WO2018151514A1 - Composition pour prévenir ou traiter des maladies osseuses ayant un excellent effet de régénération osseuse - Google Patents

Composition pour prévenir ou traiter des maladies osseuses ayant un excellent effet de régénération osseuse Download PDF

Info

Publication number
WO2018151514A1
WO2018151514A1 PCT/KR2018/001910 KR2018001910W WO2018151514A1 WO 2018151514 A1 WO2018151514 A1 WO 2018151514A1 KR 2018001910 W KR2018001910 W KR 2018001910W WO 2018151514 A1 WO2018151514 A1 WO 2018151514A1
Authority
WO
WIPO (PCT)
Prior art keywords
bone
composition
bmp
preventing
stem cells
Prior art date
Application number
PCT/KR2018/001910
Other languages
English (en)
Korean (ko)
Inventor
송재준
송호석
고윤영
Original Assignee
고려대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020180017137A external-priority patent/KR102106895B1/ko
Application filed by 고려대학교 산학협력단 filed Critical 고려대학교 산학협력단
Priority to US16/486,757 priority Critical patent/US20200046774A1/en
Publication of WO2018151514A1 publication Critical patent/WO2018151514A1/fr

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/28—Bone marrow; Haematopoietic stem cells; Mesenchymal stem cells of any origin, e.g. adipose-derived stem cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/32—Bones; Osteocytes; Osteoblasts; Tendons; Tenocytes; Teeth; Odontoblasts; Cartilage; Chondrocytes; Synovial membrane
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/33—Fibroblasts
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/48—Reproductive organs
    • A61K35/54—Ovaries; Ova; Ovules; Embryos; Foetal cells; Germ cells
    • A61K35/545—Embryonic stem cells; Pluripotent stem cells; Induced pluripotent stem cells; Uncharacterised stem cells

Definitions

  • the present invention relates to a composition for preventing or treating bone diseases excellent in bone regeneration efficacy, and implements a bone regeneration effect through a BMP-2 growth factor and at the same time provides a double safety device for controlling cell death through a double kill switch. Include as an active ingredient.
  • Bones which support the soft tissues and weight of the body and protect internal organs from external shocks, are not only structurally supporting muscles or organs, but also an important part of the body that stores essential minerals such as calcium, phosphorus and magnesium in the body.
  • the bones of the grown adult are balanced by the process of repeating the generation and absorption process of removing old bones and replacing them with new bones. This is called bone remodeling (Yamaguchi A. et al., Tanpakushitsu Kakusan). Koso., 50 (6 Suppl); 664-669, 2005). This bone circulation is essential to repair and maintain the microscopic damage of bone caused by growth and stress. In adults, about 10% to 30% of the skeleton is reshaped every year through remodeling of bone resorption-osteoblasts.
  • Osteoblast formation involves osteoblasts that produce bone and osteoclasts that destroy bone, and bone homeostasis is maintained through close interaction between them.
  • osteoblasts are in the body by controlling the differentiation of osteoclasts responsible for bone resorption through the secretion of a substance, such as RANKL (receptor activator of nuclear factor- ⁇ B ligand), and their induction of receptor OPG (osteoprotegerin) Maintain goal homeostasis.
  • RANKL receptor activator of nuclear factor- ⁇ B ligand
  • OPG osteoprotegerin
  • a diet containing calcium is recommended for the treatment and prevention of osteoporosis, and estrogen or vitamin D administration is recommended for postmenopausal women.
  • bisphosphonate-based drugs such as Fosamax (component name: alendronate) and Actonel (component name: risedronate) are attracting attention as new alternative therapeutics as bone resorption inhibitors that inhibit osteoclasts and induce death. .
  • BMP-2 a protein that plays a key role in the recruitment and differentiation of stem cells
  • BMP-2 growth factor a form of recombinant protein
  • Existing treatment methods for the treatment of bone regeneration include surgical treatment, treatment using biomaterials / tissue engineering, treatment using stem cells / growth factors.
  • Autogenous bone grafts in bone grafts require donor injury and repetitive surgery. Allogeneic bone xenograft grafts may result in insufficient bone regeneration or complications such as infections.
  • Biomaterial scaffold has a disadvantage in that when bone defects are large due to lack of osteoinduction, the bone regeneration effect is weak and stem cells or growth factors are required.
  • stem cells or growth factors are required.
  • stem cells / growth factors are required.
  • functional cell therapies that can improve bone regeneration through the combination of stem cells and growth factors.
  • cell therapy is also a problem that needs to be solved because of the possibility of differentiating into unwanted cells in vivo to inhibit the function of the tissue or develop into a malignant tumor.
  • the present invention is to solve the above problems of the prior art, an object of the present invention is to provide a composition for the prevention or treatment of bone diseases having an excellent biosafety while improving the efficacy of bone regeneration.
  • a stem cell comprising a BMP-2 encoding gene and an HSV-tk encoding gene, into which a dual kill switch expression vector to which the HGPRT encoding gene is knocked out is introduced, or Provided is a composition for preventing or treating bone diseases, comprising the cells differentiated from the stem cells as an active ingredient.
  • the stem cells may be embryonic stem cells (ESC, Embryonic stem cells) or mesenchymal stem cells (MSC, Mesenchymal stem cells).
  • ESC embryonic stem cells
  • MSC mesenchymal stem cells
  • the cells differentiated from the stem cells may be fibroblast (osteoblast) or osteoblast (osteoblast).
  • the fibroblasts may be teratoma-derived fibroblast (TDF).
  • TDF teratoma-derived fibroblast
  • the bone disease may be one or more selected from the group consisting of bone defects, osteoporosis, osteoporotic fractures, diabetic fractures, nonunion fractures, osteoplasia and osteomalacia.
  • composition ALP Alkaline phosphatase
  • IBSP Integrin binding sialoprotein
  • RUNX2 Rasterix
  • SPP1 Secreted phosphoprotein 1
  • OCN Olecalcin
  • the composition may further comprise a scaffold.
  • the support may be made of polycaprolactone (PCL, Polycaprolactone) or biphasic calcium phosphate (BCP).
  • PCL polycaprolactone
  • BCP biphasic calcium phosphate
  • preparing a vector comprising a BMP-2 coding gene and HSV-tk coding gene; Knocking out the HGPRT encoding gene in the vector; And introducing the vector into stem cells or cells differentiated from the stem cells.
  • a method of preparing a composition for preventing or treating bone diseases There is provided a method of preparing a composition for preventing or treating bone diseases.
  • composition for preventing or treating bone diseases of the present invention includes stem cells into which the BMP-2 gene has been introduced, the BMP-2 growth factor may be generated per se, and thus, an excellent bone regeneration effect may be realized.
  • the stem cells include the HSV-tk gene, and knock out the HGPRT encoding gene to implement a double kill switch, thereby preventing cancer cell transformation by autoproliferation, etc., and improving human safety.
  • Figure 1 shows the morphology before and after Cre treatment of cells and BMP-2 and HSV-tk gene expression diagram according to an embodiment of the present invention.
  • FIG. 2 is a graph showing the BMP-2 release behavior of the cell line according to an embodiment of the present invention.
  • Figure 3 is a graph showing the ALP activity of the cell line according to an embodiment of the present invention.
  • Figure 4 is a graph showing the ALP activity of the TDF cell line injected with BMP-2 from the outside.
  • FIG. 5 is a graph showing BMP-2 release behavior during bone differentiation of cell lines according to an embodiment of the present invention.
  • Figure 6 is a graph showing the level of gene expression related to bone differentiation according to an embodiment of the present invention.
  • Figure 7 is a graph showing the calcium deposition of the cell line according to an embodiment of the present invention.
  • FIG. 8 is a graph showing the mineral deposition of the cell line according to an embodiment of the present invention.
  • FIG. 9 is an X-ray image showing the bone formation efficacy for the femoral bone defect animal model of the cell line according to an embodiment of the present invention.
  • Figure 10 is a micro-CT showing the bone formation efficacy of the cell line according to an embodiment of the present invention.
  • FIG. 11 is a graph comparing H & E tissue staining results and bone loss size of bone cell deficient animal models of cell lines according to an embodiment of the present invention.
  • Figure 12 is an image showing the cell morphology according to the concentration and time of gancyclovir treatment of the cell line according to an embodiment of the present invention.
  • 13 is a graph showing the number of cells with gancyclovir treatment concentration and time.
  • Figure 14 is an image of the shape of the cell line according to an embodiment of the present invention.
  • 15 is a graph showing the BMP-2 release behavior of the cell line according to an embodiment of the present invention.
  • 16 is a graph showing the level of gene expression related to bone differentiation according to an embodiment of the present invention.
  • Figure 17 is a graph showing the calcium deposition of the cell line according to an embodiment of the present invention.
  • FIG 19 is an H & E tissue staining result showing bone formation efficacy for the skull bone defect animal model of the cell line according to an embodiment of the present invention.
  • 20 is an image showing the results of resistance test for 6-TG drug of the cell line according to an embodiment of the present invention.
  • 21 is an image showing the cell killing effect of the aminopterin drug against the cell line according to an embodiment of the present invention.
  • 22 is an image showing the expression level of the bone regeneration marker of the cell line according to an embodiment of the present invention.
  • Figure 23 is a graph comparing the BMP-2 release behavior with or without lgK attachment.
  • 24 is a graph comparing HGPRT expression levels of the control group and the double kill switch group after HGPRT gene editing.
  • a stem cell comprising a BMP-2 encoding gene and an HSV-tk encoding gene, into which a dual kill switch expression vector to which the HGPRT encoding gene is knocked out is introduced, or Provided is a composition for preventing or treating bone diseases, comprising the cells differentiated from the stem cells as an active ingredient.
  • the BMP-2 is a kind of bone morphogenetic protein that is involved in the healing of cartilage-resistant membrane fractures and promotes bone growth as well as essential for natural regeneration reactions. Compared to the case of injecting BMP-2 from the bone disease treatment efficacy can be improved.
  • Hypoxanthine-guanine phosphoribosyltransferase is a protein that inhibits apoptosis, and removing HGPRT encoding genes can be a double safeguard against apoptosis control failure due to loss of HSV-tk. That is, by inserting the HSV-tk coding gene into the expression vector, not only a single kill switch can be implemented, but in addition, the HGPRT coding gene can be knocked out to implement a dual kill switch. Specifically, when the double kill switch expression vector is introduced into a cell line, apoptosis may be induced by treating a drug such as aminopterin. Therefore, the composition of the present invention can effectively control the cell death can prevent side effects of stem cell therapeutics such as aberrant proliferation, malignant tumors.
  • stem cell therapeutics such as aberrant proliferation, malignant tumors.
  • the BMP-2 introduced cell line may be a stem cell, and specifically, the stem cell may be an embryonic stem cell (ESC) or a mesenchymal stem cell (MSC).
  • the stem cells may perform their own osteogenic function separately from the bone formation caused by BMP-2, but when applied together with BMP-2, more effective bone formation effect may be realized.
  • the cells differentiated from the stem cells may be fibroblast (osteoblast) or osteoblast (osteoblast).
  • the fibroblasts may be teratoma-derived fibroblasts (TDF).
  • the cells into which the BMP-2 coding gene is introduced may be fibroblasts derived from teratomas formed from embryonic stem cells, and osteoblasts differentiated from embryonic stem cells, but are not limited thereto.
  • teratoma is a kind of tumor composed of various cells and tissues such as skin cells, muscle cells, and nerve cells, whereas a general tumor is composed of a single cell. It can be formed by injecting. By separating fibroblasts generated from the teratoma and using them as cell lines, the expression efficiency of BMP-2 can be improved. In addition, the fibroblasts can be differentiated into osteoblasts can implement osteogenic function.
  • the stem cells or cells differentiated from the stem cells have excellent differentiation in and of themselves, may not only function as a therapeutic agent but also pose a risk of development into cancer cells.
  • the cell line can be suppressed from developing into cancer cells.
  • an internal ribosome entry site (IRES) gene may be inserted between the BMP-2 gene and the HSV-tk gene.
  • IRES internal ribosome entry site
  • the BMP-2 gene, IRES gene and HSV-tk gene may be composed of the nucleotide sequence represented by SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3, respectively.
  • the BMP-2 gene may be a gene encoding the Lgk peptide at the 5 'end.
  • the Lgk peptide is a leader peptide that induces extracellular release of BMP-2 protein generated in cells, and can improve bone formation efficacy by the BMP-2 protein.
  • the BMP-2 gene into which the Lgk peptide coding gene is introduced may consist of a nucleotide sequence represented by SEQ ID NO: 4.
  • the HSV-tk gene phosphorylates drugs such as acyclovir and gancyclovir, and phosphorylation of these drugs can induce cell death by inhibiting DNA synthesis by DNA polymerase. Accordingly, cancer cellization of the cell line can be prevented by administering a drug such as acyclovir or gancyclovir at a time point at which bone formation by BMP-2 is sufficiently induced in the cell line. In other words, these HSV-tk genes can act as kill switches for cell lines.
  • the BMP-2 coding gene and the HSV-tk coding gene may be inserted into one expression vector, and the genes may be expressed by transfection of the expression vector into a host cell.
  • the expression vector may be an adenovirus expression vector, an adeno-associated virus, an retrovirus vector or a plasmid, but is not limited thereto.
  • the bone disease to be prevented or treated of the composition may be a disease associated with bone mass to a decrease in bone density, specifically selected from the group consisting of bone defects, osteoporosis, osteoporotic fractures, diabetic fractures, nonunion fractures, osteoplasia and osteomalacia It may be one or more, but is not limited thereto.
  • the composition can increase the expression of genes or proteins involved in improving bone mass to bone density.
  • the composition is selected from the group consisting of Alkaline phosphatase (ALP), Integrin binding sialoprotein (IBSP), Run-related transcription factor 2 (RUNX2), Osterix (OSX), Secreted phosphoprotein 1 (SPP1), and Osteocalcin (OCN). It is possible to increase the expression of one or more markers, but is not limited thereto.
  • the composition may exhibit excellent bone formation ability by itself, but may further include a scaffold to further improve its efficacy.
  • the support may be made of polycaprolactone (PCL, Polycaprolactone) or biphasic calcium phosphate (BCP), but is not limited thereto.
  • PCL polycaprolactone
  • BCP biphasic calcium phosphate
  • preparing a vector comprising a BMP-2 coding gene and HSV-tk coding gene; And introducing the vector into stem cells or cells differentiated from the stem cells.
  • a method of preparing a composition for preventing or treating bone diseases is provided.
  • the functions of the BMP-2 coding gene and the HSV-tk coding gene, the method of introducing them into the cell line, and the types of the bone diseases are as described above.
  • the method of knocking out the HGPRT encoding gene may use a known gene removal method, for example, TAL-nuclease, meganuclease, zinc-finger nuclease (ZFN), or RNA-induced It may be performed using endonucleases.
  • the Cas9 / CRISPR method may be used.
  • PL453 vector containing CAG promoter-loxP-neo-loxP was digested with NotI restriction enzyme and blunt end was formed using T4 DNA polymerase.
  • Plasmid DNA containing the HSV-tk gene was digested with BglII / NcoI restriction enzyme, blunt ends were formed using T4 DNA polymerase, and then inserted into the vector.
  • the vector was cleaved with BamHI restriction enzyme to form a blunt end using T4 DNA polymerase, and then the BMP-IRES portion was amplified by PCR and inserted into the vector to insert the BMP-2 gene and the HSV-tk gene.
  • the generated vector was cleaved with BamHI restriction enzyme to form a blunt end using T4 DNA polymerase, and then the BMP-IRES portion was amplified by PCR and inserted into the vector to insert the BMP-2 gene and the HSV-tk gene.
  • Example 2 After dispensing the TDF cell line of Example 1 to 2 ⁇ 10 6 cells in a 60 phi dish, the vector of Example 2 was transfected. After 48 hours of transfection, cells without neoR gene were killed by treatment with neomycin for 5 days, and cells into which BMP-2 gene was introduced were selected.
  • the plasmid DNA containing pCAG-Cre was transfected into the cells so that the BMP-2 and HSV-tk genes were expressed by reacting the loxP gene with the Cre protein (FIG. 1).
  • the expression of BMP-2 was confirmed by ELISA analysis, and the results are shown in FIG. 2. Referring to Figure 2, two treatments with Cre was confirmed that the release of extracellular BMP-2 of about 2ng / ml.
  • Example 3 In order to measure the ALP activity of the TDF cell line of Example 3 and the normal TDF cell line not expressing BMP-2, a group of cells cultured in an Osteogenesis induction medium (OIM) and a general growth culture (GM, Growth medium) was divided into groups incubated for 3 days, 7 days and then each ALP activity was measured.
  • OIM Osteogenesis induction medium
  • GM General growth culture
  • the ALP activity of the cell line of Example 3 was observed to be about 2 times higher than that of the control group, and the cell line of Example 3 exhibited ALP activity even in normal growth culture. It was. Through this, it can be seen that the TDF cell line introduced with BMP-2 can implement excellent initial osteogenic induction ability.
  • each cultured cell was washed twice with PBS, lysed with 1 ml of Trizol reagent, and then stirred by adding 200 ⁇ l chloroform and centrifuged at 4 ° C and 12000 rpm for 20 minutes to separate the supernatant.
  • 500 ⁇ l of isopropanol was added to the separated supernatant, followed by stirring, followed by centrifugation at 4 ° C. and 12000 rpm.
  • the pellet, except the supernatant was washed three times with 70% ethanol and RNA was isolated.
  • RNA 5 ⁇ l was prepared, added to the RT-PCR amplification kit, and reacted at 45 ° C. for 60 minutes to prepare cDNA.
  • the prepared cDNA was amplified by real-time PCR using primers specific for ALP, OCN (Osteocalcin) and OPN (Osteopontin), respectively.
  • TDF cell line of Example 3 increases the gene expression levels of the bone formation markers ALP, IBSP, RUXN2 and OSX, which is effectively BMP-2 introduced TDF cell line Imply that it can be induced.
  • the TDF cell line of Example 3 and a normal TDF cell line that does not express BMP-2 were respectively formed in bone formation induction medium (OIM) or normal growth culture (GM) and calcium and mineral deposition were measured after incubation for 10 to 12 days.
  • OFM bone formation induction medium
  • GM normal growth culture
  • the TDF cell line of Example 3 showed more than 4 times calcium deposition and more than 2 times mineral deposition compared to the control group, and it can be seen that it is excellent in inducing late bone formation.
  • a bone defect model was performed through segmental resection of the iliac bone after surgically exposing the thigh of the rat at 7 weeks of age. was produced. At this time, the size of the bone defect was produced to 7 mm so that coalescence does not occur after 4 weeks and 8 weeks of partial excision.
  • Example 3 The TDF cells of Example 3 and the control TDF cells without BMP-2 were mixed with 5 ⁇ 10 5 polycaprolactone (PCL, Polycaprolactone) scaffolds and incubated at 37 ° C. for 24 hours.
  • PCL polycaprolactone
  • the rat was introduced into a bone defect site. Thereafter, the surgical site was sutured and finished by fixing with an external fixation device, and bone formation was observed using X-rays at one week intervals, and the results are shown in FIG. 9.
  • both the group injected with control TDF cells and the group injected with TDF cells of Example 3 showed an increase in bone formation. have.
  • the TDF cells of Example 3 showed more effective union of the bone defect region than the control TDF cells.
  • the group introducing the TDF cell line of Example 3 exhibited significantly improved bone formation ability compared to the group introducing only the PCL support and the control group introducing the TDF cell line.
  • a bone defect model was produced through segmental resection after surgically exposing the skull of an 8-week-old nude mouse. It was. At this time, the bone defect size was 4 mm to prevent fusion after 4 and 8 weeks of partial ablation.
  • TDF cells of Example 3 and control TDF cells without BMP-2 were mixed with 5 ⁇ 10 5 or more calcium phosphate (BCP) scaffolds and incubated at 37 ° C. for 24 hours. It was then introduced into the bone defect site of the rat. After 3 weeks, the bone defects were collected and bone formation was evaluated using the H & E tissue staining test. The results are shown in FIG. 11, and the osteocalcin and Lamin A / C markers were fluorescently stained. The confirmed result is shown in FIG. .
  • the TDF cell line introduction group of Example 3 shows an excellent bone formation effect compared to the control TDF cell line introduction group, it can be seen that the most reduced the defect site size.
  • Example 3 In order to evaluate the cell death according to HSV-tk gene expression according to the TDF cell line according to Example 3, 0 ⁇ g / ml, 50 ⁇ g / ml and 500 ⁇ g of gancyclovir in the cell line of Example 3 The cells were treated at a concentration of / ml and observed and analyzed for 72 to 124 hours, respectively, and are shown in FIGS. 12 and 13, respectively.
  • Embryonic stem cells (WA01 male embryonic stem cells, WiCell research institute) were aliquoted into 10 6 cells in 60 phi dishes, and the vector of Example 2 was then transfected. After 48 hours of transfection, cells without neoR gene were killed by treatment with neomycin for 5 days, and cells into which BMP-2 gene was introduced were selected.
  • EB embryonic bodies
  • OB osteoblasts
  • the plasmid DNA containing pCAG-Cre was transfected into the cell line so that the BMP-2 and HSV-tk genes were expressed by reacting the loxP gene with the Cre protein.
  • 14 is an image of the osteoblasts (OB) differentiated by inserting the embryonic stem cells, empty vectors or the vector of Example 2 thereto.
  • BMP-2 expression of the cell line was confirmed by ELISA analysis, and the results are shown in FIG. 15. Referring to FIG. 15, it was confirmed that the OB cell line into which BMP-2 was introduced exhibited enhanced extracellular BMP-2 release compared to the control OB cell line into which the empty vector was introduced.
  • Example 10 To determine whether the OB cell line of Example 10 increases the expression of ALP, RUNX2, OSX, IBSP, SPP1 and OCN, which are related markers of bone formation, the gene expression level of each marker was measured in the same manner as in Example 6. It was. At this time, an OB cell line into which the empty vector was introduced was used as a control, and the measurement results are shown in FIG. 16.
  • the OB cell line of Example 10 increases the expression of all of the bone formation markers ALP, RUNX2, OSX, IBSP, SPP1, and OCN. Suggests that it can effectively induce bone formation.
  • the OB cell line of Example 10 exhibited two-fold improvement in calcium deposition and mineral deposition compared to the control group into which the empty vector was introduced, indicating that the late bone formation ability was excellent.
  • the Cas9 / CRISPR method was performed.
  • An sgRNA (guide RNA) complementary to the PAM site at the HGPRT gene exon8 site was cloned.
  • Cas9 plasmid DNA and sgRNA were introduced into the TDF cell line of Example 3 by using a Neon Transfection method in a ratio of 1: 1 to prepare a double kill switch expression vector.
  • Reverse primer GGTCCTTTTCACCAGCAAGCT
  • the HGPRT expression level of the double kill switch group was measured to be about 0.328 times that of the control group, and these results confirm that most of the HGPRT genes were removed.
  • Example 15 Securing Dual Kill Switch Cell Lines Using Drug Testing
  • TDF cell line knocked out of the HGPRT gene in Example 14 and the TDF cell line of Example 3 were treated with 6-TG (Tioguanine), and the number of cells 5 and 9 days after the treatment was observed and is shown in FIG. 20. And surviving HGPRT gene knockout cells were isolated.
  • the isolated HGPRT gene knockout cell line and the TDF cell line of Example 3 were cultured in 6-well at 1 ⁇ 10 4 .
  • a 50 ⁇ aminopterins (HAT) stock in the culture was diluted with 1 ⁇ (hypoxanthine 100 ⁇ M, aminopretin 0.4 ⁇ M, thymidine 16 ⁇ M) and treated with aminopterin (HAT).
  • HAT aminopterin

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Cell Biology (AREA)
  • Developmental Biology & Embryology (AREA)
  • Immunology (AREA)
  • Chemical & Material Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Veterinary Medicine (AREA)
  • Virology (AREA)
  • Zoology (AREA)
  • Public Health (AREA)
  • Medicinal Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Reproductive Health (AREA)
  • Gynecology & Obstetrics (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Rheumatology (AREA)
  • Hematology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

La présente invention concerne une composition qui permet de prévenir ou de traiter des maladies osseuses, et qui comprend un gène codant pour BMP-2 et un gène codant pour HSV-tk, et comme principe actif une cellule souche, dans laquelle est introduit un vecteur d'expression à double commutateur de destruction dans lequel le gène codant pour la HGPRT est inactivé, ou une cellule différenciée issue de la cellule souche, l'effet de régénération osseuse étant obtenu par le facteur de croissance BMP-2 et, en même temps, l'apoptose pouvant également être contrôlée de manière double par le double commutateur de destruction.
PCT/KR2018/001910 2017-02-16 2018-02-14 Composition pour prévenir ou traiter des maladies osseuses ayant un excellent effet de régénération osseuse WO2018151514A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US16/486,757 US20200046774A1 (en) 2017-02-16 2018-02-14 Composition for preventing or treating bone diseases which has excellent bone regeneration effect

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR20170020967 2017-02-16
KR10-2017-0020967 2017-02-16
KR10-2018-0017137 2018-02-12
KR1020180017137A KR102106895B1 (ko) 2017-02-16 2018-02-12 골재생 효능이 우수한 골질환 예방 또는 치료용 조성물

Publications (1)

Publication Number Publication Date
WO2018151514A1 true WO2018151514A1 (fr) 2018-08-23

Family

ID=63170377

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2018/001910 WO2018151514A1 (fr) 2017-02-16 2018-02-14 Composition pour prévenir ou traiter des maladies osseuses ayant un excellent effet de régénération osseuse

Country Status (1)

Country Link
WO (1) WO2018151514A1 (fr)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20110011471A (ko) * 2009-07-28 2011-02-08 코오롱생명과학 주식회사 골 형성 유도용 조성물
KR101032871B1 (ko) * 2009-07-10 2011-05-06 주식회사 바이오드 비엠피-2와 에이치에스브이-티케이 자살유전자를 동시에 포함하고 발현 할 수 있도록 하는 벡터와 이 벡터가 도입된 자가조절형 줄기세포 치료제
KR20110132579A (ko) * 2009-03-31 2011-12-08 코오롱생명과학 주식회사 골재생용 조성물
KR20130109417A (ko) * 2012-03-27 2013-10-08 충북대학교 산학협력단 자살유전자를 발현하는 양수 유래 줄기세포 및 이를 포함하는 암 치료용 조성물
US20150376650A1 (en) * 2014-06-06 2015-12-31 Regeneron Pharmaceuticals, Inc. Methods and compositions for modifying a targeted locus

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20110132579A (ko) * 2009-03-31 2011-12-08 코오롱생명과학 주식회사 골재생용 조성물
KR101032871B1 (ko) * 2009-07-10 2011-05-06 주식회사 바이오드 비엠피-2와 에이치에스브이-티케이 자살유전자를 동시에 포함하고 발현 할 수 있도록 하는 벡터와 이 벡터가 도입된 자가조절형 줄기세포 치료제
KR20110011471A (ko) * 2009-07-28 2011-02-08 코오롱생명과학 주식회사 골 형성 유도용 조성물
KR20130109417A (ko) * 2012-03-27 2013-10-08 충북대학교 산학협력단 자살유전자를 발현하는 양수 유래 줄기세포 및 이를 포함하는 암 치료용 조성물
US20150376650A1 (en) * 2014-06-06 2015-12-31 Regeneron Pharmaceuticals, Inc. Methods and compositions for modifying a targeted locus

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
CHUNG, Y.-H. O ET AL.: "Requirement of de novo protein synthesis for aminopterin-induced apoptosis in a mouse myeloma cell line", IMMUNOLOGY LETTERS, vol. 77, 2001, pages 127 - 131, XP055536674 *
RAWADI, G.: "BMP-2 controls alkaline phosphatase expression and osteoblast mineralization by a Wnt autocrine loop", JOURNAL OF BONE AND MINERAL RESEARCH, vol. 18, no. 10, 2003, pages 1842 - 1853, XP008138541 *

Similar Documents

Publication Publication Date Title
Clement et al. Bone morphogenetic protein 2 in the early development of Xenopus laevis
WO2018101708A1 (fr) Composition pharmaceutique contenant des mitochondries
WO2015156649A1 (fr) Peptide présentant une activité inhibitrice contre la fibrose, et composition le contenant
WO2013169077A1 (fr) Composition pour la prévention ou le traitement de la cachexie
WO2015167067A1 (fr) Composition pour une transplantation d'organe, de tissu, ou de cellules, trousse et procédé de transplantation
WO2019231266A1 (fr) Cellule souche mésenchymateuse dérivée d'une cellule souche pluripotente induite humaine à gène hla supprimé et son procédé de préparation
WO2017142367A1 (fr) Composition pharmaceutique pour la prévention ou le traitement d'une maladie musculaire, comprenant des cellules souches mésenchymateuses ou xcl1
WO2019212324A1 (fr) Ciblage de macrophages associés à une tumeur de type m2 par l'utilisation d'un peptide pro-apoptotique à base de mélittine
WO2017026878A1 (fr) Composition de milieu de culture pour induire des cellules progénitrices musculo-squelettiques et composition pharmaceutique comprenant des cellules progénitrices musculo-squelettiques pour la prévention ou le traitement de maladies musculo-squelettiques
WO2018021879A1 (fr) Procédé de production de cellules souches mésenchymateuses qui inhibent la prolifération de cellules cancéreuses
WO2017135795A1 (fr) Cellule souche mésenchymateuse exprimant le facteur de croissance des hépatocytes, et son utilisation
WO2018088813A9 (fr) Fragment de nkx3.2 et composition pharmaceutique le comprenant en tant que principe actif
WO2018088693A1 (fr) Méthode d'amélioration de l'activité de cellules souches à l'aide de 2dg
WO2019147036A1 (fr) Cellules souches mésenchymateuses exprimant le facteur neurotrophique dérivé du cerveau, et leur utilisation
KR100781753B1 (ko) Ｄｋｋ2를 포함하는 혈관신생을 촉진시키는 방법
WO2018151514A1 (fr) Composition pour prévenir ou traiter des maladies osseuses ayant un excellent effet de régénération osseuse
WO2012047037A2 (fr) Cardiomyocytes dérivés de cellules souches embryonnaires et produit de thérapie cellulaire les utilisant comme principe actif
WO2010114319A9 (fr) Composition pour régénération osseuse
WO2019216667A9 (fr) Procédé de génération de cellules souches neurales induites reprogrammées directement à partir de cellules non neurales en utilisant la sox2 et le c-myc
WO2016027990A1 (fr) Composition pharmaceutique comprenant dusp5 en tant que substance active pour prévenir ou traiter des maladies métaboliques osseuses
WO2012161519A1 (fr) Lignée de cellules souches adultes introduite avec un gène du facteur de croissance hépatocytaire et un gène du facteur de transcription neurogène ayant un motif basique hélice-boucle-hélice et ses utilisations
WO2015072708A1 (fr) Procédé pour la préparation de cellule endothéliale vasculaire par transformation (transdifférenciation) de fibroblaste adulte et son utilisation
KR102106895B1 (ko) 골재생 효능이 우수한 골질환 예방 또는 치료용 조성물
WO2020067774A1 (fr) Cellules souches mésenchymateuses dérivées de la synoviale et leur utilisation
Giacinti et al. Cdk9‐55: A new player in muscle regeneration

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18753835

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 18753835

Country of ref document: EP

Kind code of ref document: A1