WO2018156372A1 - Animaux non humains génétiquement modifiés et produits associés - Google Patents

Animaux non humains génétiquement modifiés et produits associés Download PDF

Info

Publication number
WO2018156372A1
WO2018156372A1 PCT/US2018/017872 US2018017872W WO2018156372A1 WO 2018156372 A1 WO2018156372 A1 WO 2018156372A1 US 2018017872 W US2018017872 W US 2018017872W WO 2018156372 A1 WO2018156372 A1 WO 2018156372A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
crispr
cas
target
genetically modified
Prior art date
Application number
PCT/US2018/017872
Other languages
English (en)
Inventor
Jacob Ellery CORN
Benjamin Gregory GOWEN
Original Assignee
The Regents Of The University Of California
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The Regents Of The University Of California filed Critical The Regents Of The University Of California
Publication of WO2018156372A1 publication Critical patent/WO2018156372A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00—Rearing or breeding animals, not otherwise provided for; New breeds of animals
    • A01K67/027—New breeds of vertebrates
    • A01K67/0275—Genetically modified vertebrates, e.g. transgenic
    • A01K67/0276—Knockout animals
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70578—NGF-receptor/TNF-receptor superfamily, e.g. CD27, CD30, CD40, CD95
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/001—Oxidoreductases (1.) acting on the CH-CH group of donors (1.3)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1048—Glycosyltransferases (2.4)
    • C12N9/1077—Pentosyltransferases (2.4.2)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1085—Transferases (2.) transferring alkyl or aryl groups other than methyl groups (2.5)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22—Ribonucleases RNAses, DNAses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
    • C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
    • C12N9/64—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue
    • C12N9/6402—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue from non-mammals
    • C12N9/6405—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue from non-mammals not being snakes
    • C12N9/6408—Serine endopeptidases (3.4.21)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y103/00—Oxidoreductases acting on the CH-CH group of donors (1.3)
    • C12Y103/03—Oxidoreductases acting on the CH-CH group of donors (1.3) with oxygen as acceptor (1.3.3)
    • C12Y103/03006—Acyl-CoA oxidase (1.3.3.6)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y204/00—Glycosyltransferases (2.4)
    • C12Y204/02—Pentosyltransferases (2.4.2)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y205/00—Transferases transferring alkyl or aryl groups, other than methyl groups (2.5)
    • C12Y205/01—Transferases transferring alkyl or aryl groups, other than methyl groups (2.5) transferring alkyl or aryl groups, other than methyl groups (2.5.1)
    • C12Y205/01006—Methionine adenosyltransferase (2.5.1.6), i.e. adenosylmethionine synthetase
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y301/00—Hydrolases acting on ester bonds (3.1)
    • C12Y301/03—Phosphoric monoester hydrolases (3.1.3)
    • C12Y301/03048—Protein-tyrosine-phosphatase (3.1.3.48)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y304/00—Hydrolases acting on peptide bonds, i.e. peptidases (3.4)
    • C12Y304/21—Serine endopeptidases (3.4.21)
    • C12Y304/21089—Signal peptidase I (3.4.21.89)
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/07—Animals genetically altered by homologous recombination
    • A01K2217/075—Animals genetically altered by homologous recombination inducing loss of function, i.e. knock out
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00—Animals characterised by species
    • A01K2227/30—Bird
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00—Animals characterised by purpose
    • A01K2267/02—Animal zootechnically ameliorated

Definitions

  • Foie gras is the fattened liver of a goose or duck and is considered a luxury food throughout the world.
  • Foie gras is traditionally produced through the inhumane practice of force-feeding animals, a controversial practice that raises serious animal welfare concerns.
  • the process of force -feeding is also extremely labor-intensive, greatly increasing the cost of production.
  • the present disclosure provides systems and methods of making genetically modified birds that comprise a disruption in one or more target genes, wherein the one or more target genes is a fatty acid metabolism pathway gene, a gene that controls appetite, or a gene that regulates fatty acid storage, wherein the disruption results in development of a fatty liver.
  • the disclosure further provides methods for producing a food product, such as foie gras, using a subject genetically modified bird, as well as food products harvested from a subject genetically modified bird.
  • the present disclosure features a genetically modified bird, wherein the genetically modified bird is genetically modified to comprise a disruption in one or more target genes, wherein the one or more target genes is a: fatty acid metabolism pathway gene; gene that controls appetite; or gene that regulates fatty acid storage, wherein the disruption results in development of a fatty liver.
  • the genetically modified bird is a duck.
  • the genetically modified bird is a goose.
  • the genetically modified bird is a poultry animal.
  • the genetically modified bird is a chicken.
  • the genetically modified bird has a genetic modification that is present in multiple organs.
  • the genetically modified bird has a genetic modification that is liver specific.
  • the genetically modified bird can be genetically modified using CRISPR and Cre/loxP tissue-specific recombination techniques to generate liver-specific modifications.
  • the genetically modified bird is genetically modified to comprise a disruption in one or more target genes, wherein the one or more target genes comprises a nucleotide sequence having at least 80%, at least 90%, at least 95%, at least 98%, at lease 99%, or 100%, nucleotide sequence identity to the nucleotide sequence of a gene selected from: MAT1A (SEQ ID NO:51), ACOX1 (SEQ ID NO:52), LEPR (SEQ ID NO:53), LEP (SEQ ID NO:54), SIRT7 (SEQ ID NO:55), APOIA (SEQ ID NO:56), SIRT1 (SEQ ID NO:57), SIRT3 (SEQ ID NO:58), SIRT4 (SEQ ID NO:59), SIRT5 (SEQ ID NO:60), SIRT6 (SEQ ID NO:61), and P
  • aspects of the present disclosure further feature a method of making a genetically modified bird of the present disclosure.
  • the method generally involves: a) genetically modifying a bird stage X primordial germ cell, wherein genetic modification of bird stage X primordial germ cell comprise a disruption in one or more target genes, wherein the one or more target genes is a fatty acid metabolism pathway gene, a gene that controls appetite, or a gene that regulates fatty acid storage; b) delivering the genetically modified bird stage X primordial germ cell into a recipient embryo; and c) allowing the recipient embryo or artificial embryo to hatch as a chick.
  • the stage X primordial germ cell line of the method is delivered into the recipient embryo by injection.
  • the method generally involves: delivering a CRISPR/Cas plasmid construct to the bird stage X recipient embryo, wherein the CRISPR/Cas plasmid construct causes a disruption in one or more target genes of a recipient stage X embryo, wherein the one or more target genes is a fatty acid metabolism pathway gene, a gene that controls appetite, or a gene that regulates fatty acid storage.
  • the CRISPR/Cas plasmid construct delivered to the bird stage X recipient embryo genetically modifies primordial germ cells within the embryo.
  • the genetic modification of the method is achieved using a Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-Cas system.
  • CRISPR Clustered Regularly Interspaced Short Palindromic Repeats
  • the genetic modification of the method is achieved using a Transcription activator-like effector nucleases (TALENs) system. In yet other embodiments, the genetic modification of the method is achieved using a Zinc Finger Nucleases (ZFNs) system.
  • TALENs Transcription activator-like effector nucleases
  • ZFNs Zinc Finger Nucleases
  • the method generally involves: a) genetically modifying an avian spermatozoa, wherein the genetic modification of the avian spermatozoa comprises a disruption in one or more target genes, wherein the one or more target genes is a fatty acid metabolism pathway gene, a gene that controls appetite, or a gene that regulates fatty acid storage; b) delivering the genetically modified bird spermatozoa to a hen; c) creating a artificial embryo; and d) allowing the artificial embryo to hatch as a chick.
  • the modified bird spermatozoa produced by the method is delivered into a hen by artificial insemination.
  • the genetic modification of the method is achieved using a Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-Cas system.
  • CRISPR Clustered Regularly Interspaced Short Palindromic Repeats
  • the genetic modification of the method is achieved using a TALEN system.
  • the genetic modification of the method is achieved using a ZFN system.
  • the present disclosure further features an isolated organ from a genetically modified bird of the present disclosure.
  • the isolated organ from the genetically modified bird is a liver.
  • the isolated organ from the genetically modified bird is a fatty liver.
  • the isolated organ from the genetically modified bird has greater than: 50 weight percent fat; 40 weight percent fat; or 30 weight percent fat.
  • a food product is produced from the isolated organ of the genetically modified bird.
  • the food product produced from the isolated organ of the genetically modified bird is foie gras.
  • the present disclosure further features a method of producing a food product.
  • the method generally involves harvesting a food product from an organ of a genetically modified bird of the present disclosure.
  • the method generally involves processing a food product harvested from the organ of the genetically modified bird.
  • the method generally involves harvesting an organ from the genetically modified bird; and processing the organ, to produce a food product.
  • the present disclosure further features a method for producing a fatty liver.
  • the method generally involves: feeding a methionine and choline deficient (MCD) diet, a choline -deficient diet (CD), a high-fat containing diet (HFD), or a conjugated linoleic acid (CLA) containing diet to a genetically modified bird of the present disclosure during at least one of a plurality of growth periods; and harvesting the liver from the genetically modified bird.
  • MCD methionine and choline deficient
  • CD choline -deficient diet
  • HFD high-fat containing diet
  • CLA conjugated linoleic acid
  • the method generally involves: feeding a methionine and choline deficient (MCD) diet, a choline-deficient diet (CD), a high-fat containing diet (HFD), or a conjugated linoleic acid (CLA) containing diet to a genetically modified bird of the present disclosure during at least one of a plurality of growth periods; harvesting the liver from the genetically modified bird; and preparing foie gras from the harvested liver.
  • MCD methionine and choline deficient
  • CD choline-deficient diet
  • HFD high-fat containing diet
  • CLA conjugated linoleic acid
  • the composition comprises: a) a first CRISPR/Cas guide RNA, or a nucleic acid comprising a nucleotide sequence encoding the first CRISPR/Cas guide RNA, wherein the first CRISPR/Cas guide RNA comprises a guide sequence having 100% complementarity over 17 or more contiguous nucleotides with a first target sequence present in a target gene, wherein the target gene is a fatty acid metabolism pathway gene, a gene that controls appetite, or a gene that regulates fatty acid storage; and b) a second CRISPR/Cas guide RNA, or a nucleic acid comprising a nucleotide sequence encoding the second CRISPR/Cas guide RNA, wherein the second CRISPR/Cas guide RNA comprises a guide sequence having 100% complementarity over 17 or more contiguous nucleotides with a second target
  • the first target sequence and the second target sequence of the system are separated from each other by at least 25 base pairs.
  • the system comprises: a) CRISPR/Cas guide RNA, or a nucleic acid comprising a nucleotide sequence encoding the CRISPR/Cas guide RNA, wherein the CRISPR/Cas guide RNA comprises a guide sequence having 100% complementarity over 17 or more contiguous nucleotides with a target sequence present in a target gene, wherein the target gene is a fatty acid metabolism pathway gene, a gene that controls appetite, or a gene that regulates fatty acid storage; and b) a donor template DNA, or a nucleic acid comprising a nucleotide sequence encoding the donor template DNA, where the donor template DNA replaces all or a portion of a target gene, resulting in a defect in the target gene.
  • the system comprises: a CRISPR/Cas guide RNA, or a nucleic acid comprising a nucleotide sequence encoding the CRISPR/Cas guide RNA, wherein the CRISPR/Cas guide RNA comprises a guide sequence having 100% complementarity over 17 or more contiguous nucleotides with a target sequence present in a target gene, wherein the target gene is a fatty acid metabolism pathway gene, a gene that controls appetite, or a gene that regulates fatty acid storage; where a class 2 CRISPR/Cas endonuclease introduces a double-stranded break in the target gene that, when repaired, results in a defect in the target gene.
  • the target gene of the system comprises a nucleotide sequence having least 80% nucleotide sequence identity to the nucleotide sequence of a gene selected from: MAT1A (SEQ ID NO:51), ACOX1 (SEQ ID NO:52), LEPR (SEQ ID NO:53), LEP (SEQ ID NO:54), SIRT7 (SEQ ID NO:55), AP01A (SEQ ID NO:56), SIRT1 (SEQ ID NO:57), SIRT3 (SEQ ID NO:58), SIRT4 (SEQ ID NO:59), SIRT5 (SEQ ID NO:60), SIRT6 (SEQ ID NO:61), and PTEN (SEQ ID NO:62).
  • MAT1A SEQ ID NO:51
  • ACOX1 SEQ ID NO:52
  • LEPR SEQ ID NO:53
  • LEP LEP
  • SIRT7 SEQ ID NO:55
  • AP01A SEQ ID NO:56
  • SIRT1 SEQ ID NO:57
  • SIRT3 S
  • the composition of the system further comprises a class 2 CRISPR/Cas endonuclease, or a nucleic acid comprising a nucleotide sequence encoding the class 2 CRISPR/Cas endonuclease.
  • the class 2 CRISPR/Cas endonuclease of the system is a Cas9 protein.
  • the class 2 CRISPR/Cas endonuclease of the system is a Cpfl protein, a C2cl protein, a C2c3 protein, or a C2c2 protein.
  • the class 2 CRISPR /Cas endonuclease is a type V or type VI CRISPR/Cas endonuclease.
  • the first and second CRISPR/Cas guide RNAs of the system are Cas9 CRISPR/Cas guide RNAs.
  • the first and second CRISPR/Cas guide RNAs of the system are single molecule CRISPR/Cas guide RNAs.
  • the first and second CRISPR/Cas guide RNAs of the system are dual molecule CRISPR/Cas guide RNAs.
  • FIG. 1 provides a nucleotide sequence of the MAT1A gene (SEQ ID NO: 51) in Anas
  • FIG. 2 provides a nucleotide sequence of the ACOX1 gene (SEQ ID NO: 52) in Anas
  • FIG. 3 provides a nucleotide sequence of the LEPR gene (SEQ ID NO: 53) in Anas
  • FIG. 4 provides a nucleotide sequence of the LEP gene (SEQ ID NO: 54) in Anas
  • FIG. 5 provides a nucleotide sequence of the SIRT7 gene (SEQ ID NO: 55) in Anas
  • FIG. 6 provides a nucleotide sequence of the APOl A gene (SEQ ID NO: 56) in Anas
  • FIG. 7 provides a nucleotide sequence of the SIRT1 gene (SEQ ID NO: 57) in Anas
  • FIG. 8 provides a nucleotide sequence of the SIRT3 gene (SEQ ID NO: 58) in Anas
  • FIG. 9 provides a nucleotide sequence of the SIRT4 gene (SEQ ID NO: 59) in Anas
  • FIG. 10 provides a nucleotide sequence of the SIRT5 gene (SEQ ID NO: 60) in Anas platyrhynchos.
  • FIG. 11 provides a nucleotide sequence of the SIRT6 gene (SEQ ID NO: 61) in Anas
  • FIG. 12 provides a nucleotide sequence of the PTEN gene (SEQ ID NO: 62) in Anas
  • FIG. 13 provides a guide nucleotide sequence of a CRISPR/Cas guide RNA for the MAT1A gene (SEQ ID NO:63).
  • FIG. 14 provides a guide nucleotide sequence of a CRISPR/Cas guide RNA for the ACOX1 gene (SEQ ID NO:64).
  • FIG. 15 provides a guide nucleotide sequence of a CRISPR/Cas guide RNA for the LEPR gene (SEQ ID NO:65).
  • FIG. 16 provides a guide nucleotide sequence of a CRISPR/Cas guide RNA for the SIRT7 gene (SEQ ID NO:66).
  • FIG. 17 provides a guide nucleotide sequence of a CRISPR/Cas guide RNA for the LEP gene (SEQ ID NO:67).
  • FIG. 18 provides a guide nucleotide sequence of a CRISPR/Cas guide RNA for the SIRT1 gene (SEQ ID NO:68).
  • FIG. 19 provides a guide nucleotide sequence of a CRISPR/Cas guide RNA for the SIRT3 gene (SEQ ID NO:69).
  • FIG. 20 provides a guide nucleotide sequence of a CRISPR/Cas guide RNA for the SIRT4 gene (SEQ ID NO:70).
  • FIG. 21 provides a guide nucleotide sequence of a CRISPR/Cas guide RNA for the SIRT5 gene (SEQ ID NO:71).
  • FIG. 22 provides a guide nucleotide sequence of a CRISPR/Cas guide RNA for the SIRT6 gene (SEQ ID NO:72).
  • FIG. 23 provides a guide nucleotide sequence of a CRISPR/Cas guide RNA for the PTEN gene (SEQ ID NO:73).
  • FIG. 24 provides a guide nucleotide sequence of a CRISPR/Cas guide RNA for the APOIA gene (SEQ ID NO:74).
  • FIG. 25 illustrates a schematic of liver-specific knockout of target genes using CRISPR/Cas9 gene editing tool for delivery of LoxP sequences to flank target genes and create a genetically modified bird with floxed LoxP sites.
  • the genetically modified bird is intercrossed with a transgenic bird expressing Albumin-Cre (Alb-Cre; Cre recombinase operably linked to an albumin promoter) in the liver to create a genetically modified bird lacking the target genes.
  • Albumin-Cre Albumin-Cre
  • Cre recombinase operably linked to an albumin promoter
  • FIG. 26A provides a table (Table 2) showing nucleic acids comprising nucleotide sequences encoding CRISPR/Cas single guide RNAs #1-4 for each target gene MATIA (SEQ ID NOs: 87- 90), ACOXl (SEQ ID NOs: 91-94), SIRT7 (SEQ ID NOs: 95-98), LEPR(SEQ ID NOs: 99-102), and LEP (SEQ ID NOs: 103-106).
  • Table 2 showing nucleic acids comprising nucleotide sequences encoding CRISPR/Cas single guide RNAs #1-4 for each target gene MATIA (SEQ ID NOs: 87- 90), ACOXl (SEQ ID NOs: 91-94), SIRT7 (SEQ ID NOs: 95-98), LEPR(SEQ ID NOs: 99-102), and LEP (SEQ ID NOs: 103-106).
  • 26B provides a table (Table 3) showing a guide nucleotide sequences of a CRISPR/Cas guide RNA for each of the MATIA (SEQ ID NOs: 107- 108, 63, 109), ACOXl (SEQ ID NOs: 110-113), SIRT7 (SEQ ID NOs: 114-116, 66), LEPR (SEQ ID NOs: 117-120), and LEP (SEQ ID NOs: 121-124) target genes.
  • Table 3 showing a guide nucleotide sequences of a CRISPR/Cas guide RNA for each of the MATIA (SEQ ID NOs: 107- 108, 63, 109), ACOXl (SEQ ID NOs: 110-113), SIRT7 (SEQ ID NOs: 114-116, 66), LEPR (SEQ ID NOs: 117-120), and LEP (SEQ ID NOs: 121-124) target genes.
  • FIG. 27 provides a plot showing the percentage of INDELs (i.e. insertions or deletions), denoted as " edited", of the target gene MATIA for each of the CRISPR/Cas9 single guide RNAs 1-4.
  • FIG. 28 provides a plot showing the percentage of INDELs (i.e. insertions or deletions), denoted as " edited", of the target gene ACOXl at exon 8 for each of the CRISPR/Cas9 single guide RNAs 1-2.
  • FIG. 29 provides a plot showing the percentage of INDELs (i.e. insertions or deletions), denoted as " edited", of the target gene ACOXl at exon 9 for each of the CRISPR/Cas9 single guide RNAs 3-4.
  • FIG. 30 provides a plot showing the percentage of INDELs (i.e. insertions or deletions), denoted as " edited", of the target gene SIRT7 for each of the CRISPR/Cas9 single guide RNAs 1-4.
  • FIG. 31 provides a plot showing the percentage of INDELs (i.e. insertions or deletions), denoted as " edited", of the target gene LEPR for each of the CRISPR/Cas9 single guide RNAs 1-4.
  • FIG. 32 provides a plot showing t the percentage of INDELs (i.e. insertions or deletions),
  • FIG. 33A-33C provide Tables 4-6.
  • FIG. 33A provides a table (Table 4) showing assembly oligonucleotide primer sequences containing T7 promoter, variable single guide RNA guide sequence, and the first 15 nt of the non-variable region of the sgRNA for each of the MATIA (SEQ ID NOs.125-128), ACOXl (SEQ ID NOs.129-132), LEPR (SEQ ID NOs.133-136), SIRT7 (SEQ ID NOs.137-140), and LEP (SEQ ID NOs.141-144) target genes.
  • FIG. 4 shows assembly oligonucleotide primer sequences containing T7 promoter, variable single guide RNA guide sequence, and the first 15 nt of the non-variable region of the sgRNA for each of the MATIA (SEQ ID NOs.125-128), ACOXl (SEQ ID NOs.129-132), LEPR (SEQ ID NOs.133-136), SIRT7 (
  • FIG. 33B provides a table (Table 5) showing genotyping forward and reverse primers of single guide RNAs 1-4 for each of the MATIA (Forward: SEQ ID NO: 145, Reverse: SEQ ID NO: 151), ACOXl (Forward: SEQ ID NOs: 146-147, Reverse: SEQ ID NO: 152-153), LEPR(Forward: SEQ ID NO: 148, Reverse: SEQ ID NO: 154), SIRT7(Forward: SEQ ID NO: 149, Reverse: SEQ ID NO: 155), and LEP (Forward: SEQ ID NO: 150, Reverse: SEQ ID NO: 156) target genes.
  • FIG. 33C provides a table (Table 6) showing primers used for sgRNA template synthesis:
  • T7RevLong SEQ ID NO: 157
  • T7FwdAmp SEQ ID NO: 158
  • T7RevAmp SEQ ID NO: 159
  • polynucleotide and nucleic acid refer to a polymeric form of nucleotides of any length, either ribonucleotides or deoxynucleotides. Thus, this term includes, but is not limited to, single-, double-, or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA -RNA hybrids, or a polymer comprising purine and pyrimidine bases or other natural, chemically or biochemically modified, non-natural, or derivatized nucleotide bases.
  • polynucleotide and “nucleic acid” should be understood to include single-stranded and double-stranded polynucleotides.
  • peptide refers to a polymeric form of amino acids of any length, which can include coded and/or non-coded amino acids, chemically or biochemically modified or derivatized amino acids, and polypeptides having modified peptide backbones.
  • nucleic acid refers to a nucleic acid, protein, cell, or organism that is found in nature.
  • a polypeptide or polynucleotide sequence that is present in an organism that can be isolated from a source in nature and which has not been intentionally modified by a human in the laboratory is naturally occurring.
  • cleavage domain or “active domain” or “nuclease domain” of a nuclease it is meant the polypeptide sequence or domain within the nuclease which possesses the catalytic activity for nucleic acid cleavage.
  • a cleavage domain can be contained in a single polypeptide chain or cleavage activity can result from the association of two (or more) polypeptides.
  • a single nuclease domain may consist of more than one isolated stretch of amino acids within a given polypeptide (e.g., RuvCI, RuvCII, and RuvCIII of a Cas9 protein can form a RuvC domain).
  • isolated is meant to describe a polynucleotide, a polypeptide, or a cell that is in an environment different from that in which the polynucleotide, the polypeptide, or the cell naturally occurs.
  • An isolated genetically modified host cell may be present in a mixed population of genetically modified host cells.
  • Heterologous means a nucleotide or polypeptide sequence that is not found in the native nucleic acid or protein, respectively (at least not at that particular position, e.g., see below).
  • the heterologous nucleic acid (and/or the CRISPR/Cas target sequence) is heterologous to the genome because the sequence is present nowhere in the genome except for where the nucleic acid has integrated.
  • the heterologous nucleic acid (and/or the CRISPR/Cas target sequence) is heterologous in the sense that it is found elsewhere in the genome, but is not normally present at the position the nucleic acid has (or will be) integrated.
  • exogenous nucleic acid refers to a nucleic acid that is not normally or naturally found in and/or produced by a given organism or cell in nature.
  • endogenous nucleic acid refers to a nucleic acid that is normally found in and/or produced by a given bacterium, organism, or cell in nature.
  • An “endogenous nucleic acid” is also referred to as a “native nucleic acid” or a nucleic acid that is “native” to a given organism or cell.
  • Recombinant means that a particular nucleic acid (DNA or RNA) or protein is the product of various combinations of cloning, restriction, and/or ligation steps resulting in a construct having a sequence (e.g., structural, coding, or non-coding sequence) that is distinguishable from endogenous nucleic acids or proteins found in natural systems.
  • DNA sequences can be assembled from cDNA fragments and short oligonucleotide linkers, or from a series of synthetic oligonucleotides, to provide a synthetic nucleic acid which is capable of being expressed from a recombinant transcriptional unit contained in a cell or in a cell-free
  • sequences can be provided in the form of an open reading frame uninterrupted by internal non-translated sequences, or introns, which are typically present in eukaryotic genes.
  • Genomic DNA comprising the relevant sequences can also be used in the formation of a recombinant gene or transcriptional unit. Sequences of non-translated DNA may be present 5' or 3' from the open reading frame, where such sequences do not interfere with manipulation or expression of the coding regions, and may indeed act to modulate production of a desired product by various mechanisms (see “DNA regulatory sequences", below).
  • the term "recombinant" polynucleotide or “recombinant” nucleic acid refers to one which is not naturally occurring, e.g., is made by the artificial combination of two otherwise separated segments of sequence through human intervention.
  • This artificial combination is often accomplished by either chemical synthesis means, or by the artificial manipulation of isolated segments of nucleic acids, e.g., by genetic engineering techniques. Such is usually done to replace a codon with a redundant codon encoding the same or a conservative amino acid, while typically introducing or removing a sequence recognition site. In some cases, it is performed to join together nucleic acid segments of desired functions to generate a desired combination of functions.
  • This artificial combination is often accomplished by either chemical synthesis means, or by the artificial manipulation of isolated segments of nucleic acids, e.g., by genetic engineering techniques.
  • the term "recombinant" polypeptide refers to a polypeptide which is not naturally occurring, e.g., is made by the artificial combination of two otherwise separated segments of amino sequence through human intervention.
  • a polypeptide that comprises a heterologous amino acid sequence is recombinant.
  • construct or "vector” is meant a recombinant nucleic acid, generally recombinant DNA, which has been generated for the purpose of the expression and/or propagation of a nucleotide sequence(s) of interest, or is to be used in the construction of other recombinant nucleotide sequences.
  • DNA regulatory sequences refer to transcriptional (e.g., transcription control elements) and translational control sequences, such as promoters, enhancers, polyadenylation signals, terminators, protein degradation signals, and the like, that provide for and/or regulate transcription of a non-coding sequence (e.g., DNA-targeting RNA) or a coding sequence (e.g., site -directed modifying polypeptide, or CasSVCsnl polypeptide) and/or regulate translation of an encoded polypeptide.
  • transcriptional e.g., transcription control elements
  • translational control sequences such as promoters, enhancers, polyadenylation signals, terminators, protein degradation signals, and the like
  • a non-coding sequence e.g., DNA-targeting RNA
  • a coding sequence e.g., site -directed modifying polypeptide, or CasSVCsnl polypeptide
  • a promoter is operably linked to a nucleotide sequence (e.g., a protein coding sequence, e.g., a sequence encoding an mRNA; a non protein coding sequence, e.g., a sequence encoding a non-coding RNA (ncRNA) such as a Cas9 guide RNA, a targeter RNA, an activator RNA; and the like) if the promoter affects its transcription and/or expression.
  • ncRNA non-coding RNA
  • the relationship can also be referred to in the reverse and retain the same meaning.
  • a nucleotide sequence of interest can be said to be operably linked to a promoter.
  • heterologous promoter and “heterologous control regions” refer to promoters and other control regions that are not normally associated with a particular nucleic acid in nature.
  • a “transcriptional control region heterologous to a coding region” is a transcriptional control region that is not normally associated with the coding region in nature.
  • a "host cell,” as used herein, denotes an in vivo, ex vivo, or in vitro eukaryotic cell (e.g., an avian cell), a eukaryotic cell present in a multicellular organism, or a cell of a multicellular organism (e.g., a cell line) cultured as a unicellular entity, which eukaryotic cells can be, or have been, used as recipients for a nucleic acid (e.g., an expression vector that comprises a nucleotide sequence of interest), and include the progeny of the original cell which has been genetically modified by the nucleic acid.
  • a nucleic acid e.g., an expression vector that comprises a nucleotide sequence of interest
  • a “recombinant host cell” (also referred to as a “genetically modified host cell”) is a host cell into which has been introduced a heterologous nucleic acid, e.g., an expression vector.
  • a eukaryotic host cell is a genetically modified eukaryotic host cell, by virtue of introduction into a suitable eukaryotic host cell of a heterologous nucleic acid, e.g., an exogenous nucleic acid that is foreign to the eukaryotic host cell, or a recombinant nucleic acid that is not normally found in the eukaryotic host cell.
  • a heterologous nucleic acid e.g., an exogenous nucleic acid that is foreign to the eukaryotic host cell, or a recombinant nucleic acid that is not normally found in the eukaryotic host cell.
  • a polynucleotide or polypeptide has a certain percent "sequence identity" to another
  • polynucleotide or polypeptide meaning that, when aligned, that percentage of bases or amino acids are the same, and in the same relative position, when comparing the two sequences.
  • Sequence similarity can be determined in a number of different manners. To determine sequence identity, sequences can be aligned using the methods and computer programs, including BLAST, available over the World Wide Web at ncbi.nlm.nih.gov/BLAST. See, e.g., Altschul et al.
  • Binding refers to a non-covalent interaction between macromolecules (e.g., between a protein and a nucleic acid). While in a state of non-covalent interaction, the macromolecules are said to be “associated” or “interacting” or “binding” (e.g., when a molecule X is said to interact with a molecule Y, it is meant the molecule X binds to molecule Y in a non-covalent manner).
  • Binding interactions can generally be characterized by a dissociation constant (Kd), e.g., of less than 10 6 M, less than 10 7 M, less than 10 s M, less than 10 9 M, less than 10 10 M, less than 10 11 M, less than 10 12 M, less than 10 13 M, less than 10 14 M, or less than 10 15 M.
  • Kd dissociation constant
  • Affinity refers to the strength of binding, increased binding affinity being correlated with a lower Kd.
  • binding domain it is meant a protein domain that is able to bind non-covalently to another molecule.
  • a binding domain can bind to, for example, a DNA molecule (a DNA-binding protein), an RNA molecule (an RNA-binding protein) and/or a protein molecule (a protein- binding protein).
  • a protein domain-binding protein it can bind to itself (to form homodimers, homotrimers, etc.) and/or it can bind to one or more molecules of a different protein or proteins.
  • a "vector” or "expression vector” is a replicon, such as plasmid, phage, virus, or cosmid, to which another DNA segment, i.e. an "insert”, may be attached so as to bring about the replication of the attached segment in a cell.
  • An "expression cassette” comprises a DNA coding sequence operably linked to a promoter.
  • operably linked refers to a juxtaposition wherein the components so described are in a relationship permitting them to function in their intended manner.
  • a promoter is operably linked to a coding sequence (or the coding sequence can also be said to be operably linked to the promoter) if the promoter affects its transcription or expression.
  • recombinant expression vector or "DNA construct” are used interchangeably herein to refer to a DNA molecule comprising a vector and one insert.
  • Recombinant expression vectors are usually generated for the purpose of expressing and/or propagating the insert(s), or for the construction of other recombinant nucleotide sequences.
  • the insert(s) may or may not be operably linked to a promoter sequence and may or may not be operably linked to DNA regulatory sequences.
  • a cell has been "genetically modified” or “transformed” or “transfected” by exogenous DNA, e.g. a recombinant expression vector, when such DNA has been introduced inside the cell.
  • exogenous DNA e.g. a recombinant expression vector
  • the presence of the exogenous DNA results in permanent or transient genetic change.
  • the transforming DNA may or may not be integrated (covalently linked) into the genome of the cell.
  • the transforming DNA may be maintained on an episomal element such as a plasmid.
  • a stably transformed cell is one in which the transforming DNA has become integrated into a chromosome so that it is inherited by daughter cells through chromosome replication.
  • a "clone” is a population of cells derived from a single cell or common ancestor by mitosis.
  • a "cell line” is a clone of a primary cell that is capable of stable growth in vitro for many generations.
  • Suitable methods of genetic modification include e.g., viral or bacteriophage infection, transfection, conjugation, protoplast fusion, lipofection,
  • a suitable method of delivering a nucleic acid is via ribonucleoprotein (RNP) -mediated genetic modification.
  • RNP ribonucleoprotein
  • cleavage it is meant the breakage of the covalent backbone of a target nucleic acid
  • RNA e.g., DNA
  • Cleavage can be initiated by a variety of methods including, but not limited to, enzymatic or chemical hydrolysis of a phosphodiester bond. Both single-stranded cleavage and double-stranded cleavage are possible, and double-stranded cleavage can occur as a result of two distinct single-stranded cleavage events.
  • a complex comprising a CRISPR/Cas protein (e.g., a Cas9 protein) and a corresponding guide RNA is used for targeted cleavage of a double stranded DNA (dsDNA), e.g., induction of a double-stranded DNA break (DSB).
  • dsDNA double stranded DNA
  • DSB double-stranded DNA break
  • a "genome editing endonuclease” is an endonuclease that can be used for the editing of a cell's genome (e.g., by cleaving at a targeted location within the cell's genomic DNA).
  • genome editing endonucleases include but are not limited to, CRISPR/Cas endonucleases (which can in some cases cleave both strands of a target double stranded DNA (dsDNA), and in some cases are nickases, which cleave only one strand of a target dsDNA).
  • CRISPR/Cas endonucleases which can in some cases cleave both strands of a target double stranded DNA (dsDNA), and in some cases are nickases, which cleave only one strand of a target dsDNA).
  • CRISPR/Cas endonucleases include class 2 CRISPR/Cas endonucleases such as: (a) type II CRISPR/Cas proteins, e.g., a Cas9 protein; (b) type V CRISPR/Cas proteins, e.g., a Cpfl polypeptide, a C2cl polypeptide, a C2c3 polypeptide, and the like; and (c) type VI CRISPR/Cas proteins, e.g., a C2c2 polypeptide.
  • type II CRISPR/Cas proteins e.g., a Cas9 protein
  • type V CRISPR/Cas proteins e.g., a Cpfl polypeptide, a C2cl polypeptide, a C2c3 polypeptide, and the like
  • type VI CRISPR/Cas proteins e.g., a C2c2 polypeptide.
  • cleavage domain or “active domain” or “nuclease domain” of a nuclease it is meant the polypeptide sequence or domain within the nuclease which possesses the catalytic activity for nucleic acid cleavage.
  • a cleavage domain can be contained in a single polypeptide chain or cleavage activity can result from the association of two (or more) polypeptides.
  • a single nuclease domain may consist of more than one isolated stretch of amino acids within a given polypeptide.
  • a "host cell” or "target cell” as used herein denotes an in vivo or in vitro avian cell that can be, or have been, used as recipients for a genome targeting composition (e.g., a system of the present disclosure), and include the progeny of the original cell (e.g., when the cell has been transformed by the nucleic acid, or when the cells genome has been modified by the genome targeting composition). It is understood that the progeny of a single cell may not necessarily be completely identical in morphology or in genomic or total DNA complement as the original parent, due to natural, accidental, or deliberate mutation.
  • a “recombinant host cell” (also referred to as a “genetically modified host cell”) is a host cell into which has been introduced an exogenous a nucleic acid, e.g., an exogenous expression vector.
  • an avian host cell can be a genetically modified avian host cell (e.g., an avian germ cell), by virtue of introduction into a suitable avian host cell of an exogenous nucleic acid.
  • stem cell is used herein to refer to a cell (e.g., an avid stem cell) that has the ability both to self-renew and to generate a differentiated cell type (see Morrison et al. (1997) Cell 88:287-298).
  • Stem cells of interest include pluripotent stem cells (PSCs).
  • PSCs pluripotent stem cells
  • the term "pluripotent stem cell” or “PSC” is used herein to mean a stem cell capable of producing all cell types of the organism. Therefore, a PSC can give rise to cells of all germ layers of the organism (e.g., the endoderm, mesoderm, and ectoderm of a vertebrate). Pluripotent cells are capable of forming teratomas and of contributing to ectoderm, mesoderm, or endoderm tissues in a living organism.
  • avian refers to any species, subspecies or race of organism of the taxonomic Class Aves, such as, but not limited to, such organisms as chicken, turkey, duck, goose, quail, pheasants, parrots, finches, hawks, crows and ratites including ostrich, emu and cassowary.
  • the term includes the various known strains of Gallus gallus (chickens), for example, White Leghorn, Brown Leghorn, Barred-Rock, London, New Hampshire, Rhode Island,
  • a "genetically modified avian” or “transgenic avian” refers to any avian in which one or more of the cells of the avian contains heterologous nucleic acid introduced by way of human intervention.
  • the present disclosure provides systems and methods of making genetically modified birds that comprise a disruption in one or more target genes, wherein the one or more target genes is a fatty acid metabolism pathway gene, a gene that controls appetite, or a gene that regulates fatty acid storage, wherein the disruption results in development of a fatty liver.
  • the disclosure further provides methods for producing a food product, such as foie gras, using a subject genetically modified bird, as well as food products harvested from a subject genetically modified bird.
  • the present disclosure provides a system for generating a genetically modified bird, wherein the genetically modified bird is genetically modified to comprise a disruption in one or more target genes, wherein the one or more target genes is a fatty acid metabolism pathway gene, gene that controls appetite, or a gene that regulates fatty acid storage, wherein the disruption results in development of a fatty liver. Also provided in the present disclosure are methods of producing such genetically modified bird and methods of producing a food product from an isolated organ of the genetically modified bird.
  • the present disclosure provides a genetically modified bird.
  • a genetically modified bird of the present disclosure is genetically modified to comprise a disruption in one or more target genes.
  • Target genes include: a) a fatty acid metabolism pathway gene; b) a gene that controls appetite; and c) a gene that regulates fatty acid storage. Disruption of the one or more target genes results in development of a fatty liver. Disruption of the one or more target genes can result in more rapid weight gain than in a corresponding bird not comprising the genetic modification.
  • the genetically modified bird is a duck. In some cases, the genetically modified bird is a goose. In some cases, the genetically modified bird is a chicken.
  • the genetic modification is present in multiple organs. In some cases, the genetic modification is present only in the liver.
  • a suitable target comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100%, nucleotide sequence identity to the nucleotide sequence of a gene selected from: MAT1A (SEQ ID NO:51), ACOX1 (SEQ ID NO:52), LEPR (SEQ ID NO:53), LEP (SEQ ID NO:54), SIRT7 (SEQ ID NO:55), APOIA (SEQ ID NO:56), SIRT1 (SEQ ID NO:57), SIRT3 (SEQ ID NO:58), SIRT4 (SEQ ID NO:59), SIRT5 (SEQ ID NO:60), SIRT6 (SEQ ID NO:61), and PTEN (SEQ ID NO:62).
  • MAT1A SEQ ID NO:51
  • ACOX1 SEQ ID NO:52
  • LEPR SEQ ID NO:53
  • LEP SEQ ID NO:54
  • SIRT7 SEQ ID NO
  • the genetically modified bird is a duck. Since the major location of lipogenesis in birds is the liver, ducks are widely known to be used for unnatural production of fatty livers through force-feeding.
  • the duck is a Cairina mochata.
  • the duck is a mule duck.
  • the mule duck is a hybrid of a Muscovy drake and a female duck Anas platyrhnychos .
  • the genetically modified bird is a goose.
  • the goose is the grey Landaise goose Anser anser.
  • the genetically modified bird is a chicken.
  • the genetic modification is present in multiple organs. In other cases, the genetic modification is target organ specific. In some cases, the genetic modification is liver specific.
  • the genetic modification is achieved using gene editing tools well known to one of ordinary skill in the art.
  • the genetic modification is achieved using a Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-Cas system.
  • CRISPR Clustered Regularly Interspaced Short Palindromic Repeats
  • the CRISPR/Cas system has been recognized and adapted to be utilized as a powerful, programmable gene editing tool within numerous organisms.
  • CRISPR/Cas nuclease as well as a short stretch of RNA containing genomic targeting information (e.g., an approximately 20 bp sequence) and a structural component to associate with CRISPR/Cas nuclease itself, allow for the precise placement of a double-stranded or single-stranded break (DSB or SSB) at a desired location(s) within a genome of interest.
  • genomic targeting information e.g., an approximately 20 bp sequence
  • SSB single-stranded break
  • TALENs are fusions of the Fokl restriction endonuclease cleavage domain with a DNA-binding transcription activator-like effector (TALE) repeat array.
  • TALE transcription activator-like effector
  • TALENs can be engineered to specifically bind and cleave a desired target DNA sequence, which is useful for the manipulation of nucleic acid molecules, genes, and genomes in vitro and in vivo. TALENs are thus useful in the generation of genetically engineered cells, tissues, and organisms.
  • the use of TALENs for generation of genetically modified organisms is well known in the art, for example, in US Patent No.
  • the genetic modification is achieved using ZFNs.
  • ZFNs are site-specific
  • the genetically modified bird is genetically modified to comprise a disruption in one or more target genes, wherein the one or more target genes comprises a nucleotide sequence having at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, or 100%, nucleotide sequence identity to the nucleotide sequence of a gene selected from: Methionine
  • adenosyltransferaselA (MAT1A) (SEQ ID NO:51), Acyl-coenzyme A oxidase (ACOX1) (SEQ ID NO:52), Leptin receptor (LEPR) (SEQ ID NO:53), Leptin (LEP) (SEQ ID NO:54), Sirtuin7 (SIRT7) (SEQ ID NO:55), Apoliporotein A-I (APOIA) (SEQ ID NO:56), Sirtuinl (SIRTl) (SEQ ID NO:57), Sirtuin3 (SIRT3) (SEQ ID NO:58), Sirtuin4 (SIRT4) (SEQ ID NO:59), Sirtuin5 (SIRT5) (SEQ ID NO:60), Sirtuin6 (SIRT6) (SEQ ID NO:61), and Phosphatase and tensin homolog (PTEN) (SEQ ID NO:62).
  • APOIA Apolipo
  • the genetically modified bird is genetically modified to comprise a
  • the one or more target genes comprise a nucleotide sequence having at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, or 100%, nucleotide sequence identity to the nucleotide sequence of a gene selected from:
  • the disruption causes a whole organism knockout of the one or more target genes.
  • the genetically modified bird is genetically modified to comprise a
  • the disruption causes a liver-specific knockout of the one or more target genes.
  • the genetically modified bird is genetically modified using Cre/loxP tissue-specific recombination and CRISPR techniques to generate liver-specific modifications.
  • the genetically modified bird is genetically modified to comprise a disruption of one or more target genes, wherein the target genes cause a disruption in lipid metabolism.
  • Target genes that cause a disruption in lipid metabolism are well known in the art, such target genes can include but are not limited to: MAT1A (SEQ ID NO:51), ACOX1 (SEQ ID NO:52), LEPR (SEQ ID NO:53), LEP (SEQ ID NO:54), SIRT7 (SEQ ID NO:55), APOIA (SEQ ID NO:56), SIRTl (SEQ ID NO:57), SIRT3 (SEQ ID NO:58), SIRT4 (SEQ ID NO:59), SIRT5 (SEQ ID NO:60), SIRT6 (SEQ ID NO:61), and PTEN (SEQ ID NO:62).
  • the genetically modified bird is genetically modified to comprise a disruption of one or more target genes, wherein the target genes cause a disruption in regulating appetite control.
  • Target genes that cause a disruption in regulating appetite control are well known in the art, such target genes can include but are not limited to: LEPR (SEQ ID NO:53) and LEP (SEQ ID NO:54).
  • a genetically modified bird of the present disclosure provides for a genetically modified bird with a fatty liver.
  • the liver of a genetically modified bird of the present disclosure can comprise at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 2-fold, at least 5-fold, at least 10-fold, at least 25 -fold, at least 50-fold, at least 100-fold, or more than 100-fold, higher fat content than the liver of a control bird not comprising the genetic modification(s) (target gene disruption).
  • disruption of the one or more target genes can result in more rapid weight gain than in a corresponding bird not comprising the genetic modification (target gene disruption).
  • disruption of the one or more target genes can result in a rate of weight increase that is at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 40%, or at least 50%, faster than the rate of weight increase by a control bird not comprising the genetic modification(s).
  • the present disclosure relates to a system and method for generating a genetically
  • the method for generating a genetically modified bird comprises genetically modifying a bird stage X primordial germ cell, wherein genetic modification of bird stage X primordial germ cell comprise a disruption of one or more target genes, wherein the one or more target genes is a fatty acid metabolism pathway gene, a gene that controls appetite, or a gene that regulates fatty acid storage; delivering the genetically modified bird stage X primordial germ cell into a recipient embryo, and allowing the recipient embryo to hatch as a chick.
  • the genetic modification is achieved using a Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-CAS system.
  • CRISPR Clustered Regularly Interspaced Short Palindromic Repeats
  • the genetic modification is achieved using TALENs.
  • the genetic modification is achieved using a ZFNs system.
  • the present disclosure also includes a method for generating a genetically modified bird comprising: delivering a CRISPR/Cas plasmid construct to a recipient bird stage X embryo, wherein delivery of the CRISPR/Cas plasmid comprises a disruption of one or more target genes of a stage X primordial germ cell in the recipient stage X embryo, wherein the one or more target genes is a fatty acid metabolism pathway gene, a gene that controls appetite, or a gene that regulates fatty acid storage; and allowing the recipient embryo to hatch as a chick.
  • aspects of the present disclosure relates to a system for generating a genetically
  • the composition comprising: a) a first CRISPR/Cas guide RNA, or a nucleic acid comprising a nucleotide sequence encoding the first CRISPR/Cas guide RNA, wherein the first CRISPR/Cas guide RNA comprises a guide sequence having 100% complementarity over 17 or more contiguous nucleotides with a first target sequence present in a target gene, wherein the target gene is a fatty acid metabolism pathway gene, a gene that controls appetite, or a gene that regulates fatty acid storage; and b) a second CRISPR/Cas guide RNA, or a nucleic acid comprising a nucleotide sequence encoding the second CRISPR/Cas guide RNA, wherein the second CRISPR/Cas guide RNA comprises a guide sequence having 100% complementarity over 17 or more contiguous nucleotides with a second target sequence in the target gene, wherein the second target sequence is 3' of the first target sequence.
  • the composition further comprises a class 2 CRISPR/Cas endonuclease, or a nucleic acid comprising a nucleotide sequence encoding the class 2 CRISPR/Cas endonuclease.
  • a CRISPR/Cas endonuclease and one or more CRISPR/Cas guide RNAs are placed in a CRISPR/Cas plasmid construct.
  • the plasmid will contain a first CRISPR/Cas guide RNA comprising a first guide sequence.
  • the plasmid will contain a second CRISPR/Cas guide RNA comprising a second guide sequence.
  • a cell is transfected with a CRISPR/Cas plasmid.
  • the guide sequence has 100% complementarity over 17 or more contiguous nucleotides with a target sequence present in a target gene, wherein the target gene is a fatty acid metabolism pathway gene, a gene that controls appetite, or a gene that regulates fatty acid storage.
  • the plasmid will contain CRISPR/Cas guide RNAs comprising single molecule CRISPR/Cas guide RNAs.
  • the CRISPR/CAS endonuclease and one or more CRISPR/Cas guide RNAs will cause a frame shift mutation to disrupt the target sequence of the target gene.
  • the plasmid will contain CRISPR/Cas guide RNAs comprising dual molecule CRISPR/Cas guide RNAs. In some cases, the CRISPR/CAS endonuclease and one or more CRISPR/CAS guide RNAs will cause a deletion of the target sequence of the target gene. In some cases, the plasmid will contain a CRISPR/Cas endonuclease, one or more CRISPR/CAS guide RNAs, and a donor sequence, where the donor sequence will replace the disrupted target sequence of the target gene.
  • the CRISPR/Cas endonuclease is a class 2 CRISPR/Cas endonuclease, or a nucleic acid comprising a nucleotide sequence encoding the class 2 CRISPR/Cas
  • the class 2 CRISPR/Cas endonuclease is a type V or type VI CRISPR/Cas endonuclease. In some cases, the class 2 CRISPR/Cas endonuclease is a Cpfl protein, a C2cl protein, a C2c3 protein, or a C2c2 protein.
  • the first and second CRISPR/Cas guide RNAs are Cas9 CRISPR/Cas guide RNAs. In some cases, the first and second CRISPR/Cas guide RNAs are single molecule CRISPR Cas guide RNAs. In some cases, the first and second CRISPR/Cas guide RNAs are dual molecule CRISPR/Cas guide RNAs.
  • RNAs that would be suitable in the disruption of one or more target genes in the present disclosure.
  • suitable guide sequences of the CRISPR Cas guide RNAs include, but are not limited to: caaugugucuaauugcaucu (SEQ ID NO:63), aauaccagcauuggcagucc (SEQ ID NO:64), gcagccacacugagcagcca (SEQ ID NO:65), augcucauaugggugagcgu (SEQ ID NO:66), cuccugcagcucuucccgcu (SEQ ID NO:67), agcgaugaagucauagccaa (SEQ ID NO:68), aagaagccacucacccugca (SEQ ID NO:69),
  • uucucagaucuuugacccgc (SEQ ID NO:72), agaggcuugaaggaguguac (SEQ ID NO:73), ccaccaggucccugaggcgg (SEQ ID NO: 74), aggaaugguguugcucugug (SEQ ID NO: 107), gaucacaucucaugccauug (SEQ ID NO: 108), cgagaugcaauuagacacau (SEQ ID NO: 109), gucugauaauccaaaaucug (SEQ ID NO: 110), gcauacgcuguugccagaag (SEQ ID NO: 111), gacugccaaugcugguauug (SEQ ID NO: 112), cgaauggccugugggca (SEQ ID NO: 113), gcuucgaucccagacuaccg (SEQ ID NO: 114), gcaauguccaaaugccauug (SEQ ID
  • the genetically modified bird is genetically modified to comprise a
  • the disruption causes a liver-specific knockout of the one or more target genes.
  • the disruption of liver- specific knockout of the one or more target genes comprises deletion of the one or more target genes using a Cre/loxP tissue-specific recombination system.
  • the Cre/loxP system is based on promoter-mediated expression of the bacteriophage PI Cre recombinase (or a modified version of the PI Cre recombinase) to delete regions of target genes flanked by loxP sites.
  • the recognition sequence for a Cre recombinase is loxP, which is a 34 base pair sequence comprised of two 13 base pair inverted repeats and an 8 bp core sequence, serves as the recombinase binding sites. See e.g. Sauer, B., Current Opinion in Biotechnology 5:521-527 (1994).
  • the loxP-Cre system utilizes the expression of the PI phage Cre
  • site-specific recombination may be employed to inactivate endogenous genes in a spatially or time controlled manner. See, e.g., U.S. Pat. Nos. 6,080,576, 5,434,066, and
  • cre-lox system an approach based on the ability of transgenic mice, carrying the bacteriophage Cre gene, to promote recombination between, for example, 34 by repeats termed loxP sites, allows ablation of a given gene in a tissue specific and a developmentally regulated manner (Orban et al. (1992) PNAS 89:6861- 6865).
  • the Cre-lox system has been successfully applied for tissue-specific transgene expression (Orban et al. Proc Natl Acad Sci U S A.
  • the genetically modified bird is genetically modified through flanking the target gene with two loxP sites.
  • two loxP sequences are inserted at specific sites on either side of one or more target genes using the CRISPR/Cas gene editing tool.
  • the genetically modified bird comprising two loxP sites one either side of the target gene is intercrossed with a transgenic bird comprising a gene encoding a Cre recombinase driven by a liver-specific promoter/enhancer.
  • the offspring of the genetically modified bird and the transgenic bird comprise a disruption of liver-specific knockout of the one or more target genes.
  • the liver-specific knockout of the one or more target genes of the offspring comprises a deletion of the one or more target genes.
  • the Cre partial cleavage of the two loxP sites will result in the liver-specific knockout of the target genes.
  • liver-specific promoters are known in the art, and any suitable liver-specific promoter can be used to drive expression of a Cre recombinase.
  • suitable liver-specific promoters include, e.g., an alpha- 1 antitrypsin promoter, a transthyretin promoter, an albumin promoter, a thyroxine-binding globulin promoter, a phosphoenol pyruvate carboxykinase promoter, an apolipoprotein H promoter, a lecithin cholesterol acetyl transferase promoter, and the like.
  • sequence-specific, e.g. genome editing, endonucleases include, but are not limited to, ZFNs, meganucleases, TALEN fusion proteins, Cre/LoxP recombinase, and CRISPR/Cas endonucleases (e.g. class 2 CRISPR/Cas endonucleases such as a type II, type V, or type VI CRISPR/Cas endonucleases).
  • a sequence-specific genome editing endonuclease includes a ZFN or a TALEN.
  • one or more TALEN protein(s) that bind to a target site in one or more target genes is introduced into a cell such that the TALEN proteins(s) is expressed and the one or more target genes are cleaved.
  • said gene cleavage results in functional disruption and/or deletion of the targeted gene.
  • the one or more target genes is a fatty acid metabolism pathway gene, a gene that controls appetite, or a gene that regulates fatty acid storage.
  • cleavage of the targeted DNA is followed by non-homologous end joining (NHEJ) where small insertions or deletions (indels) are inserted at the site of cleavage, where the indels cause functional disruption through introduction of non-specific mutations at the cleavage location.
  • NHEJ non-homologous end joining
  • Indels small insertions or deletions
  • one or more ZFNs is introduced into a cell, where the one or more ZFNs comprise a DNA -binding domain and a DNA -cleaving domain.
  • the DNA-cleaving domain is a nuclease domain of Fokl.
  • one or more ZFNs that bind to a target site in one or more target genes is introduced into a cell such that the ZFN protein(s) is expressed and the one or more target genes are cleaved.
  • the one or more target genes is a fatty acid metabolism pathway gene, a gene that controls appetite, or a gene that regulates fatty acid storage.
  • the one or more ZFNs make a double stranded break in the target site in the one or more target genes.
  • cleavage of the targeted DNA is followed by NHEJ where small insertions or deletions (indels) are inserted at the site of cleavage, where the indels cause functional disruption through introduction of non-specific mutations at the cleavage location.
  • Indels small insertions or deletions
  • the present disclosure further provides a method of making a genetically modified bird of the present disclosure, the method comprising: a) genetically modifying a bird stage X primordial germ cell, wherein genetic modification of bird stage X primordial germ cell comprises a disruption in one or more target genes, wherein the one or more target genes is a fatty acid metabolism pathway gene, a gene that controls appetite, or a gene that regulates fatty acid storage; b) delivering the genetically modified bird stage X primordial germ cell to into a recipient embryo; and c) allowing the recipient embryo or artificial embryo to hatch as a chick.
  • the genetically modified stage X primordial germ cell line is delivered into the recipient embryo by injection.
  • the genetically modified stage X primordial germ cell line injected into the recipient embryo at the time of primordial germ cell migration at approximately Stages 12-17. In some cases, the genetically modified stage X primordial germ cell line is injected into the recipient embryo at Stages 13-14.
  • the genetic modification comprises delivering a CRISPR/Cas plasmid construct into a stage X recipient embryo at the time of primordial germ cell migration.
  • the primordial germ cell migration occurs at approximately Stages 12-17.
  • the genetically modified Stage X recipient embryo is injected into the recipient embryo at Stages 12-17.
  • the genetically modified Stage X recipient embryo is injected into the recipient embryo at Stages 13-14.
  • the genetic modification comprises transfection of primordial stage X bird cells with the CRISPR/Cas plasmid construct.
  • the genetic modification of primordial stage X bird cells with the CRISPR/Cas plasmid construct includes a transfection reagent.
  • a suitable transfection reagent includes, but is not limited to: Lipofectamine 2000CD (Thermo Fisher).
  • genetically modified bird stage X primordial germ cells or the CRISPR/Cas plasmid construct are delivered into early stage X bird recipient embryos.
  • freshly laid eggs are obtained and placed in a temperature controlled, humidified incubator.
  • the embryonic blastodisc in the egg is gradually rotated to lie on top of the yolk. This may be accomplished by any method known in the art, such as by gently rocking the egg regularly, in some cases every 15 minutes.
  • the genetically modified bird stage X primordial cells, or the CRISPR/Cas plasmid construct may be delivered by any method known in the art for delivering compositions to the inside of an egg (See, e.g.
  • the CRISPR/Cas plasmid construct is injected into the circulatory system of the early stage X bird recipient embryos.
  • the genetically modified bird stage X primordial germ cells or the CRISPR/Cas plasmid construct are injected into a blood vessel of a bird embryo.
  • a window is opened in the shell, the genetically modified bird stage X primordial germ cells are injected through the window and the shell window is closed.
  • the eggs are incubated until hatching.
  • the eggs are incubated at a temperature sufficient for the embryo to develop into a chick.
  • the eggs will hatch after approximately 20 days, depending upon the particular avian species from which they are obtained. In some cases, hatched chicks are raised to sexual maturity and mated.
  • the genetically modified offspring of the founder animals may be identified by any method known in the art, such as Southern blot, PCR and expression analysis.
  • the genetically modified bird stages X primordial germ cells, or
  • CRISPR/Cas plasmid construct are injected into the embryo in the eggshell in which the embryo is developed. While the germ cells that are genetically modified in the bird may be embryonic germ cells, in some cases the cells are primordial germ cells.
  • the genetically modified bird is a chicken.
  • the germline in chickens is initiated as cells from the epiblast of a Stage X embryo ingress into the nascent hypoblast. As the hypoblast progresses anteriorly, the pre-primordial germ cells are swept forward into the germinal crescent where they can be identified as large glycogen laden cells. The earliest identification of cells in the germline by these morphological criteria is
  • the primordial germ cells reside in the germinal crescent from Stage 4 until they migrate through the vasculature during Stage 12-17. At this time, the primordial germ cells are a small population of about 200 cells. From the vasculature, the primordial germ cells migrate into the genital ridge and are incorporated into the ovary or testes as the gonad differentiates.
  • Germline chimeric chickens have been generated previously by transplantation of donor primordial germ cells and gonadal germ cells from various developmental stages (blastoderm to day 20 embryo) into recipient embryos. Methods of obtaining transgenic chickens from long- term cultures of avian primordial germ cells have also been described, for example, in US Patent Application 20060206952. When combined with a host avian embryo by known procedures, those modified primordial germ cells are transmitted through the germline to yield genetically modified offspring. [00118] In some cases, the method of the present disclosure involves direct injection of genetically modified primordial stage X bird cells into a bird embryo to make a genetically modified bird. Thus, the methods of the disclosure may be used to inject genetically modified bird germ cells including primordial germ cells and embryonic germ cells.
  • the method of making the genetically modified bird comprises:
  • genetically modifying an avian spermatozoa wherein the genetic modification of the avian spermatozoa comprises a) a disruption in one or more target genes, wherein the one or more target genes is a fatty acid metabolism pathway gene, a gene that controls appetite, or a gene that regulates fatty acid storage; b) delivering the genetically modified bird spermatozoa to a hen; c) creating a artificial embryo; and d) allowing the artificial embryo to hatch as a chick.
  • the one or more target genes comprises a nucleotide sequence having least 80% or at least 90% nucleotide sequence identity to the nucleotide sequence of a gene selected from: MAT1A (SEQ ID NO:51), ACOX1 (SEQ ID NO:52), LEPR (SEQ ID NO:53), LEP (SEQ ID NO:54), SIRT7 (SEQ ID NO:55), APOIA (SEQ ID NO:56), SIRT1 (SEQ ID NO:57), SIRT3 (SEQ ID NO:58), SIRT4 (SEQ ID NO:59), SIRT5 (SEQ ID NO:60), SIRT6 (SEQ ID NO:61), and PTEN (SEQ ID NO:62).
  • MAT1A SEQ ID NO:51
  • ACOX1 SEQ ID NO:52
  • LEPR SEQ ID NO:53
  • LEP LEP
  • SIRT7 SEQ ID NO:55
  • APOIA SEQ ID NO:56
  • SIRT1 SEQ ID NO:57
  • genetically modified birds are created using sperm transfection assisted gene editing (STAGE).
  • STAGE sperm transfection assisted gene editing
  • Examples of using STAGE as a delivery mechanism for gene editing constructs is known in the art, for example, in Cooper et al., 2016 (Cooper A. et al., 2016, "Generation of gene edited birds in one generation using sperm transfection assisted gene editing (STAGE)", Transgenic Research (2016), pp. 1-17).
  • the genetic modification of avian spermatozoa comprises transfection of avian spermatozoa with the CRISPR/Cas plasmid construct.
  • the CRISPR/Cas plasmid construct is transfected into the sperm cytosol of the spermatozoa.
  • the genetic modification of avian spermatozoa comprises transfection of avian spermatozoa with the CRISPR/Cas plasmid construct and a transfection reagent.
  • a transfection reagents suitable for transfection in the present application.
  • transfection reagent includes, but is not limited to: Lipofectamine 2000CD (Thermo Fisher).
  • the genetically modified avian spermatozoa will be placed into female recipient birds using a syringe.
  • the genetically modified avian spermatozoa will be delivered into the cloaca of the female bird recipient.
  • insemination is performed at 3-7 day intervals. Following insemination, an artificial embryo is created. It is known to one of ordinary skill in the art that genome activation and active transcription in a chick embryo occurs after the embryo has reached stage X and contained more than 20,000 cells.
  • the artificial embryo contains the CRISPR/Cas endonuclease and one or more CRISPR/Cas guide RNAs for disruption of target genes after the embryo has reached stage X.
  • the embryo containing the CRISPR/Cas endonuclease and one or more CRISPR/Cas guide RNAs will target fatty acid metabolism genes, genes that regulate appetite, or genes that regulate fatty acid storage.
  • the embryo from the recipient bird is collected and stored at a desired temperature and desired time until the artificial embryo is hatched, thereby producing a chick.
  • the genetically modified bird is produced after 1 generation. In other cases, the genetically modified bird is produced after 2 generations.
  • the genetically modified birds of the disclosure are genetically modified with a composition comprising a) a first CRISPR/Cas guide RNA, or a nucleic acid comprising a nucleotide sequence encoding the first CRISPR/Cas guide RNA, wherein the first CRISPR/Cas guide RNA comprises a guide sequence having 100% complementarity over 17 or more contiguous nucleotides with a first target sequence present in a target gene, wherein the target gene is a fatty acid metabolism pathway gene, a gene that controls appetite, or a gene that regulates fatty acid storage; and b) a second CRISPR/Cas guide RNA, or a nucleic acid comprising a nucleotide sequence encoding the second CRISPR/Cas guide RNA, wherein the second CRISPR/Cas guide RNA comprises a guide sequence having 100% complementarity over 17 or more contiguous nucleotides with a second target sequence in the target
  • the first target sequence and the second target sequence are identical to each other.
  • the target gene comprises a nucleotide sequence of a gene selected from: MAT1A (SEQ ID NO:51), ACOX1 (SEQ ID NO:52), LEPR (SEQ ID NO:53), LEP (SEQ ID NO:54), SIRT7 (SEQ ID NO:55), APOIA (SEQ ID NO:56), SIRT1 (SEQ ID NO:57), SIRT3 (SEQ ID NO:58), SIRT4 (SEQ ID NO:59), SIRT5 (SEQ ID NO:60), SIRT6 (SEQ ID NO:61), and PTEN (SEQ ID NO:62)
  • the composition further comprises a class 2 CRISPR/Cas endonuclease, or a nucleic acid comprising a nucleotide sequence encoding the class 2 CRISPR/Cas endonuclease.
  • the class 2 CRISPR/Cas endonuclease is a Cas9 protein. In other embodiments, the class 2 CRISPR /Cas endonuclease is a type V or type VI CRISPR/Cas endonuclease. In some embodiments, the class 2 CRISPR/Cas endonuclease is a Cpf 1 protein, a C2cl protein, a C2c3 protein, or a C2c2 protein.
  • the system comprises: a) CRISPR/Cas guide RNA, or a nucleic acid comprising a nucleotide sequence encoding the CRISPR/Cas guide RNA, wherein the
  • CRISPR/Cas guide RNA comprises a guide sequence having 100% complementarity over 17 or more contiguous nucleotides with a target sequence present in a target gene, wherein the target gene is a fatty acid metabolism pathway gene, a gene that controls appetite, or a gene that regulates fatty acid storage; and b) a donor template DNA, or a nucleic acid comprising a nucleotide sequence encoding the donor template DNA, where the donor template DNA replaces all or a portion of a target gene, resulting in a defect in the target gene.
  • the system comprises: a CRISPR/Cas guide RNA, or a nucleic acid comprising a nucleotide sequence encoding the CRISPR/Cas guide RNA, wherein the CRISPR/Cas guide RNA comprises a guide sequence having 100% complementarity over 17 or more contiguous nucleotides with a target sequence present in a target gene, wherein the target gene is a fatty acid metabolism pathway gene, a gene that controls appetite, or a gene that regulates fatty acid storage; where a class 2 CRISPR/Cas endonuclease introduces a double-stranded break in the target gene that, when repaired, results in a defect in the target gene.
  • the first and second CRISPR/Cas guide RNAs are Cas9 CRISPR/Cas guide RNAs.
  • the first and second CRISPR/Cas guide RNAs are single molecule CRISPR/Cas guide RNAs.
  • the first and second CRISPR/Cas guide RNAs are dual molecule CRISPR/Cas guide RNAs.
  • Suitable guide sequences of first and second CRISPR/Cas guide RNAs e.g., a Cas9 guide RNA
  • suitable guide sequences of first and second CRISPR/Cas (e.g. a Cas9 guide RNA) guide RNAs that may be used in the present disclosure include, but are not limited to:
  • caaugugucuaauugcaucu (SEQ ID NO:63), aauaccagcauuggcagucc (SEQ ID NO:64), gcagccacacugagcagcca (SEQ ID NO:65), augcucauaugggugagcgu (SEQ ID NO:66), cuccugcagcucuucccgcu (SEQ ID NO:67), agcgaugaagucauagccaa (SEQ ID NO:68), aagaagccacucacccugca (SEQ ID NO:69), cuccucccaccagcccaaca (SEQ ID NO:70),
  • aaagaagcagcagcuuugcu (SEQ ID NO:71), uucucagaucuuugacccgc (SEQ ID NO:72), agaggcuugaaggaguguac (SEQ ID NO:73), ccaccaggucccugaggcgg (SEQ ID NO: 74), aggaaugguguugcucugug (SEQ ID NO: 107), gaucacaucucaugccauug (SEQ ID NO: 108), cgagaugcaauuagacacau (SEQ ID NO: 109), gucugauaauccaaaaucug (SEQ ID NO: 110), gcauacgcuguugccagaag (SEQ ID NO: 111), gacugccaaugcugguauug (SEQ ID NO: 112), cgaauggccugugggca (SEQ ID NO: 113), gcuucgaucccagacuaccg (SEQ
  • nucleotide sequences encoding CRISPR/Cas e.g. a first Cas9 guide RNA and/or a second Cas9 guide RNA
  • aataccagcattggcagtcc SEQ ID NO:76
  • gcagccacactgagcagcca SEQ ID NO:77
  • ctcctgcagctcttcccgct SEQ ID NO:79
  • Atgggcttgactgacatcaa (SEQ ID NO: 102), aaaaactacgggcggatgcg (SEQ ID NO: 103),
  • Atcccccgagccgcgcgcgctga (SEQ ID NO: 104), catccccgagccgcgcgctg (SEQ ID NO: 105), tgagccgaaccctcagcgcg (SEQ ID NO: 106).
  • a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene MATIA comprises at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to the nucleotide sequence aggaatggtgttgctctgtg (SEQ ID NO: 87).
  • a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene MATIA comprises at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to the nucleotide sequence gatcacatctcatgccattg (SEQ ID NO:88).
  • a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene MATIA comprises at least 90% sequence identity to the nucleotide sequence caatgtgtctaattgcatct (SEQ ID NO:89). In some cases, a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene MATIA comprises at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to the nucleotide sequence cgagatgcaattagacacat (SEQ ID NO:90).
  • a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene ACOX1 comprises at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to the nucleotide sequence aataccagcattggcagtcc (SEQ ID NO:76).
  • a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene ACOX1 comprises at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to the nucleotide sequence gtctgataatccaaaatctg (SEQ ID NO:91).
  • a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene ACOX1 comprises at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to the nucleotide sequence gcatacgctgttgccagaag (SEQ ID NO:92).
  • a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene ACOX1 comprises at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to the nucleotide sequence gactgccaatgctggtattg (SEQ ID NO:93).
  • a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene ACOX1 comprises at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to the nucleotide sequence cgaatggcctgtggtgggca (SEQ ID NO:94).
  • a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene SIRT7 comprises at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to the nucleotide sequence gcttcgatcccagactaccg (SEQ ID NO:95).
  • a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene SIRT7 comprises at least 90% sequence identity to the nucleotide sequence gcaatgtccaaatgccattg (SEQ ID NO:96).
  • a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene SIRT7 comprises at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to the nucleotide sequence atttggacattgctgcagaa (SEQ ID NO:97). In some cases, a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene SIRT7 comprises at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to the nucleotide sequence atgctcatatgggtgagcgt (SEQ ID NO:98).
  • a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene LEPR comprises at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to the nucleotide sequence gcagccacactgagcagcca (SEQ ID NO:77).
  • a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene LEPR comprises at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to the nucleotide sequence gcagttacactgagcagcca (SEQ ID NO:99).
  • a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene LEPR comprises at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to the nucleotide sequence gtgtggttgagtcttgggga (SEQ ID NO: 100).
  • a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene LEPR comprises at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to the nucleotide sequence tcaaccacacttacgtcatg (SEQ ID NO: 101).
  • a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene LEPR comprises at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to the nucleotide sequence atgggcttgactgacatcaa (SEQ ID NO: 102).
  • a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene LEP comprises at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to the nucleotide sequence ctcctgcagctcttcccgct (SEQ ID NO:79).
  • a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene LEP comprises at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to the nucleotide sequence aaaaactacgggcggatgcg (SEQ ID NO: 103).
  • a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene LEP comprises at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to the nucleotide sequence atccccgagccgcgcgctga (SEQ ID NO: 104).
  • a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene LEP comprises at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to the nucleotide sequence catccccgagccgcgcgctg (SEQ ID NO: 105).
  • a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene LEP comprises at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to the nucleotide sequence
  • a target gene can have at least 80%, at least 90%, at least 95%, at least 98%, at least
  • nucleotide sequence identity to the nucleotide sequence of a gene selected from: MAT1A (SEQ ID NO:51), ACOX1 (SEQ ID NO:52), LEPR (SEQ ID NO:53), LEP (SEQ ID NO:54), SIRT7 (SEQ ID NO:55), APOIA (SEQ ID NO:56), SIRT1 (SEQ ID NO:57), SIRT3 (SEQ ID NO:58), SIRT4 (SEQ ID NO:59), SIRT5 (SEQ ID NO:60), SIRT6 (SEQ ID NO:61), and PTEN (SEQ ID NO:62).
  • a CRISPR/Cas protein (also referred to herein as a CRISPR/Cas endonuclease) interacts with (binds to) a corresponding guide RNA to form a ribonucleoprotein (RNP) complex (referred to herein as a CRISPR/Cas complex) that is targeted to a particular site (a target sequence) in a target genome via base pairing between the guide RNA and a target sequence within the target genome.
  • RNP ribonucleoprotein
  • a guide RNA includes (i) a nucleotide sequence (a guide sequence) that is complementary to a sequence (the target site) of a target DNA and (ii) a protein-binding region that includes a double stranded RNA (dsRNA) duplex and bind to a corresponding CRISPR/Cas protein.
  • the guide RNA can be readily modified in order to target any desired sequence within a target genome (by modifying the guide sequence).
  • a wild type CRISPR/Cas protein e.g., a Cas9 protein
  • a target nucleic acid e.g., a double stranded DNA (dsDNA)
  • dsDNA double stranded DNA
  • CRISPR/Cas protein includes wild type CRISPR/Cas proteins, and also variant CRISPR/Cas proteins, e.g., CRISPR/Cas proteins with one or more mutations in a catalytic domain rendering the protein a nickase.
  • a heterologous nucleic acid is integrated into the genome of a cell (e.g., any prokaryotic or eukaryotic cell).
  • a heterologous nucleic acid can be any desired length.
  • the heterologous nucleic acid has a length in a range of from 17 to 40 nucleotides (nt) (e.g., 17 to 30, 17 to 25, 17 to 22, 17 to 20, 18 to 40, 18 to 30, 18 to 25, 18 to 22, 18 to 20, 19 to 40, 19 to 30, 19 to 25, 19 to 22, 19 to 20, 20 to 40, 20 to 35, 20 to 30, or 20 to 25 nt).
  • the heterologous nucleic acid is 17 to 25 nucleotides in length. In some cases, the heterologous nucleic acid is 17 nt in length. In some cases, the heterologous nucleic acid is 18 nt in length. In some cases, the heterologous nucleic acid is 19 nt in length. In some cases, the heterologous nucleic acid is 20 nt in length. In some cases, the heterologous nucleic acid is 18 nt in length. In some cases, the heterologous nucleic acid is 23 nt in length. As noted above, the term "heterologous" is a relative term.
  • the heterologous nucleic acid is heterologous to the genome because the sequence is present nowhere in the genome except for where the nucleic acid has integrated.
  • the heterologous nucleic acid is heterologous in the sense that it is found elsewhere in the genome, but is not normally present at the position the nucleic acid has integrated (i.e., it is heterologous to the position at which it is integrated)(i.e., the sequence is not present at that position in the genome in the parent cell that was used to produce the genetically modified cell.
  • a nucleic acid that is integrated into the genome at one or more positions includes a CRISPR/Cas target sequence.
  • two or more nucleic acids (having the same CRISPR/Cas target sequence) (3 or more, 4 or more, 5 or more, 6 or more, etc.) are integrated into two or more different positions within the same locus (e.g., flanking a nucleotide sequence encoding a protein and/or an RNA, or a transcription control element).
  • two or more (3 or more, 4 or more, 5 or more, 6 or more, etc.) nucleic acids (having the same CRISPR/Cas target sequence) are integrated into two or more different loci (e.g., into nucleotide sequences that encode two different proteins).
  • at least two of the two or more positions are within 1 kilobase (1 kb) of one another.
  • locus refers to a position (which position can be particular base pair location, or can be a range of from one base pair to another) within a genome of interest.
  • a locus can be a particular base pair position (as an illustrative example - base pair 10,324 of human chromosome 14 would be a particular base pair position).
  • a locus can be a range of base pair positions, e.g., the position in the genome that codes a particular protein or RNA that is transcribed (as an illustrative example, the Wnt3A locus is a protein-coding locus that is transcribed and encodes the Wnt3A protein).
  • protein-coding locus or RNA -coding locus generally includes the transcriptional control sequences that influence transcription of the locus.
  • protein-coding locus not only refers to the nucleotide sequences that have an open reading frame (ORF) and directly encode the protein, but also the promoter, the 5' UTR, the 3' UTR, etc.
  • a heterologous nucleic acid when integrated into a protein-coding locus, it will be understood that the purpose is to integrate a CRISPR/Cas target sequence for later recognition by a CRISPR/Cas complex, and that editing a promoter of a protein-coding sequence can in some cases accomplish the same goal as editing the protein-coding sequence itself (e.g., when the goal is to cleave at the CRISPR/Cas target sequence in order to reduce expression of the protein encoding by the locus).
  • a target DNA e.g., genomic DNA
  • a CRISP/Cas protein e.g., Cas9
  • target site e.g., genomic DNA
  • CRISPR/Cas target site or CRISPR/Cas target sequence
  • a target DNA e.g., genomic DNA of a cell
  • CRISPR/Cas guide RNA can bind, allowing cleave of the target DNA by the CRISPR/Cas endonuclease.
  • the strand of the target DNA that is complementary to and hybridizes with the CRISPR/Cas guide RNA is referred to as the "complementary strand” or the “target strand' and the strand of the target DNA that is complementary to the "complementary strand” (and is therefore not complementary to the guide RNA) is referred to as the "non- complementary strand” or “non-target strand.”
  • the target sequence is the sequence to which the guide sequence of a subject CRISPR/Cas guide RNA (e.g., a Cas9 guide RNA) will hybridize.
  • the target site (or target sequence) 5'-GAGCAUAUC-3' within a target nucleic acid is targeted by (or is bound by, or hybridizes with, or is complementary to) the sequence 5'-GAUAUGCUC-3'.
  • Suitable hybridization conditions include physiological conditions normally present in a cell.
  • a target sequence can be any desired length and in some cases can depend upon the type of CRISPR/Cas guide RNA and CRISPR/Cas protein that will be used to target the target sequence.
  • the CRISPR/Cas target sequence has a length in a range of from 17 to 40 nucleotides (nt) (e.g., 17 to 30, 17 to 25, 17 to 22, 17 to 20, 18 to 40, 18 to 30, 18 to 25, 18 to 22, 18 to 20, 19 to 40, 19 to 30, 19 to 25, 19 to 22, 19 to 20, 20 to 40, 20 to 35, 20 to 30, or 20 to 25 nt).
  • the CRISPR/Cas target sequence is 17 to 25 nucleotides in length.
  • the CRISPR/Cas target sequence is 17 nt in length. In some cases, the CRISPR/Cas target sequence is 18 nt in length. In some cases, the CRISPR/Cas target sequence is 19 nt in length. In some cases, the CRISPR/Cas target sequence is 20 nt in length.
  • a feature that renders the target sequence functional is that it is adjacent to a protospacer adjacent motif (PAM), also referred to as a "PAM sequence.”
  • PAM protospacer adjacent motif
  • the CRISPR/Cas target sequence is adjacent to a PAM.
  • the PAM can be present at that position in the genome prior to the integration (e.g., the nucleic acid can be integrated such that the CRISPR/Cas target sequence is inserted next to the PAM that was already present in the genome.
  • the PAM is not present at the desired position in the genome, and the PAM is instead present on the nucleic acid to be integrated.
  • a heterologous nucleic acid would therefore include the CRISPR/Cas target sequence adjacent to a PAM sequence, and both the CRISPR/Cas target sequence and the PAM would be integrated into the genome.
  • a wild type CRISPR/Cas protein e.g., Cas9 protein
  • Cas9 protein normally has
  • nuclease activity that cleaves a target nucleic acid (e.g., a double stranded DNA (dsDNA)) at a target site defined by the region of complementarity between the guide sequence of the guide RNA and the target nucleic acid.
  • a target nucleic acid e.g., a double stranded DNA (dsDNA)
  • site-specific targeting to the target nucleic acid occurs at locations determined by both (i) base-pairing complementarity between the guide nucleic acid and the target nucleic acid; and (ii) a short motif referred to as the "protospacer adjacent motif (PAM) in the target nucleic acid.
  • PAM protospacer adjacent motif
  • the PAM sequence that is recognized (bound) by the Cas9 polypeptide is present on the non-complementary strand (the strand that does not hybridize with the targeting segment of the guide nucleic acid) of the target DNA.
  • a PAM sequence has a length in a range of from 1 nt to 15 nt (e.g., 1 nt to 14 nt, 1 nt to 13 nt, 1 nt to 12 nt, 1 nt to 11 nt, 1 nt to 10 nt, 1 nt to 9 nt, 1 nt to 9 nt, 1 nt to 8 nt, 1 nt to 7 nt, 1 nt to 6 nt, 1 nt to 5 nt, 1 nt to 4 nt, 1 nt to 3 nt, 2 nt to 15 nt, 2 nt to 14 nt, 2 nt to 13 nt, 2 nt to 12 nt, 2 nt to 11 nt, 2 nt to 10 nt, 2 nt to 9 nt, 2 nt to 8 nt, 2 nt to 7 nt, 2
  • CRISRPR/Cas e.g., Cas9 proteins from different species can have different PAM
  • the PAM sequence is NRG because the S. pyogenes Cas9 PAM (PAM sequence) is NAG or NGG (or NRG where "R" is A or G).
  • PAM sequence for 5.
  • pyogenes Cas9 is: NGG, NAG, AGG, CGG, GGG, TGG, AAG, CAG, GAG, and TAG.
  • the PAM sequence is on the 5' end of the target sequence. In some cases, the PAM sequence is on the 3' end of the target sequence. In some embodiments (e.g., when a Cas9 protein is derived from the Cas9 protein of Neisseria meningitidis or a closely related Cas9 is used), the PAM sequence (e.g., of a target nucleic acid) can be 5 ' -NNNNGANN-3 ' , 5 ' -NNNNGTTN-3 ' , 5'- NNNNGNNT-3' , 5 ' -NNNNGTNN-3 ' , 5 ' -NNNNGNTN-3 ' , or 5 ' -NNNNGATT-3 ' , where N is any nucleotide.
  • the PAM sequence (e.g., of a target nucleic acid) can be 5'-NNAGAA-3', 5'-NNAGGA-3', 5'-NNGGAA-3', 5'-NNANAA-3', or 5'- NNGGGA-3' where N is any nucleotide.
  • the PAM sequence (e.g., of a target nucleic acid) can be 5'-NAAAAN-3', 5'-NAAAAC-3', 5'-NAAANC-3', 5'-NANAAC-3', or 5'-NNAAAC-3' , where N is any nucleotide.
  • additional PAM sequences for other Cas9 polypeptides can readily be determined using bioinformatic analysis (e.g., analysis of genomic sequencing data). See Esvelt et al., Nat Methods. 2013 Nov;10(l l): 1116-21, for additional information.
  • RNA-guided endonucleases include, but are not limited to,
  • CRISPR/Cas endonucleases e.g., class 2 CRISPR/Cas endonucleases such as a type II, type V, or type VI CRISPR/Cas endonucleases.
  • a suitable RNA-guided endonuclease is a class 2 CRISPR/Cas endonuclease.
  • a suitable RNA-guided endonuclease is a class 2 type II CRISPR/Cas endonuclease (e.g., a Cas9 protein).
  • a suitable RNA- guided endonuclease is a class 2 type V CRISPR/Cas endonuclease (e.g., a Cpfl protein, a C2cl protein, or a C2c3 protein).
  • a suitable RNA-guided endonuclease is a class 2 type VI CRISPR/Cas endonuclease (e.g., a C2c2 protein).
  • an RNA-guided endonuclease is a fusion protein that is fused to a
  • heterologous polypeptide also referred to as a "fusion partner"
  • an RNA-guided endonuclease is fused to an amino acid sequence (a fusion partner) that provides for subcellular localization, i.e., the fusion partner is a subcellular localization sequence (e.g., one or more nuclear localization signals (NLSs) for targeting to the nucleus, two or more NLSs, three or more NLSs, etc.).
  • a subcellular localization sequence e.g., one or more nuclear localization signals (NLSs) for targeting to the nucleus, two or more NLSs, three or more NLSs, etc.
  • an RNA-guided endonuclease is fused to an amino acid sequence (a fusion partner) that provides a tag (i.e., the fusion partner is a detectable label) for ease of tracking and/or purification (e.g., a fluorescent protein, e.g., green fluorescent protein (GFP), YFP, RFP, CFP, mCherry, tdTomato, and the like; a histidine tag, e.g., a 6XHis tag; a hemagglutinin (HA) tag; a FLAG tag; a Myc tag; and the like).
  • a fluorescent protein e.g., green fluorescent protein (GFP), YFP, RFP, CFP, mCherry, tdTomato, and the like
  • GFP green fluorescent protein
  • YFP green fluorescent protein
  • RFP red fluorescent protein
  • CFP CFP
  • mCherry mCherry
  • tdTomato e.g
  • the fusion partner can provide for increased or decreased stability (i.e., the fusion partner can be a stability control peptide, e.g., a degron, which in some cases is controllable (e.g., a temperature sensitive or drug controllable degron sequence).
  • a stability control peptide e.g., a degron
  • controllable e.g., a temperature sensitive or drug controllable degron sequence
  • an RNA-guided endonuclease is conjugated (e.g., fused) to a polypeptide permeant domain to promote uptake by the cell (i.e., the fusion partner promotes uptake by a cell).
  • a polypeptide permeant domain to promote uptake by the cell (i.e., the fusion partner promotes uptake by a cell).
  • permeant domains are known in the art and may be used, including peptides, peptidomimetics, and non-peptide carriers. (See, for example, Futaki et al. (2003) Curr Protein Pept Sci. 2003 Apr; 4(2): 87-9 and 446; and Wender et al. (2000) Proc. Natl. Acad. Sci. U.S.A 2000 Nov. 21 ; 97(24): 13003-8; published U.S.
  • the nona-arginine (R9) sequence is one of the more efficient PTDs that have been characterized (Wender et al. 2000; Uemura et al. 2002).
  • the site at which the fusion is made may be selected in order to optimize the biological activity, secretion or binding characteristics of the polypeptide. The optimal site can be determined by routine experimentation.
  • a genome editing nuclease includes a "Protein Transduction Domain" or
  • PTD also known as a CPP - cell penetrating peptide
  • CPP CPP - cell penetrating peptide
  • a PTD attached to another molecule which can range from a small polar molecule to a large macromolecule and/or a nanoparticle, facilitates the molecule traversing a membrane, for example going from extracellular space to intracellular space, or cytosol to within an organelle.
  • a PTD is covalently linked to the amino terminus a polypeptide (e.g., a genome editing nuclease, e.g., a Cas9 protein).
  • a PTD is covalently linked to the carboxyl terminus of a polypeptide (e.g., an RNA-guided endonuclease, e.g., a Cas9 protein).
  • the PTD is inserted internally in the RNA-guided endonuclease (e.g., Cas9 protein) (i.e., is not at the N- or C-terminus of the genome editing nuclease).
  • an RNA- guided endonuclease (e.g., a Cas9 protein) includes (is conjugated to, is fused to) one or more PTDs (e.g., two or more, three or more, four or more PTDs).
  • a PTD includes a nuclear localization signal (NLS) (e.g., in some cases 2 or more, 3 or more, 4 or more, or 5 or more NLSs).
  • NLS nuclear localization signal
  • an RNA-guided endonuclease (e.g., a Cas9 protein) includes one or more
  • a PTD is covalently linked to a nucleic acid (e.g., a CRISPR/Cas guide RNA, a polynucleotide encoding a CRISPR/Cas guide RNA, a polynucleotide encoding a class 2 CRISPR/Cas endonuclease such as a Cas9 protein or a type V or type VI CRISPR/Cas protein, etc.).
  • a nucleic acid e.g., a CRISPR/Cas guide RNA, a polynucleotide encoding a CRISPR/Cas guide RNA, a polynucleotide encoding a class 2 CRISPR/Cas endonuclease such as a Cas9 protein or a type V or type VI CRISPR/Cas protein, etc.
  • PTDs include but are not limited to a polyarginine sequence comprising a number of arginines sufficient to direct entry into a cell (e.g., 3, 4, 5, 6, 7, 8, 9, 10, or 10-50 arginines); a VP22 domain (Zender et al. (2002) Cancer Gene Ther. 9(6):489-96); a Drosophila Antennapedia protein transduction domain (Noguchi et al. (2003) Diabetes 52(7): 1732-1737); a truncated human calcitonin peptide (Trehin et al. (2004) Pharm. Research 21 : 1248-1256); polylysine (Wender et al. (2000) Proc. Natl. Acad. Sci.
  • a polyarginine sequence comprising a number of arginines sufficient to direct entry into a cell (e.g., 3, 4, 5, 6, 7, 8, 9, 10, or 10-50 arginines); a VP22 domain (Zender et al. (2002) Cancer Gene Ther.
  • the PTD is an activatable CPP (ACPP) (Aguilera et al. (2009) Integr Biol (Camb) June; 1(5-6): 371-381).
  • ACPPs comprise a polycationic CPP (e.g., Arg9 or "R9") connected via a cleavable linker to a matching polyanion (e.g., Glu9 or "E9"), which reduces the net charge to nearly zero and thereby inhibits adhesion and uptake into cells.
  • a polyanion e.g., Glu9 or "E9
  • RNA-guided endonuclease e.g., a Cas9 protein
  • An RNA-guided endonuclease can have multiple (1 or more, 2 or more, 3 or more, etc.) fusion partners in any combination of the above.
  • an RNA-guided endonuclease e.g., a Cas9 protein
  • can have a fusion partner that provides for tagging e.g., GFP
  • a subcellular localization sequence e.g., one or more NLSs.
  • such a fusion protein might also have a tag for ease of tracking and/or purification (e.g., a histidine tag, e.g., a 6XHis tag; a hemagglutinin (HA) tag; a FLAG tag; a Myc tag; and the like).
  • a histidine tag e.g., a 6XHis tag
  • HA hemagglutinin
  • FLAG tag e.g., hemagglutinin (HA) tag
  • FLAG tag e.g., a FLAG tag
  • Myc tag e.g., a Myc tag
  • an RNA-guided endonuclease e.g., a Cas9 protein
  • NLSs e.g., two or more, three or more, four or more, five or more, 1, 2, 3, 4, or 5 NLSs.
  • a fusion partner (or multiple fusion partners, e.g., 1, 2, 3, 4, or 5 NLSs) (e.g., an NLS, a tag, a fusion partner providing an activity, etc.) is located at or near the C-terminus of the RNA-guided endonuclease (e.g., Cas9 protein).
  • a fusion partner (or multiple fusion partners, e.g., 1, 2, 3, 4, or 5 NLSs) (e.g., an NLS, a tag, a fusion partner providing an activity, etc.) is located at the N-terminus of the RNA-guided endonuclease (e.g., Cas9 protein).
  • the genome editing nuclease e.g., Cas9 protein
  • has a fusion partner or multiple fusion partners, e.g., 1, 2, 3, 4, or 5 NLSs)(e.g., an NLS, a tag, a fusion partner providing an activity, etc.) at both the N-terminus and C-terminus.
  • fusion partner e.g., 1, 2, 3, 4, or 5 NLSs
  • RNA-mediated adaptive immune systems in bacteria and archaea rely on Clustered
  • an RNA-guided endonuclease nuclease of a system of the present disclosure is a class 2 CRISPR/Cas endonuclease.
  • a system of the present disclosure includes a class 2 CRISPR/Cas endonuclease (or a nucleic encoding the endonuclease).
  • class 2 CRISPR systems the functions of the effector complex (e.g., the cleavage of target DNA) are carried out by a single endonuclease (e.g., see Zetsche et al., Cell. 2015 Oct 22;163(3):759-71 ; Makarova et al., Nat Rev Microbiol. 2015 Nov;13(l l):722-36; and Shmakov et al., Mol Cell. 2015 Nov 5;60(3):385-97).
  • class 2 CRISPR/Cas protein is used herein to encompass the endonuclease (the target nucleic acid cleaving protein) from class 2 CRISPR systems.
  • class 2 CRISPR/Cas endonuclease encompasses type II CRISPR/Cas proteins (e.g., Cas9), type V CRISPR/Cas proteins (e.g., Cpfl, C2cl, C2C3), and type VI CRISPR/Cas proteins (e.g., C2c2).
  • type II CRISPR/Cas proteins e.g., Cas9
  • type V CRISPR/Cas proteins e.g., Cpfl, C2cl, C2C3
  • type VI CRISPR/Cas proteins e.g., C2c2c2
  • Type II CRISPR/Cas endonucleases e.g., Cas 9
  • Cas9 functions as an RNA-guided
  • RNA for target recognition and cleavage by a mechanism involving two nuclease active sites in Cas9 that together generate double-stranded DNA breaks (DSBs), or can individually generate single-stranded DNA breaks (SSBs).
  • DSBs double-stranded DNA breaks
  • SSBs single-stranded DNA breaks
  • the Type II CRISPR endonuclease Cas9 and engineered dual-guide RNA (dgRNA) or singleguide RNA (sgRNA) form a ribonucleoprotein (RNP) complex that can be targeted to a desired DNA sequence.
  • dgRNA dual-guide RNA
  • sgRNA singleguide RNA
  • RNP ribonucleoprotein
  • Cas9 Guided by a dual-RNA complex or a single-guide RNA (sgRNA), Cas9 generates site-specific DSBs or SSBs (for example, when one of the catalytic domains harbors an inactivating mutation) within double- stranded DNA (dsDNA) target nucleic acids, which are repaired either by non-homologous end joining (NHEJ) or homology-directed recombination (HDR).
  • NHEJ non-homologous end joining
  • HDR homology-directed recombination
  • a system of the present disclosure includes a type II
  • a type II CRISPR/Cas endonuclease is a type of class 2
  • the type II CRISPR/Cas endonuclease is a Cas9 protein.
  • a Cas9 protein forms a complex with a Cas9 guide RNA.
  • the guide RNA provides target specificity to a Cas9-guide RNA complex by having a nucleotide sequence (a guide sequence) that is complementary to a sequence (the target site) of a target nucleic acid (as described elsewhere herein).
  • the Cas9 protein of the complex provides the site-specific activity. In other words, the Cas9 protein is guided to a target site (e.g., stabilized at a target site) within a target nucleic acid sequence (e.g.
  • a chromosomal sequence or an extrachromosomal sequence e.g., an episomal sequence, a minicircle sequence, a mitochondrial sequence, a chloroplast sequence, etc.
  • a Cas9 protein can bind and/or modify (e.g., cleave, nick, methylate, demethylate, etc.) a target nucleic acid and/or a polypeptide associated with target nucleic acid (e.g., methylation or acetylation of a histone tail)(e.g., when the Cas9 protein includes a fusion partner with an activity).
  • the Cas9 protein is a naturally-occurring protein (e.g., naturally occurs in bacterial and/or archaeal cells).
  • the Cas9 protein is not a naturally-occurring polypeptide (e.g., the Cas9 protein is a variant Cas9 protein, a chimeric protein, and the like).
  • Cas9 proteins include, but are not limited to, those set forth in SEQ ID NO:
  • Naturally occurring Cas9 proteins bind a Cas9 guide RNA, are thereby directed to a specific sequence within a target nucleic acid (a target site), and cleave the target nucleic acid (e.g., cleave dsDNA to generate a double strand break, cleave ssDNA, cleave ssRNA, etc.).
  • a chimeric Cas9 protein is a fusion protein comprising a Cas9 polypeptide that is fused to a heterologous protein (referred to as a fusion partner), where the heterologous protein provides an activity (e.g., one that is not provided by the Cas9 protein).
  • the fusion partner can provide an activity, e.g., enzymatic activity (e.g., nuclease activity, activity for DNA and/or RNA methylation, activity for DNA and/or RNA cleavage, activity for histone acetylation, activity for histone methylation, activity for RNA modification, activity for RNA-binding, activity for RNA splicing etc.).
  • enzymatic activity e.g., nuclease activity, activity for DNA and/or RNA methylation, activity for DNA and/or RNA cleavage, activity for histone acetylation, activity for histone methylation, activity for RNA modification, activity for RNA-binding, activity for RNA splicing etc.
  • a portion of the Cas9 protein e.g., the RuvC domain and/or the HNH domain
  • exhibits reduced nuclease activity relative to the corresponding portion of a wild type Cas9 protein e.g., in some cases the Ca
  • Cas9 orthologs from a wide variety of species have been identified and in some cases the proteins share only a few identical amino acids.
  • Identified Cas9 orthologs have similar domain architecture with a central HNH endonuclease domain and a split RuvC/RNaseH domain (e.g., RuvCI, RuvCII, and RuvCIII) (e.g., see Table 1).
  • a Cas9 protein can have 3 different regions (sometimes referred to as RuvC-I, RuvC-II, and RucC-III), that are not contiguous with respect to the primary amino acid sequence of the Cas9 protein, but fold together to form a RuvC domain once the protein is produced and folds.
  • Cas9 proteins can be said to share at least 4 key motifs with a conserved architecture.
  • Motifs 1, 2, and 4 are RuvC like motifs while motif 3 is an HNH-motif.
  • the motifs set forth in Table 1 may not represent the entire RuvC -like and/or HNH domains as accepted in the art, but Table 1 does present motifs that can be used to help determine whether a given protein is a Cas9 protein.
  • Table 1 lists 4 motifs that are present in Cas9 sequences from various species.
  • amino acids listed in Table 1 are from the Cas9 from 5.
  • pyogenes SEQ ID NO: 5).
  • a suitable Cas9 protein comprises an amino acid sequence having 4
  • motifs each of motifs 1-4 having 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 99% or more or 100% amino acid sequence identity to motifs 1-4 as set forth in SEQ ID NOs: 1-4, respectively (e.g., see Table 1).
  • a suitable Cas9 polypeptide comprises an amino acid sequence having 4 motifs, each of motifs 1-4 having 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 99% or more or 100% amino acid sequence identity to motifs 1-4 of the Cas9 amino acid sequence set forth in SEQ ID NO: 5 (e.g., the sequences set forth in SEQ ID NOs: 1-4, e.g., see Table 1), or to the corresponding portions in any of the amino acid sequences set forth in SEQ ID NOs: 6-21.
  • a suitable Cas9 protein comprises an amino acid sequence having 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 99% or more or 100% amino acid sequence identity to amino acids 7-166 or 731-1003 of the Cas9 amino acid sequence set forth in SEQ ID NO: 5, or to the corresponding portions in any of the amino acid sequences set forth as SEQ ID NOs: 6-21.
  • a suitable Cas9 protein comprises an amino acid sequence having 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 99% or more or 100% amino acid sequence identity to the Cas9 amino acid sequence set forth in SEQ ID NO: 5, or to any of the amino acid sequences set forth as SEQ ID NOs: 6-21.
  • a suitable Cas9 polypeptide is a high fidelity (HF) Cas9 polypeptide (e.g., see Kleinstiver et al. (2016) Nature 529:490).
  • HF high fidelity
  • a suitable Cas9 polypeptide exhibits altered PAM specificity. See, e.g.,
  • Cas9 protein encompasses a "chimeric Cas9 protein.”
  • Cas9 protein encompasses a variant Cas9 that is a nickase.
  • a Cas9 protein is a variant Cas9 protein.
  • a variant Cas9 protein has an amino acid sequence that is different by at least one amino acid (e.g., has a deletion, insertion, substitution, fusion) when compared to the amino acid sequence of a corresponding wild type Cas9 protein.
  • a protein e.g., a class 2 CRISPR/Cas protein, e.g., a Cas9 protein
  • nickase e.g., a "nickase Cas9”
  • a variant Cas9 protein can cleave the complementary strand (sometimes referred to in the art as the target strand) of a target nucleic acid but has reduced ability to cleave the non-complementary strand (sometimes referred to in the art as the non-target strand) of a target nucleic acid.
  • the variant Cas9 protein can have a mutation (amino acid substitution) that reduces the function of the RuvC domain.
  • the Cas9 protein can be a nickase that cleaves the complementary strand, but does not cleave the non-complementary strand.
  • a variant Cas9 protein has a mutation at an amino acid position corresponding to residue D10 (e.g., DIOA, aspartate to alanine) of SEQ ID NO: 5 (or the corresponding position of any of the proteins set forth in SEQ ID NOs: 6-21 and can therefore cleave the complementary strand of a double stranded target nucleic acid but has reduced ability to cleave the non-complementary strand of a double stranded target nucleic acid (thus resulting in a single strand break (SSB) instead of a double strand break (DSB) when the variant Cas9 protein cleaves a double stranded target nucleic acid) (see, for example, Jinek et al., Science. 2012 Aug 17;337(6096):816-21).
  • residue D10 e.g., DIOA, aspartate to alanine
  • a variant Cas9 protein can cleave the non-complementary strand of a target nucleic acid but has reduced ability to cleave the complementary strand of the target nucleic acid.
  • the variant Cas9 protein can have a mutation (amino acid substitution) that reduces the function of the HNH domain.
  • the Cas9 protein can be a nickase that cleaves the non-complementary strand, but does not cleave the complementary strand.
  • the variant Cas9 protein has a mutation at an amino acid position corresponding to residue H840 (e.g., an H840A mutation, histidine to alanine) of SEQ ID NO: 5 (or the corresponding position of any of the proteins set forth as SEQ ID NOs: 6- 21) and can therefore cleave the non-complementary strand of the target nucleic acid but has reduced ability to cleave (e.g., does not cleave) the complementary strand of the target nucleic acid.
  • residue H840 e.g., an H840A mutation, histidine to alanine
  • Such a Cas9 protein has a reduced ability to cleave a target nucleic acid (e.g., a single stranded target nucleic acid) but retains the ability to bind a target nucleic acid (e.g., a single stranded target nucleic acid).
  • a variant Cas9 protein can have the same parameters for
  • a suitable variant Cas9 protein comprises an amino acid sequence having 4 motifs, each of motifs 1-4 having 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 99% or more or 100% amino acid sequence identity to motifs 1-4 of the Cas9 amino acid sequence set forth as SEQ ID NO: 5 (the motifs are in Table 1, above, and are set forth as SEQ ID NOs: 1-4, respectively), or to the corresponding portions in any of the amino acid sequences set forth in SEQ ID NOs: 6-21.
  • a suitable variant Cas9 protein comprises an amino acid sequence having
  • amino acid sequence identity to amino acids 7-166 or 731-1003 of the Cas9 amino acid sequence set forth in SEQ ID NO: 5, or to the corresponding portions in any of the amino acid sequences set forth as SEQ ID NOs: 6-21.
  • a suitable variant Cas9 protein comprises an amino acid sequence having
  • a suitable variant Cas9 protein comprises an amino acid sequence having 70% or more amino acid sequence identity to amino acids 7-166 or 731-1003 of the Cas9 amino acid sequence set forth in SEQ ID NO: 5, or to the corresponding portions in any of the amino acid sequences set forth as SEQ ID NOs: 6-21.
  • a suitable variant Cas9 protein comprises an amino acid sequence having 75% or more amino acid sequence identity to amino acids 7-166 or 731-1003 of the Cas9 amino acid sequence set forth in SEQ ID NO: 5, or to the corresponding portions in any of the amino acid sequences set forth as SEQ ID NOs: 6-21. In some cases, a suitable variant Cas9 protein comprises an amino acid sequence having 80% or more amino acid sequence identity to amino acids 7-166 or 731-1003 of the Cas9 amino acid sequence set forth in SEQ ID NO: 5, or to the corresponding portions in any of the amino acid sequences set forth as SEQ ID NOs: 6-21.
  • a suitable variant Cas9 protein comprises an amino acid sequence having 85% or more amino acid sequence identity to amino acids 7-166 or 731-1003 of the Cas9 amino acid sequence set forth in SEQ ID NO: 5, or to the corresponding portions in any of the amino acid sequences set forth as SEQ ID NOs: 6-21. In some cases, a suitable variant Cas9 protein comprises an amino acid sequence having 90% or more amino acid sequence identity to amino acids 7-166 or 731-1003 of the Cas9 amino acid sequence set forth in SEQ ID NO: 5, or to the corresponding portions in any of the amino acid sequences set forth as SEQ ID NOs: 6-21.
  • a suitable variant Cas9 protein comprises an amino acid sequence having 95% or more amino acid sequence identity to amino acids 7-166 or 731-1003 of the Cas9 amino acid sequence set forth in SEQ ID NO: 5, or to the corresponding portions in any of the amino acid sequences set forth as SEQ ID NOs: 6-21. In some cases, a suitable variant Cas9 protein comprises an amino acid sequence having 99% or more amino acid sequence identity to amino acids 7-166 or 731-1003 of the Cas9 amino acid sequence set forth in SEQ ID NO: 5, or to the corresponding portions in any of the amino acid sequences set forth as SEQ ID NOs: 6-21.
  • a suitable variant Cas9 protein comprises an amino acid sequence having 100% amino acid sequence identity to amino acids 7-166 or 731-1003 of the Cas9 amino acid sequence set forth in SEQ ID NO: 5, or to the corresponding portions in any of the amino acid sequences set forth as SEQ ID NOs: 6-21.
  • a suitable variant Cas9 protein comprises an amino acid sequence having
  • a suitable variant Cas9 protein comprises an amino acid sequence having 60% or more amino acid sequence identity to the Cas9 amino acid sequence set forth in SEQ ID NO: 5, or to any of the amino acid sequences set forth as SEQ ID NOs: 6-21.
  • a suitable variant Cas9 protein comprises an amino acid sequence having 70% or more amino acid sequence identity to the Cas9 amino acid sequence set forth in SEQ ID NO: 5, or to any of the amino acid sequences set forth as SEQ ID NOs: 6-21. In some cases, a suitable variant Cas9 protein comprises an amino acid sequence having 75% or more amino acid sequence identity to the Cas9 amino acid sequence set forth in SEQ ID NO: 5, or to any of the amino acid sequences set forth as SEQ ID NOs: 6-21. In some cases, a suitable variant Cas9 protein comprises an amino acid sequence having 80% or more amino acid sequence identity to the Cas9 amino acid sequence set forth in SEQ ID NO: 5, or to any of the amino acid sequences set forth as SEQ ID NOs: 6-21.
  • a suitable variant Cas9 protein comprises an amino acid sequence having 85% or more amino acid sequence identity to the Cas9 amino acid sequence set forth in SEQ ID NO: 5, or to any of the amino acid sequences set forth as SEQ ID NOs: 6-21. In some cases, a suitable variant Cas9 protein comprises an amino acid sequence having 90% or more amino acid sequence identity to the Cas9 amino acid sequence set forth in SEQ ID NO: 5, or to any of the amino acid sequences set forth as SEQ ID NOs: 6-21. In some cases, a suitable variant Cas9 protein comprises an amino acid sequence having 95% or more amino acid sequence identity to the Cas9 amino acid sequence set forth in SEQ ID NO: 5, or to any of the amino acid sequences set forth as SEQ ID NOs: 6-21.
  • a suitable variant Cas9 protein comprises an amino acid sequence having 99% or more amino acid sequence identity to the Cas9 amino acid sequence set forth in SEQ ID NO: 5, or to any of the amino acid sequences set forth as SEQ ID NOs: 6-21. In some cases, a suitable variant Cas9 protein comprises an amino acid sequence having 100% amino acid sequence identity to the Cas9 amino acid sequence set forth in SEQ ID NO: 5, or to any of the amino acid sequences set forth as SEQ ID NOs: 6-21.
  • a system of the present disclosure includes a type V or type VI
  • CRISPR/Cas endonuclease i.e., the genome editing endonuclease is a type V or type VI CRISPR/Cas endonuclease) (e.g., Cpfl, C2cl, C2c2, C2c3).
  • Type V and type VI CRISPR/Cas endonucleases are a type of class 2 CRISPR/Cas endonuclease. Examples of type V
  • CRISPR/Cas endonucleases include but are not limited to: Cpfl, C2cl, and C2c3.
  • An example of a type VI CRISPR/Cas endonuclease is C2c2.
  • a system of the present disclosure includes a type V CRISPR/Cas endonuclease (e.g., Cpfl, C2cl, C2c3).
  • a Type V CRISPR/Cas endonuclease is a Cpfl protein.
  • a type V CRISPR/Cas endonuclease is a C2cl protein.
  • a system of the present disclosure includes a type VI CRISPR/Cas endonuclease (e.g., C2c2). In some cases a type V CRISPR/Cas endonuclease is a C2c2 protein. In some cases, a system of the present disclosure includes t type VI CRISPR/Cas endonuclease (e.g., C2c3). In some cases a type V CRISPR/Cas endonuclease is a C2c3 protein.
  • type V and VI CRISPR/Cas endonucleases form a complex with a corresponding guide RNA.
  • the guide RNA provides target specificity to an endonuclease-guide RNA RNP complex by having a nucleotide sequence (a guide sequence) that is complementary to a sequence (the target site) of a target nucleic acid (as described elsewhere herein).
  • the endonuclease of the complex provides the site-specific activity. In other words, the endonuclease is guided to a target site (e.g., stabilized at a target site) within a target nucleic acid sequence (e.g.
  • a chromosomal sequence or an extrachromosomal sequence e.g., an episomal sequence, a minicircle sequence, a mitochondrial sequence, a chloroplast sequence, etc.
  • C2cl, C2c2, and C2c3 guide RNAs can be found in the art, for example, see Zetsche et al., Cell. 2015 Oct 22;163(3):759-71 ; Makarova et al., Nat Rev Microbiol. 2015 Nov;13(l l):722-36; and Shmakov et al., Mol Cell. 2015 Nov 5;60(3):385-97; and U.S.
  • Type V or type VI CRISPR/Cas endonuclease e.g., Cpfl, C2cl,
  • C2c2, C2c3) is enzymatically active, e.g., the Type V or type VI CRISPR/Cas polypeptide, when bound to a guide RNA, cleaves a target nucleic acid.
  • the Type V or type VI CRISPR/Cas endonuclease e.g., Cpfl, C2cl, C2c2, C2c3
  • exhibits reduced enzymatic activity relative to a corresponding wild-type a Type V or type VI CRISPR/Cas endonuclease e.g., Cpfl, C2cl, C2c2, C2c3
  • a type V CRISPR/Cas endonuclease is a Cpfl protein.
  • a type V CRISPR/Cas endonuclease is a Cpfl protein.
  • a type V CRISPR/Cas endonuclease is a Cpfl protein.
  • Cpfl protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100%, amino acid sequence identity to the Cpfl amino acid sequence set forth in any of SEQ ID NOs: 22-26.
  • a Cpfl protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100%, amino acid sequence identity to a contiguous stretch of from 100 amino acids to 200 amino acids (aa), from 200 aa to 400 aa, from 400 aa to 600 aa, from 600 aa to 800 aa, from 800 aa to 1000 aa, from 1000 aa to 1100 aa, from 1100 aa to 1200 aa, or from 1200 aa to 1300 aa, of the Cpfl amino acid sequence set forth in any of SEQ ID NOs: 22-26.
  • a type V CRISPR/Cas endonuclease is a C2cl protein (examples include those set forth as SEQ ID NOs: 27-34).
  • a C2cl protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100%, amino acid sequence identity to the C2cl amino acid sequence set forth in any of SEQ ID NOs: 27-34.
  • a C2cl protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100%, amino acid sequence identity to a contiguous stretch of from 100 amino acids to 200 amino acids (aa), from 200 aa to 400 aa, from 400 aa to 600 aa, from 600 aa to 800 aa, from 800 aa to 1000 aa, from 1000 aa to 1100 aa, from 1100 aa to 1200 aa, or from 1200 aa to 1300 aa, of the C2cl amino acid sequence set forth in any of SEQ ID NOs: 27-34.
  • a type V CRISPR/Cas endonuclease is a C2c3 protein (examples include those set forth as SEQ ID NOs: 35-38).
  • a C2c3 protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100%, amino acid sequence identity to the C2c3 amino acid sequence set forth in any of SEQ ID NOs: 35-38.
  • a C2c3 protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100%, amino acid sequence identity to a contiguous stretch of from 100 amino acids to 200 amino acids (aa), from 200 aa to 400 aa, from 400 aa to 600 aa, from 600 aa to 800 aa, from 800 aa to 1000 aa, from 1000 aa to 1100 aa, from 1100 aa to 1200 aa, or from 1200 aa to 1300 aa, of the C2c3 amino acid sequence set forth in any of SEQ ID NOs: 35-38.
  • a type VI CRISPR/Cas endonuclease is a C2c2 protein (examples include those set forth as SEQ ID NOs: 39-50).
  • a C2c2 protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100%, amino acid sequence identity to the C2c2 amino acid sequence set forth in any of SEQ ID NOs: 39-50.
  • a C2c2 protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100%, amino acid sequence identity to a contiguous stretch of from 100 amino acids to 200 amino acids (aa), from 200 aa to 400 aa, from 400 aa to 600 aa, from 600 aa to 800 aa, from 800 aa to 1000 aa, from 1000 aa to 1100 aa, from 1100 aa to 1200 aa, or from 1200 aa to 1300 aa, of the C2c2 amino acid sequence set forth in any of SEQ ID NOs: 39-50.
  • a nucleic acid that binds to a class 2 CRISPR/Cas endonuclease e.g., a Cas9 protein; a type V or type VI CRISPR/Cas protein; a Cpfl protein; etc.
  • a guide RNA e.g., a guide RNA
  • CRISPR/Cas guide nucleic acid or “CRISPR/Cas guide RNA.”
  • a guide RNA provides target specificity to the complex (the RNP complex) by
  • a targeting segment which includes a guide sequence (also referred to herein as a targeting sequence), which is a nucleotide sequence that is complementary to a sequence of a target nucleic acid.
  • a guide sequence also referred to herein as a targeting sequence
  • a guide RNA can be referred to by the protein to which it corresponds.
  • the corresponding guide RNA can be referred to as a "Cas9 guide RNA.”
  • the class 2 CRISPR/Cas endonuclease is a Cas9 protein
  • the corresponding guide RNA can be referred to as a "Cas9 guide RNA.”
  • the class 2 CRISPR/Cas endonuclease is a Cas9 protein
  • the corresponding guide RNA can be referred to as a "Cas9 guide RNA.”
  • the class 2 CRISPR/Cas endonuclease is a Cas9 protein
  • the corresponding guide RNA can be referred to as a "Cas9 guide RNA.”
  • the class 2 CRISPR/Cas endonuclease is a Cas9 protein
  • CRISPR/Cas endonuclease is a Cpfl protein
  • the corresponding guide RNA can be referred to as a "Cpfl guide RNA.”
  • a guide RNA includes two separate nucleic acid molecules: an
  • the guide RNA is one molecule (e.g., for some class 2 CRISPR/Cas proteins, the corresponding guide RNA is a single molecule; and in some cases, an activator and targeter are covalently linked to one another, e.g., via intervening nucleotides), and the guide RNA is referred to as a "single guide RNA", a “single-molecule guide RNA,” a “one -molecule guide RNA”, or simply "sgRNA.”
  • the first and second CRISPR/Cas guide RNA comprise guide sequences that hybridize to a target sequence present in a target gene, wherein the target gene is a fatty acid metabolism pathway gene, a gene that controls appetite, or a gene that regulates fatty acid storage.
  • a guide sequence of a first and second CRISPR/Cas guide RNA e.g. a Cas9 guide RNA
  • the guide sequence of the first CRISPR/Cas guide RNA e.g.
  • a Cas9 guide RNA has 100% complementarity over 20 contiguous nucleotides with the target sequence of the target gene selected from SEQ ID NOs.: 51-62, and the guide sequence of the second CRISPR/Cas guide RNA (e.g., a Cas9 guide RNA) has 100% complementary over 20 contiguous nucleotides with a target sequence of the target gene selected from SEQ ID NOs.: 51-62.
  • a first CRISPR/Cas guide RNA (e.g., a Cas9 guide RNA) includes a guide sequence that includes a sequence selected from SEQ ID NOs.: 63-74, 107-124 (which sequences hybridize to a target sequence of a target gene that is a fatty acid metabolism pathway gene, a gene that controls appetite, or a gene that regulates fatty acid storage).
  • a second CRISPR/Cas guide RNA (e.g., a Cas9 guide RNA) includes a guide sequence that includes a sequence selected from SEQ ID NOs.: 63-74, 107-124 (which sequences hybridize to a target sequence of a target gene that is a fatty acid metabolism pathway gene, a gene that controls appetite, or a gene that regulates fatty acid storage).
  • a target gene can have at least 80%, at least 90%, at least 95%, at least 98%, at least
  • nucleotide sequence identity to the nucleotide sequence of a gene selected from: MAT1A (SEQ ID NO:51), ACOX1 (SEQ ID NO:52), LEPR (SEQ ID NO:53), LEP (SEQ ID NO:54), SIRT7 (SEQ ID NO:55), APOIA (SEQ ID NO:56), SIRT1 (SEQ ID NO:57), SIRT3 (SEQ ID NO:58), SIRT4 (SEQ ID NO:59), SIRT5 (SEQ ID NO:60), SIRT6 (SEQ ID NO:61), and PTEN (SEQ ID NO:62).
  • a non-complementary strand of the target sequence that is targeted by a first CRISPR/Cas guide RNA includes a sequence selected from SEQ ID NOs: 76-77, 79-106.
  • a first CRISPR/Cas guide RNA includes a guide sequence that includes a sequence selected from SEQ ID NOs: 63-74, 107-124.
  • a non-complementary strand of the target sequence that is targeted by a second CRISPR/Cas guide RNA e.g.
  • a Cas9 guide RNA includes a sequence selected from SEQ ID NOs: 76-77, 79-106).
  • a second CRISPR/Cas guide RNA e.g. a Cas9 guide RNA
  • Cas9 guide RNA specific location within a target nucleic acid is referred to herein as a "Cas9 guide RNA.”
  • a Cas9 guide RNA can be said to include two segments, a first segment (referred to herein as a “targeting segment”); and a second segment (referred to herein as a “protein-binding segment”).
  • target segment a segment/section/region of a molecule, e.g., a contiguous stretch of nucleotides in a nucleic acid molecule.
  • a segment can also mean a region/section of a complex such that a segment may comprise regions of more than one molecule.
  • the first segment (targeting segment) of a Cas9 guide RNA includes a nucleotide
  • the protein-binding segment (or "protein-binding sequence") interacts with (binds to) a Cas9 polypeptide.
  • the protein-binding segment of a subject Cas9 guide RNA includes two complementary stretches of nucleotides that hybridize to one another to form a double stranded RNA duplex (dsRNA duplex).
  • Site-specific binding and/or cleavage of a target nucleic acid can occur at locations (e.g., target sequence of a target locus) determined by base-pairing complementarity between the Cas9 guide RNA (the guide sequence of the Cas9 guide RNA) and the target nucleic acid.
  • a Cas9 guide RNA and a Cas9 protein form a complex (e.g., bind via non-covalent interactions).
  • the Cas9 guide RNA provides target specificity to the complex by including a targeting segment, which includes a guide sequence (a nucleotide sequence that is
  • the Cas9 protein of the complex provides the site-specific activity (e.g., cleavage activity or an activity provided by the Cas9 protein when the Cas9 protein is a Cas9 fusion polypeptide, i.e., has a fusion partner).
  • the Cas9 protein is guided to a target nucleic acid sequence (e.g. a target sequence in a chromosomal nucleic acid, e.g., a chromosome; a target sequence in an extra chromosomal nucleic acid, e.g.
  • the "guide sequence” also referred to as the "targeting sequence” of a Cas9 guide RNA can be modified so that the Cas9 guide RNA can target a Cas9 protein to any desired sequence of any desired target nucleic acid, with the exception that the protospacer adjacent motif (PAM) sequence can be taken into account.
  • PAM protospacer adjacent motif
  • a Cas9 guide RNA can have a targeting segment with a sequence (a guide sequence) that has complementarity with (e.g., can hybridize to) a sequence in a nucleic acid in a eukaryotic cell, e.g., a viral nucleic acid, a eukaryotic nucleic acid (e.g., a eukaryotic chromosome, chromosomal sequence, a eukaryotic RNA, etc.), and the like.
  • a eukaryotic cell e.g., a viral nucleic acid, a eukaryotic nucleic acid (e.g., a eukaryotic chromosome, chromosomal sequence, a eukaryotic RNA, etc.), and the like.
  • the guide sequence of a CRISPR/Cas9 guide RNA will have a nucleotide sequence having at least 80% or at least 90% nucleotide sequence identify to the nucleotide sequence of a gene selected from: MAT1A (SEQ ID NO:51), ACOX1 (SEQ ID NO:52), LEPR (SEQ ID NO:53), LEP (SEQ ID NO:54), SIRT7 (SEQ ID NO:55), APOIA (SEQ ID NO:56), SIRT1 (SEQ ID NO:57), SIRT3 (SEQ ID NO:58), SIRT4 (SEQ ID NO:59), SIRT5 (SEQ ID NO:60), SIRT6 (SEQ ID NO:61), and PTEN (SEQ ID NO:62).
  • MAT1A SEQ ID NO:51
  • ACOX1 SEQ ID NO:52
  • LEPR SEQ ID NO:53
  • LEP LEP
  • SIRT7 SEQ ID NO:55
  • APOIA SEQ ID NO:56
  • RNAs examples include, but are not limited to: caaugugucuaauugcaucu (SEQ ID NO:63), aauaccagcauuggcagucc (SEQ ID NO:64), gcagccacacugagcagcca (SEQ ID NO:65), augcucauaugggugagcgu (SEQ ID NO:66), cuccugcagcucuucccgcu (SEQ ID NO:67), agcgaugaagucauagccaa (SEQ ID NO:68), aagaagccacucacccugca (SEQ ID NO:69), cuccucccaccagcccaaca (SEQ ID NO:70),
  • aaagaagcagcagcuuugcu (SEQ ID NO:71), uucucagaucuuugacccgc (SEQ ID NO:72), agaggcuugaaggaguguac (SEQ ID NO:73), ccaccaggucccugaggcgg (SEQ ID NO: 74), aggaaugguguugcucugug (SEQ ID NO: 107), gaucacaucucaugccauug (SEQ ID NO: 108), cgagaugcaauuagacacau (SEQ ID NO: 109), gucugauaauccaaaaucug (SEQ ID NO: 110), gcauacgcuguugccagaag (SEQ ID NO: 111), gacugccaaugcugguauug (SEQ ID NO: 112), cgaauggccugugggca (SEQ ID NO: 113), gcuucgaucccagacuaccg (SEQ
  • RNAs e.g. a first Cas9 guide RNA and/or a second Cas9 guide RNA
  • aataccagcattggcagtcc SEQ ID NO:76
  • gcagccacactgagcagcca SEQ ID NO:77
  • ctcctgcagctcttcccgct SEQ ID NO:79
  • aagaagccactcaccctgca SEQ ID NO:81
  • ctcctcccaccagcccaaca SEQ ID NO:82
  • aaagaagcagcagctttgct SEQ ID NO:83
  • ttctcagatctttgacccgc SEQ ID NO:84
  • aggaatggtgttgctctgtg (SEQ ID NO:87), gatcacatctcatgccattg (SEQ ID NO:88), caatgtgtctaattgcatct (SEQ ID NO:89), cgagatgcaattagacacat (SEQ ID NO:90), gtctgataatccaaaatctg (SEQ ID N0:91), gcatacgctgttgccagaag (SEQ ID NO:92),
  • Atttggacattgctgcagaa SEQ ID NO:97
  • atgctcatatgggtgagcgt SEQ ID NO:98
  • gcagttacactgagcagcca (SEQ ID NO:99), gtgtggttgagtcttgggga (SEQ ID NO: 100),
  • a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene MAT1A comprises at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to the nucleotide sequence aggaatggtgttgctctgtg (SEQ ID NO: 87).
  • a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene MAT1A comprises at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to the nucleotide sequence gatcacatctcatgccattg (SEQ ID NO:88).
  • a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene MAT1A comprises at least 90% sequence identity to the nucleotide sequence caatgtgtctaattgcatct (SEQ ID NO:89). In some cases, a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene MAT1A comprises at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to the nucleotide sequence cgagatgcaattagacacat (SEQ ID NO:90).
  • a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene ACOX1 comprises at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to the nucleotide sequence aataccagcattggcagtcc(SEQ ID NO:76).
  • a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene ACOX1 comprises at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to the nucleotide sequence gtctgataatccaaaatctg (SEQ ID NO:91).
  • a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene ACOX 1 comprises at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to the nucleotide sequence gcatacgctgttgccagaag (SEQ ID NO:92).
  • a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene ACOX1 comprises at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to the nucleotide sequence gactgccaatgctggtattg (SEQ ID NO:93).
  • a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene ACOX1 comprises at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to the nucleotide sequence cgaatggcctgtggtgggca (SEQ ID NO:94).
  • a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene SIRT7 comprises at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to the nucleotide sequence gcttcgatcccagactaccg (SEQ ID NO:95).
  • a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene SIRT7 comprises at least 90% sequence identity to the nucleotide sequence gcaatgtccaaatgccattg (SEQ ID NO:96). In some cases, a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene SIRT7 comprises at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to the nucleotide sequence atttggacattgctgcagaa (SEQ ID NO:97).
  • a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene SIRT7 comprises at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to the nucleotide sequence atgctcatatgggtgagcgt (SEQ ID NO:98).
  • a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene LEPR comprises at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to the nucleotide sequence gcagccacactgagcagcca(SEQ ID NO:77). In some cases, a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene LEPR comprises at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to the nucleotide sequence gcagttacactgagcagcca (SEQ ID NO:99).
  • a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene LEPR comprises at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to the nucleotide sequence gtgtggttgagtcttgggga (SEQ ID NO: 100).
  • a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene LEPR comprises at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to the nucleotide sequence tcaaccacacttacgtcatg (SEQ ID NO: 101).
  • a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene LEPR comprises at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to the nucleotide sequence
  • a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene LEP comprises at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to the nucleotide sequence ctcctgcagctcttcccgct (SEQ ID NO:79).
  • a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene LEP comprises at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to the nucleotide sequence aaaaactacgggcggatgcg (SEQ ID NO: 103).
  • a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene LEP comprises at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to the nucleotide sequence atccccgagccgcgcgctga (SEQ ID NO: 104).
  • a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene LEP comprises at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to the nucleotide sequence catccccgagccgcgcgctg (SEQ ID NO: 105).
  • a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene LEP comprises at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to the nucleotide sequence
  • a Cas9 guide RNA includes two separate nucleic acid molecules: an "activator” and a “targeter” and is referred to herein as a “dual Cas9 guide RNA", a “double- molecule Cas9 guide RNA”, or a “two-molecule Cas9 guide RNA” a “dual guide RNA”, or a “dgRNA.”
  • the activator and targeter are covalently linked to one another (e.g., via intervening nucleotides) and the guide RNA is referred to as a "single guide RNA", a “Cas9 single guide RNA", a “single-molecule Cas9 guide RNA,” or a “one-molecule Cas9 guide RNA”, or simply "sgRNA.”
  • a Cas9 guide RNA can also be said to include 3 parts: (i) a targeting sequence (a)
  • nucleotide sequence that hybridizes with a sequence of the target nucleic acid (ii) an activator sequence (as described above)(in some cases, referred to as a tracr sequence); and (iii) a sequence that hybridizes to at least a portion of the activator sequence to form a double stranded duplex.
  • a targeter has (i) and (iii); while an activator has (ii).
  • a Cas9 guide RNA (e.g. a dual guide RNA or a single guide RNA) can be comprised of any corresponding activator and targeter pair.
  • the duplex forming segments can be swapped between the activator and the targeter.
  • the targeter includes a sequence of nucleotides from a duplex forming segment of a tracrRNA (which sequence would normally be part of an activator) while the activator includes a sequence of nucleotides from a duplex forming segment of a crRNA (which sequence would normally be part of a targeter).
  • a targeter comprises both the targeting segment (single stranded) of the
  • a corresponding tracrRNA-like molecule comprises a stretch of nucleotides (a duplex-forming segment) that forms the other half of the dsRNA duplex of the protein-binding segment of the Cas9 guide RNA.
  • a stretch of nucleotides of the targeter is complementary to and hybridizes with a stretch of nucleotides of the activator to form the dsRNA duplex of the protein- binding segment of a Cas9 guide RNA.
  • each targeter can be said to have a
  • a targeter and an activator hybridize to form a Cas9 guide RNA.
  • the particular sequence of a given naturally existing crRNA or tracrRNA molecule is characteristic of the species in which the RNA molecules are found. Examples of suitable activator and targeter are well known in the art.
  • the first segment of a subject guide nucleic acid includes a guide sequence (i.e., a
  • targeting sequence (a nucleotide sequence that is complementary to a sequence (a target site) in a target nucleic acid).
  • the targeting segment of a subject guide nucleic acid can interact with a target nucleic acid (e.g., double stranded DNA (dsDNA)) in a sequence-specific manner via hybridization (i.e., base pairing).
  • dsDNA double stranded DNA
  • the nucleotide sequence of the targeting segment may vary (depending on the target) and can determine the location within the target nucleic acid that the Cas9 guide RNA and the target nucleic acid will interact.
  • the targeting segment of a Cas9 guide RNA can be modified (e.g., by genetic engineering)/designed to hybridize to any desired sequence (target site) within a target nucleic acid (e.g., a eukaryotic target nucleic acid such as genomic DNA).
  • a target nucleic acid e.g., a eukaryotic target nucleic acid such as genomic DNA.
  • the targeting segment can have a length of 7 or more nucleotides (nt) (e.g., 8 or more, 9 or more, 10 or more, 12 or more, 15 or more, 20 or more, 25 or more, 30 or more, or 40 or more nucleotides). In some cases, the targeting segment can have a length of from 7 to 100 nucleotides (nt) (e.g., from 7 to 80 nt, from 7 to 60 nt, from 7 to 40 nt, from 7 to 30 nt, from 7 to 25 nt, from
  • the complementary to a nucleotide sequence (target site) of the target nucleic acid can have a length of 10 nt or more.
  • the targeting sequence of the targeting segment that is complementary to a target site of the target nucleic acid can have a length of 12 nt or more, 15 nt or more, 18 nt or more, 19 nt or more, or 20 nt or more.
  • the nucleotide sequence (the targeting sequence) of the targeting segment that is complementary to a nucleotide sequence (target site) of the target nucleic acid has a length of 12 nt or more.
  • the nucleotide sequence (the targeting sequence) of the targeting segment that is complementary to a nucleotide sequence (target site) of the target nucleic acid has a length of 18 nt or more.
  • the targeting sequence of the targeting segment that is complementary to a target sequence of the target nucleic acid can have a length of from 10 to 100 nucleotides (nt) (e.g., from 10 to 90 nt, from 10 to 75 nt, from 10 to 60 nt, from 10 to 50 nt, from 10 to 35 nt, from 10 to 30 nt, from 10 to 25 nt, from 10 to 22 nt, from 10 to 20 nt, from 12 to 100 nt, from 12 to 90 nt, from 12 to 75 nt, from 12 to 60 nt, from 12 to 50 nt, from 12 to 35 nt, from 12 to 30 nt, from 12 to 25 nt, from 12 to 22 nt, from 12 to 20 nt, from 15 to 100 nt, from 15 to 90 nt, from 15 to 75 nt, from 15 to 60 nt, from 15 to 50 nt, from 15 to 35 nt, from 10 to 30 nt
  • the targeting sequence of the targeting segment that is complementary to a target sequence of the target nucleic acid has a length of from 15 nt to 30 nt. In some cases, the targeting sequence of the targeting segment that is complementary to a target sequence of the target nucleic acid has a length of from 15 nt to 25 nt. In some cases, the targeting sequence of the targeting segment that is complementary to a target sequence of the target nucleic acid has a length of from 18 nt to 30 nt. In some cases, the targeting sequence of the targeting segment that is complementary to a target sequence of the target nucleic acid has a length of from 18 nt to 25 nt.
  • the targeting sequence of the targeting segment that is complementary to a target sequence of the target nucleic acid has a length of from 18 nt to 22 nt. In some cases, the targeting sequence of the targeting segment that is complementary to a target site of the target nucleic acid is 20 nucleotides in length. In some cases, the targeting sequence of the targeting segment that is complementary to a target site of the target nucleic acid is 19 nucleotides in length.
  • the percent complementarity between the targeting sequence (guide sequence) of the targeting segment and the target site of the target nucleic acid can be 60% or more (e.g., 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%). In some cases, the percent complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% over the seven contiguous 5 '-most nucleotides of the target site of the target nucleic acid.
  • the percent complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 60% or more over about 20 contiguous nucleotides. In some cases, the percent complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% over the fourteen contiguous 5 '-most nucleotides of the target site of the target nucleic acid and as low as 0% or more over the remainder. In such a case, the targeting sequence can be considered to be 14 nucleotides in length.
  • the percent complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% over the seven contiguous 5 '-most nucleotides of the target site of the target nucleic acid and as low as 0% or more over the remainder.
  • the targeting sequence can be considered to be 20 nucleotides in length.
  • the percent complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% over the 7 contiguous 5'- most nucleotides of the target site of the target nucleic acid (which can be complementary to the 3'-most nucleotides of the targeting sequence of the Cas9 guide RNA). In some cases, the percent complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% over the 8 contiguous 5 '-most nucleotides of the target site of the target nucleic acid (which can be complementary to the 3 '-most nucleotides of the targeting sequence of the Cas9 guide RNA).
  • the percent complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% over the 9 contiguous 5 '-most nucleotides of the target site of the target nucleic acid (which can be complementary to the 3 '-most nucleotides of the targeting sequence of the Cas9 guide RNA). In some cases, the percent complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% over the 10 contiguous 5 '-most nucleotides of the target site of the target nucleic acid (which can be complementary to the 3 '-most nucleotides of the targeting sequence of the Cas9 guide RNA).
  • the percent complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% over the 17 contiguous 5 '-most nucleotides of the target site of the target nucleic acid (which can be complementary to the 3'- most nucleotides of the targeting sequence of the Cas9 guide RNA). In some cases, the percent complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% over the 18 contiguous 5 '-most nucleotides of the target site of the target nucleic acid (which can be complementary to the 3 '-most nucleotides of the targeting sequence of the Cas9 guide RNA).
  • the percent complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 60% or more (e.g., e.g., 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%) over about 20 contiguous nucleotides. In some cases, the percent complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% over the 7 contiguous 5'- most nucleotides of the target site of the target nucleic acid and as low as 0% or more over the remainder.
  • the targeting sequence can be considered to be 7 nucleotides in length.
  • the percent complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% over the 8 contiguous 5 '-most nucleotides of the target site of the target nucleic acid and as low as 0% or more over the remainder.
  • the targeting sequence can be considered to be 8 nucleotides in length.
  • the percent complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% over the 9 contiguous 5 '-most nucleotides of the target site of the target nucleic acid and as low as 0% or more over the remainder.
  • the targeting sequence can be considered to be 9 nucleotides in length.
  • the percent complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% over the 10 contiguous 5 '-most nucleotides of the target site of the target nucleic acid and as low as 0% or more over the remainder.
  • the targeting sequence can be considered to be 10 nucleotides in length.
  • the percent complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% over the 11 contiguous 5'- most nucleotides of the target site of the target nucleic acid and as low as 0% or more over the remainder.
  • the targeting sequence can be considered to be 11 nucleotides in length.
  • the percent complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% over the 12 contiguous 5'- most nucleotides of the target site of the target nucleic acid and as low as 0% or more over the remainder.
  • the targeting sequence can be considered to be 12 nucleotides in length.
  • the percent complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% over the 13 contiguous 5'- most nucleotides of the target site of the target nucleic acid and as low as 0% or more over the remainder.
  • the targeting sequence can be considered to be 13 nucleotides in length.
  • the percent complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% over the 14 contiguous 5'- most nucleotides of the target site of the target nucleic acid and as low as 0% or more over the remainder.
  • the targeting sequence can be considered to be 14 nucleotides in length.
  • the percent complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% over the 17 contiguous 5'- most nucleotides of the target site of the target nucleic acid and as low as 0% or more over the remainder.
  • the targeting sequence can be considered to be 17 nucleotides in length.
  • the percent complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% over the 18 contiguous 5'- most nucleotides of the target site of the target nucleic acid and as low as 0% or more over the remainder.
  • the targeting sequence can be considered to be 18 nucleotides in length.
  • the protein-binding segment of a subject Cas9 guide RNA interacts with a Cas9 protein.
  • the Cas9 guide RNA guides the bound Cas9 protein to a specific nucleotide sequence within target nucleic acid via the above mentioned targeting segment.
  • the protein-binding segment of a Cas9 guide RNA comprises two stretches of nucleotides that are complementary to one another and hybridize to form a double stranded RNA duplex (dsRNA duplex).
  • dsRNA duplex double stranded RNA duplex
  • the protein-binding segment includes a dsRNA duplex.
  • the protein-binding segment also includes stem loop 1 (the "nexus") of a Cas9 guide RNA.
  • the activator of a Cas9 guide RNA includes (i) a duplex forming segment that contributes to the dsRNA duplex of the protein-binding segment; and (ii) nucleotides 3' of the duplex forming segment, e.g., that form stem loop 1 (the "nexus”).
  • the protein- binding segment includes stem loop 1 (the ' 'nexus") of a Cas9 guide RNA.
  • the protein-binding segment includes 5 or more nucleotides (nt) (e.g., 6 or more, 7 or more, 8 or more, 9 or more, 10 or more, 11 or more, 12 or more, 15 or more, 20 or more, 30 or more, 40 or more, 50 or more, 60 or more, 70 or more, 75 or more, or 80 or more nt) 3' of the dsRNA duplex (where 3' is relative to the duplex-forming segment of the activator sequence).
  • nt nucleotides
  • activator and targeter is sometimes referred to herein as the "stem loop".
  • activator activator RNA, tracrRNA
  • Cas9 guide RNAs e.g., 5.
  • pyogenes guide RNAs has 3 stem loops (3 hairpins) that are 3' of the duplex-forming segment of the activator.
  • stem loop 1 The closest stem loop to the duplex-forming segment of the activator (3' of the duplex forming segment) is called “stem loop 1" (and is also referred to herein as the "nexus”); the next stem loop is called “stem loop 2" (and is also referred to herein as the "hairpin 1”); and the next stem loop is called “stem loop 3" (and is also referred to herein as the "hairpin 2").
  • a Cas9 guide RNA sgRNA or dgRNA
  • sgRNA or dgRNA e.g., a full length Cas9 guide
  • RNA has stem loops 1, 2, and 3.
  • an activator of a Cas9 guide RNA
  • an activator has stem loop 1, but does not have stem loop 2 and does not have stem loop 3.
  • an activator of a Cas9 guide RNA
  • an activator of a Cas9 guide RNA
  • the activator (e.g., tracr sequence) of a Cas9 guide RNA includes (i) a duplex forming segment that contributes to the dsRNA duplex of the protein-binding segment; and (ii) a stretch of nucleotides (e.g., referred to herein as a 3' tail) 3' of the duplex forming segment.
  • the additional nucleotides 3' of the duplex forming segment form stem loop 1.
  • the activator (e.g., tracr sequence) of a Cas9 guide RNA includes (i) a duplex forming segment that contributes to the dsRNA duplex of the protein-binding segment; and (ii) 5 or more nucleotides (e.g., 6 or more, 7 or more, 8 or more, 9 or more, 10 or more, 11 or more, 12 or more, 13 or more, 14 or more, 15 or more, 20 or more, 25 or more, 30 or more, 35 or more, 40 or more, 45 or more, 50 or more, 60 or more, 70 or more, or 75 or more nucleotides) 3' of the duplex forming segment.
  • nucleotides e.g., 6 or more, 7 or more, 8 or more, 9 or more, 10 or more, 11 or more, 12 or more, 13 or more, 14 or more, 15 or more, 20 or more, 25 or more, 30 or more, 35 or more, 40 or more, 45 or more, 50 or more, 60 or more, 70
  • the activator (activator RNA) of a Cas9 guide RNA includes (i) a duplex forming segment that contributes to the dsRNA duplex of the protein-binding segment; and (ii) 5 or more nucleotides (e.g., 6 or more, 7 or more, 8 or more, 9 or more, 10 or more, 11 or more, 12 or more, 13 or more, 14 or more, 15 or more, 20 or more, 25 or more, 30 or more, 35 or more, 40 or more, 45 or more, 50 or more, 60 or more, 70 or more, or 75 or more nucleotides) 3' of the duplex forming segment.
  • nucleotides e.g., 6 or more, 7 or more, 8 or more, 9 or more, 10 or more, 11 or more, 12 or more, 13 or more, 14 or more, 15 or more, 20 or more, 25 or more, 30 or more, 35 or more, 40 or more, 45 or more, 50 or more, 60 or more, 70 or more, or 75
  • the activator (e.g., tracr sequence) of a Cas9 guide RNA includes (i) a duplex forming segment that contributes to the dsRNA duplex of the protein-binding segment; and (ii) a stretch of nucleotides (e.g., referred to herein as a 3' tail) 3' of the duplex forming segment.
  • the stretch of nucleotides 3' of the duplex forming segment has a length in a range of from 5 to 200 nucleotides (nt) (e.g., from 5 to 150 nt, from 5 to 130 nt, from 5 to 120 nt, from 5 to 100 nt, from 5 to 80 nt, from 10 to 200 nt, from 10 to 150 nt, from 10 to 130 nt, from 10 to 120 nt, from 10 to 100 nt, from 10 to 80 nt, from 12 to 200 nt, from 12 to 150 nt, from 12 to 130 nt, from 12 to 120 nt, from 12 to 100 nt, from 12 to 80 nt, from 15 to 200 nt, from 15 to 150 nt, from 15 to 130 nt, from 15 to 120 nt, from 15 to 100 nt, from 15 to 80 nt, from 20 to 200 nt, from 20 to 150 nt, from 20 to 130 n
  • nucleotides of the 3' tail of an activator RNA are wild type sequences.
  • Examples of various Cas9 proteins and Cas9 guide RNAs (as well as information regarding requirements related to protospacer adjacent motif (PAM) sequences present in targeted nucleic acids) can be found in the art, for example, see Jinek et al., Science. 2012 Aug 17;337(6096):816-21 ; Chylinski et al., RNA Biol. 2013
  • RNAs corresponding to type V and type VI CRISPR/Cas endonucleases e.g., Cpfl Guide RNA
  • a guide RNA that binds to a type V or type VI CRISPR/Cas protein e.g., Cpfl, C2cl,
  • C2c2, C2c3 targets the complex to a specific location within a target nucleic acid is referred to herein generally as a "type V or type VI CRISPR/Cas guide RNA" .
  • An example of a more specific term is a "Cpfl guide RNA.”
  • a type V or type VI CRISPR/Cas guide RNA can have a total length of from 30 nucleotides (nt) to 200 nt, e.g., from 30 nt to 180 nt, from 30 nt to 160 nt, from 30 nt to 150 nt, from 30 nt to 125 nt, from 30 nt to 100 nt, from 30 nt to 90 nt, from 30 nt to 80 nt, from 30 nt to 70 nt, from 30 nt to 60 nt, from 30 nt to 50 nt, from 50 nt to 200 nt, from 50 nt to 180 nt, from 50 nt to 160 nt, from 50 nt to 150 nt, from 50 nt to 125 nt, from 50 nt to 100 nt, from 50 nt to 90 nt, from 50
  • a type V or type VI CRISPR/Cas guide RNA (e.g., cpfl guide RNA) has a total length of at least 30 nt (e.g., at least 40 nt, at least 50 nt, at least 60 nt, at least 70 nt, at least 80 nt, at least 90 nt, at least 100 nt, or at least 120 nt,).
  • RNA can have 100% complementarity with a corresponding length of target nucleic acid sequence.
  • the guide sequence can have less than 100% complementarity with a corresponding length of target nucleic acid sequence.
  • the guide sequence of a type V or type VI CRISPR/Cas guide RNA e.g., cpfl guide RNA
  • the target nucleic acid-binding segment has 100% complementarity to the target nucleic acid sequence.
  • the target nucleic acid-binding segment has 1 non-complementary nucleotide and 24 complementary nucleotides with the target nucleic acid sequence.
  • the target nucleic acid- binding segment has 2 non-complementary nucleotides and 23 complementary nucleotides with the target nucleic acid sequence.
  • the genetically modified organism will include a nucleic acid encoding a
  • the nucleotide sequence encoding the CRISPR/Cas endonuclease and/or a transcription control element that is operably linked to the nucleotide sequence will include a CRISPR/Cas target sequence (e.g., via a subject heterologous integrated nucleic acid).
  • CRISPR/Cas target sequence will be the same as the CRISPR/Cas target sequence integrated elsewhere in the genome.
  • CRISPR/Cas target sequence will be different than the target sequence integrated elsewhere (e.g., will be a second CRISPR/Cas target sequence), and a second guide RNA (a second species of guide RNA, having a guide sequence that hybridizes with the second target sequence) would be needed to target the second target sequence.
  • the nucleic acid encoding the CRISPR/Cas endonuclease e.g., a Cas9 protein
  • the nucleic acid will not be integrated (e.g., will be episomally or transiently maintained).
  • a subject genetically modified cell or non-human organism; e.g., bird.
  • the components of a CRISPR/Cas system can be delivered (introduced into a cell) as DNA, RNA, or protein.
  • the composition when the composition includes a class 2 CRISPR/Cas endonuclease (e.g., Cas9, Cpfl, etc.) and a corresponding guide RNA (e.g., a Cas9 guide RNA, a Cpfl guide RNA, etc.), the endonuclease and guide RNA can be delivered (introduced into the cell) as an RNP complex (i.e., a pre- assembled complex of the CRISPR/Cas endonuclease and the corresponding CRISPR/Cas guide RNA).
  • an RNP complex i.e., a pre- assembled complex of the CRISPR/Cas endonuclease and the corresponding CRISPR/Cas guide RNA.
  • a class 2 CRISPR/Cas endonuclease can be introduced into a cell as a protein.
  • a class 2 CRISPR/Cas endonuclease can be introduced into a cell as a nucleic acid (DNA and/or RNA) encoding the endonuclease.
  • a CRISPR/Cas guide RNA can be introduced into a cell as RNA, or as DNA encoding the guide RNA.
  • the method may include inducing expression of the CRISPR/Cas endonuclease.
  • a donor polynucleotide (a nucleic acid comprising a donor sequence) can also be provided to the cell.
  • a donor sequence or "donor
  • polynucleotide it is meant a nucleic acid sequence to be inserted at the site cleaved by the CRISPR/Cas protein.
  • the donor polynucleotide can contain sufficient homology to a genomic sequence at the target site, e.g. 70%, 80%, 85%, 90%, 95%, or 100% homology with the nucleotide sequences flanking the target site, e.g. within about 50 bases or less of the target site, e.g. within about 30 bases, within about 15 bases, within about 10 bases, within about 5 bases, or immediately flanking the target site, to support homology-directed repair between it and the genomic sequence to which it bears homology.
  • Donor polynucleotides can be of any length, e.g. 10 nucleotides or more, 50 nucleotides or more, 100 nucleotides or more, 250 nucleotides or more, 500 nucleotides or more, 1000 nucleotides or more, 5000 nucleotides or more, etc.
  • the present disclosure relates to a genetically modified bird, wherein the genetically modified bird is genetically modified to comprise a disruption in one or more target genes, wherein the one or more target genes is a fatty acid metabolism pathway gene, a gene that controls appetite, or a gene that regulates fatty acid storage; wherein the disruption results in a fatty liver.
  • the present disclosure also provides an organ (e.g., an isolated organ) obtained from a genetically modified bird of the present disclosure. In some cases, the isolated organ from the genetically modified bird is a liver. In some cases, the isolated organ from the genetically modified bird is a fatty liver. In some cases, the organ isolated from a genetically modified bird of the present disclosure is not an embryo.
  • the present disclosure also provides a food product (e.g., an unprocessed food product; where examples of such unprocessed food products are meat and eggs) obtained from a genetically modified bird of the present disclosure.
  • an organ of the present disclosure has greater than 30 weight percent fat. In some cases, the organ has greater than 40 weight percent fat. In some cases, the organ has greater than 50 weight percent fat. In some cases, the organ is 5 to 7 times the size of an organ from a naturally produced bird (i.e., a bird that is not genetically modified).
  • the present disclosure provides a method of producing a food product, the method
  • the food product is foie gras.
  • a method of harvesting and processing the organ of a bird is well known to those skilled in the art, for example, in Brun et al., ((2015) BMC Genet , 16: 145).
  • Foie gras is a food product made of the liver of a duck or goose that has been fattened by force feeding. See, e.g., Skippon et al, (2013) Can Vet J. ; 54(4):403-404.
  • the present disclosure provides a method of producing a fatty liver in a genetically
  • the genetically modified bird is not force fed in order to produce foie gras. In some cases, the genetically modified bird is fed a special diet that, along with the genetic modification, gives rise to a fatty liver.
  • the genetically modified bird is force-fed in order to produce foie gras. In some cases, the genetically modified bird is force-fed for a shorter period of time than generally required to produce foie gras. (Skippon et al., (2013) Can Vet J. ; 54(4):403-404; Guemene et al., (2004) World's Poultry Science Journal.; 60:211-222) In some cases, the genetically modified bird is force -fed less than 2-3 times a day. In some cases, the genetically modified bird is force- fed for less than 2-4 weeks. In some cases, the genetically modified bird is force -fed less than 2- 3 times a day for less than 2-4 weeks.
  • the genetically modified bird is fed a methionine and choline deficient diet (MCD), a choline deficient diet (CD), a high-fat containing diet (HFD), or a conjugated linoleic acid containing (CLA) diet during at least one of a plurality of growth periods.
  • MCD methionine and choline deficient diet
  • CD choline deficient diet
  • HFD high-fat containing diet
  • CLA conjugated linoleic acid containing
  • CLA Conjugated linoleic acid
  • a method for producing a fatty liver comprises feeding a CLA containing diet to a genetically modified bird of the present disclosure during at least one of a plurality of growth periods; and harvesting the liver from the genetically modified bird.
  • a genetically modified bird of the present disclosure produces a fatty liver by feeding a CLA containing diet to the genetically modified bird.
  • Examples of the CLA containing diet can be found in US Patent Application No. 20060182785, which is hereby incorporated by reference in its entirety.
  • One embodiment provides a method for producing a fatty liver includes producing
  • poultry with CLA enhanced nutritional properties including preparing a CLA containing diet, selecting a poultry species, feeding the CLA containing diet to the genetically modified bird and harvesting at least one of a plurality of CLA enhanced poultry products.
  • Feeding the CLA containing diet to a genetically modified bird of the present disclosure can include feeding the CLA containing diet to the selected poultry species during one or more periods within the life of that animal.
  • the life periods can include a starter period, a grower period, a breeding period and a mature period.
  • the CLA containing diet can include a CLA isomer mixture.
  • the CLA containing diet can include a CLA isomer mixture in addition to a typical diet
  • the CLA containing diet can include a CLA isomer mixture that replaces at least a portion of a typical diet
  • the specific isomer content of the CLA isomer mixture can include about 25% to about 50% cis-9, trans-11 CLA and about 25% to about 100% trans-10, cis-12 CLA.
  • the CLA containing diet can include between about 45 and about 65% carbohydrate, between about 10 and about 25% protein and between about 3 and about 10% fat, wherein the fat includes about 25% to about 100% of the CLA isomer mixture.
  • the CLA enhanced poultry products can include a fatty liver, a CLA enhanced meat product, and a CLA enhanced egg. Foie gras can be produced using the fatty liver.
  • a genetically modified bird of the present disclosure is selected and the
  • CLA containing diet is fed to the genetically modified bird during at least one period in the life of the animal.
  • One or more CLA enhanced poultry products can be harvested.
  • Methionine and choline deficient (MCD) diet are examples of methionine and choline deficient (MCD) diet.
  • a diet deficient in both methionine and choline is widely used to induce fatty liver in rodents and typically contains about 20% fat by energy (Fatty_Liver_Disease_2012, Ricci et al., 2012).
  • Examples of methionine and choline deficient diets tested in animals to induce and study non-alcoholic fatty liver disease can be found in US Patent Nos 9061009, 7883904, 8003620, which are all hereby incorporated by reference in their entirety.
  • a genetically modified bird of the present disclosure produces a fatty liver by feeding a MCD diet to the genetically modified bird.
  • a method for producing a fatty liver comprises feeding a MCD diet to the genetically modified bird during at least one of a plurality of growth periods; and harvesting the liver from the genetically modified bird.
  • a choline defieicnet (CD) diet is commonly used to induce fatty livers in rodents.
  • a genetically modified bird of the present disclosure produces a fatty liver by feeding a CD diet to the genetically modified bird.
  • a method for producing a fatty liver comprises feeding a CD diet to the genetically modified bird during at least one of a plurality of growth periods; and harvesting the liver from the genetically modified bird.
  • High-fat containing diet HFD
  • a high-fat containing diet is commonly used to induce fatty liver in rodents.
  • a high -fat diet has been shown to increase liver fat within days (Ricci et al., 2012, Fatty Liver Disease 2012)
  • Examples of high-fat containing diet tested in animals to induce and study nonalcoholic fatty liver disease or steatosis can be found in US Patent Nos. 9061009, which is hereby incorporated by reference in its entirety.
  • a genetically modified bird produces of the present disclosure a fatty liver by feeding a HFD to the genetically modified bird.
  • a method for producing a fatty liver comprises feeding a HFD to the genetically modified bird during at least one of a plurality of growth periods; and harvesting the liver from the genetically modified bird.
  • the present disclosure provides a genetically modified bird that has been modified to include a disruption in one or more target genes, wherein the one or more target genes is a fatty acid metabolism pathway gene, a gene that controls appetite, or a gene that regulates fatty acid storage, wherein the disruption results in a fatty liver.
  • the bird comprising genetically modified germ cells or genetically modified spermatozoa of the disclosure, and the genetically modified bird according to the present disclosure, may be used in the production of food.
  • the methods of the present disclosure can be applicable to the production of poultry products for human and animal consumption. Methods of the disclosure are also applicable to the production of luxury food products such as foie gras.
  • Methods of producing food from poultry are well known in the art and may comprise the harvesting of meat and/or eggs from poultry such as, but not limited to, duck or geese. See, e.g., US Patent Application No. 14394712.
  • the genetically modified birds find use in a variety of applications, including, but not limited to, food production, research, and the like. For example, the genetically modified birds find use in producing food products that are high in fatty acid than those produced naturally. The genetically modified birds find use in research, the study the effects of non-alcoholic fatty liver disease.
  • the present disclosure provides methods for producing food products from a genetically modified bird of the present disclosure, and food products harvested from a genetically modified bird.
  • the methods generally involve harvesting a food product from a subject genetically modified bird. Where the food product requires further processing, the methods involve harvesting a food product from a genetically modified bird, and processing the food product.
  • the disclosure provides a method of producing a processed food product, involving processing a food product harvested from a genetically modified bird.
  • the disclosure further provides a processed food product obtained by processing a food product harvested from a genetically modified bird.
  • Methods of harvesting food products from a subject genetically modified bird are well known to those in the agricultural and food production industries. Where a subject genetically modified bird produces a fatty liver, the liver is harvested by standard abattoir methods. Where the subject transgenic animal is a transgenic poultry, and the food product is an egg, the eggs are harvested in the usual manner. Methods of processing a food product harvested from a subject genetically modified bird are standard in the food processing art and are well known to those in the field. Where the subject transgenic animal is a transgenic poultry, and the food product is meat, the meat is harvested in the usual manner. [00241] The present disclosure further provides food products produced by a subject genetically modified bird, and processed food products made with such food products.
  • a subject food product includes a food product that contains a meat, egg, or other product of a subject genetically modified bird.
  • a subject food product includes an organ, or a processed product of an organ, of a subject genetically modified bird.
  • Food products include any preparation for human consumption including for enteral or parenteral consumption, which when taken into the body (a) serve to nourish or build up tissues or supply energy and/or (b) maintain, restore or support adequate nutritional status or metabolic function.
  • Food products produced from an organ obtained from a subject genetically modified bird can include foie gras.
  • the present disclosure provides production of foie gras by isolating and processing the fatty liver of the genetically modified bird with minimal or no need for force- feeding.
  • the present disclosure further provides a method for making a genetically modified bird, where the genetically modified bird can be used as models for studying non-alcoholic fatty liver disease or hepatic steatosis.
  • the subject genetically modified birds find use in research, to study fatty acid synthesis and regulation, fatty acid storage, and appetite control.
  • the disclosure provides a method to study such conditions associated with non-alcoholic fatty liver disease and hepatic steatosis such as: obesity, insulin resistance, and type 2 diabetes.
  • the method for making a genetically modified bird can also be used to generate a wide range of genetically modified birds, including models for studying avian influenza.
  • the present disclose further provides use of a genetically modified bird of the present disclosure for research applications.
  • the present disclosure provides a method of determining the effect of a test agent on one or more of: i) fatty acid synthesis; ii) fatty acid regulation; iii) fatty acid storage; and iv) appetite control, the method comprising: a)
  • a test agent administering to a genetically modified bird of the present disclosure a test agent; and b) determining the effect of the test agent on one or more of i) fatty acid synthesis; ii) fatty acid regulation; iii) fatty acid storage; and iv) appetite control.
  • Aspect 1 A genetically modified bird, wherein the genetically modified bird is
  • the one or more target genes is a: a) fatty acid metabolism pathway gene; b) gene that controls appetite; or c) gene that regulates fatty acid storage, wherein the disruption results in development of a fatty liver.
  • Aspect 2 The genetically modified bird of aspect 1 , wherein the bird is a duck.
  • Aspect 3 The genetically modified bird of aspect 1, wherein the bird is a goose.
  • Aspect 4 The genetically modified bird of aspect 1 , wherein the bird is a chicken.
  • Aspect 5 The genetically modified bird of any one of aspects 1-4, wherein the genetic modification is present in multiple organs.
  • Aspect 6 The genetically modified bird of any one of aspects 1-4, wherein the genetic modification is liver specific.
  • Aspect 7 The genetically modified bird of any one of aspects 1-6, wherein the one or more target genes comprises a nucleotide sequence having least 80% nucleotide sequence identity to the nucleotide sequence of a gene selected from: MATIA (SEQ ID NO:51), ACOXl (SEQ ID NO:52), LEPR (SEQ ID NO:53), LEP (SEQ ID NO:54), SIRT7 (SEQ ID NO:55), APOIA (SEQ ID NO:56), SIRT1 (SEQ ID NO:57), SIRT3 (SEQ ID NO:58), SIRT4 (SEQ ID NO:59), SIRT5 (SEQ ID NO:60), SIRT6 (SEQ ID NO:61), and PTEN (SEQ ID NO:62).
  • MATIA SEQ ID NO:51
  • ACOXl SEQ ID NO:52
  • LEPR SEQ ID NO:53
  • LEP SEQ ID NO:54
  • SIRT7 SEQ ID NO:55
  • APOIA SEQ ID
  • Aspect 8 The genetically modified bird of any one of aspects 1-6, wherein the one or more target genes comprises a nucleotide sequence having least 90% nucleotide sequence identity to the nucleotide sequence of a gene selected from: MATIA (SEQ ID NO:51), ACOXl (SEQ ID NO:52), LEPR (SEQ ID NO:53), LEP (SEQ ID NO:54), SIRT7 (SEQ ID NO:55), APOIA (SEQ ID NO:56), SIRT1 (SEQ ID NO:57), SIRT3 (SEQ ID NO:58), SIRT4 (SEQ ID NO:59), SIRT5 (SEQ ID NO:60), SIRT6 (SEQ ID NO:61), and PTEN (SEQ ID NO:62).
  • MATIA SEQ ID NO:51
  • ACOXl SEQ ID NO:52
  • LEPR SEQ ID NO:53
  • LEP LEP
  • SIRT7 SEQ ID NO:55
  • APOIA SEQ ID NO:56
  • Aspect 9 An organ or food product isolated from the genetically modified bird of any one of aspects 1-8.
  • Aspect 10 The organ or food product of aspect 9, wherein the organ is a liver; or
  • the food product is meat or an egg.
  • Aspect 11 The organ or food product of aspect 10, wherein the organ has greater than
  • a food product (e.g., a processed food product) produced from the isolated organ or food product of any one of aspects 9-11.
  • Aspect 13 The processed food product of aspect 12, wherein the product is foie gras.
  • a method of producing a food product comprising: a) harvesting an organ or food product from the genetically modified bird of any one of aspects 1-8; and b) processing the organ or food product, to produce a processed food product.
  • Aspect 15 The method of aspect 14, wherein the processed food product is foie gras.
  • a method for producing a fatty liver comprising: a) feeding a methionine and choline deficient (MCD) diet, a choline -deficient diet (CD), a high-fat containing diet (HFD), or a conjugated linoleic acid (CLA) containing diet to the genetically modified bird of any one of aspects 1-8 during at least one of a plurality of growth periods; and b) harvesting the liver from the genetically modified bird.
  • MCD methionine and choline deficient
  • CD choline -deficient diet
  • HFD high-fat containing diet
  • CLA conjugated linoleic acid
  • a method for producing foie gras comprising: a) feeding a
  • MCD methionine and choline deficient
  • CD choline -deficient diet
  • HFD high-fat containing diet
  • CLA conjugated linoleic acid
  • Aspect 18 A system for generating a genetically modified bird, the composition
  • Aspect 19 The system of aspect 18, wherein the first target sequence and the second target sequence are separated from each other by at least 25 base pairs.
  • Aspect 20 The system of aspect 18, wherein the target gene comprises a nucleotide sequence having least 80% nucleotide sequence identity to the nucleotide sequence of a gene selected from: MAT1A (SEQ ID NO:51), ACOX1 (SEQ ID NO:52), LEPR (SEQ ID NO:53), LEP (SEQ ID NO:54), SIRT7 (SEQ ID NO:55), AP01A (SEQ ID NO:56), SIRT1 (SEQ ID NO:
  • SIRT3 SEQ ID NO:58
  • SIRT4 SEQ ID NO:59
  • SIRT5 SEQ ID NO:60
  • Aspect 21 The system of aspect 18, wherein the composition further comprises a class 2
  • CRISPR/Cas endonuclease or a nucleic acid comprising a nucleotide sequence encoding the class 2 CRISPR/Cas endonuclease.
  • Aspect 22 The system of aspect 21, wherein the class 2 CRISPR/Cas endonuclease is a
  • Aspect 23 The system of aspect 22, wherein the class 2 CRISPR /Cas endonuclease is a type V or type VI CRISPR/Cas endonuclease.
  • Aspect 24 The system of aspect 22, wherein the class 2 CRISPR/Cas endonuclease is a
  • Cpfl protein a C2cl protein, a C2c3 protein, or a C2c2 protein.
  • Aspect 25 The system of aspect 18, wherein the first and second CRISPR/Cas guide
  • RNAs are Cas9 CRISPR/Cas guide RNAs.
  • Aspect 26 The system of aspect 18, wherein the first and second CRISPR/Cas guide
  • RNAs are single molecule CRISPR/Cas guide RNAs.
  • Aspect 27 The system of aspect 18, wherein the first and second CRISPR/Cas guide
  • RNAs are dual molecule CRISPR/Cas guide RNAs.
  • a method of making the genetically modified bird of any one of aspects 1-8 comprising: a) genetically modifying: i. a bird stage X primordial germ cell; wherein genetic modification of bird stage X primordial germ cell comprise a disruption in one or more target genes, wherein the one or more target genes is a fatty acid metabolism pathway gene, a gene that controls appetite, or a gene that regulates fatty acid storage; b) delivering the genetically modified bird stage X primordial germ cell into a recipient embryo; and c) allowing the recipient embryo to hatch as a chick.
  • a method of making the genetically modified bird of any one of aspects 1-8 comprising: a) delivering a CRISPR/Cas plasmid construct into a recipient stage X embryo, wherein delivery of the CRISPR/Cas plasmid construct causes a disruption in one or more target genes of a stage X primordial germ cell in the stage X embryo, wherein the one or more target genes is a fatty acid metabolism pathway gene, a gene that controls appetite, or a gene that regulates fatty acid storage; and b) allowing the recipient embryo to hatch as a chick.
  • a method of making the genetically modified bird of any one of aspects 1-8 comprising: a) genetically modifying an avian spermatozoa, wherein the genetic modification of the avian spermatozoa comprises a disruption in one or more target genes, wherein the one or more target genes is a fatty acid metabolism pathway gene, a gene that controls appetite, or a gene that regulates fatty acid storage; b) delivering the genetically modified bird spermatozoa to a hen; c) creating a artificial embryo; and d) allowing the artificial embryo to hatch as a chick.
  • Aspect 31 The method of any one of aspects 28-30, wherein said genetic modification is achieved using a Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-CAS system.
  • CRISPR Clustered Regularly Interspaced Short Palindromic Repeats
  • Aspect 32 The method of any one of aspects 28-30, wherein said genetic modification is achieved using a Transcription activator-like effector nucleases (TALENs).
  • TALENs Transcription activator-like effector nucleases
  • Aspect 33 The method of any one of aspects 28-30, wherein said genetic modification is achieved using a Zinc Finger Nucleases (ZFNs) system.
  • ZFNs Zinc Finger Nucleases
  • Aspect 34 The method of aspect 28, wherein the stage X primordial germ cell line is delivered into the recipient embryo by injection.
  • Aspect 35 The method of aspect 30, wherein the avian spermatozoa is delivered into a hen by artificial insemination.
  • Standard abbreviations may be used, e.g., bp, base pair(s); kb, kilobase(s); pi, picoliter(s); s or sec, second(s); min, minute(s); h or hr, hour(s); aa, amino acid(s); kb, kilobase(s); bp, base pair(s); nt, nucleotide(s); i.m., intramuscular(ly); i.p., intraperitoneal(ly); s.c, subcutaneous(ly); and the like.
  • Example 1 Delivery of CRISPR/Cas9 guide RNA complexes to chicken cell lines
  • Cas9 was prepared by the UC Berkeley Macro Lab using a published protocol (Lin et al. (2014) supra). Cas9 was stored and diluted in sterile-filtered Cas9 Buffer (20 mM HEPES pH 7.5, 150 mM KC1, 1 mM MgCl 2 , 10% glycerol, 1 mM TCEP). sgRNA was synthesized by assembly polymerase chain reaction (PCR) and in vitro transcription.
  • PCR assembly polymerase chain reaction
  • a T7 RNA polymerase substrate template was assembled by PCR from a variable 58 nt primer, or a 59 nt primer with an additional guanine at the 5' end, containing T7 promoter, variable sgRNA guide sequence, and the first 15 nt of the non-variable region of the sgRNA (T7FwdVar primers, 10 nM) (Table 4, presented in FIG. 33A), and an 82 nt primer containing the reverse complement of the invariant region of the sgRNA (T7RevLong, 10 nM), along with amplification primers (T7FwdAmp, T7RevAmp, 200 nM each) (Table 6, presented in FIG. 33C).
  • SPRI solid phase reversible immobilization
  • sgRNA concentrations were determined by fluorescence using the Qubit RNA BR assay kit (Life Technologies, Inc).
  • LMH cells were grown on gelatin-coated tissue culture plates in
  • Waymouth's Medium (Thermo Fisher Scientific) supplemented with 10% fetal calf serum, penicillin, and streptomycin.
  • genomic DNA was harvested with QuickExtract DNA Extraction Solution (Epicenter, Inc.) according to the manufacturer' s protocol.
  • the edited loci were amplified by PCR using primers listed in Tables 4-6, presented in FIG. 33A-33C, respectively.
  • the PCR primers contain 5' "stubs" to allow for subsequent amplification for sequencing library preparation (see below).
  • PCR product sizes were verified by agarose gel electrophoresis, and PCR products were purified by treatment with a 5X volume of homemade solid phase reversible immobilization (SPRI) beads (comparable to Beckman-Coulter AMPure beads) and elution in DEPC-treated water.
  • SPRI solid phase reversible immobilization
  • concentrations were determined by fluorescence using the Qubit dsDNA HS assay kit (Life Technologies, Inc). A second round of PCR amplification was performed to amplify on Illumina sequencing adapters and indexes. PCR product sizes were verified by agarose gel
  • PCR products were purified by treatment with a 0.8X volume of Beckman- Coulter AMPure beads and elution in DEPC-treated water. PCR product concentrations were determined by fluorescence using the Qubit dsDNA HS assay kit (Life Technologies, Inc). Samples were pooled and sequenced on the Illumina MiSeq with 2x250 paired-end reads.
  • Sequencing reads were de -multiplexed. The sequence reads for each sample were
  • Genomic DNA from the chicken liver cells was harvested 3-4 days following delivery of CRISPR/Cas9 single guide RNAs. Frequency of insertion and deletions (INDELs) were measured using Illumina sequencing.
  • FIGs. 27-32 provide the percentage of indels for target genes MAT1A, ACOX1, SIRT7,
  • electroporation protocol was used for delivery of CRISPR/Cas9 single guide RNAs 1-4 for each target gene corresponding to SEQ ID NOs 87-90, 91-94, 95-98, 99-102, and 103-106.
  • Gene editing rates (% INDELs) for the electroporation protocol using program code CA-199 or CB- 150, which varied in time and voltage of electroporation, worked similarly, thus, editing results of the different electroporation protocols for each CRISPR/Cas9 single guide RNA complex were averaged (n 2), as shown in FIGs. 27-32.
  • Results show that delivery of CRISPR/Cas9 guide RNAs in chicken cell lines can be expressed and localized to the nucleus of chicken cells to edit the target genes MATIA, ACOXl, SIRT7, LEPR, and LEP.
  • FIG. 27 provides a plot showing the percentage of INDELs (i.e. insertions or deletions), denoted as "% edited", of the target gene MATIA for each of the CRISPR/Cas9 single guide RNAs 1-4.
  • the CRISPR/Cas9 single guide RNA #2 showed the greatest percentage of INDELs (13.06%), followed by single guide RNA #1 (10.17%), single guide RNA #3 (7.54%), and single guide RNA 4 (3.23%).
  • FIG. 28 provides a plot showing the percentage of INDELs (i.e. insertions or deletions), denoted as "% edited", of the target gene ACOXl at exon 8 for each of the CRISPR/Cas9 single guide RNAs 1-2.
  • the CRISPR/Cas9 single guide RNA #2 showed the greatest percentage of INDELs (11.28%), followed by single guide RNA #1 (9.18%).
  • FIG. 29 provides a plot showing the percentage of INDELs (i.e. insertions or deletions), denoted as "% edited", of the target gene ACOXl at exon 9 for each of the CRISPR/Cas9 single guide RNAs 3-4.
  • the CRISPR/Cas9 single guide RNA #3 showed the greatest percentage of INDELs (5.08%), followed by single guide RNA #4 (0.20%).
  • FIG. 30 provides a plot showing the percentage of INDELs (i.e. insertions or deletions), denoted as "% edited", of the target gene SIRT7 for each of the CRISPR/Cas9 single guide RNAs 1-4.
  • the CRISPR/Cas9 single guide RNA #1 showed the greatest percentage of INDELs (18.63%), followed by single guide RNA #2 (11.87%), and single guide RNA #3 (0.01%).
  • FIG. 31 provides a plot showing the percentage of INDELs (i.e. insertions or deletions), denoted as "% edited", of the target gene LEPR for each of the CRISPR/Cas9 single guide RNAs 1-4.
  • the CRISPR/Cas9 single guide RNA #1 showed the greatest percentage of INDELs (43.61%), followed by single guide RNA #2 (41.70%), single guide RNA #4 (16.61%), and single guide RNA #3 (4.99%).
  • FIG. 32 provides a plot showing t the percentage of INDELs (i.e. insertions or
  • the CRISPR/Cas9 single guide RNA #4 showed the greatest percentage of INDELs (9.97%), followed by single guide RNA #2 (5.95%), single guide RNA #1 (2.54%), and single guide RNA #3 (1.10%).

Abstract

La présente divulgation concerne des systèmes et des procédés permettant d'obtenir des oiseaux génétiquement modifiés qui introduisent une disruption dans un ou plusieurs gènes cibles, où le ou les gènes cibles sont un gène de la voie métabolique des acides gras, un gène qui régule l'appétit, ou un gène qui régule le stockage des acides gras, ladite disruption entraînant le développement d'un foie gras. Des procédés de production d'un produit alimentaire, tel que le foie gras, à l'aide d'un sujet aviaire génétiquement modifié, ainsi que des produits alimentaires obtenus à partir d'un sujet aviaire génétiquement modifié sont en outre décrits.
PCT/US2018/017872 2017-02-22 2018-02-12 Animaux non humains génétiquement modifiés et produits associés WO2018156372A1 (fr)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US201762462195P 2017-02-22 2017-02-22
US62/462,195 2017-02-22
US201762539208P 2017-07-31 2017-07-31
US62/539,208 2017-07-31

Publications (1)

Publication Number Publication Date
WO2018156372A1 true WO2018156372A1 (fr) 2018-08-30

Family

ID=63253420

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2018/017872 WO2018156372A1 (fr) 2017-02-22 2018-02-12 Animaux non humains génétiquement modifiés et produits associés

Country Status (1)

Country Link
WO (1) WO2018156372A1 (fr)

Cited By (22)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10465176B2 (en) 2013-12-12 2019-11-05 President And Fellows Of Harvard College Cas variants for gene editing
US10508298B2 (en) 2013-08-09 2019-12-17 President And Fellows Of Harvard College Methods for identifying a target site of a CAS9 nuclease
US10597679B2 (en) 2013-09-06 2020-03-24 President And Fellows Of Harvard College Switchable Cas9 nucleases and uses thereof
US10682410B2 (en) 2013-09-06 2020-06-16 President And Fellows Of Harvard College Delivery system for functional nucleases
US10704062B2 (en) 2014-07-30 2020-07-07 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US10745677B2 (en) 2016-12-23 2020-08-18 President And Fellows Of Harvard College Editing of CCR5 receptor gene to protect against HIV infection
US10858639B2 (en) 2013-09-06 2020-12-08 President And Fellows Of Harvard College CAS9 variants and uses thereof
US10947530B2 (en) 2016-08-03 2021-03-16 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US11046948B2 (en) 2013-08-22 2021-06-29 President And Fellows Of Harvard College Engineered transcription activator-like effector (TALE) domains and uses thereof
US11214780B2 (en) 2015-10-23 2022-01-04 President And Fellows Of Harvard College Nucleobase editors and uses thereof
US11268082B2 (en) 2017-03-23 2022-03-08 President And Fellows Of Harvard College Nucleobase editors comprising nucleic acid programmable DNA binding proteins
US11306324B2 (en) 2016-10-14 2022-04-19 President And Fellows Of Harvard College AAV delivery of nucleobase editors
US11319532B2 (en) 2017-08-30 2022-05-03 President And Fellows Of Harvard College High efficiency base editors comprising Gam
US11447770B1 (en) 2019-03-19 2022-09-20 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11542509B2 (en) 2016-08-24 2023-01-03 President And Fellows Of Harvard College Incorporation of unnatural amino acids into proteins using base editing
US11542496B2 (en) 2017-03-10 2023-01-03 President And Fellows Of Harvard College Cytosine to guanine base editor
US11560566B2 (en) 2017-05-12 2023-01-24 President And Fellows Of Harvard College Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation
US11661590B2 (en) 2016-08-09 2023-05-30 President And Fellows Of Harvard College Programmable CAS9-recombinase fusion proteins and uses thereof
US11732274B2 (en) 2017-07-28 2023-08-22 President And Fellows Of Harvard College Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE)
US11795443B2 (en) 2017-10-16 2023-10-24 The Broad Institute, Inc. Uses of adenosine base editors
US11898179B2 (en) 2017-03-09 2024-02-13 President And Fellows Of Harvard College Suppression of pain by gene editing
US11912985B2 (en) 2020-05-08 2024-02-27 The Broad Institute, Inc. Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20110265194A1 (en) * 2008-10-31 2011-10-27 Bettina Duemmler Them5-modified models of non-alcoholic fatty liver disease
US20140212918A1 (en) * 2013-01-31 2014-07-31 Rutgers, The State University Of New Jersey In vitro model of macrosteatotic (fatty) liver
US20150232881A1 (en) * 2013-11-07 2015-08-20 Editas Medicine, Inc. CRISPR-RELATED METHODS AND COMPOSITIONS WITH GOVERNING gRNAS
US20160362667A1 (en) * 2015-06-10 2016-12-15 Caribou Biosciences, Inc. CRISPR-Cas Compositions and Methods

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20110265194A1 (en) * 2008-10-31 2011-10-27 Bettina Duemmler Them5-modified models of non-alcoholic fatty liver disease
US20140212918A1 (en) * 2013-01-31 2014-07-31 Rutgers, The State University Of New Jersey In vitro model of macrosteatotic (fatty) liver
US20150232881A1 (en) * 2013-11-07 2015-08-20 Editas Medicine, Inc. CRISPR-RELATED METHODS AND COMPOSITIONS WITH GOVERNING gRNAS
US20160362667A1 (en) * 2015-06-10 2016-12-15 Caribou Biosciences, Inc. CRISPR-Cas Compositions and Methods

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
HERAULT ET AL.: "Liver gene expression in relation to hepatic steatosis and lipid secretion in two duck species", ANIMAL GENETICS, vol. 41, no. 1, 24 September 2009 (2009-09-24), pages 12 - 20, XP055535732 *

Cited By (34)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10508298B2 (en) 2013-08-09 2019-12-17 President And Fellows Of Harvard College Methods for identifying a target site of a CAS9 nuclease
US11920181B2 (en) 2013-08-09 2024-03-05 President And Fellows Of Harvard College Nuclease profiling system
US10954548B2 (en) 2013-08-09 2021-03-23 President And Fellows Of Harvard College Nuclease profiling system
US11046948B2 (en) 2013-08-22 2021-06-29 President And Fellows Of Harvard College Engineered transcription activator-like effector (TALE) domains and uses thereof
US10597679B2 (en) 2013-09-06 2020-03-24 President And Fellows Of Harvard College Switchable Cas9 nucleases and uses thereof
US10682410B2 (en) 2013-09-06 2020-06-16 President And Fellows Of Harvard College Delivery system for functional nucleases
US10858639B2 (en) 2013-09-06 2020-12-08 President And Fellows Of Harvard College CAS9 variants and uses thereof
US10912833B2 (en) 2013-09-06 2021-02-09 President And Fellows Of Harvard College Delivery of negatively charged proteins using cationic lipids
US11299755B2 (en) 2013-09-06 2022-04-12 President And Fellows Of Harvard College Switchable CAS9 nucleases and uses thereof
US11124782B2 (en) 2013-12-12 2021-09-21 President And Fellows Of Harvard College Cas variants for gene editing
US10465176B2 (en) 2013-12-12 2019-11-05 President And Fellows Of Harvard College Cas variants for gene editing
US11053481B2 (en) 2013-12-12 2021-07-06 President And Fellows Of Harvard College Fusions of Cas9 domains and nucleic acid-editing domains
US10704062B2 (en) 2014-07-30 2020-07-07 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US11578343B2 (en) 2014-07-30 2023-02-14 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US11214780B2 (en) 2015-10-23 2022-01-04 President And Fellows Of Harvard College Nucleobase editors and uses thereof
US11702651B2 (en) 2016-08-03 2023-07-18 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US10947530B2 (en) 2016-08-03 2021-03-16 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US11661590B2 (en) 2016-08-09 2023-05-30 President And Fellows Of Harvard College Programmable CAS9-recombinase fusion proteins and uses thereof
US11542509B2 (en) 2016-08-24 2023-01-03 President And Fellows Of Harvard College Incorporation of unnatural amino acids into proteins using base editing
US11306324B2 (en) 2016-10-14 2022-04-19 President And Fellows Of Harvard College AAV delivery of nucleobase editors
US11820969B2 (en) 2016-12-23 2023-11-21 President And Fellows Of Harvard College Editing of CCR2 receptor gene to protect against HIV infection
US10745677B2 (en) 2016-12-23 2020-08-18 President And Fellows Of Harvard College Editing of CCR5 receptor gene to protect against HIV infection
US11898179B2 (en) 2017-03-09 2024-02-13 President And Fellows Of Harvard College Suppression of pain by gene editing
US11542496B2 (en) 2017-03-10 2023-01-03 President And Fellows Of Harvard College Cytosine to guanine base editor
US11268082B2 (en) 2017-03-23 2022-03-08 President And Fellows Of Harvard College Nucleobase editors comprising nucleic acid programmable DNA binding proteins
US11560566B2 (en) 2017-05-12 2023-01-24 President And Fellows Of Harvard College Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation
US11732274B2 (en) 2017-07-28 2023-08-22 President And Fellows Of Harvard College Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE)
US11319532B2 (en) 2017-08-30 2022-05-03 President And Fellows Of Harvard College High efficiency base editors comprising Gam
US11932884B2 (en) 2017-08-30 2024-03-19 President And Fellows Of Harvard College High efficiency base editors comprising Gam
US11795443B2 (en) 2017-10-16 2023-10-24 The Broad Institute, Inc. Uses of adenosine base editors
US11795452B2 (en) 2019-03-19 2023-10-24 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11447770B1 (en) 2019-03-19 2022-09-20 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11643652B2 (en) 2019-03-19 2023-05-09 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11912985B2 (en) 2020-05-08 2024-02-27 The Broad Institute, Inc. Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence

Similar Documents

Publication Publication Date Title
WO2018156372A1 (fr) Animaux non humains génétiquement modifiés et produits associés
AU2021201239B2 (en) Methods and compositions for targeted genetic modifications and methods of use
JP6936952B2 (ja) 細胞ゲノムの誘導性改変
JP2020137521A (ja) 標的遺伝子座を修飾するための方法及び組成物
CN107208078B (zh) 使用成对向导rna进行靶向遗传修饰的方法和组合物
US20240117381A1 (en) Method for producing dna-edited eukaryotic cell, and kit used in the same
US20110016542A1 (en) Canine genome editing with zinc finger nucleases
CN107208113A (zh) 用于通过单步多重靶向进行靶向遗传修饰的方法和组合物
CN102625655A (zh) 使用锌指核酸酶在大鼠中进行基因组编辑
JP6958917B2 (ja) 遺伝子ノックイン細胞の作製方法
CN110546267A (zh) 提高细胞基因编辑效率的方法
WO2018013759A1 (fr) Sélection du sexe de la volaille et de la progéniture
Bharati et al. Genome editing in animals: an overview
JP2017521079A (ja) 生殖系列細胞を切除するｎａｎｏｓノックアウト
EP4242237A1 (fr) Variant de domaine de nucléase foki
ES2923629T3 (es) Métodos para la introducción sin cicatrices de modificaciones dirigidas en vectores de direccionamiento
JP2021164447A (ja) ゲノム改変方法及びゲノム改変キット
KR20220097406A (ko) 고빈도 표적화된 동물 유전자도입
US20230287459A1 (en) Single generation targeted gene integration
US20240124898A1 (en) Method for producing dna-edited eukaryotic cell, and kit used in the same
WO2024069186A1 (fr) Cellules génétiquement modifiées
Hossner Cellular and molecular biology.
NZ765592A (en) Methods and compositions for targeted genetic modifications and methods of use
NZ765592B2 (en) Methods and compositions for targeted genetic modifications and methods of use
NZ728561B2 (en) Methods and compositions for targeted genetic modifications and methods of use

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18757853

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 18757853

Country of ref document: EP

Kind code of ref document: A1