRAS; RELA; PRKCD; PRKAA1; MAPK9;
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: B Cell Receptor Signaling, RACl; PTEN; LYN; ELK1; MAPKl; RAC2; PTPN11; AKT2; IKBKB; PIK3CA; CREB 1; SYK; NFKB2; CAMK2A; MAP3K14; PIK3CB; PIK3C3; MAPK8; BCL2L1; ABL1; MAPK3; ETS1; KRAS; MAPK13; RELA; PTPN6; MAPK9; EGR1; PIK3C2A; BTK; MAPKl 4; RAFl; IKBKG; RELB; MAP3K7; MAP2K2; AKT1; PIK3R1; CHUK;
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Leukocyte Extravasation
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Integrin Signaling, ACTN4;
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Acute Phase Response Signaling, IRAKI; SOD2; MYD88; TRAF6; ELKl; MAPKl; PTPNl l; AKT2; IKBKB; PIK3CA; FOS; NFKB2; MAP3K14; PIK3CB; MAPK8; RIPK1; MAPK3; IL6ST; KRAS;
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: PTEN Signaling, ITGAM; ITGA5; RAC1; PTEN; PRKCZ; BCL2L11; MAPKl; RAC2; AKT2; EGFR; IKBKB; CBL; PIK3CA; CDKN1B; PTK2; NFKB2; BCL2; PIK3CB; BCL2L1; MAPK3; ITGAl;
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: p53 Signaling, PTEN; EP300; BBC3; PCAF; FASN; BRCA1; GADD45A; BIRC5; AKT2; PIK3CA; CHEK1;
- TP53INP1 TP53INP1; BCL2; PIK3CB; PIK3C3; MAPK8; THBS1; ATR; BCL2L1; E2F1;
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Aryl Hydrocarbon Receptor Signaling, HSPB 1; EP300; FASN; TGM2; RXRA; MAPKl; NQOl; NCOR2; SP1; ARNT; CDKN1B; FOS; CHEK1; SMARCA4; NFKB2; MAPK8; ALDHIAI; ATR; E2F1; MAPK3; NRIPl; CHEK2; RELA; TP73; GSTP1; RBI; SRC; CDK2; AHR; FE2L2; NCOA3; TP53; T F; CDKN1A; NCOA2; APAF1; NFKB 1; CC D1; ATM; ESR1; CDKN2A; MYC; JUN; ESR2; BAX; IL6; CYP1B 1; HSP90AA1.
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Xenobiotic Metabolism Signaling, PRKCE; EP300; PRKCZ; RXRA; MAPKl; NQOl; NCOR2; PIK3CA; ARNT; PRKCI; NFKB2; CAMK2A; PIK3CB; PPP2R1A; PIK3C3; MAPK8; PRKD1; ALDHIAI;
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: SAPK/JNK Signaling, PRKCE; IRAKI; PRKAA2; EIF2AK2; RAC1; ELK1; GRK6; MAPKl; GADD45A; RAC2;
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: PPAr/RXR Signaling, PRKAA2; EP300; INS; SMAD2; TRAF6; PPARA; FASN; RXRA; MAPKl; SMAD3; GNAS; IKBKB; NCOR2; ABCAl; GNAQ; NFKB2; MAP3K14; STAT5B; MAPK8; IRSl; MAPK3; KRAS; RELA; PRKAAl; PPARGCIA; NCOA3; MAPKl 4; INSR; RAFl; IKBKG; RELB; MAP3K7; CREBBP; MAP2K2; JAK2; CHUK; MAP2K1; NFKBl; TGFBR1; SMAD4; JUN; IL1R1; PRKCA; IL6; HSP90AA1; ADIPOQ.
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: NF-KB Signaling, IRAKI;
- EIF2AK2; EP300; INS; MYD88; PRKCZ TRAF6; TBK1; AKT2; EGFR; IKBKB; PIK3CA; BTRC; NFKB2; MAP3K14; PIK3CB; PIK3C3; MAPK8; RIPKl; HDAC2; KRAS; RELA; PIK3C2A; TRAF2; TLR4: TNF; INSR; LCK; IKBKG; RELB; MAP3K7; CREBBP; AKTl; PIK3R1; CHUK; PDGFRA; FKB 1; TLR2; BCL10;
- GSK3B GSK3B; AKT3; TNFAIP3; IL1R1.
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Neuregulin Signaling, ERBB4; PRKCE; ITGAM; ITGA5: PTEN; PRKCZ; ELK1; MAPK1; PTPN11; AKT2; EGFR; ERBB2; PRKCI; CDKN1B; STAT5B; PRKD1; MAPK3; ITGA1; KRAS; PRKCD; STAT 5 A; SRC; ITGB7; RAFl; ITGB l; MAP2K2; ADAM 17; AKTl; PIK3R1; PDPKl; MAP2K1; ITGB3; EREG; FRAPl; PSEN1; ITGA2; MYC; RG1; CRKL; AKT3;
- PRKCA HSP90AA1; RPS6KB 1.
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Wnt & Beta catenin Signaling, CD44; EP300; LRP6; DVL3; CS K1E; GJA1; SMO; AKT2; PIN1; CDH1; BTRC; GNAQ; MARK2; PPP2R1A; WNT11; SRC; DKK1; PPP2CA; SOX6; SFRP2: ILK; LEFl; SOX9; TP53; MAP3K7; CREBBP; TCF7L2; AKTl; PPP2R5C; WNT5A; LRP5; CTN B1; TGFBR1; CC D1; GSK3A; DVL1; APC; CDKN2A; MYC; CS K1A1; GSK3B; AKT3; SOX2.
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Insulin Receptor Signaling, PTEN; INS; EIF4E; PTPN1; PRKCZ; MAPK1; TSC1; PTPN11; AKT2; CBL; PIK3CA;
- PRKCI PRKCI; PIK3CB; PIK3C3; MAPK8; IRS1; MAPK3; TSC2; KRAS; EIF4EBP1;
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: IL-6 Signaling, HSPB 1; TRAF6; MAPKAPK2; ELK1; MAPKl; PTPN11; IKBKB; FOS; NFKB2: MAP3K14; MAPK8; MAPK3; MAPKIO; IL6ST; KRAS; MAPK13; IL6R; RELA; SOCSl; MAPK9; ABCB l; TRAF2; MAPKl 4; TNF; RAFl; IKBKG; RELB; MAP3K7; MAP2K2; IL8; JAK2; CHUK; STAT3; MAP2K1; NFKB l; CEBPB; JUN; IL1R1; SRF; IL6.
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Hepatic Cholestasis, PRKCE; IRAKI; INS; MYD88; PRKCZ; TRAF6; PPARA; RXRA; IKBKB; PRKCI; NFKB2; MAP3K14; MAPK8; PRKDl; MAPKIO; RELA; PRKCD; MAPK9; ABCBl; TRAF2; TLR4; TNF; INSR; IKBKG; RELB; MAP3K7; IL8; CHUK; NR1H2; TJP2; NFKB 1; ESR1; SREBF1; FGFR4; JUN; IL1R1; PRKCA; IL6.
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: IGF-1 Signaling, IGF1; PRKCZ; ELK1; MAPKl; PTPN11; NEDD4; AKT2; PIK3CA; PRKCl; PTK2; FOS; PIK3CB; PIK3C3; MAPK8; IGFIR; IRSl; MAPK3; IGFBP7; KRAS; PIK3C2A; YWHAZ; PXN; RAFl; CASP9; MAP2K2; AKTl; PIK3R1; PDPK1; MAP2K1; IGFBP2; SFN; JUN; CYR61; AKT3; FOXOl; SRF; CTGF; RPS6KB 1.
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: NRF2-mediated Oxidative Stress Response, PRKCE; EP300; SOD2; PRKCZ; MAPKl; SQSTM1; NQOl; PIK3CA;
- PRKCl PRKCl; FOS; PIK3CB; P1K3C3; MAPK8; PRKDl; MAPK3; KRAS; PRKCD; GSTPl; MAPK9; FTL; NFE2L2; PIK3C2A; MAPKl 4; RAFl; MAP3K7; CREBBP; MAP2K2; AKTl; PIK3R1; MAP2K1; PPIB; JUN; KEAPl; GSK3B; ATF4; PRKCA; EIF2AK3; HSP90AA1.
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Hepatic, Fibrosis/Hepatic Stellate Cell Activation, EDN1; IGF1; KDR; FLT1; SMAD2; FGFR1; MET; PGF; SMAD3; EGFR; FAS; CSFl; NFKB2; BCL2; MYH9; IGFIR; IL6R; RELA; TLR4; TNF; RELB; IL8; PDGFRA; NFKB l; TGFBR1; SMAD4; VEGFA; BAX; IL1R1; CCL2; HGF;
- MMP1 STAT1; IL6; CTGF; MMP9.
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: PPAR Signaling, EP300; INS; TRAF6; PPARA; RXRA; MAPKl; IKBKB; NCOR2; FOS; NFKB2; MAP3K14;
- STAT5B MAPK3; NRIPl; KRAS; PPARG; RELA; STAT5A; TRAF2; PPARGCIA; TNF; INSR; RAFl; IKBKG; RELB; MAP3K7; CREBBP; MAP2K2; CHUK; PDGFRA; MAP2K1; NFKBl; JUN; IL1R1; HSP90AA1.
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Fc Epsilon RI Signaling, PRKCE; RAC1; PRKCZ; LYN; MAPKl; RAC2; PTPN11; AKT2; PIK3CA; SYK; PRKCI;
- PIK3CB PIK3C3; MAPK8; PRKD1; MAPK3; MAPKIO; KRAS; MAPKl 3; PRKCD; MAPK9; PIK3C2A; BTK; MAPKl 4; TNF; RAFl; FYN; MAP2K2; AKT1; PIK3R1; PDPK1; MAP2K1; AKT3; VAV3; PRKCA.
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: G-Protein Coupled Receptor Signaling, PRKCE; RAPIA; RGS16; MAPKl; GNAS; AKT2; IKBKB; PIK3CA;
- CREB l GNAQ; NFKB2; CAMK2A; PIK3CB; PIK3C3; MAPK3; KRAS; RELA; SRC; PIK3C2A; RAFl; IKBKG; RELB; FYN; MAP2K2; AKT1; PIK3R1; CHUK; PDPK1; STAT3; MAP2K1; NFKB l; BRAF; ATF4; AKT3; PRKCA.
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Inositol Phosphate Metabolism, PRKCE; IRAKI; PRKAA2; EIF2AK2; PTEN; GRK6; MAPKl; PLKl; AKT2; PIK3CA; CDK8; PIK3CB; PIK3C3; MAPK8; MAPK3; PRKCD; PRKAA1; MAPK9; CDK2; PFM1; PIK3C2A; DYRK1A; MAP2K2; PIP5K1A; PIK3R1; MAP2K1; PAK3; ATM; TTK; CSNK1A1; BRAF; SGK.
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: PDGF Signaling, EIF2AK2;
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: VEGF Signaling, ACTN4;
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Natural Killer Cell Signaling, PRKCE; RACl; PRKCZ; MAPKl; RAC2; PTPNl l; KIR2DL3; AKT2; PIK3CA; SYK; PRKCI; PIK3CB; PIK3C3; PRKD1; MAPK3; KRAS; PRKCD; PTPN6; PIK3C2A; LCK; RAFl; FYN; MAP2K2; PAK4; AKTl; PIK3R1; MAP2K1; PAK3; AKT3; VAV3; PRKCA.
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Cell Cycle: Gl/S Checkpoint Regulation, HDAC4; SMAD3; SUV39H1; FID AC 5; CDKN1B; BTRC; ATR; ABLl; E2F1; HDAC2; HDAC7A; RB I; HDAC11; FID AC 9; CDK2; E2F2; HDAC3; TP53; CDKNIA; CCNDl; E2F4; ATM; RBL2; SMAD4; CDKN2A; MYC; NRGl; GSK3B; RBL1; HDAC6.
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: T Cell Receptor Signaling, RACl; ELK1; MAPKl; 1KB KB; CBL; PIK3CA; FOS; NFKB2; PIK3CB; PIK3C3; MAPK8; MAPK3; KRAS; RELA, PIK3C2A; BTK; LCK; RAFl; IKBKG; RELB, FYN;
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Death Receptor Signaling, CRADD; HSPB1; BID; BIRC4; TBK1; IKBKB; FADD; FAS; NFKB2; BCL2;
- MAP3K14 MAPK8; RIPK1; CASP8; DAXX; TNFRSFIOB; RELA; TRAF2; TNF; IKBKG; RELB; CASP9; CHUK; APAFl; NFKBl; CASP2; BIRC2; CASP3; BIRC3.
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: FGF Signaling RACl; FGFR1; MET; MAPKAPK2; MAPKl; PTPNl l; AKT2; PIK3CA; CREBl; PIK3CB; PIK3C3; MAPK8; MAPK3; MAPK13; PTPN6; PIK3C2A; MAPKl 4; RAFl; AKTl; PIK3R1; STAT3; MAP2K1; FGFR4; CRKL; ATF4; AKT3; PRKCA; HGF.
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: GM-CSF Signaling, LYN; ELK1; MAPKl; PTPNl l; AKT2; PIK3CA; CAMK2A; STAT5B; PIK3CB; PIK3C3; GNB2L1; BCL2L1; MAPK3; ETSl; KRAS; RUNXl; PIMl; PIK3C2A; RAFl; MAP2K2; AKTl; JAK2; PIK3R1; STAT3; MAP2K1; CCND1; AKT3; STAT1.
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Amyotrophic Lateral Sclerosis Signaling, BID; IGF1; RAC1; BIRC4; PGF; CAPNSl; CAPN2; PIK3CA; BCL2;
- PIK3CB PIK3C3; BCL2L1; CAPN1; PIK3C2A; TP53; CASP9; PIK3R1; RAB5A; CASP1; APAFl; VEGFA; BIRC2; BAX; AKT3; CASP3; BIRC3.
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: JAK/Stat Signaling, PTPN1;
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Nicotinate and Nicotinamide Metabolism, PRKCE; IRAKI; PRKAA2; EIF2AK2; GRK6; MAPKl; PLK1; AKT2; CDK8; MAPK8; MAPK3; PRKCD; PRKAA1; PBEF1; MAPK9; CDK2; PIMl;
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Chemokine Signaling, CXCR4; ROCK2; MAPKl; PTK2; FOS; CFLl; GNAQ; CAMK2A; CXCL12; MAPK8; MAPK3; KRAS; MAPK13; RHOA; CCR3; SRC; PPP1CC; MAPKl 4; NOX1; RAFl; MAP2K2; MAP2K1; JUN; CCL2; PRKCA.
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: IL-2 Signaling, ELK1; MAPKl; PTPNl l; AKT2; PIK3CA; SYK; FOS; STAT5B; PIK3CB; PIK3C3; MAPK8; MAPK3; KRAS; SOCS1; STAT5A; PIK3C2A: LCK; RAFl; MAP2K2; JAKl; AKTl; PIK3R1; MAP2K1; JUN; AKT3.
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Synaptic Long Term Depression, PRKCE; IGF1; PRKCZ; PRDX6; LYN; MAPK1; GNAS; PRKCl; GNAQ; PPP2R1A; IGFIR; PRKIDl; MAPK3; KRAS; GRN; PRKCD; NOS3; NOS2A; PPP2CA; YWHAZ; RAFl; MAP2K2; PPP2R5C; MAP2K1; PRKCA.
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Estrogen Receptor Signaling, TAF4B; EP300; CARMl; PCAF; MAPK1; NCOR2; SMARCA4; MAPK3; NRIP1; KRAS; SRC; NR3C1; HDAC3; PPARGCIA; RBM9; NCOA3; RAFl; CREBBP;
- MAP2K2 MAP2K2; NCOA2; MAP2K1; PRKDC; ESR1; ESR2.
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Protein Ubiquitination Pathway, TRAF6; SMURF1; BIRC4; BRCA1; UCHL1; NEDD4; CBL; UBE2I; BTRC; HSPA5; USP7; USP10; FBXW7; USP9X; STUBl; USP22; B2M; BIRC2; PARK2; USP8; USPl; VHL; HSP90AA1; BIRC3.
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: IL-10 Signaling, TRAF6; CCR1; ELK1; 1KB KB; SPl; FOS; NFKB2; MAP3K14; MAPK8; MAPK13; RELA; MAPK14; TNF; IKBKG; RELB; MAP3K7; JAK1; CHUK; STAT3; NFKB1; JUN; IL1R1; IL6.
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: VDR/RXR Activation, PRKCE; EP300; PRKCZ; RXRA; GADD45A; HESl; NCOR2; SPl; PRKCl; CDKNIB; PRKDl; PRKCD; RUNX2; KLF4; YY1; NCOA3; CDKN1A; NCOA2; SPP1; LRP5; CEBPB; FOXOl; PRKCA.
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: TGF-beta Signaling, EP300;
- SMAD2 SMURFl
- MAPKl MAPK1
- SMAD3 SMADl
- FOS MAPK8
- MAPK3 MAPK3
- KRAS KRAS
- translatable molecule examples include: Toll-like Receptor Signaling, IRAKI; EIF2AK2; MYD88; TRAF6; PPARA; ELK1; 1KB KB; FOS; FKB2;
- MAP3K14 MAPK8; MAPK13; RELA; TLR4; MAPK14; IKBKG; RELB; MAP3K7; CHUK; FKB1; TLR2; JUN.
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: p38 MAPK Signaling, HSPB 1; IRAKI; TRAF6; MAPKAPK2; ELK1; FADD; FAS; CREB 1; DDIT3; RPS6KA4;
- DAXX DAXX
- MAPK13 TRAF2; MAPK 14; TNF; MAP3K7; TGFBRl; MYC; ATF4; IL1R1; SRF; STAT1.
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Neurotrophin/TRK Signaling, NTRK2; MAPKl; PTPN11; PIK3CA; CREB1; FOS; PIK3CB; PIK3C3; MAPK8;
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: FXR/RXR Activation, INS;
- PPARA PPARA
- FASN RXRA
- AKT2 SDC1
- MAPK8 APOB
- MAPKIO PPARG
- MTTP MAPK9
- PPARGC1A TNF
- CREBBP CREBBP
- AKTl SREBF1
- FGFR4 FGFR4
- AKT3 FOXOl
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Synaptic Long Term Potentiation, PRKCE; RAPIA; EP300; PRKCZ; MAPKl; CREB1; PRKC1; GNAQ; CAMK2A; PRKDl; MAPK3; KRAS; PRKCD; PPPICC; RAFl; CREBBP; MAP2K2; MAP2K1; ATF4; PRKCA.
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Calcium Signaling, RAPIA; EP300; HDAC4; MAPKl; HDAC5; CREB1; CAMK2A; MYH9; MAPK3; HDAC2; HDAC7A; HDACl l; HDAC9; HDAC3; CREBBP; CALR; CAMKK2; ATF4; HDAC6.
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: EGF Signaling, ELK1; MAPK1; EGFR; PIK3CA; FOS; PIK3CB; PIK3C3; MAPK8; MAPK3; PIK3C2A; RAF1; JAK1; PIK3R1; STAT3; MAP2K1; JUN; PRKCA; SRF; STAT1.
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Hypoxia Signaling in the
- Cardiovascular System EDNl; PTEN; EP300; NQOl; UBE21; CREBl; ARNT; HIFIA; SLC2A4; NOS3; TP53; LDHA; AKTl; ATM; VEGFA; JUN; ATF4; VHL; HSP90AA1.
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: LPS/IL-1 Mediated Inhibition of RXR Function, IRAKI; MYD88; TRAF6; PPARA; RXRA; ABCAl, MAPK8;
- ALDHIAI ALDHIAI
- GSTP1 MAPK9
- ABCBl TRAF2; TLR4; TNF; MAP3K7; NR1H2;
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: LXR/RXR Activation, FASN; RXRA; NCOR2; ABCAl; NFKB2; IRF3; RELA; NOS2A; TLR4; TNF; RELB; LDLR; NR1H2; NFKBl; SREBF1; IL1R1; CCL2; IL6; MMP9.
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Amyloid Processing, PRKCE; CSNK1E; MAPKl; CAPNSl; AKT2; CAPN2; CAPNl; MAPK3; MAPK13; MAPT; MAPK14; AKTl; PSEN1; CSNK1A1; GSK3B; AKT3; APP.
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: IL-4 Signaling, AKT2; PIK3CA; PIK3CB; PIK3C3; IRS1; KRAS; SOCS1; PTPN6; NR3C1; PIK3C2A; JAK1; AKTl; JAK2; PIK3R1; FRAP1; AKT3; RPS6KB1.
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Cell Cycle: G2/M DNA Damage Checkpoint Regulation, EP300; PCAF; BRCA1; GADD45A; PLK1; BTRC; CHEK1; ATR; CHEK2; YWHAZ; TP53; CDKN1A; PRKDC; ATM; SFN; CDKN2A.
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Nitric Oxide Signaling in the Cardiovascular System, KDR; FLTl; PGF; AKT2; PIK3CA; PIK3CB; PIK3C3; CAVl; PRKCD; NOS3; PIK3C2A; AKT1; PIK3R1; VEGFA; AKT3; HSP90AA1.
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Purine Metabolism NME2;
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: cAMP-mediated Signaling, RAPIA; MAPKl; GNAS; CREB 1; CAMK2A; MAPK3; SRC; RAFl; MAP2K2;
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Mitochondrial Dysfunction Notch Signaling, SOD2; MAPK8; CASP8; MAPKIO; MAPK9; CASP9; PARK7; PSENl; PARK2; APP; CASP3 HESl; JAGl; NUMB; NOTCH4; AD AMI 7; NOTCH2; PSENl; NOTCH3; NOTCH1; DLL4.
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Endoplasmic Reticulum Stress Pathway, HSPA5; MAPK8; XBPl; TRAF2; ATF6; CASP9; ATF4; EIF2AK3; CASP3.
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Pyrimidine Metabolism, NME2; AICDA; RRM2; EIF2AK4; ENTPD1; RRM2B; NT5E; POLD1; NME1.
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Parkinson's Signaling, UCHL1; MAPK8; MAPK13; MAPKl 4; CASP9; PARK7; PARK2; CASP3.
- Examples of genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Cardiac & Beta Adrenergic Signaling, GNAS; GNAQ; PPP2R1A; GNB2L1; PPP2CA; PPP1CC; PPP2R5C. [00409] Examples of genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Glycolysis/Gluco-neogenesis, HK2; GCK; GPI; ALDH1A1; PKM2; LDHA; HK1.
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Interferon Signaling, IRF1;
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Sonic Hedgehog Signaling, ARRB2; SMO; GLI2; DYRK1A; GLI1; GSK3B; DYRKIB.
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Glycerophospholipid Metabolism, PLD1; GRN; GPAM; YWHAZ; SPHK1; SPHK2.
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Phospholipid Degradation, PRDX6; PLD1; GRN; YWHAZ; SPHK1; SPHK2.
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Tryptophan Metabolism, SIAH2; PRMT5; NEDD4; ALDHIAI; CYP1B 1; SIAHl .
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Lysine Degradation, SUV39H1; EHMT2; NSD1; SETD7; PPP2R5C.
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Nucleotide Excision, ERCC5; ERCC4; XPA; XPC; ERCC1.
- Examples of genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Repair Pathway Starch and Sucrose Metabolism, UCHL1; HK2; GCK; GPI; HK1.
- Examples of genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Aminosugars Metabolism, NQOl; HK2; GCK; HK1.
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Arachidonic Acid Metabolism, PRDX6; GRN; YWHAZ; CYP1B 1.
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Circadian Rhythm Signaling, CS K1E; CREB1; ATF4; R1D1.
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Coagulation System, BDKRB1; F2R; SERPINE1; F3.
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Dopamine Receptor Signaling, PPP2R1A; PPP2CA; PPP1CC; PPP2R5C.
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Glutathione Metabolism, IDH2; GSTP1; ANPEP; IDH1.
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Glycerolipid Metabolism, ALDHIAI; GPAM; SPHK1; SPHK2.
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Linoleic Acid Metabolism, PRDX6; GRN; YWHAZ; CYP1B 1.
- Examples of genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Methionine Metabolism, DNMT1; DNMT3B; AHCY; DNMT3A. [00427] Examples of genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Pyruvate Metabolism, GLOl; ALDH1A1; PKM2; LDHA.
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Arginine and Proline Metabolism, ALDHIAI; NOS3; NOS2A.
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Eicosanoid Signaling, PRDX6; GRN; YWHAZ.
- translatable molecule examples include: Fructose and Mannose
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Galactose Metabolism, HK2; GCK; HK1.
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Stilbene, Coumarine and Lignin Biosynthesis, PRDX6; PRDX1; TYR.
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Antigen Presentation Pathway, CALR; B2M.
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Biosynthesis of Steroids, NQOl; DHCR7.
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Butanoate Metabolism,
- ALDHIAI ALDHIAI
- LGN1 Examples of genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Citrate Cycle, IDH2; IDH1.
- translatable molecule examples include: Fatty Acid Metabolism,
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Glycerophospholipid Metabolism, PRDX6; CHKA.
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Histidine Metabolism, PRMT5; ALDHlAl .
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Inositol Metabolism, EROIL; APEX1.
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Metabolism of Xenobiotics by Cytochrome p450, GSTP1; CYP1B1.
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Methane Metabolism, PRDX6; PRDX1.
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Phenylalanine Metabolism, PRDX6; PRDX1.
- translatable molecule examples include: Propanoate Metabolism,
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Selenoamino Acid Metabolism, PRMT5; AHCY.
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Sphingolipid Metabolism, SPHK1; SPHK2.
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Aminophosphonate Metabolism, PRMT5.
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Androgen and Estrogen
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Ascorbate and Aldarate
- translatable molecule examples include: Bile Acid Biosynthesis,
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Cysteine Metabolism, LDHA.
- translatable molecule examples include: Fatty Acid Biosynthesis, FASN.
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Glutamate Receptor Signaling, G B2L1.
- Examples of genes for which a translatable molecule can be used to express the corresponding peptide or protein include: RF2-mediated Oxidative Stress Response, PRDX1.
- Examples of genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Pentose Phosphate Pathway, GPL
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Pentose and Glucuronate
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Retinol Metabolism, ALDH1A1.
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Riboflavin Metabolism, TYR.
- translatable molecule examples include: Tyrosine Metabolism, PRMT5, TYR.
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Ubiquinone Biosynthesis, PRMT5.
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Valine, Leucine and Isoleucine Degradation, ALDH1A1.
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Glycine, Serine and Threonine Metabolism, CHKA.
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Lysine Degradation, ALDHIAI .
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Pain/Taste, TRPM5; TRPA1.
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Pain, TRPM7; TRPC5; TRPC6; TRPCl; Cnrl; cnr2; Grk2; Trpal; Pome; Cgrp; Crf; Pka; Era; Nr2b; TRPM5; Prkaca; Prkacb; Prkarla; Prkar2a.
- Examples of genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Mitochondrial Function, AIF; CytC; SMAC (Diablo); Aifm-1; Aifin-2.
- genes for which a translatable molecule can be used to express the corresponding peptide or protein include: Developmental Neurology, BMP- 4; Chordin (Chrd); Noggin (Nog); WNT (Wnt2; Wnt2b; Wnt3a; Wnt4; Wnt5a; Wnt6; Wnt7b; Wnt8b; Wnt9a; Wnt9b; WntlOa; WntlOb; Wntl6); beta-catenin; Dkk-1; Frizzled related proteins; Otx-2; Gbx2; FGF-8; Reelin; Dabl; unc-86 (Pou4fl or Brn3a); Numb; Rein.
- this invention provides methods for synthesis of translatable molecules.
- nucleic acids Some methods for preparing nucleic acids are given in, for example, Merino, Chemical Synthesis of Nucleoside Analogues, (2013); Gait, Oligonucleotide synthesis: a practical approach (1984); Herdewijn, Oligonucleotide Synthesis, Methods in Molecular Biology, Vol. 288 (2005).
- a translatable molecule can be made by in vitro transcription (IVT) reaction.
- IVT in vitro transcription
- a mix of nucleoside triphosphates (NTP) can be
- RNA polymerized using T7 reagents, for example, to yield RNA from a DNA template.
- the DNA template can be degraded with RNase-free DNase, and the RNA column-separated.
- a ligase can be used to link a synthetic oligomer to the 3' end of an RNA molecule or an RNA transcript to form a translatable molecule.
- the synthetic oligomer that is ligated to the 3' end can provide the functionality of a polyA tail, and advantageously provide resistance to its removal by 3'-exoribonucleases.
- the ligated product translatable molecule can have increased specific activity and provide increased levels of ectopic protein expression.
- ligated product translatable molecules of this invention can be made with an RNA transcript that has native specificity.
- the ligated product can be a synthetic molecule that retains the structure of the RNA transcript at the 5' end to ensure compatibility with the native specificity.
- ligated product translatable molecules of this invention can be made with an exogenous RNA transcript or non-natural RNA.
- the ligated product can be a synthetic molecule that retains the structure of the RNA.
- the canonical mRNA degradation pathway in cells includes the steps: (i) the polyA tail is gradually cut back to a stub by 3' exonucleases, shutting down the looping interaction required for efficient translation and leaving the cap open to attack; (ii) decapping complexes remove the 5' cap; (iii) the unprotected and
- translationally incompetent residuum of the transcript is degraded by 5' and 3' exonuclease activity.
- Embodiments of this invention involve new translatable structures which can have increased translational activity over a native transcript.
- the translatable molecules can prevent exonucleases from trimming back the polyA tail in the process of de-adenylation.
- Embodiments of this invention provide structures, compositions and methods for translatable molecules.
- Embodiments of this invention can provide translatable molecules containing one or more chemically modified monomers, as well as natural nucleotides, and having increased functional half-life.
- this invention provides pharmaceutical compositions containing a translatable compound and a pharmaceutically acceptable carrier.
- a pharmaceutical composition can be capable of local or systemic administration.
- a pharmaceutical composition can be capable of any modality of administration.
- the administration can be intravenous, subcutaneous, pulmonary, intramuscular, intraperitoneal, dermal, oral, or nasal administration.
- Embodiments of this invention include pharmaceutical compositions containing a translatable compound in a lipid formulation.
- a pharmaceutical composition may comprise one or more lipids selected from cationic lipids, anionic lipids, sterols, pegylated lipids, and any combination of the foregoing.
- a pharmaceutical composition can be any suitable pharmaceutical composition.
- a pharmaceutical composition can include liposomes or nanoparticles.
- lipids and lipid compositions for delivery of an active molecule of this invention are given in WO/2015/074085, which is hereby incorporated by reference in its entirety.
- a pharmaceutical composition can contain an oligomeric compound within a viral or bacterial vector.
- a pharmaceutical composition of this disclosure may include carriers, diluents or excipients as are known in the art. Examples of pharmaceutical compositions and methods are described, for example, in Remington's Pharmaceutical Sciences, Mack Publishing Co. (A.R. Gennaro ed. 1985), and Remington, The Science and Practice of Pharmacy, 21st Edition (2005).
- excipients for a pharmaceutical composition include antioxidants, suspending agents, dispersing agents, preservatives, buffering agents, tonicity agents, and surfactants.
- An effective dose of an agent or pharmaceutical formulation of this invention can be an amount that is sufficient to cause translation of a translatable molecule in a cell.
- a therapeutically effective dose can be an amount of an agent or formulation that is sufficient to cause a therapeutic effect.
- a therapeutically effective dose can be administered in one or more separate administrations, and by different routes.
- a therapeutically effective dose, upon administration, can result in serum levels of an active agent of 1-1000 pg/ml, or 1-1000 ng/ml, or 1-1000 ⁇ g/ml, or more.
- a therapeutically effective dose of an active agent in vivo can be a dose of 0.001-0.01 mg/kg body weight, or 0.01-0.1 mg/kg, or 0.1-1 mg/kg, or 1-10 mg/kg, or 10- 100 mg/kg.
- a therapeutically effective dose of an active agent in vivo can be a dose of 0.001 mg/kg body weight, or 0.01 mg/kg, or 0.1 mg/kg, or 1 mg/kg, or 2 mg/kg, or 3 mg/kg, or 4 mg/kg, or 5 mg/kg, or more.
- the following protocol is for a 200 ul IVT reaction using NEB HiScribe T7 reagents, that should yield about 1 mg of RNA.
- 2.5X NTP mix was prepared as required by thawing individual lOOmM NTP stocks (ATP, GTP, CTP, and UTP nucleotides, or chemically modified counterparts) and pooling them together.
- For the IVT reaction about 2-4 ug of the template was used for a 200 ul reaction.
- the 10X IVT reaction buffer, the 2.5X dNTP mix, the template DNA and the T7 RNA polymerase were mixed well by pipetting and incubated at 37°C for 4 hours.
- the IVT reaction was diluted with 700ul of nuclease-free water and then 10X DNase I buffer and 20ul of the RNase-free DNase I are added to the IVT mix and incubated at 37°C for 15 minutes.
- the diluted (to 1 ml) and DNase treated reaction was then purified by a Qiagen RNeasy Maxi columns as per the manufacturer's instructions with a final elution in RNase-free water.
- the purified RNA was then quantified by UV absorbance where the A260/A280 should be about 1.8-2.2, depending on the
- RNA was denatured at 65°C for 5 minutes and then snap chilled to relieve any secondary conformations.
- RNA For the total 1 ml capping reaction, 1 mg denatured RNA in 700 ul of nuclease-free water was used along with 100 ul (10X) capping buffer, 50 ul (10 mM) GTP, 50 ul (4 mM) SAM, 50 ul of (10 U/ul) Vaccinia capping enzyme and 50 ul of mRNA cap 2'-0-methyltransferase at (50 U/ul) were combined and incubated at 37°C for 1 hour. The resulting capped mRNA was eluted using RNASE free water, re-purified on an RNeasy column, quantified by nanodrop. The mRNA was also visualized on the gel by running 500 ng of the purified product per lane in a denaturing gel after denaturation and snap-chill to remove secondary structures.
- mRNA samples 100 ng were doted on of each mRNA Biodyne® pre-cut modified nylon membrane (Thermo Scientific, Catalog # 77016) (0.45 ⁇ , 8 x 12 cm). The membrane was blocked by incubating 5% non-fat dried milk in TBS-T buffer (50 mM Tris HC1, 150 mM NaCl (pH 7.4) and 0.05% Tween20) for 1 hour, and then was incubated with primary antibody anti ds-RNA mAB J2 (English and Scientific
- Example A Cloning example for templates.
- pIDT-SMART(Kan) (1962 bps, IDT DNA) was modified by point mutations to remove Notl and Mlul restriction sites.
- the resulting plasmid was inserted with a 1226 bp DNA fragment containing the following DNA elements: stuff er DNA + T7 RNA promoter, 5' UTR from Tobacco Etch Virus (TEV), human EPO ORF, sequence containing 3' UTR from Xenopus beta globin (XbG) gene, polyA120, and BspQI restriction enzyme site + T7 terminator + stuffer DNA.
- the resulting parental plasmid (pIDT-SMART-T7-TEV-hEPO-XbG- pA120) had total length of 3188 bps.
- the parental plasmid was used to clone the alternative ORFs.
- TEV 5 'UTR Constructs containing TEV 5 'UTR were constructed as follows.
- the plasmid was linearized with Ncol and Xhol, and the synthesized ORF DNA fragments with Ncol and Xhol site were inserted by T4 DNA ligase.
- the synthesized ORF DNA fragments contained 20-25 bp of plasmid sequences flanking the designed ORFs, and cloned into the same linearized plasmid via a seamless cloning method.
- SynK-cmEPO-XbG plasmid constructs were generated with synthesized DNA fragments containing SynK 5 'UTR and cmEPO ORF with Aflll and Xhol site. These fragments were cloned by T4 DNA ligase into the parental plasmid linearized with Afin and Xhol.
- polyA120 (SEQ ID NO: 6)
- nucleotide T and GC compositions of wildtype protein coding sequences are shown in Table 5.
- Example B Templates and mRNAs for hEPO.
- FIG. 4 shows the results of surprisingly increased human EPO protein production for a translatable molecule of this invention.
- Human EPO ARC-RNA was synthesized using a DNA template having reduced deoxyadenosine nucleotides in an open reading frame of the template strand, as well as reduced complementary
- ARC-RNA was transfected into HEPAl-6 cells using MESSENGERMAX transfection reagents. The cell culture medium was collected 24 hrs after transfection. ELISA was used to detect the protein production with the ARC-RNA (5MeOU) as compared to wild type mRNA with similarly reduced T.
- FIG. 4 shows surprisingly high translational efficiency of the ARC-mRNA (5MeOU) compared to the wild type hEPO mRNA (UTP).
- the ARC-mRNA (5MeOU) exhibited superior expression efficiency at all levels of template T composition as compared to the hEPO mRNA (UTP).
- FIG. 4 shows that ARC-mRNA (5MeOU) products exhibited unexpectedly superior expression efficiency at levels of template T composition of 13- 16%), as compared to either wild type or "reduced T" hEPO mRNA (UTP).
- ARC-mRNA 5MeOU
- ARC-mRNA exhibited unexpectedly superior expression efficiency at 14% template T composition, when codon replacement was done randomly.
- compositions of the templates for hEPO are shown in Table 6.
- Table 6 Non-Template Nucleotide T compositions for hEPO hEPO T%
- Example C Templates and mRNAs for hF9.
- FIG. 5 shows the results of surprisingly increased human F9 protein production for a translatable molecule of this invention.
- Human F9 ARC-RNA was synthesized using a DNA template having reduced deoxyadenosine nucleotides in an open reading frame of the template strand, as well as reduced complementary
- deoxythymidine nucleotides in the non-template strand ("reduced T”).
- the synthesis was also carried out with 5-methoxyuri dines (5MeOU, 100%).
- the ARC-RNA was transfected into HEPA1-6 cells using MESSENGERMAX transfection reagents. The cell culture medium was collected 24 hrs after transfection. ELISA was used to detect the protein production with the ARC-RNA (5MeOU) as compared to wild type mRNA with similarly reduced T.
- FIG. 5 shows surprisingly high translational efficiency of the ARC-mRNA (5MeOU) compared to the wild type hF9 mRNA (UTP).
- FIG. 5 shows that ARC- mRNA (5MeOU) products exhibited surprisingly superior expression efficiency at levels of template T composition of 13-14%.
- the increase of ARC-mRNA (5MeOU) expression efficiency at lower levels of template T composition of 13-14% is
- FIG. 5 shows that the ARC-mRNA (5MeOU) exhibited unexpectedly superior expression efficiency at 14-16% template T composition, when codon replacement was done randomly.
- FIG. 6 shows the results of surprisingly reduced impurity levels in a process for synthesizing an hF9 translatable molecule of this invention.
- FIG. 6 shows the results of a dot blot for detecting double strand RNA impurity in the synthesis mixture (nitro cellulose membrane, J2 antibody to detect dsRNA).
- the ARC-RNA (5MeOU) "reduced T" synthesis products which were translatable for hF9, showed surprisingly reduced dot blot intensity as compared to similar "reduced T" mRNA (UTP) synthesis products.
- UTP "reduced T" mRNA
- the process for synthesizing the ARC-RNA (5MeOU) molecules of this invention with template reduced T composition provided a surprisingly reduced level of double strand RNA impurity. As shown in FIG. 6, this result is surprising because the "reduced T" mRNA (UTP) synthesis products exhibited increased levels of double strand RNA impurity at lower template T composition.
- compositions of the templates for hF9 are shown in Table 7.
- Table 7 Non-Template Nucleotide T compositions for hF9
- ATGCAGCGCGTGAACATGATCATGGCAGAATCACCAGGCCTCATCACCA TCTGCCTTTTAGGATATCTACTCAGTGCTGAATGTACAGTTTTTCTTGATCATGAAAAC GCCAACAAAATTCTGAATCGGCCAAAGAGGTATAATTCAGGTAAATTGGAAGAGTTTGT TCAAGGGAACCTTGAGAGAAAAGTGTAGTTTTGAAGAAGCACGAG AAGTTTTTGAAAACACTGAAAGAACAACTGAATTTTGGAAGCAGTATGTTGATGGAGAT CAGTGTGAGTCCAATCCATGTTTAAATGGCGGCAGTTGCAAGGATGACATTAATTCCTA TGAATGTTGGTGTCCCTTTGGATTTGAAGGAAAGAACTGTGAATTAGATGTAACATGTA ACATTAAGAATGGCAGATGCGAGCAGTTTTGTAAAAATAGTGCTGATAACAAGGTGGTT TGCTCCTGTACTGAGGGATATCGACTTGCAGAAAACCAGAAGTCCTGT
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Gastroenterology & Hepatology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Pharmacology & Pharmacy (AREA)
- Epidemiology (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- Toxicology (AREA)
- Marine Sciences & Fisheries (AREA)
- Endocrinology (AREA)
- Hematology (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Medicinal Preparation (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Priority Applications (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| JP2019546855A JP7674077B2 (ja) | 2017-02-28 | 2018-02-27 | 翻訳可能分子およびその合成 |
| EP18761078.7A EP3589290A4 (en) | 2017-02-28 | 2018-02-27 | Translatable molecules and synthesis thereof |
| JP2022209557A JP2023052106A (ja) | 2017-02-28 | 2022-12-27 | 翻訳可能分子およびその合成 |
| JP2025159744A JP2026016392A (ja) | 2017-02-28 | 2025-09-26 | 翻訳可能分子およびその合成 |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201762465073P | 2017-02-28 | 2017-02-28 | |
| US62/465,073 | 2017-02-28 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2018160592A1 true WO2018160592A1 (en) | 2018-09-07 |
Family
ID=63370513
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2018/020018 Ceased WO2018160592A1 (en) | 2017-02-28 | 2018-02-27 | Translatable molecules and synthesis thereof |
Country Status (4)
| Country | Link |
|---|---|
| US (2) | US11407800B2 (https=) |
| EP (1) | EP3589290A4 (https=) |
| JP (3) | JP7674077B2 (https=) |
| WO (1) | WO2018160592A1 (https=) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110331147A (zh) * | 2019-06-21 | 2019-10-15 | 苏州吉玛基因股份有限公司 | 一种mRNA的制备方法及其在肿瘤治疗中的应用 |
| WO2022073131A1 (en) * | 2020-10-09 | 2022-04-14 | Providence Therapeutics Holdings Inc. | Compositions and methods for the prevention and/or treatment of covid-19 |
| WO2024054020A1 (ko) * | 2022-09-07 | 2024-03-14 | 아이진 주식회사 | 변형핵산 함유 mrna의 체내 전달용 조성물 |
| KR20240035322A (ko) * | 2022-09-07 | 2024-03-15 | 아이진 주식회사 | 변형핵산 함유 mRNA의 체내 전달용 조성물 |
| US11939363B2 (en) | 2017-02-28 | 2024-03-26 | Arcturus Therapeutics, Inc. | Translatable molecules and synthesis thereof |
Families Citing this family (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU2019394996B2 (en) | 2018-12-06 | 2025-11-06 | Arcturus Therapeutics, Inc. | Compositions and methods for treating ornithine transcarbamylase deficiency |
| US12351834B2 (en) | 2020-03-03 | 2025-07-08 | Arcturus Therapeutics, Inc. | Compositions and methods for the treatment of ornithine transcarbamylase deficiency |
| AU2021236068A1 (en) | 2020-03-09 | 2022-10-06 | Arcturus Therapeutics, Inc. | Compositions and methods for inducing immune responses |
| CA3176844A1 (en) | 2020-05-01 | 2021-11-04 | Carlos G. PEREZ-GARCIA | Nucleic acids and methods of treatment for cystic fibrosis |
| EP4196128A4 (en) | 2020-08-14 | 2024-06-12 | Arcturus Therapeutics, Inc. | METHOD FOR FREEZE DILIZATION OF LIPID NANOPARTICLES |
| CN113372432A (zh) * | 2021-06-15 | 2021-09-10 | 深圳市臻质医疗科技有限公司 | 一种基于化学修饰mRNA编码蛋白因子诱导和/或增强软骨损伤修复的方法 |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20090226906A1 (en) * | 2008-03-05 | 2009-09-10 | Helicos Biosciences Corporation | Methods and compositions for reducing nucleotide impurities |
| US7659391B2 (en) * | 2001-11-05 | 2010-02-09 | Janssen Pharmaceutica N.V. | Method for the in vitro synthesis of short double stranded RNAs |
| US20130123481A1 (en) * | 2011-10-03 | 2013-05-16 | modeRNA Therapeutics | Modified nucleosides, nucleotides, and nucleic acids, and uses thereof |
| US8748089B2 (en) * | 2005-08-23 | 2014-06-10 | The Trustees Of The University Of Pennsylvania | RNA containing modified nucleosides and methods of use thereof |
| WO2015124935A1 (en) * | 2014-02-21 | 2015-08-27 | Oxford Nanopore Technologies Limited | Sample preparation method |
Family Cites Families (16)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| ES2340499T3 (es) | 2001-06-05 | 2010-06-04 | Curevac Gmbh | Arnm de antigeno tumoral estabilizado con un contenido de g/c aumentado. |
| US8304529B2 (en) | 2006-07-28 | 2012-11-06 | Life Technologies Corporation | Dinucleotide MRNA cap analogs |
| WO2009058911A2 (en) | 2007-10-31 | 2009-05-07 | Applied Biosystems Inc. | Preparation and isolation of 5' capped mrna |
| US9283287B2 (en) * | 2012-04-02 | 2016-03-15 | Moderna Therapeutics, Inc. | Modified polynucleotides for the production of nuclear proteins |
| US9254311B2 (en) | 2012-04-02 | 2016-02-09 | Moderna Therapeutics, Inc. | Modified polynucleotides for the production of proteins |
| WO2013151665A2 (en) | 2012-04-02 | 2013-10-10 | modeRNA Therapeutics | Modified polynucleotides for the production of proteins associated with human disease |
| KR102121086B1 (ko) * | 2012-11-01 | 2020-06-09 | 팩터 바이오사이언스 인크. | 세포에서 단백질을 발현시키는 방법들과 생성물들 |
| PL2922554T3 (pl) * | 2012-11-26 | 2022-06-20 | Modernatx, Inc. | Na zmodyfikowany na końcach |
| KR102354389B1 (ko) * | 2013-08-21 | 2022-01-20 | 큐어백 아게 | Rna―암호화된 단백질의 발현을 증가시키는 방법 |
| EP3052511A4 (en) | 2013-10-02 | 2017-05-31 | Moderna Therapeutics, Inc. | Polynucleotide molecules and uses thereof |
| JP6506749B2 (ja) | 2013-10-22 | 2019-04-24 | シャイアー ヒューマン ジェネティック セラピーズ インコーポレイテッド | フェニルケトン尿症のためのmRNA療法 |
| AU2015338923B2 (en) * | 2014-11-02 | 2021-10-21 | Arcturus Therapeutics, Inc. | Messenger UNA molecules and uses thereof |
| WO2016077125A1 (en) * | 2014-11-10 | 2016-05-19 | Moderna Therapeutics, Inc. | Alternative nucleic acid molecules containing reduced uracil content and uses thereof |
| WO2016077123A1 (en) * | 2014-11-10 | 2016-05-19 | Moderna Therapeutics, Inc. | Multiparametric nucleic acid optimization |
| WO2017201317A1 (en) * | 2016-05-18 | 2017-11-23 | Modernatx, Inc. | Polyribonucleotides containing reduced uracil content and uses thereof |
| US11407800B2 (en) | 2017-02-28 | 2022-08-09 | Arcturus Therapeutics, Inc. | Translatable molecules and synthesis thereof |
-
2018
- 2018-02-27 US US15/907,123 patent/US11407800B2/en active Active
- 2018-02-27 JP JP2019546855A patent/JP7674077B2/ja active Active
- 2018-02-27 WO PCT/US2018/020018 patent/WO2018160592A1/en not_active Ceased
- 2018-02-27 EP EP18761078.7A patent/EP3589290A4/en active Pending
-
2022
- 2022-07-14 US US17/812,576 patent/US11939363B2/en active Active
- 2022-12-27 JP JP2022209557A patent/JP2023052106A/ja active Pending
-
2025
- 2025-09-26 JP JP2025159744A patent/JP2026016392A/ja active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7659391B2 (en) * | 2001-11-05 | 2010-02-09 | Janssen Pharmaceutica N.V. | Method for the in vitro synthesis of short double stranded RNAs |
| US8748089B2 (en) * | 2005-08-23 | 2014-06-10 | The Trustees Of The University Of Pennsylvania | RNA containing modified nucleosides and methods of use thereof |
| US20090226906A1 (en) * | 2008-03-05 | 2009-09-10 | Helicos Biosciences Corporation | Methods and compositions for reducing nucleotide impurities |
| US20130123481A1 (en) * | 2011-10-03 | 2013-05-16 | modeRNA Therapeutics | Modified nucleosides, nucleotides, and nucleic acids, and uses thereof |
| WO2015124935A1 (en) * | 2014-02-21 | 2015-08-27 | Oxford Nanopore Technologies Limited | Sample preparation method |
Non-Patent Citations (1)
| Title |
|---|
| LI ET AL.: "Effects of Chemically Modified Messenger RNA on Protein Expression", BIOCONJUGATE CHEMISTRY, vol. 27, no. 3, 24 February 2016 (2016-02-24), pages 849 - 853, XP055317909 * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11939363B2 (en) | 2017-02-28 | 2024-03-26 | Arcturus Therapeutics, Inc. | Translatable molecules and synthesis thereof |
| CN110331147A (zh) * | 2019-06-21 | 2019-10-15 | 苏州吉玛基因股份有限公司 | 一种mRNA的制备方法及其在肿瘤治疗中的应用 |
| WO2022073131A1 (en) * | 2020-10-09 | 2022-04-14 | Providence Therapeutics Holdings Inc. | Compositions and methods for the prevention and/or treatment of covid-19 |
| WO2024054020A1 (ko) * | 2022-09-07 | 2024-03-14 | 아이진 주식회사 | 변형핵산 함유 mrna의 체내 전달용 조성물 |
| KR20240035322A (ko) * | 2022-09-07 | 2024-03-15 | 아이진 주식회사 | 변형핵산 함유 mRNA의 체내 전달용 조성물 |
| KR102785258B1 (ko) * | 2022-09-07 | 2025-03-26 | 아이진 주식회사 | 변형핵산 함유 mRNA의 체내 전달용 조성물 |
Also Published As
| Publication number | Publication date |
|---|---|
| JP2023052106A (ja) | 2023-04-11 |
| JP2026016392A (ja) | 2026-02-03 |
| JP7674077B2 (ja) | 2025-05-09 |
| US11407800B2 (en) | 2022-08-09 |
| US20180327471A1 (en) | 2018-11-15 |
| JP2020510426A (ja) | 2020-04-09 |
| US11939363B2 (en) | 2024-03-26 |
| EP3589290A1 (en) | 2020-01-08 |
| EP3589290A4 (en) | 2020-12-30 |
| US20230059111A1 (en) | 2023-02-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11939363B2 (en) | Translatable molecules and synthesis thereof | |
| US10815463B2 (en) | Messenger UNA molecules and uses thereof | |
| US12509698B2 (en) | Synthesis and structure of high potency RNA therapeutics | |
| ES2542015T3 (es) | Ingeniería de sistemas, métodos y composiciones de guía optimizadas para manipulación de secuencias | |
| AU2021206908A1 (en) | Multimeric coding nucleic acid and uses thereof | |
| US12270043B2 (en) | Compositions and methods for targeting, editing, or modifying genes | |
| US20240409956A1 (en) | Engineered cardiac muscle compositions | |
| US20180353622A1 (en) | Gene deletion and rescue by crispr-mediated elimination of exon splicing enhancers | |
| US20240100136A1 (en) | Chimeric adaptor proteins and methods of regulating gene expression | |
| WO2024166035A1 (en) | Regulating gene expression in gamma delta t cell receptors expressing cells | |
| EP4665361A1 (en) | Regulating gene expression in gamma delta t cell receptors expressing cells | |
| HK40059692B (en) | Multimeric coding nucleic acid and uses thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 18761078 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 2019546855 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2018761078 Country of ref document: EP Effective date: 20190930 |