WO2018147642A1 - Enoblock을 유효성분으로 포함하는 비만 예방 또는 치료용 약학 조성물 - Google Patents
Enoblock을 유효성분으로 포함하는 비만 예방 또는 치료용 약학 조성물 Download PDFInfo
- Publication number
- WO2018147642A1 WO2018147642A1 PCT/KR2018/001662 KR2018001662W WO2018147642A1 WO 2018147642 A1 WO2018147642 A1 WO 2018147642A1 KR 2018001662 W KR2018001662 W KR 2018001662W WO 2018147642 A1 WO2018147642 A1 WO 2018147642A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- enoblock
- mice
- treated
- treatment
- expression
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/53—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with three nitrogens as the only ring hetero atoms, e.g. chlorazanil, melamine
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/0012—Galenical forms characterised by the site of application
- A61K9/0019—Injectable compositions; Intramuscular, intravenous, arterial, subcutaneous administration; Compositions to be administered through the skin in an invasive manner
Definitions
- composition for the prevention or treatment of obesity including ENOb lock as an active ingredient
- the present invention relates to a pharmaceutical composition for preventing or treating obesity comprising ENOb lock as an active ingredient.
- Obesity is a chronic disease that increases the morbidity and mortality of various diseases due to excessive accumulation of fat tissue due to abnormal energy balance function or over nutrition.
- Obesity may act as a cause of diseases such as hypertension, hyperlipidemia and cardiovascular disease or diabetes, as well as problems with obesity itself.
- An increase in weight of 1 kg increases the risk of cardiovascular disease by 3.1% and increases the risk of diabetes by 4.5-9%, and a decrease of about 11% in weight is known to reduce the mortality rate of the disease by 253 ⁇ 4. Is required.
- Diabetes one of the chronic adult diseases caused by obesity, is a type 1 diabetes that causes the destruction of cells that secrete insulin, resulting in an absolute lack of insulin. It is divided into diabetes. In Korea, type 2 diabetes patients account for more than 90%. In addition, with the improvement of the standard of living in Korea and the westernization of lifestyle, the number of diabetic patients is increasing rapidly, and the mortality rate is also increasing rapidly, making it the number one among the 0ECD countries. These diabetes may include retinopathy, kidney failure,
- Korean Patent Publication No. 10-1472083 discloses the first non-substrate that directly binds to and inhibits enolase, a component of the glycolysis pathway.
- a small molecule 'ENOblock' which is an analog is disclosed.
- the patent does not specifically mention the use of ENOblock, which is a triazine compound.
- the present inventors completed the present invention by confirming that the ENOblock, an enolase modulating compound, induces anti-obesity, anti-inflammatory and anti-fibrosis effects in obese and diabetic mouse models.
- An object of the present invention is to provide a pharmaceutical composition for preventing or treating obesity, fibrosis, fatty liver, diabetes complications, hyperlipidemia and / or degenerative brain disease.
- the present invention provides a pharmaceutical composition for preventing or treating obesity, comprising ENOblock as an active ingredient.
- the present invention provides a pharmaceutical composition for preventing or treating fibrosis comprising ENOblock as an active ingredient.
- the present invention provides a pharmaceutical composition for preventing or treating fatty liver, comprising ENOblock as an active ingredient.
- the present invention prevents diabetic complications comprising ENOblock as an active ingredient Or provide a therapeutic pharmaceutical composition.
- the present invention provides a pharmaceutical composition for preventing or treating hyperlipidemia comprising ENOblock as an active ingredient.
- the present invention provides a pharmaceutical composition for preventing or treating degenerative brain disease comprising ENOblock as an active ingredient.
- the present invention also provides a method for preventing or treating any one disease selected from the group consisting of obesity, fibrosis, fatty liver, diabetes complications, hyperlipidemia and degenerative brain diseases, comprising administering ENOblock to the subject.
- ENOblock according to the present invention not only improves the symptoms of diabetes and hyperlipidemia by inhibiting enolase activity, but also has the effect of preventing the damage, inflammation progression and tissue fibrosis caused by apoptosi s as a diabetic complication. .
- ENOblock can be usefully used as a therapeutic agent for obesity by inhibiting the expression of fat producing genes.
- ENOblock has fewer side effects in the liver, kidney, and heart than rosigl itazone, previously known as an antidiabetic agent.
- Figure 1 shows the enolase enzyme activity according to the ENOblock treatment represented by the formula (2).
- Figure 2 is a Western blot analysis of the enolase in the nucleus in the ENOblock-treated 3T3-L1 adipocyte cell line represented by the formula (2).
- Figure 3 is a quantification of the enolase in the nucleus in the ENOblock-treated 3T3-L1 progenitor cell line represented by the formula (2).
- Enolase was analyzed via Western blot.
- Figure 6 is an analysis of the expression of the enolase binding gene c-Myc in ENOblock-treated 3T3-L1 adipocyte cell line represented by the formula (2).
- FIG. 7 shows c-Myc expression in ENOblock-treated 3T3-L1 adipocytes represented by Formula 2.
- Figure 8 is an analysis of the expression of the enolase binding gene Erbb2 in ENOblock-treated 3T3-L1 adipocytes.
- Figure 10 is an analysis of Erbb2 expression known as enolase binding gene in ENOblock treated Huh7 liver cell line represented by the formula (2).
- Figure 13 Quantify enolase in the nucleus in ENOblock or NaF treated Huh7 liver cell lines.
- FIG. Figures 14 and 15 analyze the expression of enolase protein in the cytosol (cytosol ic) and nucleus in hepatocytes ( Figure 14) or liver tissue (Figure 15) after treatment with ENOblock.
- FIG. Figure 17 depicts a protocol relating to animal experiments for evaluating the antidiabetic effect of ENOblock represented by Formula 2 in db / db T2DM mice.
- 18 is db / db treated with ENOblock or rosiglitazone represented by Formula 2 Blood glucose levels were measured for 24 hours in mice.
- FIG. 20 shows LDL / VLDL cholesterol of db / db mice after 7 weeks of treatment with ENOblock or rosiglitazone represented by Formula 2.
- FIG. 21 shows the values of HDL cholester of db / db mice treated with ENOblock or rosiglitazone represented by Formula 2 for 7 weeks or more.
- FIG. 22 shows free fatty acid (FFA) levels in serum of ENOblock or rosiglitazone treated mice represented by Formula 2.
- FIG. 23 shows the activity of alanine aminotransferase (ALT) in the serum of ENOblock or rosiglitazone treated mice represented by formula (2).
- FIG. 24 shows enolase activity in liver tissue of ENOblock or rosiglitazone treated mice represented by Formula 2.
- FIG. 25 shows enolase activity in renal tissue of ENOblock or rosiglitazone treated mice represented by Formula 2.
- mice used in FIGS. 20 to 25 are the same age and the same strain B6 mice.
- 26 to 28 analyze the expression of the enolase binding genes Cox-2, Erbb-2 and c—Myc.
- FIG. 29 is a representative liver photograph of db / db mice treated with ENOblock or rosiglitazone for 7 weeks.
- FIG. 30 shows liver weights of db / db mice 7 weeks after treatment with ENOblock or rosiglitazone represented by Formula 2.
- Figure 31 shows the degree of lipid accumulation in liver tissue of db / db mice treated with ENOblock or rosiglitazone represented by Formula 2 through oil red 0 staining will be.
- FIG. 34 quantifies liver fibrosis of mice treated with ENOblock represented by Formula 2.
- 35 shows the degree of hepatic microlipidosis (l iver mi crosteatosi s) of db / db mice treated with ENOblock or rosiglitazone represented by Formula 2 through H & E staining.
- FIG. 36 quantifies liver microlipidosis of db / db mice treated with ENOblock or rosiglitazone represented by Formula 2.
- FIG. 38 quantifies atoptocytic cells in liver tissue of mice treated with ENOblock or rosiglitazone represented by Formula 2.
- FIG. 39 shows the results of Western blot analysis of caspase-3, cleaved caspase-3 (Aspl75), PARP, and cleaved PARP in liver tissue of mice treated with ENOblock or rosiglitazone represented by Formula 2. At this time, the same age B6 mouse strain was used as a comparison group.
- FIGS. 42 and 43 analyze inflammatory genes TNF- ⁇ and IL-6 following ENOblock treatment represented by Formula 2 in liver tissue.
- Figure 44 shows the expression of the cytoplasmic form following the ENOblock treatment represented by the formula (2).
- Figure 45 shows the expression of 3 ⁇ 4:-mitochondria form following the ENOblock treatment represented by the formula (2).
- Figure 48 shows the expression of Insig- according to the ENOblock treatment represented by the formula (2) in liver tissue.
- 49 and 50 are to evaluate the expression of the LXR target genes Abcg-5 and Scrap according to the ENOblock treatment represented by the formula (2) in db / db mouse liver.
- 51 and 52 show the body weight and gonad adipose tissue weight of db / db mice treated with ENOblock or rosiglitazone represented by the formula (2).
- FIG. 54 quantifies adipocyte size (*: significance ⁇ ⁇ 0.05 for reduced size compared to untreated; ** significance ⁇ ⁇ 0.05 compared to untreated rosiglitazone).
- FIG. 56 quantifies fibrosis in the tissues of mice according to each group.
- FIG. 57 is a Western blot expression of fibrosis marker ⁇ -SMA following ENOblock treatment represented by Formula 2.
- 58 is a concentration of ⁇ -SMA expression following ENOblock treatment represented by Formula 2 It is a measurement analysis.
- Figures 59 and 60 confirm the expression of TNF- ⁇ and TLR-4 according to the treatment of ENOblock represented by Formula 2 and the presence or absence of LPS stimulation in Li 264.7 macrophages.
- 61 to 65 confirm the expression of inflammatory genes TNF- a, Cdllc and Mcp-1, adipogenic marker Ppar y, and Col6a3 in adipose fibroblasts in adipose tissue.
- FIG. 66 shows the heart weight of rosiglitazone or ENOblock-treated db / db mice represented by Formula 2.
- Figure 67 shows the ratio of heart weight to body weight (indicator of cardiac hypertrophy).
- FIG. 70 shows myocardial cell images visualized by ⁇ & ⁇ staining. Pottery measures the width of myocardial cells following drug treatment.
- 73 Quantify atoptoid cells of mouse heart tissue following drug treatment.
- FIG. 74 shows the results of Western blot analysis of caspase-3, cleaved caspase-3 (Aspl75), PARP, and cleaved PARP in cardiac tissue of rosiglitazone or ENOblock treated mice represented by Formula 2. At this time, age-matched B6 mice were used as controls.
- FIG. 75 quantifies the expression of cleaved caspase-3 (Aspl75) versus ⁇ -tubul in in the heart tissue of ENOblock or rosiglitazone treated mice represented by Formula 2.
- FIG. FIG. 76 is a quantification of a -tubul in versus truncated PARP expression in cardiac tissue of ENOblock or rosiglitazone treated mice represented by Formula 2.
- FIG. 77 to 80 show the results of analysis of mRNA of Gata-4, Glut-4, I rap, and a_MHC, which are indicators of cardiac function, in rosiglitazone or ENOblock-treated mice represented by the formula (2).
- 81 to 84 show the results of analyzing the mRNA of Kcnk-l, Asah-2, B4glant and MMP-3, which are cardiac pathological markers in rosiglitazone or ENOblock-treated mice represented by Formula 2.
- FIG. 85 shows kidney weight of mice treated with ENOblock or rosiglitazone represented by Formula 2.
- 86 is a measurement of fibrosis (dyeing in blue) by staining kidney tissue with Masson-tri chrome staining.
- FIG. 87 quantifies the accumulation of interstitial ECM components in ENOblock or rosiglitazone treated mice represented by Formula 2.
- Figure 89 is a quantification of apoptosis cells in the kidney tissue of ENOblock or rosiglitazone treated mice represented by the formula (2).
- FIG. 90 shows the results of Western blot analysis of caspase-3, cleaved caspase-3 (Aspl75), PARP, and cleaved PARP in renal tissue of ENOblock or rosiglitazone treated mice represented by Formula 2. At this time, age-matched B6 mice were used as controls.
- FIG. 91 shows expression of cleaved caspase-3 (Aspl75) versus ⁇ -tubul in in kidney tissue of ENOblock or rosiglitazone treated mice represented by Formula 2. It is quantified.
- FIG. 92 is a quantification expression of cleaved PARP relative to a -tubul in in renal tissue of ENOblock or rosiglitazone treated mice represented by Formula 2.
- 93 to 96 show the expression levels of angiotens in, Bax and p53, and cytoplasm related to positive regulation of glucose neosynthesis, in kidney tissue of ENOblock or rosiglitazone treated mice represented by Formula 2; will be.
- 97 to 99 are measured CoMal, Col4a2 and Col4a3 ⁇ ⁇ expression in the kidney tissue of ENOblock or rosiglitazone treated mice represented by the formula (2).
- FIG. 100 illustrates the analysis of enolase protein expression in cytoplasm (cytosol i c) and nucleus (nuc lear) in hepatocytes after treatment with ENOblock represented by Formula 2.
- FIG. 101a shows the result of Western blot analysis of ⁇ -SMA in liver tissue of db / db mice treated with ENOblock or rosiglitazone represented by Formula 2.
- 101B quantifies the expression of a -SMA normalized to GAPDH.
- Figure 102 depicts a compound treatment protocol in adipose progenitor cells derived from white adipose tissue.
- Figure 103 shows the expression of adipogenic regulatory genes following the treatment of ENOblock represented by forskol in, rapamyc in or formula (2).
- Figure 104 shows the expression of oxidative phosphorylation regulatory genes according to the treatment of ENOblock represented by forskol in, rapamyc in or formula (2).
- FIG. 105 shows expression of heat generating regulatory genes following treatment with forskol in, rapamycin or ENOblock represented by Formula 2.
- FIG. 105 shows expression of heat generating regulatory genes following treatment with forskol in, rapamycin or ENOblock represented by Formula 2.
- FIG. 106 depicts a compound pretreatment protocol in adipocytes of white adipose tissue undergoing adipocyte differentiation.
- Figure 107 shows the expression of adipose-producing regulatory genes for differentiating fat precursor cells following the treatment of forskol in, rapamycin or ENOblock represented by the formula (2).
- FIG. 108 shows expression of oxidative phosphorylation regulatory genes following treatment with forskol in, rapamycin or ENOblock represented by Formula 2.
- FIG. 108 shows expression of oxidative phosphorylation regulatory genes following treatment with forskol in, rapamycin or ENOblock represented by Formula 2.
- Figure 109 shows the expression of heat production regulatory genes according to the treatment of forskol in, rapamycin or ENOblock represented by the formula (2).
- FIG. 111 shows the expression of adipogenic regulatory genes after treatment of differentiation adipocytes with forskol in, rapamycin, ENOblock or NaF represented by Formula 2.
- FIG. 112 shows the expression of oxidative phosphorylation regulatory genes following treatment with forskoHn, rapamycin, ENOblock or NaF represented by Formula 2.
- FIG. 113 shows expression of a gene for regulating heat production following treatment with forskol in, rapamycin, ENOblock or NaF represented by Formula 2.
- FIG. 113 shows expression of a gene for regulating heat production following treatment with forskol in, rapamycin, ENOblock or NaF represented by Formula 2.
- FIG. 114 depicts a protocol for treating compounds on brown adipocytes isolated from brown adipose tissue (BAT).
- FIG. 115 shows the expression of adipose-producing regulatory genes for differentiating adipocytes following treatment with forskol in, rapamycin, ENOblock or NaF represented by Formula 2.
- Figure 116 shows the expression of oxidative phosphorylation regulatory genes following the treatment of forskol in, rapamycin, ENOblock or NaF represented by the formula (2).
- Figure 117 shows the expression of heat production regulatory genes following treatment with forskol in, rapamycin, ENOblock or NaF represented by formula (2).
- 118 is shown using TMRE to visualize the mitochondrial membrane potential of ENOblock, NaF, forskol in or rapamycin-treated 3T3-L1 adipocytes and brown adipocytes represented by Formula 2.
- Figure 119 shows the quantification of mitochondrial membrane potential of ENOblock, NaF, forskol in or rapamycin-treated 3T3-L1 adipocytes represented by the formula (2).
- FIG. 120 shows the use of TMRE to visualize the mitochondrial membrane potential of ENOblock, NaF, forskol in or rapamycin-treated 3T3-L1 white adipocytes represented by Formula 2.
- 121 is a quantification of the mitochondrial membrane potential of ENOblock, NaF, forskol in or rapamycin-treated white adipose precursor cells represented by the formula (2).
- 122 is a quantification of the mitochondrial membrane potential of ENOblock, NaF, forskol in or rapamycin-treated brown fat precursor cells represented by the formula (2).
- FIG. 123 shows the result of staining 3T3-L1 white adipose precursor cells with ENOblock, forskol in or rapamycin represented by Formula 2 and staining with oil red 0.
- FIG. 123 shows the result of staining 3T3-L1 white adipose precursor cells with ENOblock, forskol in or rapamycin represented by Formula 2 and staining with oil red 0.
- Figure 124 shows the quantification of the oil red 0 staining results of ENOblock, forskol in or rapamycin-treated white adipose precursor cells represented by the formula (2).
- 125 is a chemical structure of an ENOblock represented by Formula 2.
- 126 is a schematic of the ENOblock treatment protocol represented by Formula 2 in high fat diet (HFD) mice.
- FIG. 128 is an abdominal anatomy (indicated by white arrow) showing visceral adipose tissue of an ENOblock or rosiglitazone treated HFD mouse represented by Formula 2.
- FIG. 129 shows changes in ENOblock or rosiglitazone treated HFD mice represented by Formula 2.
- FIG. 130 shows the feed intake of ENOblock or rosiglitazone treated HFD mice represented by Formula 2.
- FIG. 131 shows Rectum body temperature of mice during ENOblock or rosiglitazone treatment represented by Formula 2.
- FIG. 132 shows fasting blood glucose levels of HFD mice at 4, 6, and 8 weeks after treatment with ENOblock and rosiglitazone represented by Formula 2.
- FIG. 133 and 134 show measured glucose tolerance test (GTT) and area under curve (AUC) for HFD mice after 4 weeks of treatment with ENOblock or rosiglitazone represented by Formula 2.
- GTT glucose tolerance test
- AUC area under curve
- 135 and 136 show the measurement of insulin resistance test ( ⁇ ) and AUC for HFD mice after 5 weeks of ENOblock or rosiglitazone treatment represented by the formula (2).
- FIG. 137 and 138 show insulin serum concentrations and insulin resistance levels of HFD mice after 8 weeks of ENOblock or rosiglitazone treatment represented by Formula 2.
- FIG. 137 and 138 show insulin serum concentrations and insulin resistance levels of HFD mice after 8 weeks of ENOblock or rosiglitazone treatment represented by Formula 2.
- 139 and 140 show pyruvate resistance test (PTT) and area under curve (AUC) for HPD mice after 7 weeks of ENOblock or rosiglitazone treatment represented by Formula 2 to determine glucose neosynthesis levels.
- FIG. 141 is a liver photograph of HFD mice treated with ENOblock or rosiglitazone represented by Formula 2.
- FIG. 142 shows the liver weight of HFD mice treated with ENOblock or rosiglitazone represented by Formula 2.
- FIG. 143 shows the serum concentration of alanine aminotransferase (ALT) of HFO mice treated with ENOblock or rosiglitazone represented by Formula 2.
- FIG. 144 is oil red 0 staining to visualize lipid accumulation in liver tissue of HFD mice treated with ENOblock or rosiglitazone represented by Formula 2.
- FIG. 145 is a quantification of lipid accumulation in HFD mice treated with ENOblock or rosiglitazone represented by Formula 2.
- FIG. 146 is H & E stained to visualize steatosi s of HFD mice treated with ENOblock or rosiglitazone represented by Formula 2.
- FIG. 146 is H & E stained to visualize steatosi s of HFD mice treated with ENOblock or rosiglitazone represented by Formula 2.
- FIG. 147 is a quantification of liposis of HFD mice treated with ENOblock or rosiglitazone represented by Formula 2.
- FIG. 148 is Masson-Tr i chrome stained to visualize liver tissue fibrosis (blue) of HFD mice treated with ENOblock or rosiglitazone represented by Formula 2.
- FIG. 148 is Masson-Tr i chrome stained to visualize liver tissue fibrosis (blue) of HFD mice treated with ENOblock or rosiglitazone represented by Formula 2.
- FIG. 149 shows quantification of fibrosis of HFD mice treated with ENOblock or rosiglitazone represented by Formula 2.
- FIG. 150 shows ⁇ -SMA immunostaining for detection of hepatic stellate cells of HFD mice treated with ENOblock or rosiglitazone.
- Figure 151 shows the quantification of hepatic stellate cell numbers in HFD mice treated with ENOblock or rosiglitazone represented by formula (2).
- FIG. 152 shows qPCR analysis of a-SMA expression in HFD mice treated with ENOblock or rosiglitazone represented by Formula 2.
- FIG. 152 shows qPCR analysis of a-SMA expression in HFD mice treated with ENOblock or rosiglitazone represented by Formula 2.
- Figure 153 shows the bee: string of a -SMA in liver of HFD mice treated with ENOblock or rosiglitazone represented by Formula 2 by Western blot analysis.
- ENOblock or rosiglitazone represented by Formula 2; Expression of inflammatory markers IL-6, TNF- ⁇ and S100a9 in mouse liver tissues was evaluated.
- FIG. 157 analyzes the expression of Srebp-la and Srebp-lc, which are lipid homeostatic regulators, in liver tissue of mice treated with ENOblock or rosiglitazone represented by Formula 2.
- Srebp-la and Srebp-lc which are lipid homeostatic regulators, in liver tissue of mice treated with ENOblock or rosiglitazone represented by Formula 2.
- Figure 158 analyzes the expression of the regulatory factors of Amfr, Insig-1 and Insig '2 that regulates Srebp protein in liver tissue of mice treated with ENOblock or rosiglitazone represented by Formula 2;
- FIG. 159 shows the expression of the LXR target genes Scap and Abcg5 in liver tissue of mice treated with ENOblock or rosiglitazone represented by Formula 2.
- FIG. 160 shows expression of Pck-1 and Pck # 2 that regulate glucose neosynthesis in liver tissue of mice treated with ENOblock or rosiglitazone represented by Formula 2.
- FIG. 160 shows expression of Pck-1 and Pck # 2 that regulate glucose neosynthesis in liver tissue of mice treated with ENOblock or rosiglitazone represented by Formula 2.
- FIG. 161 shows the expression of Adipoq, Ap2, Ppar- ⁇ , Retn, and Cebpa, which are fat-forming regulators, in liver tissue of mice treated with ENOblock or rosiglitazone represented by Formula 2.
- FIG. 161 shows the expression of Adipoq, Ap2, Ppar- ⁇ , Retn, and Cebpa, which are fat-forming regulators, in liver tissue of mice treated with ENOblock or rosiglitazone represented by Formula 2.
- FIG. 162 shows expression of inflammatory markers IL-6, TNF- ⁇ , Cdllc, Tlr-4, and Nptx2 in the hippocampus of mice treated with ENOblock or rosiglitazone represented by Formula 2.
- FIG. 162 shows expression of inflammatory markers IL-6, TNF- ⁇ , Cdllc, Tlr-4, and Nptx2 in the hippocampus of mice treated with ENOblock or rosiglitazone represented by Formula 2.
- Figure 163 shows the expression of energy status sensors Creb and mitochondrial biosynthesis regulators Tfam, Nrfl and Nrf2 in the hippocampus of mice treated with ENOblock or rosiglitazone represented by formula (2).
- Figure 164 shows the mitochondrial DNA content in the hippocampus of mice treated with ENOblock or rosiglitazone represented by formula (2).
- 165 shows the treatment of ENOblock or rosiglitazone represented by Formula 2; Nissl staining of neurons in the CAl, CA2 and CA3 regions of mouse hippocampus is shown. At this time, attention should be paid to the disordered neural structure in the CA1 region of rosiglitazone treated mice.
- Figures 166 to 168 measure the serum levels of triglycerides, HDL and LDL cholesterol in ENOblock or rosiglitazone treated HFD mice represented by formula (2).
- Figure 169 shows the white adipose tissue of the dissected germline of ENOblock or rosiglitazone treated mice represented by formula (2).
- Figure 170 shows the white adipose tissue weight of the gonad of the ENOblock or rosiglitazone treated mice represented by the formula (2).
- FIG. 1 is H & E staining of adipose tissue of the gonad to visualize adipocyte size of ENOblock or rosiglitazone treated mice represented by Formula 2.
- FIG. 1 is H & E staining of adipose tissue of the gonad to visualize adipocyte size of ENOblock or rosiglitazone treated mice represented by Formula 2.
- 172 is a measure of the fat cell width of the ENOblock or rosiglitazone treated mice represented by the formula (2).
- 173 shows adipose cell regions (beige) in white adipose tissue of the gonads stained with H & E from ENOblock treated HFD mice represented by Formula 2 (indicated by white arrows).
- FIG. 174 shows qPCR analysis of inflammatory markers TNF- ⁇ , Cdllc, and Mcp-1 and Ppar- ⁇ , a master fat production regulator, in the white adipose tissue of the gonad of ENOblock or rosiglitazone treated mice represented by Formula 2.
- FIG. 175 is a representative photograph of brown adipose tissue between the scapula of the ENOblock or rosiglitazone treated mice represented by Formula 2.
- FIG. 175 is a representative photograph of brown adipose tissue between the scapula of the ENOblock or rosiglitazone treated mice represented by Formula 2.
- FIG. 176 shows the brown adipose tissue (BAT) weight between the scapula of ENOblock or rosiglitazone treated mice represented by Formula 2.
- FIG. 177 is H & E staining of brown adipose tissue between scapula of ENOblock or rosiglitazone treated mice represented by Formula 2 to visualize fatty liver size.
- Figure 178 shows the expression of inflammatory markers and fat production regulators that differentiate differentiation progenitor cells according to the treatment of ENOblock or rosiglitazone represented by the formula (2).
- FIG. 179 illustrates expression of a heat generation regulatory gene according to the treatment of ENOblock or Hojiglitazone represented by Formula 2.
- FIG. 179 illustrates expression of a heat generation regulatory gene according to the treatment of ENOblock or Hojiglitazone represented by Formula 2.
- FIG. 180 is Masson-Tr i chrome stained to visualize fibrosis in brown adipose tissue of ENOblock or rosiglitazone treated mice represented by Formula 2.
- FIG. 180 is Masson-Tr i chrome stained to visualize fibrosis in brown adipose tissue of ENOblock or rosiglitazone treated mice represented by Formula 2.
- FIG. 181 shows quantification of fibrosis in brown adipose tissue of HFD mice treated with ENOblock or rosiglitazone represented by Formula 2.
- FIG. 183 is an anatomical photograph showing visceral adipose tissue (white arrow) of an ENOblock or met formin treated HFD mouse represented by Chemical Formula 2.
- FIG. 183 is an anatomical photograph showing visceral adipose tissue (white arrow) of an ENOblock or met formin treated HFD mouse represented by Chemical Formula 2.
- Figure 184 shows the mouse body weight during the ENOblock or met formin treatment represented by the formula (2).
- Figure 185 shows the fasting blood glucose level of HFD mice at 4 and 6 weeks of ENOblock or metformin treatment represented by the formula (2).
- FIG. 186 and 187 show the blood glucose tolerance test (GTT) and the area under the curve (AUC) for HFD mice after 4 weeks of treatment with ENOblock or met formin represented by Formula 2.
- GTT blood glucose tolerance test
- AUC area under the curve
- 188 and 189 are treated with ENOblock or met formin represented by Formula 2
- ITT insulin resistance test
- AUC area under the curve
- 190 and 191 show the pyruvic acid resistance test (PTT) and the area under the curve (AUC) after 7 weeks of treatment with ENOblock or met formin represented by the formula (2).
- FIG. 194 is a white adipose tissue photograph of the dissected germline of an ENOblock or met formin treated mouse represented by Formula 2.
- FIG. 194 is a white adipose tissue photograph of the dissected germline of an ENOblock or met formin treated mouse represented by Formula 2.
- Figure 195 is a measure of the white adipose tissue weight of the gonads in the ENOblock or met formin treated mice represented by the formula (2).
- FIG. 196 shows flow cytometry (FACs) of white adipose tissue-induced inflammatory cells stained with antibodies to the plate macrophage marker CD68 (macrosi al in) and the M2 anti-inflammatory macrophage marker CD206 (mannose receptor). .
- FACs flow cytometry
- FIG. 197 shows quantification of M2-type macrophages in white adipose tissue inflammation group from ENOblock or met formin treated mice represented by Formula 2.
- FIG. 198 and 199 illustrate the therapeutic effect of ENOblock represented by Formula 2 on the progression of obesity induced by a high fat diet.
- ENOblock referred to herein is a triazine-based compound represented by Formula 1:
- R 1 is H;
- R2 is H,-(CH2) q- (C0NH) -Cl-5 linear or branched alkyl (where q is an integer of 1-5),-(CH2) q- (C0NH) -Cl-5 straight chain or Branched alkyl alcohol (where q is an integer of 1-5),-(CH2) q- (C0NH)-[(CH2) m-0] n- (CH2) p-NH2 (where n, p and q Are each an integer of 0-5, and m is an integer of 1-5) or-(CH2) q- (C0NH)-[(CH2) m-0] n- (CH2) p-CH3 (where m, n and q are each an integer of 1-5, and p is an integer of 0-5).
- the ENOblock is a triazine-based compound represented by the following formula (2) (N- [2 ⁇ [2 [(2 ⁇ aminoet hoxy) et hoxy] ethyl] -4- [[4- [(eye 1 ohexy 1 me t hy 1) am i no] _6_ [[(4 ⁇ f luorophenyl) methyl] amino] -1, 3, 5-tr i azin-2-yl] amino]-benzeneacet amide hydrochlor ide):
- the present invention in one aspect, provides a pharmaceutical composition for the prevention or treatment of obesity comprising ENOblock as an active ingredient.
- Obesity is a condition in which the body has an excessive accumulation of adipose tissue.
- the present invention provides a pharmaceutical composition for preventing or treating fibrosis comprising ENOblock as an active ingredient.
- Fibrosis refers to the formation of excess fibrous connective tissue in organs or tissues during reparative or reaction processes.
- the fibrosis may be any one selected from the items consisting of liver fibrosis, kidney fibrosis, myocardial fibrosis and cardiac fibrosis.
- Fatty liver refers to the accumulation of fat in liver cells.
- the present invention by confirming that the fatosis is reduced in the liver of ENOblock-treated T2DM and HFD mice, the possibility of treating the fatty liver of ENOblock was confirmed.
- the present invention provides a pharmaceutical composition for preventing or treating diabetes comprising ENOblock as an active ingredient.
- the diabetes may be diabetes mellitus type 2 (T2DM).
- Type 2 diabetes is a disease caused by insulin resistance in which a sufficient amount of insulin is not secreted in the body or the cells do not react to insulin.
- ENOblock-treated diabetic mice (T2DM) and obese mice (HFD) by inhibiting insulin resistance is confirmed by reducing the blood sugar in the body, The possibility of treating diabetes was confirmed.
- the present invention also provides a pharmaceutical composition for preventing or treating diabetic complications comprising ENOblock as an active ingredient.
- Diabetes complications can occur due to various metabolic disorders in the body due to the maintenance of blood glucose levels above normal.
- the diabetic complication may be at least one selected from the group consisting of diabetic nephropathy, diabetic liver disorder, diabetic heart disease, diabetic encephalopathy, diabetic vascular complications, and diabetic neuropathy.
- the present invention by confirming the reduction of tissue damage, fibrosis and apoptosis in liver, heart, kidney and hippocampal tissue of ENOblock-treated T2DM and HFD mice, the possibility of treating diabetic complications of ENOblock was confirmed.
- the present invention provides a pharmaceutical composition for preventing or treating hyperlipidemia comprising ENOblock as an active ingredient.
- Hyperlipidemia is a condition in which more fatty substances are present in the blood and accumulated on the walls of blood vessels, causing inflammation and cardiovascular disease.
- the present invention by confirming that lipid accumulation is suppressed and triglyceride and LDL cholesterol levels are reduced in ENOblock-treated T2DM and HFD mice, the possibility of treating hyperlipidemia of ENOblock was confirmed.
- the present invention provides a pharmaceutical composition for preventing or treating degenerative brain disease comprising ENOblock as an active ingredient.
- Degenerative brain diseases include stroke, stroke, dementia, Alzheimer's disease, Parkinson's disease, Huntington's disease, Pick's disease or Creutzfeld-Jakob's disease.
- the present invention provides ENOblock-treated T2DM and HFD. By confirming decreased expression of hippocampal inflammatory markers in mice, the possibility of treatment of degenerative brain disease of ENOblock was confirmed.
- composition comprising the ENOblock according to the invention as an active ingredient c— Myc, Erbb2, Cox-2, ⁇ ⁇ SMA, Col6a3, c 1 eaved-caspase-3, cleaved PARP, angiotensin, Bax, p53, IL-6, TNF- ⁇ , Mcp-1, Cdllc, Tlr4, Nptx2, Pck-1, Scap, Abcg5, Ap2, Agt, Adipoq, Ppar- ⁇ , Retn, Cebpa, Cebpb, Kcnkl, Asah2, B4glant, Mmp-3, Col4a3, At least one gene selected from the group consisting of Nrfl, Cptlb, Cox8b, Srebp-la, Srebp-lc or Insig-2 can be down regulated.
- ENOblock-treated T2DM and HFD mice by inhibiting the expression of aptosis gene c 1 eaved-caspase-3, cleaved PARP, angiotensin, Bax or p53 and oxidative phosphorylation genes Nrfl, Cptlb or Cox8b It was confirmed that ENOblock inhibited cell death.
- ENOblock inhibited tissue inflammation by confirming that expression of inflammatory genes IL-6, TNF- ⁇ , Mcp-1, Cdllc, Tlr4 or Nptx2 was suppressed in ENOblock-treated T2DM and HFD mice.
- ENOblock inhibited the increase in blood glucose by confirming that the expression of Pck-1, a glucose neosynthesis gene, was suppressed in T2DM and HFD mice treated with ENOblock.
- ENOblock-treated T2DM and HFD mice reduced the expression of Scap or Abcg5, which is a ste-regulatory gene, and Srebp-la, Srebp-lc, or Ins ig-2. And the possibility of treatment of liver fat and hyperlipidemia was confirmed.
- ENOblock inhibited fat production by confirming that the expression of the fat-producing genes A ⁇ 2'Agt, Adipoq, Ppar- ⁇ , Retn, Cebpa, or Cebpb ⁇ was inhibited in ENOblock-treated T2DM and HFD mice.
- compositions comprising the ENOblock according to the present invention as an active ingredient can inhibit fat cell differentiation, and can inhibit insulin resistance and hyperinsulinemia.
- composition comprising the ENOblock according to the invention as an active ingredient can upregulate the expression of the heat generating gene Ucp-1 or Ucp-3 ⁇ ⁇ .
- Compositions comprising the ENOblock of the present invention as an active ingredient, containing 0.01 to 99.9% by weight of ENOblock as an active ingredient relative to the total weight of the composition may comprise a pharmaceutically acceptable carrier, excipient or diluent.
- compositions of the present invention may be in various oral or parenteral formulations.
- diluents or excipients such as layering agents, extenders, binders, wetting agents, disintegrating agents and surfactants are usually used.
- Solid form preparations for oral administration include tablets, pills, powders, granules, capsules and the like, which form at least one excipient such as starch, calcium carbonate, sucrose or lactose ( l actose), gelatin, etc. It is prepared.
- lubricants such as magnesium stearate, talc and the like are also used.
- Liquid preparations for oral administration include suspensions, liquid solutions, emulsions, and syrups, and may include various excipients, for example, wetting agents, sweeteners, fragrances, and preservatives, in addition to water and liquid paraffin, which are commonly used simple diluents. have.
- Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations and suppositories.
- non-aqueous solvent and the suspension solvent propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate, and the like can be used.
- wi tepsol, macrogol, tween 61, cacao butter, laurin butter, glycerogelatin and the like can be used.
- compositions of the present invention may be administered orally or parenterally, and may be administered externally or intraperitoneally, rectally, intravenously, intramuscularly, subcutaneously, intrauterine dural or cerebrovascular.
- the dosage of the composition of the present invention varies depending on the weight of the patient, age, sex, health status, diet, time of administration, administration method, excretion rate and severity of the disease, the daily dosage is based on the amount of ENOblock It is preferably 0.01 to 1000 rag / kg, preferably 0.1 to 100 rag / kg, may be administered 1 to 6 times a day.
- the composition of the present invention can be used alone or in combination with methods using surgery, radiation therapy, hormone therapy, chemotherapy and biological response modifiers.
- the present invention also provides a method for preventing or treating any one disease selected from the group consisting of obesity, fibrosis, fatty liver, diabetic complications, hyperlipidemia and degenerative brain diseases, comprising administering ENOblock to a subject.
- the present invention provides a use of the pharmaceutical composition comprising the ENOblock as an active ingredient for preventing or treating any one disease selected from the group consisting of obesity, fibrosis, fatty liver, diabetes complications, hyperlipidemia and degenerative brain disease to provide.
- the present invention also provides the use of ENOblock in the manufacture of a pharmaceutical composition for preventing or treating any one disease selected from the group consisting of obesity, fibrosis, fatty liver, diabetes complications, hyperlipidemia and degenerative brain disease. .
- ENOblock represented by Formula 2 N- [2- [2- (2-aminoethoxy) ethoxy] ethyl]-4- [[4- [(eye 1 ohexy 1 me t hy 1) am i no] -6- [ [(4- f 1 uor opheny 1) methyl] amino] l, 3, 5- tr i azin-2-yl] ami no] -benzeneacet amide hydrochk) r ide) Provided by Prof. Rosiglitazone (Rosigl i tazon) was purchased from Santa Cruz Biotechnology (CA, USA).
- Ci lostazol was purchased from Enzo Li Science (NY, USA). enolase (catalog number sc271384), lamin B (catalog number sc374015), pro- Antibodies against caspase-3 (catalog number sc7148) and a -tubul in (catalog number sc53646) were purchased from Santa Cruz Biotechnology. Antibodies against hi stone H3, c leaved caspase- 3 (catalog number cs- # 9661) and PARP / cleaved PARP (catalog number cs- # 9542) were purchased from Cel l Signaling (catalog number # 9715). In addition, Nonident-P40 (IGEPAL CA-630) was purchased from Generay Biotech. Example 2. Cell Culture
- Fibroblasts of NIH / 3T3 mice, Huh7 human hepatocytes, 3T3-L1 mouse adipocytes and RAW 264.7 mouse macrophages were obtained from the Korean Cell Line Bank (KCLB) (Seoul National University Korea). The cells were maintained in DMEM growth medium supplemented with 10% FBS, 50 uni ts mL— 1 penicillin and 50 mg ml / 1 streptomycin.
- KCLB Korean Cell Line Bank
- mice Maintained at 12h / 12h light cycle. Food and water were free to eat. One week after the environmental dip period, mice were used for the experiment. Male C57BL / 6J mice were purchased from Damool Science for comparison with normal background strains and age matched for comparison with drug treated C57BL / Ksj-db / db mice.
- db / db mice were randomly divided into 3 groups of 10 animals.
- Blood glucose monitoring was performed every 48 hours during the 7 week drug treatment period (6 hours after drug treatment). Blood glucose was measured using OneTouch Ul tra (Li feScan, CA, USA).
- rats were anesthetized with diethyl ether to collect blood from the heart and harvested kidneys, liver and adipose tissue. Collected blood was stored in 1.5 mL tubes for coagulation for 15 minutes. Blood clot was removed by centrifugation at 1500 g for 10 minutes at 4 ° C. The supernatant was stored at -80 ° C in 50 ii L portions. Harvested tissues were washed twice with PBS and stored at -80 ° C. Tissue analyzes such as Real-Time PCR, fibrosis staining, apoptosis assay and enolase activity assay were performed by blind test method.
- Example 4 Embedding and Cutting Tissues
- the sinus heart tissue of 5 mice of each treatment group was cut to 8 ⁇ depth and fixed using 3.7% formaldehyde solution. Hematoxyl in and eosin (H & E) staining were performed to measure the width of heart muscle cells. Myocyte width was measured in the myocardium region with parallel myocyte masses using Aper io ImageScope (Leica Biosys terns, Germany). 30-47 muscle cells were measured in each heart.
- Example 6 Extraction of Nuclear Proteins
- Cells were cultured and treated with compounds of interest in 10 cm dishes. After treatment, cells were washed with PBS and cytoplasmic extract complete solution (10 mM Hepes pH 7.9, 10 mM KCl, 0.1 mM EDTA, 0.5% nonident-P40 (IGEPAL CA-630, which does not destroy nuclear membrane) and protease inhibitor cocktail . Cells were harvested by scraping the cells by incubation with ice for 5 minutes and then centrifuging for 5 minutes at 3000 rpm at 4 ° C. The supernatant was discarded and the cell pellet was washed twice with detergent-free cytosolic extract supernatant.
- cytoplasmic extract complete solution 10 mM Hepes pH 7.9, 10 mM KCl, 0.1 mM EDTA, 0.5% nonident-P40 (IGEPAL CA-630, which does not destroy nuclear membrane) and protease inhibitor cocktail .
- Cells were harvested by scraping the cells by incubation with ice for 5 minutes
- Enolase activity was tested by detecting the modification of 2-phospho-glycerate to phospho-enol-pyruvate (Enolase Activity Colorimetric Assay Kit, Biovision, CA, USA). Three homogenized liver tissues (10 mg) in 6 animals per treatment group were used for tissue-based analysis. Cells (2 ⁇ 10 5 ) were treated in triplicate for cell-based analysis. Enolase activity was measured after 20 minutes with an absorbance of 570 nm.
- Example 9 Cellular Level Enolase Nuclear Potential Assay
- mice C57BL / 6J mice (8 weeks old) were injected intraperitoneally with saline plus 10% DMS0 or saline plus 10% DMS0 with 12 mg / kg ENOblock (5 per treatment group). After 24 hours, mice were regenerated and liver tissue was extracted. Nuclear and cytosolic proteins were separated from liver tissue using the Nuclear / Cytosol Fractionation Kit (Biovision Inc.). Example 11. Western Blot
- Extracts of 30-40 protein samples were loaded onto a 10% polyacrylamide H gel and after electrophoresis the nitro cells were transferred to the rose membrane. Details of the primary antibody used are provided in Example 1 Detection was performed using HRP-conjugated secondary (anti-mouse IgG-HRP, sc2031, Santa Cruz Biotech). All primary antibodies were diluted 1: 1000 in TBS-T containing 5% skim milk and incubated overnight at 4 ° C. Secondary antibodies were diluted 1: 10,000 and incubated at room temperature (RT) for 30 minutes.
- RNA concentration was measured using Bradford assay. Expression signals were visualized using ECL solution (RPN2232, GE Healthcare Library, UK). Band Intensity was measured by ImageJ 1.45 software (Nat ional Inst itutes of Health, USA) and normalized using a-tubul in for cytoplasmic protein and lamin-B for nuclear extraction. Protein samples from the tissues of five mice in each treatment group were used for western blot analysis.
- Example 12 Isolation of RNA from Cells and Tissues
- RNA was obtained using TRIzol reagent (Thermo Fisher Scienti, MA, USA) according to the manufacturer's instructions. Tissue frozen with liquid nitrogen proceeded by grinding into powder using free mortar prior to RNA extraction.
- RT-PCR and Real-Time PCR
- transcript levels of genes of interest were analyzed using a StepOnePlus real time PCR system (Appl ied Biosys terns, UK). Total RNA was reverse transcribed to prepare cDNA using AccuPower® RT PreMix (Bioneer Cor por ion). The obtained cDNA was subjected to real time PCR according to the manufacturer's instructions through the following changes.
- PCR was performed three times in the total volume of Mix (Appl ied Biosys terns, UK). PCR amplification consisted of incubation of the mixture for 10 minutes at 95 ° C., followed by 40 cycles of denaturation, denaturation, annealing and extension. Denaturation was performed at 95 ° C. for 15 seconds, annealing was performed at 60 ° C. for 1 minute, and extension was performed at 72 ° C. for 20 seconds using fluorescence detection at 72 ° C. after each cycle. After the final cycle, melting point analysis of all samples was performed in the range of 60-95 ° C. using continuous fluorescence detection.
- Mcp-l ( cl2) NM_0l l.33l
- Example 16 Numerical Measurement of Serum HDL and LDL Cholesterol
- Serum High Density Lipoprotein (HDL) and Low Density Lipoprotein (LDL) Cholesterol are HDL and LDL / VLDL Cholesterol Quantitative Chromaticity Measurement / Fluorescence Measurement Kit (BioVision, CA, USA). Colorimetric analysis was used. Serum samples were used three times in five animals per treatment group.
- Liver fat lipid accumulation was visually confirmed and measured using Oil Red 0 staining and ImageJ 1.45s software.
- Liver tissue for oil red 0 staining was sectioned to 8 ⁇ thickness using a cryostat (Leica CM 1850) at -25 ° C. The frozen slices were air dried for 10 minutes and then fixed with 10% formalin solution. The slides were then rinsed with running water and washed with 60% isopropanol.
- Apoptosis analysis was performed using TACS® 2 TdT-DAB In Situ Apoptosis.
- Detect ion Kit (Trevigen, MD, USA) was used to measure according to the manufacturer's protocol. Visualization of the acetotic nucleus in heart, kidney and liver tissues was performed at a final magnification of 400 ⁇ using tissue from 5 mice per treatment group. Nine fields of vision among three stained sections in each mouse were randomly selected and visualized to calculate the atoptotic nuclei.
- Adipose tissue sections were stained with H & E. The size distribution of fat cells in adipose tissue was measured using Image J 1.48v software. Adipose tissue from 8 mice per treatment group was stained and 40 randomly selected adipocyte sizes from each mouse were measured.
- Example 20 Measurement of Tissue Fibers
- Tissue sections were stained with Trichrome Stain (Masson) kit (Sigma-Aldrich, Mo., USA) for the evaluation of fibrosis.
- Trichrome Stain Masson kit (Sigma-Aldrich, Mo., USA) for evaluation of fibrosis.
- renal fibrosis and hepatic fibrosis were quantified by measuring blue stained staining sites using i ma g e J 1.48v software.
- Adipose tissue fibrosis was assessed by quantifying blue stained areas around adipocytes. The percentage of fiberization was calculated as the percentage of blue staining in the total tissue sections calculated using ImageJ software.
- mice / treatment groups were used for liver fibrosis analysis. It was used for cardiac, adipose and renal tissue fibrosis analysis corresponding to 5 mouse / administration groups. Three stained sections from each animal were used to assess the degree of fibrosis.
- Macrophage cell line RAW 264.7 was inoculated into six well plates at a density of 2.5 ⁇ 10 5 cells / well. After 12 hours, macrophages were treated with the compound of interest for 16 hours. Macrophages were then treated for 3 hours in the presence or absence of 100 ng / mL LPS and the cells harvested to separate RNA for gene expression analysis. Repeat the assay two more times to take three samples for quantitative real-time PCR analysis. Obtained. Experimental Example 1. Modulation of Enolase Enzyme Activity of E Oblock
- ENOblock-treated 3T3-L1 adipocytes or Huh7 hepatocytes showed increased expression of enolase in the nucleus (FIGS. 2-5).
- ENOblock treatment also reduced the expression of c- ⁇ , known as the target gene of nuclear enolase / MBP-1, in adipocytes (FIGS. 6 and 7).
- Erbb2 (HER2 / neu) known as the enolase target gene, has reduced expression in both ENOblock treated hepatocytes and adipocytes (FIGS. 8-11).
- ENOblock induces enolase nuclear localization through the regulation of enzymatic glycolysis activity
- 10 ⁇ M of ENOblock or 2 mM NaF which inhibits enolase catalytic activity, was applied to Huh7 liver for 48 hours. Cell lines were treated. That The results are shown in FIGS. 12 and 13. As shown in FIGS. 12 and 13, NaF did not induce nuclear localization and increased nuclear localization by ENOblock.
- db / db mice Six-week-old db / db mice were treated with 8 mg / kg ENOblock or 8 mg / kg rosiglitazone (rosigl i tazone) for at least 24 hours. Subsequently, ENOblock and rosiglitazone were treated for 7 weeks in db / db mice.
- the chemical structure of the ENOblock is shown in FIG. 16, and the experimental procedure is shown in FIG. Thereafter, blood glucose levels, serum levels and enolase activity of each mouse were measured.
- FIGS. 20 to 25 is one-way ANOVA.
- Test and Dunnett's mut iple comparison test and unpai red t-test (ns: not significantly different; *, ** or p ⁇ 0.05, p ⁇ 0.01 or p ⁇ 0.001;# , ## or #: p ⁇ 0.05, p ⁇ 0.01 or p 0 .001, respectively, significantly different from the corresponding db-control; , a: a: or : p ⁇ 0.05, p ⁇ 0.01 or p 0 .001, respectively significantly different from the corresponding db_ Rosi .
- FIGS. 18-28 blood glucose levels were significantly reduced in ENOblock and rosiglitazone treated mice (FIG. 18).
- blood glucose levels were significantly reduced in db / db mice treated with 8 mg / kg or 12 mg / kg ENOblock, or 8 mg / kg rosiglitazone for 7 weeks (FIG. 19). Rosiglitazone reduced blood glucose levels more effectively than ENOblock.
- ENOblock treatment significantly reduced serum LDL levels, while not affecting HDL levels as compared to untreated db / db mice (FIGS. 20 and 21).
- Db / db mice treated with 12 mg / kg ENOblock reduced serum levels of free fatty acids (FFA) compared to untreated db / db mice (FIG. 22).
- FFA free fatty acids
- livers were extracted from db / db mice. Then, the liver weight was measured, and the liver was visually Evaluated. In addition, lipid staining and liver fibrosis were measured through various staining and marker expression measurements. In addition, apoptosis of mouse liver cells was measured. Tooth diagram
- ENOblock treatment did not affect liver weight or appearance, while rosiglitazone treatment significantly increased liver weight (FIGS. 29 and 30). Lipid accumulation was induced in the liver of 12 mg / kg ENOblock treated mice by Oi l red 0 staining (FIGS. 31 and 32). Masson-Tr i chrome staining confirmed that ENOblock treatment significantly reduced liver fibrosis (FIGS. 33 and 34). Fibrosis in the liver of rosiglitazone treated mice could not be assessed due to the accumulation of large amounts of lipids.
- a_SMA expression was statistically significantly less than in untreated db / db mice in ENOblock treated mice (FIG. 101).
- ENOblock treatment significantly reduced steatosis than rosiglitazone treatment (FIGS. 35 and 36).
- ENOblock treatment reduced hepatocyte apoptosis and more effectively inhibited atoptosis than rosiglitazone (FIGS. 37 and 38).
- the inhibitory effect of hepatocyte atoptosis upon treatment with ENOblock was confirmed by Western blot analysis of two apoptosis markers, cleaved caspase-3 and cleaved PARP (FIGS. 39 to 41).
- Experimental Example 5 Expression of inflammatory markers in liver of T2DM mice and confirmation of function of ENOblock on hepatic lipid homeostasis and important regulators of glucose neosynthesis
- FIGS. 29 to 50 are the mean ⁇ SD for (FIGS. 30, 32, 34, 36, and 38), and It was represented by ⁇ SE. All statistical analyzes were performed with one-way ANOVA test and Dunnett's mult iple compar i son test (ns: not significantly different; *, ** or ***: p ⁇ 0.05 , p ⁇ 0.01 or p ⁇ 0.0 means significantly different from the corresponding control group (B6); #, ## or ⁇ : p ⁇ 0.05, p ⁇ 0.01 or p ⁇ 0.001, respectively meaning db--significantly different from the control) .
- ENOblock treatment inhibited the expression of inflammatory markers IL-6 and TNF- ⁇ , increased expression in db / db mice compared to the B6 strain (Fig. 42 and 43).
- ENOblock was shown to be more effective at reducing TNF- ⁇ expression than rosiglitazone.
- Phosphoenol pyruvate carboxykinase-KPck-l cytoplasmic form is associated with positive regulation of glucose angiogenesis.
- Pck-1 expression was down-regulated by ENOblock treatment, whereas the expression of pyruvate carboxykinase-2 (Pck-2; mi tochondrial form) increased with phosphoen, which was not associated with glucose neosynthesis regulation (FIGS. 44 and 45).
- Pck-2 pyruvate carboxykinase-2
- Srebp-la and Srebp-lc are major regulators of lipid homeostasis.
- db / db mice were treated with 12 mg / kg ENOblock or 8 mg / kg rosiglitazone for 7 weeks.
- the results are shown in FIGS. 51 to 58.
- 51-58 ENOblock treatment did not increase overall weight compared to rosiglitazone treatment.
- ENOblock-treated mice did not differ in gonad adipose tissue weight compared to rosiglitazone treated mice (FIGS. 51 and 52).
- db / db mice showed increased adipocyte size and fat fibrosis compared to non-diabetic mice, C57BL / 6 B6).
- ENOblock significantly reduced adipocyte size and adipose tissue fibrosis (FIGS. 53-56).
- ENOblock treatment reduced the expression of the fibrosis marker ⁇ -smooth musc le act in (FIGS. 57 and 58).
- RAW 264.7 macrophages were treated with 5 or 10 ⁇ ENOblock for 16 hours before treatment with 100 ng / mL LPS for 3 hours.
- macrophages were pretreated with Ci lostaz, known as antiplatelet drug, which improved insulin resistance by inhibiting chronic inflammation at a concentration of 10 or 25 ⁇ .
- FIGS. 59 to 65 The results are shown in FIGS. 59 to 65.
- FIGS. 59 and 60 The statistical analysis of FIGS. 59 and 60 is a bidirectional AN0VA test and Sidak mut iple comparison test.
- ENOblock inhibited TNF- ⁇ , an inflammatory gene, and toll-like receptor 4 (TLR4) is present in proinflammatory LPS-stimulated macrophages.
- the inhibitory effect of ENOblock on TLR4 expression is greater than cilostazol (FIGS. 59 to 60).
- cilostaz is an inhibitor of phosphodiesterase 3B which suppresses chronic inflammation in T2DM adipose tissue and improves insulin resistance.
- Heart weight was not affected by ENOblock treatment ( Figure 66).
- Heart weight which is an indicator of cardiac hypertrophy: the ratio of body weight was reduced by ENOblock treatment (FIG. 67).
- Masson-Tr i chrome staining showed that ENOblock treatment reduced cardiac fibrosis (FIG. 68 and 69).
- H & E staining showed that ENOblock treatment reduced cardiomyocyte hypertrophy (FIGS. 70 and 71).
- ENOblock reduced aptosis in cardiac tissues (FIGS. 72 and 73).
- Low levels of apoptosis in ENOblock treated cardiac tissue compared to rosiglitacon were confirmed by Western blot of apoptosis markers, truncated PARP and truncated caspase-3 (FIGS. 74-76).
- Potassium two pore domain channel subfami ly K member l Kcnkl
- N ⁇ acylsphingosine amidohydrolase 2 Asah2
- beta-l N ⁇ acylsphingosine amidohydrolase 2
- B4glant 4-N-acetyl-galactosaminyl transferase l
- MMP-3 matr ix metal loproteinase 3
- ENOblock treatment reduced the expression of Kcnkl compared to untreated db / db mice and decreased the expression of Asah2, B4glant and MMP-3 compared to rosiglitazone treated mice (FIGS. 81-84).
- Experimental Example 8 ENOblock's Function on Renal Tissue Fibrosis and Apoptosis in T2DM Mice
- ENOblock treatment did not significantly affect kidney weight (Figure 85). Masson-tr i chrome staining showed that ENOblock reduced kidney fibrosis (FIG. 86 and FIG. 87). In addition, ENOblock treatment reduced aptosis, while logiglitazone treatment reduced atoptosis. Increased (FIG. 88 and FIG. 89).
- Kidneys are a major site of glucose neosynthesis. ENOblock downregulated the expression of Pck-1 (cytoplasmic form) associated with positive regulation of glucose neosynthesis (FIG. 96). Collagen 4a3 is glomerular specific and excess levels are associated with glomerulonephritis. On the other hand, collagen 4al and collagen 4a2 are commonly expressed in the basement membrane. ENOblock treatment reduced the expression of collagen 4a3 and increased the expression of collagens 4al and 4a2 (FIGS. 97-99).
- Pck-1 cytoplasmic form
- Collagen 4a3 is glomerular specific and excess levels are associated with glomerulonephritis.
- collagen 4al and collagen 4a2 are commonly expressed in the basement membrane. ENOblock treatment reduced the expression of collagen 4a3 and increased the expression of collagens 4al and 4a2 (FIGS. 97-99).
- Dexamethasone forskol in, rapamycin and rosigl itazon were purchased from Santa Cruz Biotechnology (CA, USA).
- Antibodies to MetforminCl, 1-dimethylbiguanide hydrochloride), 3-isobutyl-l-methylxanthine (IBMX), sodium f luor ide (NaF), oil red 0 and a -smooth muscle act in (Catalog No. A5228) were identified as Sigma-Aldrich ( MO, USA).
- Tetramethylrhodamine, ethyl ester and perchlorate (TMRE) were also purchased from Thermo Fisher Scient if ic (MA, USA).
- 3T3-L1 mice Whole adipocytes of 3T3-L1 mice were obtained from the Bank of Korea Cell Line (Seoul National University Hospital, Korea). The cells were then incubated in DMEM with 10% calf serum, 50 units mL- 1 penicillin and 50 ug mL- 1 streptomycin (PenStrep). 3T3-L1 cells were differentiated into adipocytes as follows: 48 hour post-confluent cells (specified as day 0) were treated with 10% FBS, 0.5 mM IBMX, 2 jug / ml dexamethasone, 1 / g / ml insulin and PenStrep. Incubated for 2 days in DMEM containing. The cells were then incubated in fresh DMEM with 10% FBS and 1 g / of insulin.
- mice Eight week old male C57BL / 6J mice were purchased from Damool Science (Korea). The protocol for separating primary adipocytes is as follows. Mice were sacrificed and whole white gonad tissue or scapula brown adipose tissue was excised and homogenized in 1 mL of DPBS containing 0.5% BSA.
- the tissues were then treated with 0.8 U / mL collagenase and 2.7 U / mL dispase in 3 mL digestion medium while incubating for 30 minutes at 37 ° C.
- the volume of the digestion medium with EDTA at a final concentration of 10 mM was adjusted to 10 mL.
- the suspension was then collected through a 70 jm filter into a new 50 mL tube. The lipid portion was removed by centrifugation at 500 g at 4 ° C. for 10 minutes.
- Adipose progenitor cells in the stromal vascular portion of the pellet were isolated by treatment for 5 minutes with RBC lysis supernatant on ice. Lysis was stopped with MACs buffer (PBS containing 2% FBS and 1 mM EDTA). Adipose progenitor cells were washed once more with PBS solution and counted to inoculate the culture dish. To induce differentiation, the progenitor cells were treated with adipocytic factor 0.5 mM IBMX, 2 ng / mL dexamethasone, 10 ⁇ rosiglitazone and 1 yg / mL insulin.
- Example 4 RNA Extraction from Cells and Tissues
- cDNA was used for real-time PCR according to the manufacturer's instructions, with the following modifications: PCR was repeated in three sections with a total volume of 20 uL of 2X Power containing 1 i L cDNA and specific primers with a final concentration of 200 nM. It was performed with SYBR® Green PCR Master Mix (Appl ied Biosystems, UK). The mixture was incubated at 95 ° C. for 10 minutes before PCR amplification consisting of 40 cycles of denaturation, annealing and extension. Degeneration was performed at 95 ° C. for 15 seconds, annealing was performed at 60 ° C. for 1 minute, extension was performed at 72 ° C. for 20 seconds, and each cycle was detected by fluorescence at 72 ° C.
- the melting point analysis of the samples was performed with continuous fluorescence detection in the range of 60-95 ° C.
- Specific cDNA samples were included in each reaction and used as a reference for comparison between reactions.
- Expression levels of 18S rRNA or act in were used for normalization while calculating expression levels of other genes. The result was the relative expression level of each gene.
- each gene in the drug-treated sample was calculated to calculate the ⁇ value.
- ACT values were further normalized to ACT values of the same gene in HFD samples or SFD samples treated with nothing, showing relative expression of each gene in drug-treated samples compared to controls. Relative mRNA expression changes were calculated using a 2 "2 ⁇ ⁇ CT method. The final mRNA expression in each experiment was calculated as the average of three independent experiments.
- Example 6 Western Blot
- Protein samples of 30 or 40 were loaded on 10% polyacrylamide gels, and after electrophoresis, the nitro sal was transferred to the rose membrane.
- Primary antibodies were used diluted 1: 1000 in TBS-T + 5% skim milk powder and stored at 4 ° C. overnight with membrane.
- Primary antibody detection was performed by incubating with HRP-linked secondary antibody (ant i-mouse IgG-HRP, sc2031, Santa Cruz Biotech, CA, USA) for 30 minutes at room temperature. At this time, the secondary antibody was diluted to 1: 10000 and used. Expression signals were visualized through ECL solution (RPN2232, GE Healthcare Life Science, UK).
- Example 7 Mitochondrial Membrane Potential Measurement
- BSA bovine serum albumin
- the cells were seeded at a density of 5 ⁇ 10 3 in a clear black polystyrene 96-well microplate (Corning TM, catalog no. 07-200-565) and of interest. The compound was treated for 72 hours. Cells were then treated with 200 nM TMRE for 20 minutes at 37 ° C. and washed with PBS containing 0.2% BSA.
- TMRE-treated cells were performed using a Lionheart FX automated microscope (BioTek, VT, USA). Fluorescence levels were measured at wavelengths of 549 nm (excitat ion) and 575 nm (emission) (Texas-Red f i ter). To measure various changes in cell location in the wells, the fluorescence intensity was scanned in the 2 ⁇ 2 region and the results were averaged. Mean obj ive intensi ty was measured and normalized to the number of cells present in each well using Gen5TM 3.0 software (BioTek, VT, USA). Data is shown as the average of nine measurements. Example 8 Oi l Red 0 staining
- mice fed a high fat diet were purchased from Charles River, Japan. Mice received HFD from 4 weeks of age and were fed at 14 weeks of age. After receiving the mouse, the mouse was fed with HFD.
- mice were stabilized for 5 days in an animal facility and maintained a 12h / 12h light cycle at a density of 3 per cage. Pre-weighed mice were fed free of HFD. The cages were cleaned weekly before the fasting experiment. After stabilization, drug treatment was started.
- mice were divided into three groups of six and the drug was treated for 8 weeks as follows: group 1) 8 mg / kg rosiglitazone; Group 2) 12 mg / kg ENOblock; Group 3) Solvent only treatment (sal ine with 10% DMS0). It was noted that the micromolar dose of rosiglitazone was higher than the ENOblock of 22.4 Mm and 20.2 mM, respectively.
- the drug was administered via intraperitoneal injection every 24 hours with a solution volume of 10 ii L / g. Food intake and body weight were monitored weekly from 1 week of drug administration. Fasting blood glucose was measured at 4, 6 and 8 weeks. Blood glucose was measured by OneTouch Ul tra (Li feScan, CA, USA). Insulin resistance test ( ⁇ ), glucose tolerance test (GTT) and pyruvate resistance test (PTT) are provided by the Mouse Metabolic Phenotyping Center at the Yale School of Medicine (MMPC; ht tps: // www. ⁇ pc.org/) It was performed according to the guidelines received. GTT, ⁇ , and PTT were performed at 4, 5, and 7 weeks of drug treatment, respectively.
- HFD mice were divided into three groups as follows: Group 1) 8 mice administered 120 mg / kg of met formin; Group 2) 12 mg / kg 7 mice administered ENOblock; Group 3) 8 mice treated with solvent only (sal ine with 10% DMS0).
- the drug was administered via intraperitoneal injection every 24 hours for 8 weeks in a solution volume of 10 ii L / g.
- Food intake and body weight were monitored weekly from 1 week of drug administration.
- GTT, ITT and PTT were performed at 4, 5 and 7 weeks of drug treatment, respectively.
- blind tests were performed when performing GTT, ITT and PTT.
- mice were dissected through inhalation of diethyl ether.
- Blood was obtained from the heart and kidney, liver, brain, spleen, pancreas, skeletal muscle, gonad fat tissue and brown adipose tissue were extracted. Blood was coagulated by placing it in a microfuge tube at room temperature for 15 minutes. The uncoated portion was removed by centrifugation (10 min at 4 ° C. at a speed of 1500 g). The supernatant was divided by 50 ii L and frozen at -80 ° C. The dissected organs and tissues were washed twice with PBS and stored at -80 ° C.
- Serum samples were stored at -80 ° C before testing.
- the volume of triglycerides was measured using a colorimetric triglyceride quantification kit (K622-100; BioVision, CA, USA) according to the manufacturer's instructions. Triglyceride concentrations were calculated and expressed in mM. Blood serum samples were used twice in 5 to 6 animals per treatment group.
- Example 11 Serum HDL and LDL Cholesterol Measurement
- HDL high density lipoprotein
- LDL low density lipoprotein
- ALT activity was expressed as nmol / mon / mL mU / mL, and the assay was performed according to the method provided by the kit (Catalog # K752, BioVision, Inc., USA). Blood serum samples were used three times in 6 animals per treatment group.
- Tissues of dissected mice were washed twice with PBS and dried, then placed in a low temperature molder and covered with OCKLei ca, Germany). The embedded tissue was then rapidly stirred using liquid nitrogen and transferred to an isopropanol slurry. The copper tissue was stored at ⁇ 80 ° C. until firmed using a CM 1850 cryostat (Leica, Germany). Paraffin sections were subjected to paraffin embedding after white and brown adipose tissue was fixed in formalin for 5 hours with 10% formaldehyde solution, followed by dehydration and xylene washing. The paraffin-embedded blocks were cut as much as 3 ⁇ ⁇ ⁇ . Sections were deparaffinized before staining with ⁇ & ⁇ or Masson Tri chrome. Hematoxylin and eosin staining was performed using a staining kit (Merck, Germany).
- mice per treatment group Five mice per treatment group were used to analyze liver fibrosis, lipid accumulation, liposemia and hepatic satellite counts. Microscopic images were taken at x200 magnification. Example 15 Measurement of Lipid Accumulation in Liver Tissues
- Liver lipid accumulation was visualized using oil red 0 staining and measured with ImageJ 1.45s software (NIH, USA). Liver tissue was cut to 8 urn thickness, air dried for 10 minutes and then fixed with 10% formalin solution. The slides were rinsed with water and washed with 6 isopropanol.
- Mitochondrial DNA (mtDNA) content in the hippocampus was quantified. Purify DNA using phenol-chloroform-isoamyl alcohol, and add 2 to each well of a 384-well plate with TaqMan primers for 18S nuclei (Mm03928990_gl) or 16S mitochondria (Mm04260181_sl) DNA (Appl ied Biosys terns, USA). ng was loaded. Hippocampal mtDNA was quantified from 6 mice of each treatment group.
- Adipose tissue sections were stained with H & E and fat cells and size distribution were measured using Image J software. Germline adipose tissue was stained from 5 mice per treatment group and 100 randomly selected fat cells were measured from each mouse.
- Example 22 Isolation of Adipose Tissue Immune Cells for Flow Cytometry Dissected from mice sacrificed with gonad adipose tissue. After weighing and taking pictures, adipose tissue was digested with collagenase. Six gonad tissues per treatment group were used for immune cell analysis.
- lipid production-related gene expression in adipocytes was measured at various stages of differentiation.
- the following genes were evaluated: lipid production regulatory genes, adiponectin adipocyte protein 2G4), peroxysome proliferative active receptor gamma (/ 3 ⁇ 4 rj, lecithin 03 ⁇ 4to), angiotensin (fea), CCAAT / amplifier binding Protein -a. ((Ba) and CCAAT / amplifier binding protein -p Cfebpb).
- oxidative phosphorylation markers nuclear respiratory factor l (Nrfl), cytochrome c oxidase subunit Vinb (3 ⁇ 4r ⁇ ) and carnitine palmitoyltransferase ⁇ Cptlb
- pyrogenic unbound protein 1-3 (Ucp- 1, Ucp-2, Ucp-3), peroxysome proliferative active receptor gamma co-activator 1-alpha (/ ⁇ - ⁇ ) and PR domain containing 16 ( ⁇ )
- the ENOblock treated adipocytes did not show significant changes in the adipogenic regulatory genes, Adipoq, Ppar- ⁇ , Cebpa and Cebpb ⁇ ⁇ expression, Ap2 and It was shown to downregulate the expression and to upregulate the expression of 12 (FIGS. 102 and 103).
- ENOblock treatment upregulated oxidative phosphorylation regulatory genes, Cox8b and Cptlb ⁇ expression, and downregulated expression of Nrfl markers (FIG. 104).
- ENOblock treatment upregulated the expression of Ucp-, a heat-generating marker, while down-regulating Prdnd6 expression, and Ucp-3 and Pgc-1 ⁇ did not show significant changes in expression (FIG. 105).
- Experimental Example 2 Induction Effect of ENOblock on Adipogenesis
- adipose progenitor cells were treated with 10 ⁇ forskolin, 1 ⁇ rapamycin or 10 ⁇ ENOblock for 72 hours. Thereafter, adipocyte localization factor was observed for 5 days.
- 106-109 (ns: not significantly different; *, ** or ***: p ⁇ 0.05, p ⁇ 0.01 or p ⁇ 0.0, which is significantly different from the corresponding 'control' or 'untreated person') Difference; ## or ⁇ : significantly different from complimentary 'ENOblock' treatment group; ⁇ , xac or ⁇ : significantly different from corresponding 'Forskolin' treatment group.).
- ENOblock treated cells Adipoq, Ap2, Ppar- ⁇ , Retn, Agt, Cebpa and Cebp ⁇ ⁇ downregulated genes.
- Rapamyc in treatment induced Adipoq, Ap2, Ppar- ⁇ , and Retn ⁇ ⁇ downregulation, whereas did not induce Agt, Cebpa and Cebpb ⁇ ⁇ downregulation (FIG. 107).
- ENOblock upregulated oxidative phosphorylation marker genes Nrfl and Cox8l and downregulated Cptlb (FIG. 108).
- ENOblock treatment inhibited the expression of Adipoq, Ap2, Ppar- ⁇ , Retn, Agt, Cebpa, and Cebpb ⁇ , which are fat-producing genes.
- NaF treatment downregulated Adipoq, Ap2, Retn and Cebpa ⁇ but did not downregulate Ppary and Cebpb.
- Anti-obesity agents that regulate the mitochondrial membrane potential of fat precursor cells of ENOblock can induce the heat production of brown adipose tissue (BAT) and white adipose tissue (WAT), which can be detected by proton leakage in the inner mitochondrial membrane.
- BAT brown adipose tissue
- WAT white adipose tissue
- 3T3-L1 white and progenitor cells were treated with 10 ⁇ ENOblock, 1 mM NaF, 1 ⁇ rapamycin, or 10 ⁇ forskolin.
- Mitochondrial membrane potential was measured using tetramethylrhodamine and ethyl ester (TMRE, indicator of mitochondrial membrane potential). The results are shown in FIGS. 118 and 119 and 122. As shown in FIGS. 118, 119, and 122, ENOblock, rapamycin, and forskol in treated 3T3-L1 and brown adipocytes showed a reduced membrane potential effect.
- 3T3-L1 white adipose precursor cells in differentiation cultures were treated with 10 ⁇ ENOblock, 10 ⁇ forskol in or 1 ⁇ rapamycin for 72 hours and Oi l Red 0 Staining was used to visualize lipid accumulation.
- ENOblock The chemical structure of the ENOblock is shown in FIG. 125. Induced by high fat diet (HFD) A treatment protocol for investigating the effects of ENOblock in the obese mouse model is shown in FIG. 126. ENOblock or rosiglitazone were treated in the HFD mouse model for 8 weeks.
- HFD high fat diet
- mice treated with ENOblock showed significantly reduced obesity induction compared to mice treated with rosiglitazone.
- HFD mice not treated with drug or treated with rosiglitazone were found to have oily hairs, which were not found in HFD mice treated with ENOblock (FIGS. 127 and 128).
- ENOblock-treated HFD mice During 8 weeks of ENOblock or rosiglitazone treatment, the increase in body weight of ENOblock-treated HFD mice was reduced compared to HFD mice not treated with drug and HFD mice treated with rosiglitazone. Weight loss between ENOblock-treated HFD mice and untreated HFD mice was statistically significant after three weeks.
- mice treated with ENOblock did not differ significantly from mice fed the standard diet (SFD group) (FIG. 129). As a result of measuring the food intake, there was no significant difference between the treatment groups (FIG. 130). Groups of mice treated with ENOblock were not treated or treated with rosiglitazone. Body temperature was significantly increased compared to the 6th week of drug treatment.
- mice treated with ENOblock at 6 weeks of drug treatment were not significant compared to SFD mice, but the body temperature of rosiglitazone treated mice was significantly lower than that of SFD mice (FIG. 131).
- Drug treatment 3, 5 and 7, the parking fasting blood glucose level was significantly decreased compared to mice induced by "a ENOblock rosiglitazone or the mouse group treated with fat (HFD) (Fig. 132).
- Experimental Example 6 Effect of ENOblock on glucose, insulin and pyruvate resistance
- mice received a glucose tolerance test (GTT). The results are shown in FIGS. 133 and 134. In addition, mice were tested for insulin resistance ( ⁇ ) at week 5 of the ENOblock treatment. The results are shown in FIGS. 135 and 136. In addition, hyperinsulemia and insulin resistance were evaluated in ENOblock treated mice. This is illustrated in FIGS. 137 and 138.
- GTT glucose tolerance test
- ENOblock and rosiglitazone treated mice showed improved glucose tolerance than untreated HFD mice (FIGS. 133 and 134).
- ENOblock and rosiglitazone treated mice Improved insulin resistance was observed when compared to untreated HFD mice, while not significantly different from the insulin resistance of SFD mice (FIGS. 135 and 136).
- ENOblock and rosiglitazone treated mice had reduced hyperinsulinemia compared to untreated HFD mice, and reduced insulin resistance (H0MA-IR) in the bio homeostasis model evaluation (FIGS. 137 and 138).
- HFD mice treated with ENOblock or rosiglitazone showed improved blood glucose response after pyruvate challenge than untreated HFD mice. Blood glucose levels after PTT showed no statistical significance between SFD mice and ENOblock or rosiglitazone treated HFD mice (FIGS. 139 and 140).
- Experimental Example 7 Effect of ENOblock on hepatic steatosis and fibrosis
- FIG. 141 Representative anatomical-liver tissue photographs of HFD mice are shown in FIG. 141. Groups of mice treated with HFD or rosiglitazone were compared to HFD mice treated with SFD or ENOblock. The results are shown in FIGS. 141 and 142.
- HFD mice showed significant lipid accumulation compared to SFD mice, which were inhibited by ENOblock treatment. Rosiglitazone treatment did not reduce lipid accumulation (FIGS. 144 and 145). H & E staining showed that HFD mice showed hepatic steatosis. ENOblock treatment reduced microlipidism, while there was no significant effect by rosiglitazone treatment (FIGS. 146 and 147).
- Masson-Tri chrome staining showed significant development of liver fibrosis in HFD mice. ENOblock treatment, but not rosiglitazone, reduced fibrosis to the levels observed in SFD mice (FIGS. 148 and 149). The development of obese-derived liver fibrosis caused by diet is associated with the activation of hepatic stellate cells that can be detected by immunostaining for alpha-smooth muscle actin ( ⁇ -SMA).
- ⁇ -SMA alpha-smooth muscle actin
- HFD mice showed an increase in hepatic stellate cells compared to SFD mice.
- Mice treated with ENOblock but not rosiglitazone reduced stellate cell numbers to levels observed in SFD mice.
- the effect of ENOblock on reducing the development of fibrosis in the liver of HFD mice was confirmed by Western blot analysis of qPCR and ⁇ -SMA expression (FIGS. 150-153).
- Experimental Example 8 Effect of ENOblock on Inflammation
- HFD-induced hepatic steatosis can progress chronic inflammation and cirrhosis.
- Mice were treated with ENOblock for 8 weeks to assess liver inflammation markers. The results are shown in FIGS. 154 and 155.
- S100 calcium-binding protein 9i S100a9 regulates myeloid cell function, which is a biomarker of nonalcoholic steatohepatitis. Expression of the protein was assessed in mice treated with ENOblock. The result is shown in FIG.
- HFD increased the expression of interleukin-6 (/ ⁇ ) and tumor necrosis factor-alpha ( ⁇ - ⁇ ).
- ENOblock or rosiglitazone also reduced IL-6 and TNF-a ⁇ ] expression as compared to SFD mice.
- S100a9 expression was increased in HFD mice than SFD mice.
- Treatment with rosiglitazone increased S100a9 expression in HFD mice, whereas ENOblock treatment showed no effect.
- Experimental Example 9 Induction of Hepatic Lipid Homeostasis and Glucose Synthesis Inhibitor of ENOblock
- Stele regulatory component binding proteins (5ra3 ⁇ 49-l3 and Srebp-1) are important regulators of lipid synthesis. Mice were treated with ENOblock to evaluate expression of these proteins. The results are shown in Figure 157. Insig-1 and Insig-2 Proteins Prevent Srebp-la and Srebp-lc Ex Maturation in Golgi and Autosecretory Motility Factors Alternatingly by receptor, isoform 2 (Amfr or Gp-78). Mice were treated with ENOblock to assess expression of these proteins. The result is shown in FIG.
- liver X receptor (LXR) target genes was observed in ENOblock treated mice. The result is illustrated in FIG. 159. The onset of prediabetes in obesity is associated with irregularities in glucose neosynthesis that are regulated by phosphoenolpyruvic acid carboxykinase. Expression of the Pck protein was measured in ENOblock treated mice. The results are shown in FIG. 160.
- Srebp-la and Srebp-lc 'expression was upregulated in the liver of HFD mice rather than SFD mice.
- ENOblock treatment inhibited Srebp-la and Srebp-lc expression.
- rosiglitazone treatment inhibited Srebp-la and Srebp-lc ex expression (FIG. 157).
- ENOblock treatment did not significantly affect the expression of Amfr and Insig-, while inhibiting Insig-2 ex expression (FIG. 158).
- the liver X receptor (LXR) target genes Scap and Abcg5 were not affected or inhibited, respectively, by ENOblock treatment (FIG. 159).
- HFD mice showed increased Pck-1 and Pck-2 ⁇ ⁇ expression than SFD mice.
- ENOblock or rosiglitazone treatment reduced the expression of Pck-1 and Pck- in HFD mice (FIG. 160).
- HPD mice also upregulated the expression of all five adipose genes than SFD mice.
- ENOblock treatment reduced the expression of all five fat producing genes to the levels observed in SFD mice.
- Rosiglitazone treatment reduced Ppar- ⁇ , Retn, and Cebpa ⁇ expression in HFD mice, but did not significantly reduce the expression of Adipoq and (FIG. 161).
- Experimental Example 10 Effect of ENOblock on Hippocampal Inflammation
- Obesity is known to be associated with hippocampal dysfunction and memory impairment, which is thought to be due to HFD-induced inflammatory reactions in the hippocampus.
- Comparison of HFD mice with SFD mice confirmed the expression of the hippocampal inflammatory markers, the similar receptors (Tl r4), IL-6, TNF- ⁇ and CDllc. The result is illustrated in FIG. 162.
- HPD mice showed increased expression of the hippocampal inflammation markers similar receptors (77r4), IL-6, TNF-a and CD11 (compared to SFD mice.
- ENOblock treatment showed SFD mice ( ⁇ ) reduced expression of these inflammatory markers in HFD mice to levels observed in ⁇ and Cdllc ⁇ ) or SFD mice (77 / and).
- rosiglitazone treatment reduced the expression of inflammatory markers in the hippocampus.
- Neuronal pentraxin-2 ( ⁇ i) regulates synaptic plasticity and is an proinflammatory biomarker of nonapoptotic neuronal death49.
- Nptx2 expression was upregulated in HFD mice compared to SFD mice.
- Treatment with ENOblock reduced Nptx2 expression in HFD mice to the levels observed in SFD mice.
- rosiglitazone also reduced expression in HFD mice.
- HFD is known to reduce mitochondrial mass in various cell types, causing changes in brain energy and infrastructure.
- mitochondrial transcription factor k Tfam has a positive correlation with the regulation of mi tochondr i al genome copy number.
- Tfam ⁇ ⁇ expression was reduced in the hippocampus of HFD mice compared to SFD mice.
- Treatment of ENOblock increased Tfam expression to the levels observed in SFD mice.
- Rosiglitazone administration also increased Tfam expression in HFD mice.
- the transcription factor cAMP response element binding protein (Creb) is sensitive to changes in the energetic state of neurons. Creb expression was increased in HFD mice compared to SFD mice. ENOblock, but not rosiglitazone, reduced Creb expression in HFD mice. Nrf-1 and Nrf-2 regulate neurite outgrowth and mitochondrial biosynthesis. Nrf-1 expression was decreased in HFD mice and ENOb lock administration was indicated by Nrf-1. Expression was significantly increased. In contrast, Nrf-2 expression was increased in HFD mice and decreased by ENOblock treatment. Rosiglitazone treatment did not affect Nrf-1 expression, but decreased Nrf2 ⁇ ⁇ expression similar to ENOblock administration (FIG. 163).
- HFO mice showed increased serum concentrations of triglycerides, HDL cholesterol and LDL cholesterol.
- serum triglyceride levels were increased, HDL cholesterol levels were decreased, and LDL cholesterol levels were not significantly changed.
- ENOblock treated HFD mice had lower levels of serum triglycerides and LDL cholesterol than untreated HFD mice. Serum LDL cholesterol levels in ENOblock treated HFD mice reached the same range as SFD mice.
- Experimental Example 12 Effect of ENOblock on Adiposis
- FIG. 169 A photo representing white adipose tissue of the gonad is shown in FIG. 169.
- the white adipose tissue weight of the gonad and the size of fat cells, induction of lipid production and expression of inflammatory markers were measured. The results are shown in FIGS. 170-174.
- ENOblock treatment decreased the tissue weight of the gonads in HFD mice, while rosiglitazone treatment did not show a significant effect (FIG. 170).
- the increase in fat cell size was suppressed in the white adipose tissue of the gonad of HFO mice by ENOblock treatment. This was more effective than rosiglitazone, which reduced fat cell size (FIG. 1 and FIG. 172). .
- Thermogenic regulators and obesity in brown adipose tissue have been shown to induce lipid formation in white adipose tissue.
- FIG. 175 A photograph representing the brown adipose tissue between the scapula is shown in FIG. 175.
- the weight of brown adipose tissue between the scapula, the size of fat cells, the expression of inflammatory markers and the degree of fibrosis were measured in HFD mice treated with ENOblock.
- HFD mice treated with ENOblock or rosiglitazone increased the brown adipose tissue weight between the scapula when compared to HFD or SFD mice.
- the effect of ENOblock on brown adipose tissue weight was greater than that of rosiglitazone treated mice (FIG. 176).
- H & E staining of brown adipose tissue between the scapula showed reduced adipocyte size in ENOblock treated HFD mice compared to HFD, rosiglitazone treated HFD and SFD mice (FIG. 177).
- Obesity is associated with progression of prediabetes / insulin resistance, which occurs in a diet-induced obese mouse model. To prevent prediabetes in obesity
- ENOblock HFD mice were treated with ENOblock or metformin (Glucophage TM ), which is most likely to affect diabetes in obese patients. It is an important remedy.
- FIG. 182 The schedule of treatment of ENOblock or metformin in HFD mice is shown in FIG. 182.
- mice showed lower blood glucose levels than the met formin-treated mice (FIG. 185).
- Blood glucose tolerance test week 4 drug treatment
- insulin resistance test week 5 drug treatment
- pyruvate resistance test week 7 drug treatment
- SFD mice were included in all ranges (FIGS. 186-191).
- Experimental Example 14 Effect of ENOblock on hyperinsulinemia HFD mice were treated with ENOblock and met formin for 8 weeks to confirm the effect of ENOblock on hyperinsulinemia. As shown in the Fig. 192 to Fig.
- HFD mice showed hyperinsulinemia and increased H0MA-IR, which were reduced by ENOblock or met formin treatment.
- ENOblock treatment significantly reduced hyperinsulinemia and H0MA-IR than met formin (FIGS. 192 and 193).
- White adipose tissue photographs of the dissected gonads are shown in FIG. 194.
- ENOblock and met formin treatment reduced the weight of brown adipose tissue of the gonads, and ENOblock showed a greater effect than met form in (FIG. 195).
- Obesity is associated with adipose tissue inflammation, which is characterized by a reduced number of anti-inflammatory 'M2' type macrophages.
- Flow cytometry of the expression of the plate macrophage marker CD68 (macrosial in) and the M2 macrophage marker CD206 (mannose receptor) in inflammatory cells derived from white adipose tissue confirmed a decrease in the number of M2 macrophages in HFD mice than in SFD mice. It was. ENOblock treatment increased the proportion of M2 macrophages in adipose tissue of HFD mice. Met formin treatment caused a variable response in HFD mice. Overall, the proportion of M2 macrophages was not significantly changed than untreated HFD mice (FIGS. 196 and 197).
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Epidemiology (AREA)
- Life Sciences & Earth Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- General Health & Medical Sciences (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Dermatology (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
본 발명은 EN0block을 유효성분으로 포함하는 비만 예방 또는 치료용 약학 조성물에 관한 것이다. 본 발명에 따른 EN0block은 에놀라제 활성을 억제하여 당뇨와 고지혈증 증세를 개선시킬 뿐만 아니라, 당뇨 합병증으로서 진행되는 세포사멸 (apoptosis)에 의한 조직 손상, 염증 진행 및 조직 섬유화를 막는 효과가 있다. EN0block은 지방 생성 유전자의 발현을 억제하여 비만 치료제로 유용하게 사용될 수 있다. 또한, EN0block은 기존에 항당뇨제로 알려진 로지글리타존 (rosiglitazone)에 비해 간, 신장 및 심장에서의 부작용이 적다. 다. 또한, EN0block은 기존에 항당뇨제로 알려진 로지글리타존 (rosiglitazone)에 비해 간, 신장 및 심장에서의 부작용이 적다.
Description
[명세서]
【발명의 명칭】
ENOb lock을 유효성분으로 포함하는 비만 예방 또는 치료용 약학 조성물 【기술분야】
본 발명은 ENOb lock을 유효성분으로 포함하는 비만 예방 또는 치료용 약학 조성물에 관한 것이다.
【배경기술】
비만은 에너지 밸런스 조절기능의 이상 혹은 과영양으로 지방조직이 과다하게 축적되어 각종 질병의 이환율과 사망률을 높이는 만성 질환이다. 비만은 비만 그 자체가 갖는 문제점뿐만 아니라, 고혈압, 고지혈증 및 심혈관계 질환이나 당뇨와 같은 질병의 원인으로 작용할 수 있다. 몸무게 1kg의 증가는 심혈관질환 위험도를 3. 1% ' 당뇨 위험도를 4.5-9% 증가시키며, 약 11% 몸무게의 감소는 상기 질환으로 인한사망률을 25¾ 감소시키는 것으로 알려져 있어 비만의 효과적인 치료 방법이 긴급하게 요구되고 있다.
비만에 의해 발생되는 만성 성인병의 하나인 당뇨병은, 인술린을 분비하는 세포가 파괴되어 인술린의 양이 절대적으로 부족한 제 1형 당뇨병과 인슐린이 작용하는 장기에서 인슐린에 대한 저항성이 생긴 제 2형 당뇨병으로 구분된다. 우리나라의 경우 제 2형 당뇨병 환자가 약 90% 이상을 차지하고 있다. 또한, 우리나라 생활수준의 향상과 함께 생활양식이 서구화되면서 당뇨병 환자가 빠르게 증가하고 있고, 그로 인한 사망률 또한 빠르게 증가하여 0ECD 국가 중 당뇨로 인한 사망률 1위를 기록했다. 이러한 당뇨병은 망막증, 신부전 ,
SUBSTITUTE SHEET (RULE 26) RO/KR
말초신경합병증 등 매우 심각한 합병증을 초래할 수 있어, 조기에 정확히 진단하고 관리하는 것이 필수적이다.
한편, 대한민국 등록공보 제 10- 1472083호에서는, 해당과정 경로 (glycolysi s pathway)의 한 구성요소인 에놀라제 (enolase)에 직접 결합하여 이의 활성을 억제하는 최초의 비-기질성 (non-substrate) 유사체인 작은 분자 'ENOblock'에 대해 개시하고 있다. 그러나, 상기 특허에서는, 트리아진계 화합물 (tr iazine compound)인 ENOblock의 용도에 대해 구체적으로 언급하고 있지 않다.
【발명의 상세한 설명】
[기술적 과제】 이에, 본 발명자들은 에놀라제 조절 화합물인 ENOblock이 비만 및 당뇨 마우스 모델에서 항-비만, 항 -염증 및 항-섬유증 효과를 유도함을 확인함으로써 본 발명을 완성하였다.
본 발명의 목적은 비만, 섬유증, 지방간, 당뇨 합병증, 고지혈증 및 /또는 퇴행성 뇌질환 예방또는 치료용 약학조성물을 제공하는 것이다.
【기술적 해결방법】
본 발명은 ENOblock을 유효성분으로 포함하는 비만 예방 또는 치료용 약학 조성물을 제공한다.
또한, 본 발명은 ENOblock을 유효성분으로 포함하는 섬유증 예방 또는 치료용 약학 조성물을 제공한다.
또한, 본 발명은 ENOblock을 유효성분으로 포함하는 지방간 예방 또는 치료용 약학 조성물을 제공한다.
또한, 본 발명은 ENOblock을 유효성분으로 포함하는 당뇨 합병증 예방
또는 치료용 약학조성물을 제공한다.
또한, 본 발명은 ENOblock을 유효성분으로 포함하는 고지혈증 예방 또는 치료용 약학조성물을 제공한다.
또한, 본 발명은 ENOblock을 유효성분으로 포함하는 퇴행성 뇌질환 예방 또는 치료용 약학조성물을 제공한다.
또한, 본 발명은 ENOblock을 개체에 투여하는 단계를 포함하는 비만, 섬유증, 지방간, 당뇨 합병증, 고지혈증 및 퇴행성 뇌질환으로 구성되는 군으로부터 선택되는 어느 하나의 질환을 예방 또는 치료하는 방법을 제공한다.
【발명의 효과】
본 발명에 따른 ENOblock은 에놀라제 활성을 억제하여 당뇨와 고지혈증 증세를 개선시킬 뿐만 아니라, 당뇨 합병증으로서 진행되는 세포사멸 (apoptosi s)에 의한 ί직 손상, 염증 진행 및 조직 섬유화를 막는 효과가 있다. ENOblock은 지방 생성 유전자의 발현을 억제하여 비만 치료제로 유용하게 사용될 수 있다. 또한, ENOblock은 기존에 항당뇨제로 알려진 로지글리타존 (rosigl itazone)에 비해 간, 신장 및 심장에서의 부작용이 적다.
【도면의 간단한 설명】
도 1은 화학식 2로 표시되는 ENOblock 처리에 따른 에놀라제 효소 활성을 나타낸 것이다.
도 2는 화학식 2로 표시되는 ENOblock 처리된 3T3-L1 지방전구세포주에서 핵 내 에놀라제를 웨스턴 블롯을 통해 분석한 것이다.
도 3은 화학식 2로 표시되는 ENOblock 처리된 3T3— L1 지방전구세포주에서 핵 내 에놀라제를 정량한 것이다.
도 4는 화학식 2로 표시되는 ENOblock 처리된 Huh7 간세포에서 핵 내
에놀라제를 웨스턴 블롯을 통해 분석한 것이다.
도 5는 화학식 2로 표시되는 ENOblock 처리된 Huh7 간세포에서 핵 내 에놀라제를 정량한 것이다.
도 6은 화학식 2로 표시되는 ENOblock 처리된 3T3-L1 지방전구세포주에서 에놀라제 결합 유전자인 c-Myc의 발현을 분석한 것이다.
도 7은 화학식 2로 표시되는 ENOblock 처리된 3T3-L1 지방전구세포에서 c-Myc 발현을 분석한 것이다.
도 8은 ENOblock을 처리된 3T3-L1 지방전구세포에서 에놀라제 결합 유전자인 Erbb2의 발현을 분석한 것이다.
도 9는 화학식 2로 표시되는 ENOblock 처리된 3T3-L1 지방전구세포에서 Erbb2 발현을 분석한 것이다.
도 10은 화학식 2로 표시되는 ENOblock 처리된 Huh7 간 세포주에서 에놀라제 결합유전자로 알려진 Erbb2 발현을 분석한 것이다.
도 11은 ENOblock을 처리한 Huh7 간 세포주에서 Erbb2 발현을 분석한 것이다.
도 12는 ENOblock 또는 NaF 처리된 Huh7 간 세포주에서 핵 내 에놀라제를 웨스턴 블롯을 통해 분석한 것이다.
도 13은 ENOblock 또는 NaF 처리된 Huh7 간 세포주에서 핵 내 에놀라제를 정량한 것이다.
도 14, 도 15는 ENOblock을 처리한 후, 간세포 (도 14) 또는 간조직 (도 15)에서 세포질 (cytosol ic) 및 핵 내 에놀라제 단백질 발현을 분석한 것이다. 도 16은 화학식 2로 표시되는 ENOblock의 화학 구조 (분자량= 631.18)이다. 도 17은 db/db T2DM 마우스에서 화학식 2로 표시되는 ENOblock의 항 당뇨병 효과를 평가하기 위한 동물 실험에 관한 프로토콜을 도식화한 것이다. 도 18은 화학식 2로 표시되는 ENOblock 또는 로지글리타존 처리한 db/db
마우스에서 24시간 동안의 혈당치를 측정한 것이다.
도 19는 화학식 2로 표시되는 ENOblock 또는 로지글리타존을 7주 이상 처리한 db/db 마우스의 혈당치를 나타낸 것이다.
도 20은 화학식 2로 표시되는 ENOblock 또는 로지글리타존을 7주 이상 처리한 후 db/db마우스의 LDL/VLDL콜레스테를 수치를 측정한 것이다.
도 21은 화학식 2로 표시되는 ENOblock 또는 로지글리타존을 7주 이상 처리한 db/db마우스의 HDL 콜레스테를 수치를 나타낸 것이다.
도 22는 화학식 2로 표시되는 ENOblock 또는 로지글리타존 처리된 마우스의 혈청 내 유리지방산 (FFA) 수준을 나타낸 것이다.
도 23은 화학식 2로 표시되는 ENOblock 또는 로지글리타존 처리된 마우스의 혈청에서의 알라닌 아미노기전달효소 (ALT)의 활성을 나타낸 것이다. 도 24는 화학식 2로 표시되는 ENOblock 또는 로지글리타존 처리된 마우스의 간조직에서의 에놀라제 활성을 나타낸 것이다.
도 25는 화학식 2로 표시되는 ENOblock 또는 로지글리타존 처리된 마우스의 신장 조직에서의 에놀라제 활성을 나타낸 것이다.
이때, 도 20 내지 도 25에서 사용된 마우스는 모두 연령이 동일하고 같은 스크레인의 B6 마우스이다.
도 26 내지 도 28은 에놀라제 결합 유전자인 Cox-2 , Erbb-2 및 c— Myc의 발현을 분석한 것이다.
도 29는 화학식 2로 표시되는 ENOblock 또는 로지글리타존으로 7주간 처리된 db/db 마우스의 대표 간사진이다.
도 30은 화학식 2로 표시되는 ENOblock또는 로지글리타존으로 처리한 지 7주 후에 db/db 마우스의 간 중량을 측정한 것이다.
도 31은 오일 레드 0 염색을 통해 화학식 2로 표시되는 ENOblock 또는 로지글리타존으로 처리된 db/db 마우스의 간 조직의 지질 축적 정도를 나타낸
것이다.
도 32는 화학식 2로 표시되는 ENOMock 또는 로지글리타존으로 처리된 db/db 마우스의 지방축적을 정량한 것이다.
도 33은 Masson-Tr i chrome 염색을 통해 ENOblock 또는 로지글리타존으로 처리된 마우스의 간 섬유화 (청색으로 염색) 정도를 나타낸 것이다 (스케일바 = 100 πι) .
도 34는 화학식 2로 표시되는 ENOblock으로 처리된 마우스의 간 섬유화를 정량화한 것이다.
도 35는 H&E 염색을 통해 화학식 2로 표시되는 ENOblock 또는 로지글리타존으로 처리된 db/db 마우스의 간 미세지방증 ( l iver mi crosteatosi s) 정도를 나타낸 것이다.
도 36은 화학식 2로 표시되는 ENOblock 또는 로지글리타존으로 처리된 db/db 마우스의 간 미세지방증을 정량화한 것이다.
도 37은 화학식 2로 표시되는 ENOblock 또는 로지글리타존으로 처리된 마우스의 간조직에서 아픕토시스 세포 (검은 핵)를 표시한 것이다 (눈금 막대 = 10 μ πι) .
도 38은 화학식 2로 표시되는 ENOblock 또는 로지글리타존으로 처리된 마우스의 간 조직에서 아톱토시스 세포를 정량화한 것이다.
도 39는 화학식 2로 표시되는 ENOblock 또는 로지글리타존으로 처리된 마우스의 간 조직에서 카스파제 -3, 절단된 카스파제 -3(Aspl75) , PARP 및 절단된 PARP의 웨스턴 블롯 분석 결과를 나타낸 것이다. 이때, 연령이 같은 B6 마우스 스트레인을 비교군으로 사용하였다.
도 40은 a -tubul in 대비 cleaved caspase_3(Aspl75)의 발현을 정량한 것이다.
도 41은 a -tubul in 대비 cleaved PARP 발현을 정량한 것이다.
도 .42 및 도 43은 간 조직에서 화학식 2로 표시되는 ENOblock 처리에 따른 염증 유전자 TNF- α와 IL-6를 분석한 것이다.
도 44는 화학식 2로 표시되는 ENOblock 처리에 따른 세포질 형태)의 발현을 나타낸 것이다.
도 45는 화학식 2로 표시되는 ENOblock 처리에 따른 ¾:- 미토콘드리아 형태)의 발현을 나타낸 것이다.
도 46 및 도 47은 화학식 2로 표시되는 ENOblock 처리에 따른 Srebp-la 및 SrebP-lc 발현을 나타낸 것이다.
도 48은 간 조직에서 화학식 2로 표시되는 ENOblock 처리에 따른 Insig- 의 발현을 나타낸 것이다.
도 49 및 도 50은 db/db 마우스 간에서 화학식 2로 표시되는 ENOblock 처리에 따른 LXR표적 유전자인 Abcg-5및 Scrap의 발현을 평가한 것이다.
도 51 및 도 52는 화학식 2로 표시되는 ENOblock 또는 로지글리타존으로 처리된 db/db마우스의 체중 및 생식선 지방조직 중량을 나타낸 것이다.
도 53은 지방 세포 크기를 시각화하기 위해, 생식선 지방 조직을 H&E 염색한 것이다 (스케일바 = 200 μ πι) .
도 54는 지방 세포 크기를 정량한 것이다 (* : 처리하지 않은 것과 비교하여 감소된 크기에 대한 유의성 ρ <0.05; ** 치료되지 않은 로지글리타존에 비해 감소 된 크기에 대한 유의성 ρ <0.05) .
도 55는 생식선 지방 조직을 Masson-tr i chrome 염색한 것이다. 섬유증 영역은 지방 세포 경계 주위에 비교적 진한 파란색 고리로 시각화되었다.
도 56은 각 그룹에 따른 마우스의 조직에서 섬유화를 정량한 것이다. 도 57은 화학식 2로 표시되는 ENOblock 처리에 따른 섬유증 마커 α - SMA의 발현을 웨스턴 블롯을 통해 나타낸 것이다.
도 58은 화학식 2로 표시되는 ENOblock 처리에 따른 α -SMA 발현의 농도
계측 분석한 것이다.
도 59 및 도 60은 丽 264.7 대식세포에서 화학식 2로 표시되는 ENOblock 의 처리와 LPS자극 유무에 따른 TNF- α 및 TLR-4의 발현을 확인 한 것이다. 도 61 내지 도 65는 지방 조직에서의 염증 유전자 TNF- a , Cdllc 및 Mcp- 1, 지방 생성 마커 Ppar y , 및 지방 섬유아세포의 Col6a3의 발현을 확인한 것이다.
도 66은 로지글리타존 또는 화학식 2로 표시되는 ENOblock 처리된 db/db 마우스의 심장무게를 측정한 것이다.
도 67은 심장 중량 대 체중의 비 (심장 비대증의 지표)를 나타낸 것이다. 도 68은 심근 조직의 Masson-tri chrome 염색으로 심장 섬유화 (청색으로 염색)를 검출한 것이다 (스케일바 = 100 μ πι) .
도 69는 약물 처리에 따른 심장 섬유화를 정량한 것이다.
도 70은 Η&Ε 염색에 의해 시각화된 심근 세포 이미지를 나타낸 것이다. 도 기은 약물 처리에 따른 심근 세포의 폭을 측정한 것이다.
도 72는 로지글리타존 또는 화학식 2로 표시되는 ENOblock 처리된 마우스의 심장조직에서 아픕토시스 핵을 염색한 것이다 (스케일바 = 100 μ πι) . 도 73은 약물 처리에 따른 마우스 심장 조직의 아톱토시스 세포를 정량화한 것이다.
도 74는 로지글리타존 또는 화학식 2로 표시되는 ENOblock 처리된 마우스의 심장 조직에서 카스파제— 3, 절단된 카스파제 -3(Aspl75) , PARP 및 절단된 PARP의 웨스턴 블롯 분석 결과를 나타낸 것이다. 이때, 연령과 일치하는 B6 마우스를 대조군으로 사용하였다.
도 75는 화학식 2로 표시되는 ENOblock 또는 로지글리타존 처리된 마우스의 심장 조직에서 α -tubul in 대비 절단된 카스파제— 3(Aspl75)의 발현을 정량한 것이다.
도 76은 화학식 2로 표시되는 ENOblock 또는 로지글리타존 처리된 마우스의 심장 조직에서 a -tubul in 대비 절단된 PARP 발현을 정량한 것이다. 도 77 내지 도 80은 로지글리타존 또는 화학식 2로 표시되는 ENOblock 처리된 마우스에서 심장 기능의 지표인 Gata-4, Glut— 4, I rap 및 a_MHC의 mRNA를 분석한 결과를 나타낸 것이다.
도 81 내지 도 84는 로지글리타존 또는 화학식 2로 표시되는 ENOblock 처리된 마우스에서 심장 병리학적 마커들인 Kcnk-l, Asah-2 , B4glant 및 MMP-3의 mRNA를 분석한 결과를 나타낸 것이다.
도 85는 화학식 2로 표시되는 ENOblock 또는 로지글리타존 처리된 마우스의 신장무게를 나타낸 것이다.
도 86은 Masson-tri chrome 염색으로 신장 조직을 염색하여 섬유화 (청색으로 염색)를 측정한 것이다.
도 87은 화학식 2로 표시되는 ENOblock 또는 로지글리타존 처리된 마우스에서 간질 ECM 성분 ( interst it ial ECM component )의 축적을 정량화한 것이다.
도 88은 화학식 2로 표시되는 ENOblock 또는 로지글리타존 처리된 마우스의 신장조직에서 아폼토시스 핵을 염색한 것이다 (스케일바 = 100 μ πι) . 도 89는 화학식 2로 표시되는 ENOblock 또는 로지글리타존 처리된 마우스의 신장조직에서 아폼토시스 세포를 정량화한 것이다.
도 90은 화학식 2로 표시되는 ENOblock 또는 로지글리타존 처리된 마우스의 신장 조직에서 카스파제 -3, 절단된 카스파제 -3(Aspl75) , PARP 및 절단된 PARP의 웨스턴 블롯 분석 결과를 나타낸 것이다. 이때, 연령과 일치하는 B6 마우스를 대조군으로 사용하였다.
도 91은 화학식 2로 표시되는 ENOblock 또는 로지글리타존 처리된 마우스의 신장 조직에서 α -tubul in 대비 절단된 카스파제 -3(Aspl75)의 발현을
정량한 것이다.
도 92는 화학식 2로 표시되는 ENOblock 또는 로지글리타존 처리된 마우스의 신장조직에서 a -tubul in 대비 절단된 PARP 발현을 정량한 것이다. 도 93 내지 도 96은 화학식 2로 표시되는 ENOblock 또는 로지글리타존 처리된 마우스의 신장 조직에서 아폼토시스 마커인 angiotens in , Bax및 p53, 및 포도당 신생합성의 양성 조절과 관련된 세포질)의 발현량을 분석한 것이다. 도 97 내지 도 99는 화학식 2로 표시되는 ENOblock 또는 로지글리타존 처리된 마우스의 신장 조직에서 CoMal, Col4a2 및 Col4a3^\ 발현을 측정한 것이다.
도 100은 화학식 2로 표시되는 ENOblock을 처리한 후, 간세포에서 세포질 (cytosol i c) 및 핵 (nuc lear ) 내 에놀라제 단백질 발현을 분석한 것이다. 도 101a는 화학식 2로 표시되는 ENOblock 또는 로지글리타존으로 처리된 db/db 마우스의 간 조직에서 α -SMA의 웨스턴 블롯 분석 결과를 나타낸 것이다. 이때, 연령과 일치하는 B6 마우스 스트레인을 대조군으로 사용하였다.
도 101b는 GAPDH로 표준화한 a -SMA의 발현을 정량한 것이다.
도 102는 백색 지방 조직 유래의 지방전구세포에서 화합물 처리 프로토콜을 도식화한 것이다.
도 103은 forskol in , rapamyc in 또는 화학식 2로 표시되는 ENOblock의 처리에 따른 지방생성 조절 유전자의 발현을 나타낸 것이다.
도 104는 forskol in , rapamyc in 또는 화학식 2로 표시되는 ENOblock의 처리에 따른산화 인산화 조절 유전자의 발현을 나타낸 것이다.
도 105는 forskol in , rapamycin 또는 화학식 2로 표시되는 ENOblock의 처리에 따른 열 생성 조절 유전자의 발현을 나타낸 것이다.
도 106은 지방 세포 분화를 진행하는 백색 지방 조직의 지방전구세포에서 화합물 전처리 프로토콜을 도식화한 것이다.
도 107은 forskol in , rapamycin 또는 화학식 2로 표시되는 ENOblock의 처리에 따른 지방전구세포를 분화시키는 지방 생성 조절 유전자의 발현을 나타낸 것이다.
도 108은 forskol in, rapamycin 또는 화학식 2로 표시되는 ENOblock의 처리에 따른 산화 인산화 조절 유전자의 발현을 나타낸 것이다.
도 109는 forskol in, rapamycin 또는 화학식 2로 표시되는 ENOblock의 처리에 따른 열 생성 조절 유전자의 발현을 나타낸 것이다.
도 110은 분화 중인 초대배양 백색 지방 세포에 화합물을 처리하는 프로토콜을 도식화한 것이다.
도 111은 분화 증인 지방세포에 forskol in, rapamycin, 화학식 2로 표시되는 ENOblock 또는 NaF를 처리한 후, 지방생성 조절 유전자의 발현을 나타낸 것이다.
도 112는 forskoHn, rapamycin, 화학식 2로 표시되는 ENOblock 또는 NaF를 처리에 따른산화적 인산화조절 유전자의 발현을 나타낸 것이다.
도 113은 forskol in, rapamycin, 화학식 2로 표시되는 ENOblock 또는 NaF를 처리에 따른 열 생성 조절 유전자의 발현을 나타낸 것이다.
도 114는 갈색 지방 조직 (BAT)에서 분리된 갈색 지방전구세포에 화합물을 처리하는 프로토콜을 도식화한 것이다.
도 115는 forskol in, rapamycin, 화학식 2로 표시되는 ENOblock 또는 NaF의 처리에 따른 지방전구세포를 분화시키는 지방 생성 조절 유전자의 발현을 나타낸 것이다.
도 116은 forskol in, rapamycin, 화학식 2로 표시되는 ENOblock 또는 NaF의 처리에 따른 산화 인산화 조절 유전자의 발현을 나타낸 것이다.
도 117은 forskol in, rapamycin, 화학식 2로 표시되는 ENOblock 또는 NaF의 처리에 따른 열 생성 조절 유전자의 발현을 나타낸 것이다.
도 118은 화학식 2로 표시되는 ENOblock, NaF, forskol in또는 rapamycin 처리된 3T3-L1 지방전구세포와 갈색 지방전구세포의 미토콘드리아 막전위를 가시화하기 위해 TMRE를 사용하여 나타낸 것이다.
도 119는 화학식 2로 표시되는 ENOblock, NaF, forskol in 또는 rapamycin 처리된 3T3-L1 지방전구세포의 미토콘드리아 막전위 정량을 나타낸 것이다.
도 120은 화학식 2로 표시되는 ENOblock, NaF, forskol in 또는 rapamycin 처리된 3T3-L1 백색 지방전구세포의 미토콘드리아 막전위를 가시화하기 위해 TMRE를 사용하여 나타낸 것이다.
도 121은 화학식 2로 표시되는 ENOblock , NaF , forskol in 또는 rapamycin 처리된 백색 지방전구세포의 미토콘드리아 막전위를 정량한 것이다.
도 122는 화학식 2로 표시되는 ENOblock, NaF , forskol in 또는 rapamycin 처리된 갈색 지방전구세포의 미토콘드리아 막전위를 정량한 것이다.
도 123은 3T3-L1 백색 지방전구세포에 화학식 2로 표시되는 ENOblock, forskol in또는 rapamycin을 처리하고 오일 레드 0 염색한 결과이다.
도 124는 화학식 2로 표시되는 ENOblock, forskol in 또는 rapamycin 처리된 백색 지방전구세포의 오일 레드 0 염색 결과의 정량을 나타낸 것이다. 도 125는 화학식 2로 표시되는 ENOblock의 화학구조이다.
도 126은 HFD(high fat diet ) 마우스에 화학식 2로 표시되는 ENOblock 처리 프로토콜을 도식화한 것이다.
도 127은 화학식 2로 표시되는 ENOblock 또는 로지글리타존을 8주간 처리한 HFD 마우스의 모습을 나타낸 것이다.
도 128은 화학식 2로 표시되는 ENOblock 또는 로지글리타존 처리한 HFD 마우스의 내장 지방조직을 보여주는 복부 해부 사진 (흰색 화살표로 표시)이다. 도 129는 화학식 2로 표시되는 ENOblock 또는 로지글리타존 처리한 HFD 마우스의 변화를 나타낸 것이다.
도 130은 화학식 2로 표시되는 ENOblock 또는 로지글리타존 처리한 HFD 마우스의 사료 섭취량을 나타낸 것이다.
도 131은 화학식 2로 표시되는 ENOblock 또는 로지글리타존 처리 도중 마우스의 직장 (Rectum) 체온을 나타낸 것이다.
도 132는 화학식 2로 표시되는 ENOblock과 로지글리타존을 처리한지 4, 6 및 8주차에 HFD마우스의 공복 혈중 포도당 수치를 나타낸 것이다.
도 133 및 도 134는 화학식 2로 표시되는 ENOblock 또는 로지글리타존으로 처리 4주 후, HFD 마우스에 대한 포도당 내성 검사 (GTT) 및 곡선하면적 (AUC)을 측정하여 나타낸 것이다.
도 135 및 도 136는 화학식 2로 표시되는 ENOblock 또는 로지글리타존 처리 5주 후, HFD 마우스에 대한 인슐린 내성 검사 ( ΠΤ) 및 AUC를 측정하여 나타낸 것이다.
도 137 및 도 138은 화학식 2로 표시되는 ENOblock 또는 로지글리타존 처리 8주 후, HFD 마우스의 인슐린 혈청 농도와 인슐린 저항성 수준을 나타낸 것이다.
도 139 및 도 140은 포도당 신생합성 수준을 결정하기 위해 화학식 2로 표시되는 ENOblock또는 로지글리타존 처리 7주 후, HPD 마우스에 대한 피루브산 저항성 테스트 (PTT) 및 곡선하면적 (AUC)을 나타낸 것이다.
도 141은 화학식 2로 표시되는 ENOblock 또는 로지글리타존을 처리한 HFD 마우스의 간 사진을 나타낸 것이다. 대조군으로 같은 연령의 SFD(Standard fat diet ) 간을 함께 나타내었다.
도 142는 화학식 2로 표시되는 ENOblock 또는 로지글리타존을 처리한 HFD 마우스의 간 중량을 나타낸 것이다.
도 143은 화학식 2로 표시되는 ENOblock 또는 로지글리타존을 처리한 HFO 마우스의 알라닌 아미노 전이 효소 (ALT)의 혈청 농도를 나타낸 것이다.
도 144는 화학식 2로 표시되는 ENOblock또는 로지글리타존을 처리한 HFD 마우스의 간조직에서 지질 축적을 시각화하기 위해 오일 레드 0 염색한 것이다. 도 145는 화학식 2로 표시되는 ENOblock 또는 로지글리타존을 처리한 HFD 마우스의 지질 축적을 정량화한 것이다.
도 146은 화학식 2로 표시되는 ENOblock 또는 로지글리타존을 처리한 HFD 마우스의 지방증 (steatosi s)을 시각화 위해 H&E 염색한 것이다.
도 147은 화학식 2로 표시되는 ENOblock 또는 로지글리타존을 처리한 HFD 마우스의 지방증을 정량화한 것이다.
도 148은 화학식 2로 표시되는 ENOblock또는 로지글리타존을 처리한 HFD 마우스의 간 조직 섬유화 (청색)를 시각화하기 위해 Masson-Tr i chrome 염색한 것이다.
도 149는 화학식 2로 표시되는 ENOblock 또는 로지글리타존을 처리한 HFD 마우스의 섬유화를 정량화한 것이다.
도 150은 화학식 2로 표시되는 ENOblock 또는 로지글리타존을 처리한 HFD 마우스의 간성상 세포 검출을 위해 α -SMA 면역 염색한 것이다.
도 151은 화학식 2로 표시되는 ENOblock 또는 로지글리타존을 처리한 HFD 마우스의 간성상 세포 수를 정량화한 것이다.
도 152는 화학식 2로 표시되는 ENOblock 또는 로지글리타존을 처리한 HFD 마우스의 a -SMA 발현을 qPCR분석하여 나타낸 것이다.
도 153은 화학식 2로 표시되는 ENOblock또는 로지글리타존을 처리한 HFD 마우스의 간에서 a -SMA의 벌:현을 웨스턴 블롯 분석을 통해 나타낸 것이다.
도 154 및 도 155는 화학식 2로 표시되는 ENOblock 또는 로지글리타존을 처리한 마우스 간에서 염증 마커인 TNF- a및 IL-6의 ELISA 분석 결과를 나타낸 것이다.
도 156은 화학식 2로 표시되는 ENOblock 또는 로지글리타존을 처리한
마우스의 간 조직에서 염증 마커 IL-6, TNF- α 및 S100a9의 발현을 평가한 것이다.
도 157은 화학식 2로 표시되는 ENOblock 또는 로지글리타존을 처리한 마우스의 간 조직에서 지질 항상성 조절 인자인 Srebp-la 및 Srebp-lc의 발현을 분석한 것이다.
도 158은 화학식 2로 표시되는 ENOblock 또는 로지글리타존을 처리한 마우스의 간 조직에서 Srebp 단백질을 조절하는 Amfr , Insig-1 및 Insigᅳ 2의 조절 인자의 발현을 분석한 것이다.
도 159는 화학식 2로 표시되는 ENOblock 또는 로지글리타존을 처리한 마우스의 간 조직에서 LXR표적 유전자인 Scap 및 Abcg5의 발현을 나타낸 것이다. 도 160은 화학식 2로 표시되는 ENOblock 또는 로지글리타존을 처리한 마우스의 간 조직에서 글루코오스 신생 합성을 조절하는 Pck-1 및 Pckᅳ 2의 발현을 나타낸 것이다.
도 161은 화학식 2로 표시되는 ENOblock 또는 로지글리타존을 처리한 마우스의 간 조직에서 지방 생성 조절 인자인 Adipoq, Ap2, Ppar- γ , Retn 및 Cebpa의 발현을 나타낸 것이다.
도 162는 화학식 2로 표시되는 ENOblock 또는 로지글리타존을 처리한 마우스의 해마에서 염증 마커인 IL-6, TNF- α , Cdllc , Tlr-4 및 Nptx2의 발현을 나타낸 것이다.
도 163은 화학식 2로 표시되는 ENOblock 또는 로지글리타존을 처리한 마우스의 해마에서 에너지 상태 센서인 Creb 및 미토콘드리아 생합성 조절자인 Tfam, Nrfl 및 Nrf2의 발현을 나타낸 것이다.
도 164는 화학식 2로 표시되는 ENOblock 또는 로지글리타존을 처리한 마우스의 해마에서 미토콘드리아 DNA 함량을 나타낸 것이다.
도 165는 화학식 2로 표시되는 ENOblock 또는 로지글리타존을 처리한
마우스 해마의 CAl , CA2 및 CA3 영역에서 뉴런의 Nissl 염색 결과를 나타낸 것이다. 이때, 로지글리타존 처리한 쥐의 CA1 영역에서 무질서하게 배열된 신경 구조를 주목해야 한다.
도 166 내지 도 168은 화학식 2로 표시되는 ENOblock 또는 로지글리타존 처리된 HFD마우스에서 트리글리세라이드, HDL 및 LDL 콜레스테를의 혈청 수치를 측정한 것이다.
도 169는 화학식 2로 표시되는 ENOblock 또는 로지글리타존 처리된 마우스의 해부된 생식선의 백색 지방조직을 나타낸 것이다.
도 170은 화학식 2로 표시되는 ENOblock 또는 로지글리타존 처리된 마우스의 생식선의 백색 지방조직 무게를 나타낸 것이다.
도 1기은 화학식 2로 표시되는 ENOblock 또는 로지글리타존 처리된 마우스의 지방 세포 크기를 시각화하기 위해 생식선의 지방 조직을 H&E 염색한 것이다.
도 172는 화학식 2로 표시되는 ENOblock 또는 로지글리타존 처리된 마우스의 지방 세포 폭을 측정한 것이다.
도 173은 화학식 2로 표시되는 ENOblock 처리된 HFD 마우스 (백색 화살표로 표시)로부터 H&E로 염색된 생식선의 백색 지방 조직에서 지방 세포 영역 (베이지 색 )을 표시한 것이다.
도 174는 화학식 2로 표시되는 ENOblock 또는 로지글리타존 처리된 마우스의 생식선의 백색 지방 조직에서 염증 마커 TNF- α , Cdllc 및 Mcp-1과 마스터 지방 생성 조절 인자인 Ppar- γ를 qPCR분석한 것이다.
도 175는 화학식 2로 표시되는 ENOblock 또는 로지글리타존 처리된 마우스의 견갑골 사이의 갈색 지방 조직의 대표 사진이다.
도 176은 화학식 2로 표시되는 ENOblock 또는 로지글리타존 처리된 마우스의 견갑골 사이의 갈색 지방 조직 (BAT) 무게를 나타낸 것이다.
도 177은 지방간 크기를 시각화하기 위해 화학식 2로 표시되는 ENOblock 또는 로지글리타존 처리된 마우스의 견갑골 사이의 갈색 지방조직을 H&E 염색한 것이다.
도 178은 화학식 2로 표시되는 ENOblock 또는 로지글리타존의 처리에 따른 염증 마커 및 지방전구세포를 분화시키는 지방 생성 조절 인자의 발현을 나타낸 것이다.
도 179 화학식 2로 표시되는 ENOblock 또는 호지글리타존의 처리에 따른 열 생성 조절 유전자의 발현을 나타낸 것이다.
도 180은 화학식 2로 표시되는 ENOblock 또는 로지글리타존 처리된 마우스의 갈색 지방 조직에서 섬유화를 시각화하기 위해 Masson-Tr i chrome 염색한 것이다.
도 181은 화학식 2로 표시되는 ENOblock 또는 로지글리타존을 처리한 HFD 마우스의 갈색 지방조직에서 섬유화를 정량화한 것이다.
도 182는 HFD 마우스에서 화학식 2로 표시되는 ENOblock 또는 met formin 처리 프로토콜을 도식화한 것이다.
도 183은 화학식 2로 표시되는 ENOblock 또는 met formin 처리된 HFD 마우스의 내장지방조직 (흰색 화살표)을 표시한 해부 사진이다.
도 184는 화학식 2로 표시되는 ENOblock 또는 met formin 처리 과정 동안의 마우스 체중을 나타낸 것이다.
도 185는 화학식 2로 표시되는 ENOblock 또는 metformin 처리 4주 및 6주차에 HFD마우스의 공복혈당치를 측정한 것이다.
도 186 및 도 187은 화학식 2로 표시되는 ENOblock 또는 met formin 처리 4주 후, HFD 마우스에 대한 혈당 내성 테스트 (GTT) 및 곡선하면적 (AUC)을 측정하여 나타낸 것이다.
도 188 및 도 189는 화학식 2로 표시되는 ENOblock 또는 met formin 처리
5주 후, 인슐린 내성 테스트 ( ITT) 및 곡선하면적 (AUC)을 측정하여 나타낸 것이다. 도 190 및 도 191은 화학식 2로 표시되는 ENOblock 또는 met formin 처리 7주 후, 피루브산 내성 테스트 (PTT) 및 곡선하면적 (AUC)을 측정하여 나타낸 것이다.
도 192 및 도 193은 화학식 2로 표시되는 ENOblock 또는 met formin 처리된 HFD마우스에서 인슐린 혈청 농도와 인슐린 저항성을 나타낸 것이다.
도 194는 화학식 2로 표시되는 ENOblock 또는 met formin 처리된 마우스의 해부된 생식선의 백색 지방조직 사진이다.
도 195는 화학식 2로 표시되는 ENOblock 또는 met formin 처리된 마우스에서 생식선의 백색 지방 조직 무게를 측정한 것이다.
도 196은 판 대식세포 마커인 CD68(macrosi al in) 및 M2 항 염증성 대식세포 마커인 CD206(mannose receptor)에 대한 항체로 염색된 백색 지방 조직 -유도 염증 세포의 유동세포분석 (FACs)을 나타낸 것이다.
도 197은 화학식 2로 표시되는 ENOblock 또는 met formin 처리된 마우스로부터 백색 지방 조직 염증 군에서 M2형 대식세포를 정량화한 것이다. 도 198 및 도 199는 고지방 식이에 의해 유발되는 비만꾀 진행에 대한 화학식 2로 표시되는 ENOblock의 치료 효과를 도식화한 것이다.
【발명의 실시를 위한 최선의 형태】
본 명세서에서 언급하고 있는 ENOblock은 하기 화학식 1로 표시되는 트리아진계 화합물이다:
<화학식 1>
이는 해당과정 경로의 한 구성요소인 에놀라제에 직접 결합하여 이의 활성을 감소시키는 비-기질성 유사체이다. 상기 화학식 1에서, R1은 H이고; R2는 H, -(CH2)q-(C0NH)-Cl-5 직쇄 또는 가지쇄의 알킬 (상기 q는 1-5의 정수이다), - (CH2)q-(C0NH)-Cl-5 직쇄 또는 가지쇄의 알킬알코올 (상기 q는 1—5의 정수이다) , -(CH2)q-(C0NH)-[ (CH2)m-0]n-(CH2)p-NH2(상기 n, p 및 q는 각각 0-5의 정수이고, 상기 m은 1-5의 정수이다) 또는 -(CH2)q-(C0NH)-[ (CH2)m-0]n-(CH2)p-CH3(상기 m, n 및 q는 각각 1-5의 정수이고, 상기 p는 0-5의 정수이다)이다.
또한, 상기 ENOblock은 하기 화학식 2로 표시되는 트리아진계 화합물 (N- [2一 [2ᅳ (2一 aminoet hoxy )et hoxy ] ethyl ]-4-[ [4-[ ( eye 1 ohexy 1 me t hy 1 ) am i no ] _6_ [ [ ( 4ᅳ f luorophenyl )methyl ] amino] -1 ,3 , 5-tr i azin-2-yl ] amino]—benzeneacet amide hydrochlor ide)일 수 있다:
비만은 체내에 지방 조직이 과다하게 축적된 상태를 의미한다. 본 발명의
일실시 예에서는, ENOblock 처리된 T2DM 및 HFD 마우스에서 지질 축적, 지방 세포 크기, 내장 지방 및 체중의 감소를 확인함으로써, ENOblock의 비만 치료 가능성을 확인하였다. 또한, 본 발명은 ENOblock을 유효성분으로 포함하는 섬유증 예방 또는 치료용 약학 조성물을 제공한다. ·
섬유증은 재생 (reparat ive)이나 반응 과정에서 기관이나 조직에 과도한 섬유성 결합조직이 형성되는 것을 의미한다. 상기 섬유증은 간섬유증, 신장섬유증, 심근섬유증 및 심장섬유증으로 구성된 항목으로부터 선택되는 어느 하나일 수 있다. ENOblock 처리된 T2DM 및 HFD 마우스에서 섬유화 관련 유전자의 발현이 감소됨을 확인함으로써, ENOblock의 섬유증 치료 가능성을 확인하였다. 또한, 본 발명은 ENOblock을 유효성분으로 포함하는 지방간 예방 또는 치료용 약학조성물을 제공한다.
지방간은 간 세포 속에 지방이 축적된 상태를 의미한다. 본 발명은 일 실시예에서, ENOblock 처리된 T2DM 및 HFD 마우스의 간에서 지방증이 감소됨을 확인함으로써, ENOblock의 지방간 치료 가능성을 확인하였다. 또한, 본 발명은 ENOblock을 유효성분으로 포함하는 당뇨병 예방 또는 치료용 약학조성물을 제공한다.
상기 당뇨병은 제 2형 당뇨병 (diabetes mel l itus type 2, T2DM)일 수 있다. 제 2형 당뇨병은 층분한 양의 인슐린이 체내에서 분비되지 않거나, 세포가 인슐린에 반웅하지 않는 인술린 저항성으로 인해 발생하는 질병이다. 본 발명의 일 실시예에서는, ENOblock 처리된 당뇨 마우스 (T2DM)와 비만 마우스 (HFD)에서 인슐린 저항성이 억제되어 체내 혈당이 감소됨을 확인함으로써, ENOblock의
당뇨병 치료 가능성을 확인하였다. 또한, 본 발명은 ENOblock을 유효성분으로 포함하는 당뇨 합병증 예방 또는 치료용 약학조성물을 제공한다.
당뇨 합병증은 혈당 농도가 정상보다 높게 유지됨으로 인해 체내에 여러 대사 장애를 유발하여 발생할 수 있다. 상기 당뇨 합병증은 당뇨성 신장병, 당뇨성 간 장애, 당뇨성 심장질환, 당뇨성 뇌병증, 당뇨성 혈관합병증, 및 당뇨성 신경병증으로 구성된 군으로부터 선택되는 적어도 어느 하나일 수 있다. 본 발명의 일 실시예에서는, ENOblock 처리된 T2DM 및 HFD 마우스의 간, 심장, 신장 및 해마 조직에서 조직의 손상, 섬유화 및 아픕토시스의 감소를 확인함으로써, ENOblock의 당뇨 합병증 치료 가능성을 확인하였다. 또한, 본 발명은 ENOblock을 유효성분으로 포함하는 고지혈증 예방 또는 치료용 약학 조성물을 제공한다.
고지혈증은 필요 이상으로 많은 지방 성분 물질이 혈액 내에 존재하면서 혈관벽에 쌓여 염증을 일으키고 심혈관계 질환을 일으키는 상태를 말한다. 본 발명의 일 실시예에서는, ENOblock 처리된 T2DM 및 HFD 마우스에서 지질 축적이 억제되고 트리글리세리드 및 LDL 콜레스테롤 수치가 감소됨을 확인함으로써, ENOblock의 고지혈증 치료 가능성을 확인하였다. 또한, 본 발명은 ENOblock을 유효성분으로 포함하는 퇴행성 뇌질환 예방 또는 치료용 약학조성물을 제공한다.
퇴행성 뇌질환은 뇌졸중, 중풍, 치매, 알츠하이머 질환, 파킨슨 질환, 헌팅턴 질환, 피크 (Pick) 질환 또는 크로이츠펠트 -야콥 (Creutzfeld-Jakob) 질환을 포함한다. 본 발명은 일 실시예에서, ENOblock 처리된 T2DM 및 HFD
마우스에서 해마 염증 마커의 발현이 감소됨을 확인함으로써, ENOblock의 퇴행성 뇌질환 치료 가능성을 확인하였다. 본 발명에 따른 ENOblock을 유효성분으로 포함하는 조성물은 c— Myc, Erbb2 , Cox-2 , αᅳ SMA, Col6a3, c 1 eaved-caspase-3 , cleaved PARP, angiotensin, Bax, p53, IL-6, TNF- α, Mcp-1, Cdllc, Tlr4, Nptx2, Pck-1, Scap, Abcg5, Ap2, Agt , Adipoq, Ppar-γ , Retn, Cebpa , Cebpb , Kcnkl, Asah2 , B4glant , Mmp-3, Col4a3, Nrfl, Cptlb, Cox8b, Srebp-la, Srebp-lc 또는 Insig-2로 구성된 군으로부터 선택되는 적어도 어느 하나의 유전자를 하향 조절할 수 있다.
본 발명의 일 실시예에서는, ENOblock 처리된 T2DM 및 HFD 마우스에서 에놀라제 타겟 유전자인 c-Myc, Erbb2 또는 Cox-2의 발현이 억제됨을 확인함으로써, ENOblock이 에놀라제 활성을 감소시킴을 확인하였다.
또한, ENOblock 처리된 T2DM 및 HFD 마우스에서 섬유화 관련 유전자인 α-SMA 또는 Col6a3의 발현이 억제됨을 확인함으로써, ENOblock이 조직의 섬유화를 억제함을 확인하였다.
또한, ENOblock 처리된 T2DM 및 HFD 마우스에서 아품토시스 유전자인 c 1 eaved-caspase-3 , cleaved PARP, angiotensin, Bax 또는 p53와 산화적 인산화 유전자인 Nrfl, Cptlb 또는 Cox8b의 발현이 억제됨을 확인함으로써, ENOblock이 세포의 사멸을 억제함을 확인하였다.
또한, ENOblock 처리된 T2DM 및 HFD 마우스에서 염증 유전자인 IL-6, TNF-α , Mcp-1, Cdllc, Tlr4 또는 Nptx2의 발현이 억제됨을 확인함으로써, ENOblock이 조직의 염증을 억제함을 확인하였다.
또한, ENOblock 처리된 T2DM 및 HFD 마우스에서 글루코오스 신생 합성 유전자인 Pck-1의 발현이 억제됨을 확인함으로써, ENOblock이 혈당 증가를 억제함을 확인하였다.
또한, ENOblock 처리된 T2DM 및 HFD 마우스에서 스테를 조절 유전자인 Scap 또는 Abcg5와 지질 합성 유전자인 Srebp-la , Srebp-lc 또는 Ins ig-2의 발현이 억제됨을 확인함으로써, ENOblock의 지질 생성 및 축적 감소와 간지방증 및 고지혈증 치료 가능성을 확인하였다.
또한, ENOblock 처리된 T2DM 및 HFD 마우스에서 지방 생성 유전자인 Αρ2' Agt, Adipoq, Ppar- γ , Retn, Cebpa 또는 Cebpb^ 발현이 억제됨을 확인함으로써, ENOblock이 지방 생성을 억제함을 확인하였다.
또한, ENOblock 처리된 T2DM 및 HFD 마우스에서 심장질환 관련 유전자인 Kcnkl, Asah2, B4glant 또는 Μιψ-3^ 사구체 신염 유전자인 Col4a3의 발현이 억제됨을 확인함으로서, ENOblock의 심장질환 및 신장 질환의 치료 가능성을 확인하였다.
또한, 본 발명에 따른 ENOblock을 유효성분으로 포함하는 조성물은 지방 세포 분화를 억제할 수 있고, 인슐린 저항성 및 과인슐린혈증을 억제할 수 있다. 한편, 본 발명에 따른 ENOblock을 유효성분으로 포함하는 조성물은 열 생성 유전자인 Ucp-1또는 Ucp-3^\ 발현을 상향 조절할 수 있다. 본 발명의 ENOblock을 유효성분으로 포함하는 조성물은, 조성물 총 중량에 대하여 ENOblock을 0. 1 내지 99.9 중량 %를 유효성분으로 함유하고, 약제학적으로 허용가능한 담체, 부형제 또는 희석제를 포함할 수 있다.
본 발명의 조성물은 경구 또는 비경구의 여러 가지 제형일 수 있다. 제제화할 경우에는 보통 사용하는 층진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제된다. 경구투여를 위한 고형제제에는 정제, 환제, 산제, 과립제, 캡슐제 등이 포함되며, 이러한 고형제제는 하나 이상의 화합물에 적어도 하나 이상의 부형제 예를 들면, 전분, 탄산칼슘, 수크로오스 (sucrose) 또는 락토오스 ( l actose) , 젤라틴 등을 섞어
조제된다. 또한, 단순한 부형제 이외에 스테아린산 마그네슘, 탈크 등과 같은 윤활제들도사용된다.
경구투여를 위한 액상제제로는 현탁제, 내용액제, 유제, 시럽제 등이 해당되는데 흔히 사용되는 단순 회석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다. 비경구투여를 위한 제제에는 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조제제, 좌제가 포함된다. 비수성용제 및 현탁용제로는 프로필렌글리콜 (propylene glycol ) , 폴리에틸렌 글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다. 좌제의 기제로는 위텝솔 (wi tepsol ) , 마크로골, 트원 (tween) 61, 카카오지, 라우린지, 글리세로젤라틴 등이 사용될 수 있다.
본 발명의 조성물은 경구 또는 비경구로 투여될 수 있으며, 피부외용 또는 복강내, 직장, 정맥, 근육, 피하, 자궁내 경막 또는 뇌혈관내로 투여될 수 있다.
본 발명의 조성물의 투여량은 환자의 체중, 연령, 성별, 건강상태, 식이, 투여시간, 투여방법, 배설율 및 질환의 중증도에 따라 그 범위가 다양하며, 일일 투여량은 ENOblock의 양을 기준으로 0.01 내지 1000 rag/kg인 것이 바람직하고, 바람직하게는 0.1 내지 100 rag/kg이며, 하루 1 ~ 6회 투여될 수 있다.
본 발명의 조성물은 단독으로, 또는 수술, 방사선 치료, 호르몬 치료, 화학 치료 및 생물학적 반응 조절제를 사용하는 방법들과 병용하여 사용할 수 있다. 또한, 본 발명은 ENOblock을 개체에 투여하는 단계를 포함하는 비만, 섬유증, 지방간, 당뇨 합병증, 고지혈증 및 퇴행성 뇌질환으로 구성되는 군으로부터 선택되는 어느 하나의 질환을 예방또는 치료하는 방법을 제공한다.
또한, 본 발명은 비만, 섬유증, 지방간, 당뇨 합병증, 고지혈증 및 퇴행성 뇌질환으로 구성되는 군으로부터 선택되는 어느 하나의 질환을 예방 또는 치료하기 위한 상기 ENOblock을 유효성분으로 포함하는 약학적 조성물의 용도를 제공한다.
또한, 본 발명은 비만, 섬유증, 지방간, 당뇨 합병증, 고지혈증 및 퇴행성 뇌질환으로 구성되는 군으로부터 선택되는 어느 하나의 질환을 예방 또는 치료하기 위한 약학적 조성물의 제조하는데 있어서, ENOblock의 용도를 제공한다.
【발명의 실시를 위한 형태】
이하, 본 발명을 하기 실시예 및 실험예에 의하여 더욱 상세하게 설명한다. 단, 하기'실시예 및 실험예는 본 발명을 예시하기 위한 것일 뿐, 본 발명의 범위가 이들만으로 한정되는 것은 아니다.
I . 제 2형 당뇨병 마우스모델에서 ENOblock의 효과 확인 실시예 1. 시약 및 항체
화학식 2로 표시되는 ENOblock (N-[2-[2-(2-aminoethoxy)ethoxy]ethyl ]- 4- [ [ 4- [ ( eye 1 ohexy 1 me t hy 1 ) am i no ] -6- [ [ ( 4- f 1 uor opheny 1 )methyl ]amino] l ,3 , 5- tr i azin-2-yl ]ami no ]-benzeneacet amide hydrochk)r ide)는 포항공과대학교의 장영태 교수와 광주과학기술원의 안진회 교수가 제공하였다. 로지글리타존 (Rosigl i tazon)은 Santa Cruz Biotechnology(CA, USA)에서 구입하였다. NaF , oi l red 0 및 1 i卿 olysaccharide(LPS)와 a -smooth muscle act in (카탈로그 번호 A5228)은 Sigma-Aldr ich(M0, USA)에서 구입하였다.
Ci lostazol은 Enzo Li fe Science (NY , USA)에서 구입하였다. enolase (카탈로그 번호 sc271384) , lamin B (카탈로그 번호 sc374015) , pro-
caspase-3(카탈로그 번호 sc7148) 및 a -tubul in (카탈로그 번호 sc53646)에 대한 항체는 Santa Cruz Biotechnology에서 구입하였다. hi stone H3 , c leaved caspase— 3(카탈로그 번호 cs-#9661) 및 PARP/cleaved PARP (카탈로그 번호 cs- #9542)에 대한 항체는 Cel l Signal ing (카탈로그 번호 #9715)에서 구입하였다. 또한, Nonident-P40( IGEPAL CA-630)은 Generay Biotech에서 구입하였다. 실시예 2. 세포배양
NIH/3T3 생쥐의 섬유아세포, Huh7 인간 간세포, 3T3-L1 생쥐 지방선구세포 및 RAW 264.7 생쥐 대식세포는 한국 세포주 은행 (KCLB) (서울대학교 한국)에서 수득하였다. 상기 세포를 10% FBS, 50 uni ts mL— 1 페니실린 및 50 mg ml/1스트렙토마이신이 첨가된 DMEM증식 배지에서 유지하였다. 실시예 3. 동물준비
실험실 동물의 관리 및 사용에 관한 실험 동물 연구소 지침에 따라 동물 면구를 수행하였다. 또한, 동물 연구는 광주 과학 기술 연구소 동물 관리 및 사용 위원회 (승인 번호: GIST-2016-33)의 승인을 받았다. 생후 5주된 수컷 C57BL/ sj-db/db 마우스를 Damool Science (대전, 한국)에서 구입하였다.
상기 마우스는. 12h/12h l ight cycle로 유지하였다. 음식과 물은 자유롭게 먹을 수 있도록 하였다. 환경 적웅 기간 1주 후, 마우스를 실험에 사용하였다. 정상 배경 균주와 비교하기 위해서, 수컷 C57BL/6J 마우스를 Damool Science에서 구입하였고, 약물 처리된 C57BL/Ksj-db/db 마우스와 비교하기 위해서 연령을 일치시켰다.
ENOblock의 항-고혈당 효과를 평가하기 위한 단기 시험을 위해, 쥐를 무작위적으로 10마리씩 3그룹으로 나누었다. 10% DMS0를 함유한 식염수, rosigl i tazone(8 mg/kg의 농도, 10% DMS0를 함유한 식염수), EN0block(8 mg/kg의
농도, 10¾ DMSO를 함유한 식염수)를 복강 내 주사 (용액 용량 = 10 ii L/g)로 주입하고, 혈당 수준을 0 시간 시점에서 즉시 측정 하였다. 1, 3 , 6, 12 및 24시간 후 모든 쥐의 혈당 수치를 측정하였다.
ENOblock 처리 7주 후의 연구를 위해, db/db 마우스를 무작위로 10마리씩 3그룹으로 나누었다. 10% DMS0를 함유한 식염수, rosigl i tazone(8 mg/kg의 농도, 10% DMS0를 함유한 식염수) , ENOblock (8 mg/kg, 12 mg/kg의 농도, 10% DMS0를 함유한 식염수)를 복강 내 주사 (용액 용량 = 10 ii L/g)로 매 24시간 마다 주입했다. 7주간의 약물 처리기간도안 매 48시간마다 혈당 모니터링을 수행했다 (약물 처리 6시간 후 수행) . OneTouch Ul tra (Li feScan, CA, USA)를 사용하여 혈당을 측정했다.
7주 후, 쥐는 diethyl ether로 마취하여 심장에서 혈액을 채취했고 신장, 간, 지방 조직을 수확했다. 수집된 혈액은 응고시키기 위해 15분간 1.5 mL 튜브에 보관하였다. 4°C에서 10분 동안 1500 g에서 원심 분리하여 혈병 (blood clot )을 제거하였다. 상등액을 50 ii L씩 나누어 -80°C에서 보관하였다. 수확된 조직은 PBS로 2회 세척하고 -80°C에서 보관했다. 블라인드 테스트 방식으로 Real-t ime PCR, 섬유증 염색법, 세포 사멸 분석 및 에놀라제 활성 분석과 같은 조직 분석을 수행하였다. 실시예 4. 조직 포매 (embedding) 및 절단
조직을 PBS로 2회 세척하고 건조시킨 후 cryo-mold에 넣고 0CT(Leica, Germany)로 완전히 덮었다. OCT 포매된 샘플을 액체 질소상에서 부유시켜 급속 동결시키고 이소프로판올 슬러리에 넣었다. 동결된 블록을 절편까지 -80°C에서 더 보관하였다. 모든 섹션은 -25°C에서 라이카 CM 1850 저온 유지 장치를 이용하여 제작하였다.
실시예 5. 심장근세포폭의 평가
각 처리군의 5마리 생쥐의 넁동 심장 조직을 8 μ πι 깊이로 절단하고, 3.7% 포름 알데히드 용액을 사용하여 고정시켰다. 심장 근세포의 폭을 측정하기 위해 Hematoxyl in과 eosin(H & E) 염색을 시행하였다. 근세포 폭은 Aper io ImageScope(Leica Biosys terns , Germany)를 사용하여 평행 근세포 덩어리가 있는 심근 부위에서 측정하였다. 각 심장에서 30 내지 47개의 근육 세포가 측정되었다. 실시예 6. 핵 단백질의 추출
세포를 배양하고 10 cm 접시에서 관심 화합물로 처리하였다. 처리 후, 세포를 PBS로 세척하고 세포질 추출 완층액 ( 10 mM Hepes pH 7.9 , 10 mM KCl , 0. 1 mM EDTA, 0.5% nonident-P40(핵 막을 파괴하지 않는 IGEPAL CA-630) 및 프로테아제 억제제 칵테일) . 얼음으로 5분 인큐베이션한 후 4°C에서 3000 rpm으로 5분 동안 원심 분리하여 세포를 긁어서 수거 하였다. 상등액을 버리고 세포 펠렛을 세제가 함유되지 않은 세포질 추출 완층액으로 2회 세척하였다.
핵 추출 버퍼 (20 mM Hepes pH 7.9, 0.4 M NaCl , 1 mM EDTA, 25 % 글리세를 및 프로테아제 억제제 칵테일)의 펠렛 만큼의 볼륨을 가한 후, 얼음에 15분간 담가놓았다. 핵 단백질을 4°C에서 13, 000 rpm으로 5분간 원심 분리하고 상등액을 수집하였다. 핵 /세포질 분획화 키트 (# K266-25, BioVi sion Incorporated, CA 95035 , USA)를 사용하여 세포 및 조직으로부터 핵 단백질을 정제하였다. 실시예 7. 일차배양마우스 간세포 정제
일차배양 마우스 간세포는 에놀라제 핵 내 전위 분석을 위해 10주령 수컷 C57BL/6J 마우스로부터 분리하였다. 간세포를 분리하기 위한 2단계 콜라게나제의 관류를 통한 효소분해 과정 거쳐 퍼콜 구배 방법을 추가하여 분리하였다. 10 mm
FBS, 10 μΜ 덱사메타손, 100 ηΜ 인슐린 및 1% Penici 1 Hn/Streptomycin이 보충된 DMEM 배지에 세포를 100 mm 직경 세포 배양 플레이트에서 2 x 106의 밀도로 도말하였다. 실시예 8. 에놀라제 활성 분석
에놀라제 활성은 2-포스포-글리세레이트의 포스포-에놀- 피루베이트 (Enolase Activity Colorimetric Assay Kit, Biovision, CA, USA)로의 변형을 검출함으로써 시험하였다. 처리군당 6마리의 동물에서 3회씩 균질화된 간 조직 (10 mg)을 조직 -기반 분석에 사용하였다. 세포 (2X105)를 세포 -기반 분석을 위해 3중으로 처리 하였다. 에놀라제 활성은 20분 후에 570 nm의 흡광도로 측정하였다. 실시예 9. 세포 수준의 에놀라제 핵 전위 분석
100 隱 직경 세포 배양 플레이트 (2X106 세포 /플레이트)에 일차 배양 마우스 간세포는 72시간 동안 10 μΜ ENOblock 또는 0.1% DMS0와 DMEM 매체를 유지했다. Nuclear/Cytosol Fractionation Kit (Biovision Inc.)를 사용하여 핵 및 세포질 단백질을 분리하였다. 단백질 샘플을 웨스턴 블롯 분석을 위해 3개씩 준비하였다. 실시예 10. 생체 내 에놀라제 핵 전위 분석
C57BL/6J 마우스 (8주령)에게 12 mg/kg ENOblock 포함된 식염수 + 10% DMS0또는 식염수 + 10% DMS0를 복강 내 주사 하였다 (처리군 당 5마리). 24시간 후, 마우스를 회생시키고 간 조직을 적출하였다. Nuclear/Cytosol Fractionation Kit(Biovision Inc.)를 사용하여 핵 및 세포질단백질을 간 조직으로부터 분리하였다.
실시예 11. 웨스턴 블롯
30 내지 40 단백질 샘플의 추출물을 10% 폴리 아크릴 아미 H 겔에 로딩하고 전기 영동 후 니트로 셀를로오스 멤브레인으로 옮겼다. 사용된 1차 항체의 세부 사항은 실시예 1에 제공되었다ᅳ 검출은 HRP-접합 2차 (항-마우스 IgG-HRP, sc2031 , Santa Cruz Biotech)를 사용하여 수행하였다. 모든 1차항체는 5% 탈지유가 함유된 TBS-T에서 1 : 1000 희석하여 4°C에서 밤새 배양하였다. 2차 항체를 1: 10 ,000으로 회석하여 실온 (RT)에서 30분 동안 배양하였다.
단백질의 농도는 Bradford 분석을 사용하여 측정하였다. 발현 신호는 ECL 솔루션 (RPN2232, GE Healthcare Li fe Science, UK)을 사용하여 시각화하였다. 밴드 Intensity는 ImageJ 1.45 소프트웨어 (Nat ional Inst itutes of Health, USA)로 측정하였고, 세포질 단백질에 대해서는 a - tubul in으로, 핵 추출에 대해서는 lamin-B를 사용하여 표준화하였다. 각 처리 그룹에서 5마리의 마우스의 조직으로부터의 단백질 샘플을 웨스턴 블롯 분석에 사용하였다. 실시예 12. 세포 및 조직으로부터 RNA의 분리
제조사의 지시에 따라 TRIzol 시약 (Thermo Fisher Scient i f ic , MA, USA)을 사용하여 RNA를 수득하였다. 액체 질소로 동결된 조직을 RNA 추출 전에 유리 모르타르를 사용하여 분말로 분쇄하여 진행하였다. 실시예 13. RT-PCR및 정량실시간 PCR
RNA는 제조사의 지시 (Sigma-Aldrich, MO, USA)에 따라 TRI 시약을 사용하여 세포 또는 조직으로부터 추출하였다. 조직에서의 PCR 분석을 위해, 각 처리군에서 5마리의 마우스로부터 RNA를 분리하였다. RT-PCR을 위해 역전사 (AccuPower® RT PreMix, Bioneer)에는 1 RNA와 100 pmole ol igo
dT16을 사용하였다. 2.5 u L RT 생성물을 PCR(AccuPower® PCR PreMix ,
Bioneer )에 사용하였다. 농도계 분석은 Scion Image 프로그램 (Scion Corporat ion, USA)을사용하여 수행하였다.
정량 실시간 PCR의 경우, 관심 유전자의 전사체 수준을 StepOnePlus 실시간 PCR시스템 (Appl ied Biosys terns , UK)을 사용하여 분석하였다. 전체 RNA를 역전사하여 AccuPower® RT PreMix(Bioneer Cor por at ion)를 사용하여 cDNA를 준비하였다. 얻은 cDNA는 다음의 변경을 통해 제조업자의 지시에 따라 실시간 PCR에 적용하였다.
특정 프라이머 각각의 200 nM (최종 농도)과 1 의 total. RNA로부터 합성된 cDNA의 1 u L를 함유하는 20 u L 2X Power SYBR® Green PCR Master
Mix(Appl ied Biosys terns , UK)의 총 부피에서 PCR을 3회 수행하였다. PCR 증폭은 흔합물을 95°C에서 10분간 인큐베이션한 후 증폭 단계를 40 사이클와 변성, 어닐링 및 연장으로 구성하였다. 변성은 95°C에서 15초 동안 수행하였고, 어닐링은 60 °C에서 1분 동안 수행하였으며, 연장은 각 사이클 후에 72°C에서 형광 검출을 사용하여 72°C에서 20초 동안 수행하였다. 최종 사이클 후, 모든 샘플의 융점 분석은 연속 형광 검출을 사용하여 60 내지 95°C의 범위 내에서 수행하였다.
특정 cDNA 샘플은 각 실행에 포함되어 실행간 비교를 위한 참조 자료로 사용하였다. β - act in 또는 18s rRNA의 발현 수준은 다른 모든 유전자의 발현 수준을 계산하여 표준화하는데 사용하였다. 결과는 각 유전자에 대한 상대적 발현 수준으로 표현하였다. 합성된 cDNA는 정량적 실시간 PCR(qRT-PCR) 또는 표준 PCR에 의해 증폭되었다. 이 실험에서 사용된 PCR 프라이머를 하기 표 1(서열번호 1 내지 70)에 나타내었다.
F TGGATGATTGACTCCGAATGTC
Er 2
R TGCCATACGGGAGAATTCTGA
F CCTCCCGCACGATTTCTG
Gata4 NM_(M)i092
R CTCAGGAAAAAGAAAATCCCAAATT
F CATGGCTGTCGCTGGTTTC
'Ght 4 AB008433
R AAACCCATGC03AC:AATGA
F CACCTGGeAGAACCACACAAG
Insig-I NM J 53526
R CACG 3CAATACAQCGCATAA
F ATOTGATCACGAGCATCTTTTCA
Insig-2 N J)0127i 53l
R GOCTGTGCCGCAGCAT
F TCTGGTAGGTCCCACGTTCAG
lttsig-2 AY 156084
QAACTGTGAAGTGAAQCAGACCAA
F TCTGGTAGGTCCCACGTTCAG
insig-2b AY1S6085
M GAACTGTGAAGTGAAGCAGACCAA
F TAGTCCTTCCTACCCCAATTTCC
Inierte ktn-S N _0006O)
R TTGGTCCTTAGCCA.CTCCTTC .
F TGCCATTATTCCTCTATQCTATG^CT
Imp N _172S27
R CAGATCCCCTGAATGTCATTGA
F CAACGGTGT'AGGACC ACAAC
Kenkl N _008 30
R CCAGTCCAAATAGATTCACCTTCTG
P TCCTGATGTTGGTGGCTTCAG
M p3 NMJW2422
R TGTCTTGGCAAATCCOOTGTA
F CTCGTGCTCATAGCTACCACCAT
Mcp-l(= cl2) NM_0l l.33l
R GGGTGCTCACCGCATCTG
F CTGCATAACGGTCTGGAC-TTC
Pck-1 NM— (Μ oΠ
CAGCAACTGCCCGmCTCC oΜ4
F CCACAGGACfCCCCATGCT
.Pck^2 NM )28994
R ATGGCTCCTATGTACCTCCC
F TGCATGGACGATCTGITGCT
pS3 AB020317
R TTCACTTGOGCCTrCAAAA,¾A
F GCCCACCAACTTCGGAATC
Ρραρ-γ NMJM 1127330
R TGCGAGTGGTCTTCCATCAC
P GATGTGCGAACTGOACACAG
Srebp-l NM 3I.1棚
R CATAGGGGGCGTC4AACAG
F CCAGAGGGTGAGCCTGACAA
Srebp-lc 画 0011313979
R AGGCTCTGCAATTTCCAGATCT
P TCTGACTTCTTCCTCCAGATGCT
Sc p N J)0100114
R CATCCQGCGAATGTCGAT
F C lUUL' lGGi 1 1 A A G 1 L
m-4 N _IJ8557
R GACATTQGAGAAACATTCGC
P AAGCCTGTAGCCCACGTCGTA
Tnf~ NM_O0«78«M
R GGCACCACTAGTTGGTTGTCTTTG
각각의 실험에서 mRNA 발현의 상대적 양을 측정하기 위해, 먼저 각 유전자의 Δ (:Τ 값을 β -act in 또는 18S rRNA의 CT 값에 대비로 표준화하였다. 다음으로, 약물 처리된 샘플에서 각 유전자의 ACT 값을 비 -처리 db/db 샘플 또는 정상 건강 대조군 (B6, 실험군과 동일한 연령)에서 동일한 유전자의 Δ ( 값으로 추가로 정규화하여 Δ Δ ΟΓ 값은 약물 처리된 샘플에서 대조군의 것과 비교된 각각의 유전자의 상대적인 발현을 계산하였다. 상대적 mRNA 발현 변화율은 최종적으로 2— 2 A A CT 방법을 사용하여 계산하였다. 각 실험에서 최종 mRNA 발현은 3가지 독립적인 실험 세트의 평균값으로 계산하였다. 실시예 14. 혈청 유리 지방산 (FFA) 정량
혈액 샘플을 4°C에서 10분 동안 원심 분리하고 혈청 (상등액)을 새로운 튜브에 수집하고 FFA 분석 시점까지 -80°C에서 동결시켰다. FFA의 농도는 색도 검정 (0D 570 nm)을 사용하여 키트 (카탈로그 #K612, BioVision, Inc . )를 사용하여 측정하였고, nmol/ μ ΐ 또는 로 표시하였다. 처리군 당 6마리의 동물에서 혈청 샘플을 3번씩 사용하였다. 실시예 15. 혈청 알라닌 아미노 전이 효소 (ALT) 활성 분석
혈청은 FFA 정량화에 대해 기술된 대로 준비하였다. 효소 활성은 nmol/mon/mL(=mU/mL)로 표시하였고, 키트 (카탈로그 번호 #K752, BioVision, Inc . )에 의해 제공된 방법에 따라 분석하였다. 처리군 당 6마리의 동물에서 혈청 샘플을 3번씩 사용 하였다. 실시예 16. 혈청 HDL및 LDL콜레스테를수치 측정
혈청 고밀도 지질단백질 (HDL)과 저밀도 지질단백질 (LDL) 콜레스테를은 HDL 및 LDL/VLDL 콜레스테롤 정량 색도 측정 /형광 측정 키트 (BioVision, CA,
USA)를 사용하여 측정하였다. 비색 분석을 사용하였다. 처리군 당 5마리의 동물에서 혈청 샘플을 3번씩 사용하였다. 실시예 17. 간장의 지질 축적 및 지방증측정
간 지방 지질 축적은 육안으로 확인하였고, 오일 레드 0 염색법과 ImageJ 1.45s 소프트웨어를 사용하여 측정하였다. 오일 레드 0 염색을 위한 간조직은 - 25°C에서 저온 유지 장치 (라이카 CM 1850)를 사용하여 8 μ ιη 두께로 절편을 만들었다. 동결박편은 10분 동안 공기 건조시킨 다음 10% 포르말린 용액으로 고정시켰다. 이어서, 슬라이드를 흐르는 수듯물로 행구고 60% 이소프로판올로 세척 하였다.
그 후, 새롭게 준비된 오일 레드 오 염색 용액 (3 g/L) (Sigma- Aldrich)으로 15분 동안 절편을 염색한 다음 60% 이소프로판올로 행구고 수용액 (Sigma-Aldrich)으로 장착하였다. 처리된 모든 마우스 간에서 30개의 무작위로 선택된 지질액 샘플을 지질 축적을 평가하기 위한 정량에 사용하였다. H&E 염색법을 사용하여 미세지방증을 평가하였다. 각 간장의 10개의 상이한 영역을 측정하여 간 지방증을 정량화하였다. 실시예 18. 조직에서의 아품토시스측정
아폼토시스 (apoptosi s) 분석은 TACS® 2 TdT-DAB In Situ Apoptosis
Detect ion Kit (Trevigen, MD, USA)를 사용하여 제조업체의 프로토콜에 따라 측정하였다. 심장, 신장 및 간 조직에서의 아픕토시스 핵의 시각화는 처리군 당 5마리의 마우스로부터의 조직을 사용하여 최종 배율 400배로 수행하였다. 아톱토시스 핵을 계산하기 위해 각 마우스에서 3개의 염색된 절편 중에서 9개의 시야를 무작위로 선택하여 시각화하였다.
실시예 19. 지방세포크기 측정
지방 조직 절편을 H&E로 염색하였다. 지방 조직에서 지방 세포의 크기 분포는 Image J 1.48v 소프트웨어를 사용하여 측정하였다. 처리군 당 8마리의 마우스로부터의 지방 조직을 염색하고 각 마우스로부터 무작위로 선택된 40개의 지방세포 크기를 측정하였다. 실시예 20. 조직 섬유의 측정
섬유증의 평가를 위해 조직 절편을 Trichrome Stain(Masson)키트 (Sigma- Aldrich, MO, USA)로 염색하였다. 심근 간질 섬유증, 신장 섬유증 및 간 섬유증의 평가를 위해 image J 1.48v 소프트웨어를 사용하여 청색으로 염색된 염색 부위를 측정함으로써 정량화하였다. 지방 조직 섬유화는 지방 세포 주변의 파란색으로 염색된 영역을 정량화함으로써 평가하였다. 섬유화 백분율은 ImageJ 소프트웨어를 사용하여 계산된 전체 조직 절편 내의 파란색 염색의 백분율로서 계산하였다.
10마리의 마우스 /처리군을 간 섬유화 분석에 사용하였다. 5마리의 마우스 /투여 그룹에 해당하는 심장, 지방 및 신장 조직 섬유화 분석에 사용하였다. 각 동물로부터 3개의 염색된 섹션을 사용하여 섬유증 정도를 평가하였다. 실시예 21. 대식세포에서 염증 반웅의 평가
대식세포 세포 라인인 RAW 264.7를 2.5X 105 세포 /웰의 밀도로 6개의 웰 플레이트에 접종 하였다. 12시간 후, 대식세포를 16시간 동안 관심 화합물로 처리하였다. 그 다음, 대식세포를 3시간 동안 100 ng/mL LPS의 존재 또는 부재 하에 처리하고 세포를 수확하여 유전자 발현 분석을 위해 RNA를 분리하였다. 분석을 2회 더 반복하여 정량적 실시간 PCR 분석을 위해 3개의 샘플을
수득하였다. 실험예 1. E Oblock의 에놀라제 효소활성 조절
에놀라제 효소 활성에 대한 ENOblock의 기능을 확인하기 위해, ENOblock
10 μ πι 또는 에놀라제 효소 억제제로 알려진 NaF 2 mM를 48시간 동안 NIH/3T3 섬유아세포에 처리하였다. 그 결과를 도 1에 나타내었다. 도 1에 나타난 바와 같이, ENOblock 처리된 세포에서 에놀라제 활성이 감소되었다. 실험예 2. ENOblock의 에놀라제 타겟 유전자조절 및 에놀라제 핵 국소화 유도
에놀라제 및 이의 핵 유사형태인 Myc—결합 단백질 -l(MBP-l)은 DNA에 결합할 수 있고, 전사 억제자로서 기능할 수 있다. 따라서, 본 발명자들은 10 μ Μ의 ENOblock을 3T3-L1 지방전구세포주 및 Huh7 간세포에 48시간 동안 처리하여 에놀라제의 핵 내로의 전위를 측정하였다. 또한, ENOblock을 처리한 각 세포에서 에놀라제 결합 유전자의 발현을 평가하였다. 그 결과를 도 2 내지 도
11에 나타내었다.
도. 2 내지 도 11에 나타난 바와 같이, ENOblock 처리된 3T3-L1 지방전구세포 또는 Huh7 간세포는 핵에서 에놀라제의 발현이 증가하였다 (도 2 내지 도 5) . 또한, ENOblock 처리는 지방 세포에서 핵 에놀라제 /MBP-1의 타겟 유전자로 알려진 c- ^의 발현을 감소시켰다 (도 6 및 도 7) . 에놀라제 타겟 유전자로 알려진 Erbb2(HER2/neu)는 ENOblock 처리된 간세포 및 지방세포 모두에서 발현이 감소되었다 (도 8 내지 도 11) .
ENOblock이 효소 당분해 활성의 조절을 통해 에놀라제 핵 국소화 (nuclear local izat ion)를 유도하는지 평가하기 위해, ENOblock 10 μ Μ 또는 에놀라제 촉매 활성을 억제하는 NaF 2 mM을 48시간 동안 Huh7 간 세포주에 처리하였다. 그
결과를 도 12 및 도 13에 나타내었다. 도 12 및 도 13에 나타난 바와 같이, NaF는 핵 국소화를 유도하지 않았고, ENOblock에 의해 핵 국소화가 증가하였다.
72시간 동안 10 μ Μ의 ENOblock을 Huh7 간세포주에 처리한 후, 일차 배양 마우스의 간세포에서 세포질 및 핵 내 에놀라제 단백질 발현을 분석하였다. 이때 cytoplasmic 에놀라제는 α -tubul in으로 평준화하였고, nuclear 에놀라제는 12 mg/kg의 ENOblock으로 24시간 처리한후 C57BL/6J 마우스 간 조직 추출 단백질을 분석하여 lamin B를 통해 평준화하였다. 그 결과를 도 100, 도 14 및 도 15에 나타내었다. 이때, 통계 분석은 일원 분산 분석 (one-way ANOVA) 테스트로 수행하였다 (ns : 크게 다르지 않음; * , ** 또는 p <0.05, p <0.01 또는 p
O.001로 각각 해당 대조군 (DMS0 (0. 1 %) - 치료군)과 유의하게 다름; 오차 = SEM) .
에놀라제의 핵 전위를 유도하는 ENOblock의 기능은 일차 배양 마우스의 간세포 및 ENOblock을 처리한 마우스의 간조직을사용하여 입증하였다. 실험예 3. ENOblock의 항 당뇨병 효과평가
6주령된 db/db 마우스에게 8 mg/kg ENOblock 또는 8 mg/kg 로지글리타존 (rosigl i tazone)을 24시간 이상 처리하였다. 이어서, db/db 마우스에서 ENOblock 및 로지글리타존을 7주간 처리하였다. 이때, ENOblock의 화학구조는 도 16에 나타내었고, 실험 과정을 도식화하여 도 17에 나타내었다. 이후, 각 마우스의 혈당 수치, 혈청 수치 및 에놀라제 활성을 측정하였다.
그 결과를 도 18 내지 도 28에 나타내었다. 이때, 상기 도 18 및 도 19, 및 도 26 내지 도 28에 대한 통계 분석은 Student ' s t test를 사용하여 수행하였다 (오차 = SEM; * 처리되지 않은 db/db 마우스와 비교하여 ENOblock 8 mg/kg에 대한유의성 p <0.05) .
또한, 도 20 내지 도 25의 통계 분석은 일원 분산 분석 (one— way ANOVA)
테스트와 Dunnett ' s mut iple 비교 테스트 및 unpai red t-test로 수행하였다 (ns : 크게 다르지 않음; *, ** 또는 p <0.05, p <0.01 또는 p <0.001; #, ## 또는 漏: p <0.05 , p <0.01 또는 p O .001로 각각 해당 db- 대조군과 유의하게 다름; , a: a: 또는 : p <0.05 , p <0.01 또는 p O .001로 각각 해당 db_ Rosi와 유의하게 다름) .
도 18 내지 도 28에 나타난 바와 같이, ENOblock 및 로지글리타존 처리된 마우스에서 혈당 수치가 상당히 감소하였다 (도 18) . 또한, 8 mg/kg 또는 12 mg/kg ENOblock, 또는 8 mg/kg로지글리타존을 7주간 처리한 db/db 마우스에서는 혈당 수치가 상당히 감소하였다 (도 19) . 로지글리타존은 ENOblock 보다 더 효과적으로 혈당 수치를 감소시켰다.
7주 후, ENOblock 처리는 혈청 LDL 수치를 상당히 감소시킨 반면, HDL 수치에는 처리되지 않은 db/db 마우스에 비해 영향을 끼치지 않았다 (도 20 및 도 21) . 12 mg/kg ENOblock 처리된 db/db 마우스는 유리지방산 (FFA)의 혈청 수치가 처리되지 않은 db/db마우스에 비해 감소되었다 (도 22) .
알라닌 아미노기전달효소 (ALT)의 혈청 수치는 ENOblock 처리된 마우스에서 비처리된 db/db 마우스에 비해 유의하게 변하지 않았다. 이는 ENOblock 처리가 간세포 독성을 생산하지 않았다는 것을 의미한다 (도 23) . ENOblock 처리된 마우스의 신장 및 간에서, 에놀라제 활성은 상당히 감소되었다 (도 24 및 도 25) . ENOblock 처리된 T2DM 마우스의 간에서 에놀라제 /MBP-1 결합 유전자인 COX-2 , Erbb2 및 c_Myc 모두 전사 억제를 나타내었다 (도 26 내지 도 28) . 실험예 4. T2DM마우스에서 ENOblock의 간섬유화 및 아픕토시스조절
12 mg/kg의 ENOblock 또는 8 mg/kg의 로지글리타존 처리 7주 후, db/db 마우스로부터 간을 적출하였다. 이후, 간 중량을 측정하였고, 간을 육안적으로
평가하였다. 또한, 여러 염색법과 마커 발현 측정을 통해 지질 축적 및 간 섬유화를 측정하였다. 또한, 마우스 간세포의 아품토시스를 측정하였다. 이를 도
29 내지 도 34에 나타내었다.
도 29 내지 도 34에 나타난 바와 같이, ENOblock 처리는 간 중량 또는 외관에 영향을 끼치지 않은 반면, 로지글리타존 처리는 간 중량을 상당히 증가시켰다 (도 29 및 도 30) . Oi l red 0 염색을 통해, 12 mg/kg ENOblock 처리된 마우스의 간에서 지질 축적이 유도됨을 알 수 있었다 (도 31 및 도 32) . Masson- Tr i chrome 염색을 통해, ENOblock 처리가 간 섬유화를 유의하게 감소시킴을 확인할 수 있었다 (도 33 및 도 34) . 로지글리타존 처리된 마우스의 간에서 섬유화는 많은 양의 지질 축적 때문에 평가할 수 없었다.
간 섬유화에서 ENOblock의 효과를 확인하기 위해, 섬유화 마커인 α - smooth muscle act in( a -SMA)의 발현을 평가하였다. 그 결과를 도 101a , 도 101b 및 도 35 내지 도 41에 나타내었다.
도 101a , 도 101b, 및 도 35 내지 도 41에 나타난 바와 같이, a _SMA 발현은 ENOblock 처리된 마우스에서 처리되지 않은 db/db 마우스에 비해 통계학적으≤ 유의하게 감소하였다 (도 101) . ENOblock 처리는 로지글리타존 처리보다 지방증을 유의하게 감소시켰다 (도 35 및 도 36) . 또한, ENOblock 처리시 간세포 아폼토시스를 감소시켰고, 로지글리타존에 비해 아톱토시스를 더 효과적으로 억제하였다 (도 37 및 도 38) . 아울러, ENOblock 처리시 간세포 아톱토시스 억제 효과는 두 아폼토시스 마커, 절단된 카스파제 -3 및 절단된 PARP의 웨스턴 블롯 분석을 통해 확인하였다 (도 39 내지 도 41) . 실험예 5. T2DM 마우스의 간에서 염증 마커의 발현 및 간 지질 항상성과 글루코오스신생합성의 중요조절자에 대한 ENOblock의 기능 확인
염증, 간 지질 항상성 및 글루코오스 신생합성에 대한 ENOblock의 기능을
확인하기 위해, T2DM 마우스에게 ENOblock을 7주 동안 처리하였다. 그 결과를 도 42 내지 도 50에 나타내었다.
한편, 실험예 4 및 5에 있어서, 도 29 내지 도 50에 대한 통계 분석 값은 (도 30, 도 32, 도 34, 도 36 및 도 38)에 대한 평균 土 SD 및 도 40 내지 도 50에 대한 士 SE로 표시하였다. 모든 통계 분석은 일원 분산 분석 (one-way ANOVA test )과 Dunnett ' s mult iple compar i son test로 수행되었다 (ns : 크게 다르지 않음을 의미; *, ** 또는 *** : p <0.05, p <0.01 또는 p <0.0이로 해당 대조군 (B6)과 유의하게 다름을 의미; #, ## 또는 漏: p <0.05 , p <0.01 또는 p <0.001로 각각 해당 db—대조군과 유의하게 다름을 의미) .
도 42 내지 도 50에 나타난 바와 같이, ENOblock 처리는 염증 마커인 IL- 6 및 TNF- α의 발현을 억제하였고, B6 strain에 비해 db/db 마우스에서 발현이 증가하였다 (도 42 및 도 43) . ENOblock은 로지글리타존보다 TNF- α 발현을 감소시키는데 더 효과적으로 나타났다 . Phosphoenol pyruvate carboxykinase- KPck-l cytoplasmic form) 글루코오스 신생 합성의 양성 조절과 관련이 있다.
Pck-1 발현은 ENOblock 처리에 의해 하향-조절된 반면, 글루코오스 신생 합성 조절과 관련 없는 Phosphoen이 pyruvate carboxykinase-2(Pck-2 ; mi tochondr i al form)의 발현은 증가하였다 (도 44 및 도 45) . Sterol regulatory element -binding protein인 Srebp-la 및 Srebp-lc는 지질 항상성의 주요 조절자이다.
ENOblock 처리는 Srebp-la 발현을 정상 B6 마우스에서 관찰된 수준까지 정상화하였고, Srebp-lc의 발현을 감소시켰다 (도 46 및 도 47) . Srebp-1 단백질 활성을 조절하는 Insig-2는 ENOblock 처리에 의해 감소되지 않았다 (도 48) . Liver X receptor (LXR)은 Srebp-1가 억제될 때 간지방증 및 고중성지질혈증을 일으키는 sterol 조절된 전사 인자이다) . 그러나, ENOblock 처리 이후, db/db 마우스 간에서 LXR 타겟 유전자인 Scap 및 Abcg5의 발현이 감소되었다 (도 49
내지 도 50) . 실험예 6. T2DM 마우스의 지방 조직 섬유화, 염증 및 지방세포 크기에 대한 ENOblock의 기능
지방 조직의 섬유화 및 염증, 및 지방세포 크기에 대한 ENOblock의 기능을 확인하기 위해, 12 mg/kg의 ENOblock 또는 8 mg/kg의 로지글리타존을 db/db 마우스에게 7주간 처리하였다. 그 결과를 도 51 내지 도 58에 나타내었다. 도 51내지 도 58에 나타난 바와 같이, ENOblock 처리는 로지글리타존 처리에 비해 전체 몸무게를 증가시키지 않았다. 또한, ENOblock 처리된 마우스는 로지글리타존 처리된 마우스에 비해 생식선의 지방 조직 무게에 차이가 없었다 (도 51 및 도 52) .
db/db 마우스는 비당뇨병 마우스인 C57BL/6 B6)에 비해 증가된 지방세포 크기 및 지방 섬유화를 나타내었다. 처리되지 않은 db/db 마우스에 비해, ENOblock은 지방세포 크기 및 지방 조직 섬유화가 유의하게 감소하였다 (도 53 내지 도 56) . ENOblock 처리는 섬유화 마커인 α -smooth musc le act in의 발현을 감소시켰다 (도 57 및 도 58) .
지방 조직에서 염증을 억제시키는 화합물을 평가하기 위해, RAW 264.7 대식세포를 3시간 동안 100 ng/mL의 LPS로 처리하기 전에 16시간 동안 5또는 10 μ Μ ENOblock으로 처리하였다. 양성 대조군으로서, 대식세포는 만성 염증을 억제함으로써 인슐린 저항성을 개선시키는 항 혈소판 약물로 알려진 Ci lostaz 을 10 또는 25 μ Μ의 농도로 전처리하였다. 그 결과를 도 59 내지 도 65에 나타내었다.
이때, 통계 분석 값은 도 51, 도 52, 도 54, 도 56, 도 59 및 도 60에 대한 평균 士 SD 및 도 61 내지 도 65에 대한 士 SE로 표시하였다. 도 59 및 도 60의 통계 분석은 양 방향 AN0VA 테스트와 Sidak의 mut iple 비교 테스트로
수행하였다 (ns: 크게 다르지 않음; *, ** 또는 ***: p <0.05, p 0.01, p <0.001로 각각 해당 DMS0- 대조군과 유의하게 다름; #, ##또는漏: p <0.05, p <0.01 또는 p <0.0이로 각각 해당 Cilo 5(=Cilostazol 5 μΜ)와 유의하게 다름; , 또는 χ:κ : : ρ <0.05, ρ <0.01 또는 ρ <0.0이로 각각 Cilo
10(=Cilostazol 10 μΜ)과 유의미한 차이가 있음; 1, H 또는 111: EN05(=EN0block 10 μΜ)와는 각각 ρ <0.05, ρ <0.01 또는 p O.001로 유의미한 차이가 있음).
도 51 내지 도 56 및 도 61 내지 도 65의 통계 분석은 일원 분산 분석 (one一 way ANOVA test)과 Dunnet t ' s multiple comparison으로 수행하였다 (ns: 크게 다르지 않음; *, ** 또는 ***: P <0.05, p <0.01 또는 p O.001로 B6 대조군과 유의하게 다름; #, ## 또는 画: p <0.05, p <0.01 또는 p O.001로 각각 db- 대조군과 유의하게 다름 ; 오차 = SEM).
도 59 내지 도 65에 나타난 바와 같이, ENOblock은 염증 유전자인 TNF- α를 억제하였고, toll-like receptor 4(TLR4)는 전염증성 LPS가 자극된 대식세포에 존재한다. TLR4 발현에서 ENOblock의 억제 효과는 cilostazol 보다 더 크다 (도 59 내지 도 60). 이때, cilostaz이은 T2DM 지방 조직에서 만성 염증을 억제하여 인슐린 저항을 개선시키는 phosphodiesterase 3B의 억제자이다. 생식선의 지방 조직에서, 실시간 PCR은 ENOblock 처리가 염증성 유전자인 TNF-α , monocyte chemoattractant protein l(MCP-l) 및 전염증성 대식세포 마커 CDllc의 발현을 하향 조절함을 나타내었다 (도 61 내지 도 63). T2DM 지방 조직에서 증가된 지질생성의 마커인 핵수용체 퍼옥시좀 증식 인자 활성화 수용체 -Y(Ppar)는 ENOblock 처리 후 감소된 발현을 나타내었다 (도 64). 대사 조절곤란 및 지방 조직 섬유화와 연관된 Col6a3는 ENOblock 처리에 의해 하향 조절되었다 (도 65).
실험예 7. T2DM 마우스의 심장 비대, 섬유화 및 아품토시스에 대한 ENOblock의 기능
T2DM 마우스에서 심장 비대, 섬유화 및 아품토시스에 대한 ENOblock의 기능을 확인하기 위해, 8 mg/kg의 로지글리타존 또는 12 kg/mg의 ENOblock을 db/db 마우스에게 7주간 처리하였다. 그 결과를 도 66 내지 84에 나타내었다. 이때, 통계 분석 값은 도 66, 도 67 , 도 69 및 도 기에 대한 평균 士 SD로 나타내었다.
도 73 및 도 75 내지 도 84에 대해서는 土 SE이다. 모든 통계 분석은 일원 분산 분석 (one一 way ANOVA test )과 Dunnett' s mul t iple compar i son test로 수행하였다 (ns : 크게 다르지 않음; *, ** 또는 *** : p <0.05 , p <0.01 또는 p <0.001로 해당 대조군 (B6)과 유의하게 다름; #, ## 또는 漏.. p <0.05, p <0.01 또는 p O .001로 각각 해당 db- 대조군과유의하게 다름; 오차 = SEM) .
도 66 내지 84에 나타난 바와 같이, 심장 중량은 ENOblock 처리에 의해 영향을 받지 않았다 (도 66) . 심장 비대 표시자인 심장 중량: 체중의 비는 ENOblock 처리에 의해 감소하였다 (도 67) . Masson-Tr i chrome 염색은 ENOblock 처리가 심장 섬유화를 감소시킴을 나타내었다 (도 68 및 도 69) . 또한, H&E 염색은 ENOblock 처리가 심장근육세포 비대 (도 70 및 도 71)를 감소시킴을 나타내었다.
또한, 아픕토시스를 증가시키는 로지글리타존과는 대조적으로, ENOblock은 심장 조직에서 아픕토시스를 감소시켰다 (도 72 및 도 73) . 로지글리타콘에 비해 ENOblock 처리된 심장 조직에서 낮은 수치의 아폼토시스는 아폼토시스 마커인 절단된 PARP 및 절단된 카스파제— 3의 웨스턴 블롯에 의해 확인되었다 (도 74 내지 도 76) .
Gata-4, glucose transporter一 4(Glut_4), insul in— regulated aminopept idase( Irap) 및 a -myosin heavy chain( α—MHC)는 심장 기능의
마커이다. ENOblock 처리는 Gata-4, I rap 및 α -MHC의 발현을 증가시켰다 (도 77 내지 도 80) .
Potassium two pore domain channel subfami ly K member l(Kcnkl) , N一 acylsphingosine amidohydrolase 2(Asah2) , beta-l ,4-N-acetyl-galactosaminyl transferase l(B4glant ) 및 matr ix metal loproteinase 3(MMP-3)는 심장 질병의 마커이다. 로지글리타존 처리는 상기 마커들의 발현을 처리되지 않은 db/db 마우스에 비해 증가시켰다. ENOblock 처리는 처리되지 않은 db/db 마우스에 비해 Kcnkl의 발현을 감소시켰고, 로지글리타존 처리된 마우스에 비해 Asah2 , B4glant 및 MMP-3의 발현을 감소시켰다 (도 81 내지 도 84) . 실험예 8. T2DM 마우스의 신장 조직 섬유화 및 아픕토시스에 대한 ENOblock의 기능
T2DM 마우스에서 신장 조직 섬유화 및 아픕토시스에 대한 ENOblock의 기능을 확인하기 위해, 12 kg/mg의 ENOblock 또는 8 mg/kg의 로지글리타존을 db/db마우스에게 7주간 처리하였다. 그 결과를 도 85 내지 도 99에 나타내었다. 이때, 통계 분석 값은 도 85의 경우 평균 士 SD로, 도 87, 도 89 및 도 91 내지 도 96의 경우 士 SE로 나타내었다. 모든 통계 분석은 일원 분산 분석 (OTie—way ANOVA test )과 Dunnett ' s mul t iple compar i son test로 수행하였다 (ns : 크게 다르지 않음; *, ** 또는 *** : p <0.05, p <0.01 또는 p <0.001로 해당 대조군 (B6)과 유의하게 다름; #, ## 또는 ###: p <0.05, p <0.01 또는 p O .001로 각각 해당 db- 대조군과 유의하게 다름; 오차 = SEM) .
도 85 내지 도 99에 나타난 바와 같이, ENOblock 처리는 신장 중량에 유의하게 영향을 끼치지 않았다 (도 85) . Masson-tr i chrome 염색은 ENOblock이 신장 섬유화를 감소시킴을 나타내었다 (도 86 및 도 87) . 또한, ENOblock 처리는 아픕토시스를 감소시켰던 반면, 로지글리타존 처리는 아톱토시스를
증가시켰다 (도 88 및 도 89).
신장 세포에서 ENOblock 처리에 따른 아픕토시스 억제 효과는 아픕토시스 마커인 절단된 카스파제 -3 및 절단된 PARP의 웨스턴 블롯 분석을 통해 확인하였다 (도 90 내지 도 92). 유전자 angiotensin, Bax 및 p53를 T2DM 신장에서 아품토시스의 마커로서 사용하였다. 실시간 PCR 분석을 통해 ENOblock 처리는 처리되지 않은 마우스에 비해 상기 세 유전자의 발현을 감소시킴을 나타내었다 (도 93 내지 도 95).
신장은 글루코오스 신생 합성의 주요 장소이다. ENOblock은 글루코오스 신생 합성의 양성 조절과 연관된 Pck-1(세포질 형태)의 발현을 하향 조절하였다 (도 96). Collagen 4a3는 사구체 특이적이며, 과잉 수치는 사구체신염과 연관되어 있다. 반면, collagen 4al 및 collagen 4a2는 기저막에서 흔하게 발현된다. ENOblock 처리는 collagen 4a3의 발현을 감소시켰고 collagens 4al 및 4a2의 발현을 증가시켰다 (도 97 내지 도 99).
II. 비만마우스모델에서 ENOblock의 효과 확인 실시예 1. 시약 및 항체
Dexamethasone, forskol in, rapamycin, rosigl itazon는 Santa Cruz Biotechnology(CA, USA)에서 구입하였다. MetforminCl, 1-dimethylbiguanide hydrochloride) , 3-isobutyl-l-methylxanthine(IBMX) , sodium f luor ide(NaF) , oil red 0 및 a -smooth muscle act in (카탈로그 번호 A5228)에 대한 항체는 Sigma-Aldrich(MO, USA)에서 구입하였다. 또한, Tetramethylrhodamine, ethyl ester 및 perchlorate (TMRE)는 Thermo Fisher Scient if ic(MA, USA)에서 구입하였다.
실시예 2. 세포배양
3T3-L1 쥐의 전 지방 세포를 한국 세포주 은행 (서울대학교 병원, 한국)에서 수득하였다. 이후, 상기 세포를 10% 송아지 혈청 (calf serum), 50 units mL— 1 페니실린 및 50 ug mL— 1 스트렙토마이신 (PenStrep)이 첨가된 DMEM에서 배양하였다. 3T3-L1 세포를 하기와 같이 지방 세포로 분화시켰다: 48시간 post- confluent 세포 (0일로 명시)를 10% FBS, 0.5 mM IBMX, 2 jug/ml dexamethasone, 1 /g/ml의 인슬린 및 PenStrep을 함유하는 DMEM에서 2일 동안 배양하였다. 이후, 상기 세포를 10% FBS 및 1 g/ 의 인슐린이 첨가된 새로운 DMEM에서 배양하였다. 실시예 3. 일차지방전구세포의 분리
8주된 수컷 C57BL/6J 마우스는 Damool Science (한국)에서 구입하였다. 일차 지방전구세포를 분리하는 프로토콜은 하기와 같다. 마우스를 희생시키고, 전체 흰 생식소 조직 또는 견갑골 갈색 지방 조직을 절개하여 0.5% BSA를 함유하는 1 mL의 DPBS에서 균질화시켰다.
그 후, 조직을 37°C에서 30분 동안 배양하면서 3 mL의 소화 배지에서 0.8 U/mL collagenase와 2.7 U/mL의 dispase로 처리하였다. 최종 농도 10 mM의 EDTA와 소화 배지의 부피를 10 mL로 조정하였다. 그리고, 현탁액을 70 jm 필터를 통해 새로운 50 mL 튜브로 모았다. 4°C에서 500 g의 속도로 10분 동안 원심 분리하여 지질 부분을 제거하였다.
펠렛의 기질 혈관 부분 내 지방전구세포를 얼음 위에서 RBC 용해 완층액으로 5분 동안 처리하여 분리하였다. 용해를 MACs 완충액 (2% FBS 및 1 mM EDTA를 함유하는 PBS)으로 중단시켰다. 지방전구세포를 PBS 용액으로 한번 더 세척하고 계수하여 배양 접시에 접종하였다. 분화를 유도하기 위해, 지방전구세포를 지방세포화 인자인 0.5 mM IBMX, 2 ng/mL dexamethasone, 10 μΜ rosiglitazone 및 1 yg/mL 인슐린으로 처리하였다.
실시예 4. 세포와조직에서 RNA추출
RNA는 제조사의 지시에 따라 TRIzol 시약 (Thermo Fisher Scient i f ic , MA, USA)을 사용하여 추출하였다. RNA 추출 전, 조직을 액체 질소에서 얼렸고, 유리 막자사발에서 가루로 갈았다. 실시예 5. 정량적 RT-PCR
StepOnePlus Real Time PCR System(Ap l ied Biosystems , UK)을 사용하여 관심 있는 유전자의 전사체의 양을 측정하였다. AccuPower® RT PreMix (Bioneer Corporat ion)를 사용하여 전체 RNA를 cDNA로 역전사하였다.
cDNA는 제조자의 지침에 따라 실시간 PCR에 사용하였으며, 하기와 같은 변형이 있었다: PCR은 세 구간반복으로 최종 농도가 200 nM인 특정 프라이머 및 1 i L cDNA를 포함하는 총 부피 20 u L의 2X Power SYBR® Green PCR Master Mix (Appl ied Biosystems , UK)로 수행하였다. 흔합물은 변성, 어닐링 (anneal ing) 및 연장의 40 사이클로 구성된 PCR 증폭 전에 95°C에서 10분 동안 배양하였다. 변성은 95°C에서 15초 동안 수행하였고, 어닐링은 60°C에서 1분 동안 수행하였으며, 연장은 72°C에서 20초 동안 수행하였고 각각의 사이클은 72°C에서 형광으로 검출하였다.
최종 사이클 후, 샘플의 용융점 분석은 60 내지 95°C의 범위 내에서 연속 형광 검출과 함께 수행하였다. 특정 cDNA 샘플을 각 반웅에 포함하였고, 반응 간 비교를 위한 기준으로 사용하였다. 18S rRNA 또는 act in의 발현 수준은 다른 유전자의 발현 수준을 계산하는 동안 표준화에 사용하였다. 결과는 각 유전자의 상대적 발현 수준으로 나타났다.
본 발명의 실험예에서 사용된 프라이머는 표 1에 나타내었다. mRNA 발현의 상대적인 양을 측정하기 위해, 각 시료의 β - act in또는 18S rRNA (내부
대조군)의 CT 값에 대해 각 유전자의 Δ(:Τ 값을 계산하였다.
다음으로, ΔΔΓΓ 값을 계산하기 위해 약물 처리된 시료의 각 유전자의
ACT 값을 아무것도 처리하지 않은 HFD 시료 또는 SFD 시료에서 동일한유전자의 ACT 값으로 더 정규화하였고, 대조군과 비교하여 약물 처리된 샘플에서 각 유전자의 상대적인 발현을 나타내었다. 상대적 mRNA 발현 변화는 2"2ᅀᅀ CT 방법을 사용하여 계산하였다. 각 실험에서 최종 mRNA 발현은 세 가지 독립적인 실험의 평균값으로 계산하였다. 실시예 6. 웨스턴 블롯
1 ml의 cold homogenization buffer 용액 (20 niM Tris-Cl (pH 7.4), 0.32 M의 설탕용액 및 단백질분해효소 저해제를 포함하는 1 mM의 EGTA)과 Wheaton® Potter-Elvehjem Tissue Grinder(NJ, USA)를 사용하여 10 내지 30 mg 조직 샘플로부터 단백질을 수득하였다. 단백질은 Bradford assay를 사용하여 정량화하였다.
30 또는 40 의 단백질 샘플은 10% 폴리아크릴아마이드 겔에 로딩하였고, 전기영동 후 니트로샐를로오스 막으로 옮겼다. 1차 항체는 TBS-T + 5% 탈지분유에서 1:1000으로 희석하여 사용하였고, 막과 함께 4°C에서 밤새 보관하였다. HRP와 연결된 2차항체 (ant i -mouse IgG-HRP, sc2031, Santa Cruz Biotech, CA, USA)와 함께 실온에서 30분간 배양하여 1차 항체 탐지를 수행하였다. 이때, 상기 2차 항체는 1:10000으로 희석하여 사용하였다. ECL 용액 (RPN2232, GE Healthcare Life Science, UK)을 통해 발현 신호를 시각화하였다. 실시예 7. 미토콘드리아 막 전위 측정
살아있는 세포의 미토콘드리아 막 전위는 TRME 탐침을 사용하여
측정하였다. 세포들을 96 웰 플레이트에 시딩하였고 관심 있어 하는 화합물을 72시간 동안 처리하였다. 그 후, 세포들을 37°C에서 20분간 1 μΜ TMRE으로 처리하였다. 그리고, 세포들을 0.2%의 소 혈청 알부민 (BSA)가 포함된 PBS 용액으로 세척하였고, 형광 정도를 마이크로플레이트 리더 (λεχ=549 nm, λβπ1=575 nm; SpectraMax , Molecular Devices , CA, USA)로 측정하였다.
살아있는 세포의 이미징 ( imaging)을 위해, 세포들을 바닥이 깨끗한 검은색 폴리스타이렌 96-웰 마이크로플레이트 (Corning™, catalog no . 07-200- 565)에 5 x 103의 밀도로 시딩하였고, 관심 있어 하는 화합물을 72시간 동안 처리하였다. 그 후, 세포들을 37°C에서 20분간 200 nM TMRE으로 처리하였고, 0.2% BSA가 담긴 PBS로 세척하였다.
이후, Lionheart FX automated microscope(BioTek, VT, USA)를 통해 TMRE가 처리된 세포의 시각화와 정량화를 수행하였다. 549 nm(excitat ion) 및 575 nm(emi ssion) (Texas-Red f i l ter)의 파장에서 형광 정도를 측정하였다. 웰에서 세포 위치의 다양한 변화를 측정하기 위해, 형광 정도를 2x2 영역에서 스캔하였고, 결과는 평균을 측정하였다. 평균 obj ect ive intensi ty는 각 웰에 존재하는 세포수를 Gen5TM 3.0 software(BioTek, VT, USA)를 사용하여 측정 및 정상화하였다. 데이터는 9개의 측정 값 중 평균으로 나타내었다. 실시예 8. Oi l Red 0 staining
지방 축적 정도를 시각화하기 위해, 12웰 배양접시에 있는 분화중인 3T3- L1 지방세포를 Oi l Red 0 시료로 염색하였다. Oi l Red 0 staining은 세포를 1 ml 100% 이소프로판올 ( i sopropanol ) 5분 동안 실온에서 녹이고 살짝 흔들어줌으로써 정량화하였다. 96 웰 플레이트에 200 uL씩 소량 옮긴 후 λ= 492 nm(SpectraMax , Molecular Devices , CA, USA)의 파장에서 흡광도를 측정하였다.
실시예 9. HFD마우스의 준비
실험실 동물의 관리 및 사용에 관한 실험 동물 연구소 지침에 따라 동물연구를 수행하였다. 또한, 동물연구는 광주 과학 기술 연구소 동물 관리 및 사용 위원회 (승인 번호: GIST-2017-079)의 승인을 받았다. 고지방사료 (high fat diet , HFD)를 먹인 수컷 C57BL/6J 마우스는 일본의 Char les River에서 구입하였다. 마우스는 생후 4주부터 HFD를 먹였고 생후 14주에 공급되었다. 마우스를 받은 후, 마우스에게 HFD를 계속 먹였다.
동물시설에서 5일간 마우스는 안정화하였고, 한 cage당 3마리의 밀도로 12h/12h l ight cycle을 유지하였다. 미리 무게를 측정한 마우스에게 HFD를 자유롭게 먹였다. 케이지는 단식 실험을 하기 전 매주 청소하였다. 안정화한후, 약물 처라를 시작하였다.
첫 번째 실험에서, 마우스를 6마리의 세 그룹으로 나누고 8주간 약물을 하기와 같이 처리하였다: 그룹 1) 8 mg/kg 로지글리타존; 그룹 2) 12 mg/kg ENOblock; 그룹 3) 용매만 처리 ( 10% DMS0 를 포함한 sal ine) . 로지글리타존의 마이크로몰 투여량이 22.4 Mm 및 20.2 mM 각각의 ENOblock 보다 높은 것을 유의하였다.
약물은 10 ii L/g의 용액 부피로 24시간마다 복강 내 주사를 통해 투여하였다. 음식 섭취와 체중은 약물 투여 1주부터 매주 모니터링 하였다. 공복 혈당은 4주, 6주 및 8주에 측정하였다. 혈당은 OneTouch Ul tra(Li feScan, CA, USA)로 측정하였다. 인슐린 저항성 검사 ( ΠΤ) , 포도당 내성 검사 (GTT) 및 피루브산 저항성 검사 (PTT)는 Yale School of Medic ine(MMPC; ht tps : //www.隱 pc . org /)의 Mouse Metabol i c Phenotyping Center에서 제공받은 가이드라인에 따라 수행하였다. GTT, ΓΓΤ 및 PTT는 각각 약물처리 4주, 5주 및 7주에 수행하였다. 두 번째 실험에서, HFD 마우스를 하기와 같이 세 그룹으로 나누었다: 그룹 1) 120 mg/kg의 met formin을 투여한 마우스 8마리; 그룹 2) 12 mg/kg의
ENOblock을 투여한 마우스 7마리; 그룹 3) 용매 (10% DMS0를 포함한 sal ine)만 처리한 마우스 8마리 .
약물은 10 ii L/g의 용액 부피로 8주간 24시간마다 복강 내 주사를 통해 투여하였다. 음식 섭취와 체중은 약물 투여 1주부터 매주 모니터링 하였다. GTT, ITT 및 PTT는 각각 약물 처리 4주, 5주 및 7주에 수행하였다. 동물 실험의 경우, GTT, ITT 및 PTT를 수행 할 때 블라인드 테스트하였다. 약물처리가 끝날 때, 마우스는 diethyl ether 흡입을 통해 해부하였다.
혈액은 심장에서 수득하였고, 신장, 간, 뇌, 비장, 췌장, 골격근, 성선 지방조직, 갈색 지방 조직을 적출하였다. 혈액은 microfuge tube에 넣고 15분간 실온에서 두어 응고시켰다. 웅고된 부분은 원심분리 (1500 g의 속도로 4°C에서 10분간)하여 제거하였다. 상층액은 50 ii L로 나누고 -80°C에서 동결시켰다. 해부된 장기와 조직은 PBS로 2회 세척하고 -80°C에서 보관하였다. 실시예 10. 혈청 트리글리세리드 (triglyceride) 측정
혈액 샘플을 마우스로부터 수득하고 혈청 분리 류브 (BD Microtainer®
SSHM, NJ , USA)를 사용하여 원심 분리하였다. 혈청 샘플을 테스트하기 전에 - 80°C에서 보관하였다. 제조사의 지침에 따라 비색 트리글리세리드 정량 키트 (K622-100; BioVision, CA, USA)를 사용하여 트리글리세리드의 부피를 측정하였다. 트리글리 세리드 농도를 계산하여 mM로 표시하였다. 처리군 당 5 내지 6 마리의 동물에서 혈액 혈청 샘플을 두 번 사용하였다. 실시예 11. 혈청 HDL및 LDL콜레스테를측정
비색 분석법을 사용하여 고밀도 지질단백질 (HDL)과 저밀도 지질단백질 (LDL) 콜레스테를을 HDL 및 LDL/VLDL 정량 비색 /형광 측정 키트 (카탈로그 # K613, BioVision, Inc . , USA)로 측정하였다. 처리군 당 5마리의
동물에서 혈액 혈청 샘플을 두 번 사용하였다. 실시예 12. 혈청 인술린 정량
혈청 내의 인슐린 수준은 마우스 ELISA 키트 (Abnova, Taiwan)를 사용하여 측정하였다. ELISA를 위해 혈청을 10배 회석시켰다. 처리군 당 6마리의 동물에서 혈청 샘플을사용하였다. 실시예 13. 혈청 알라닌 아미노전이효소 (ALT) 활성의 측정
ALT 활성은 nmol /mon/mL mU/mL)로 표시하였고, 키트 (카탈로그 # K752 , BioVi sion, Inc . , USA)가 제공하는 방법에 따라 분석을 수행하였다. 처리군 당 6마리의 동물에서 혈액 혈청 샘플을 세 번씩 사용하였다. 실시예 14. 조직의 포매 (embedding) 및 절편
해부된 마우스의 조직을 PBS로 2회 세척하고 건조시킨 후, 저온 성형기에 넣고 OCKLei ca , Germany)로 덮어 포매시켰다. 그 후, 포매된 조직을 액체 질소를 사용하여 급속 넁동시키고 이소프로판올 슬러리로 옮겼다. CM 1850 저온 유지 장치 (Leica, Germany)를 사용하여 잘단할 때까지 넁동 조직을 -80°C에서 보관하였다. 파라핀 절편은 흰색과 갈색의 지방 조직을 10% 포름알데히드 용액으로 5시간 동안 포르말린 고정시킨 후 탈수 및 자일렌 세척 과정을 거쳐 파라핀 포매 (paraf f in embedment )를 수행하였다. 파라핀 포매된 블록을 3 μ ηι만큼 절단하였다. 섹션은 Η&Ε 또는 Masson Tri chrome 염색 전에 탈파라핀화하였다. 염색 키트 (Merck, Germany)를 사용하여 헤마톡실린 및 에오신 염색을 수행하였다.
처리군 당 5마리의 마우스를 사용하여 간 섬유화, 지질 축적, 지방증 및 간장 위성 수를 분석 하였다. 현미경 이미지는 x200 배율로 촬영하였다.
실시예 15. 간조직의 지질 축적 측정
간 지질 축적은 oil red 0 염색을 사용하여 시각화하였고 ImageJ 1.45s 소프트웨어 (NIH, USA)로 측정하였다. 간 조직을 8 urn 두께로 절단하고, 10분 동안 공기 건조시킨 후 10%포르말린 용액으로 고정시켰다. 슬라이드를 수듯물로 행구고, 6 이소프로판올로 세척하였다.
이후, 상기 슬라이드를 새로 준비된 oil red 0 염색 용액 (3 g/L)(Sigma- Aldrich, USA)으로 15분 동안 염색하고, 60% 이소프로판올로 행군 후 aqueous mount ant ( S i gma-A 1 dr i ch , USA)로 mount하였다. 5마리의 마우스 간 /처리군으로부터 무작위로 캡처된 5개의 현미경 이미지에서 무작위로 선택된 30개의 지질 드로플릿 (droplet)을 정량화 (배율: 200 배)를 위해 사용하 ¾다. . 실시예 16. 간지방증의 측정
H&E 염색법을 사용하여 지방증을 시각화하였다. 간 지방증을 정량화하기 위해 Image J 소프트웨어 1.48v 소프트웨어 (NIH, USA)와 함께 각 마우스 간의 10개의 다른 영역 (배율 200x)을사용하였다. 실시예 17. 조직 섬유화의 결정
조직 절편을 Masson Tri chrome Staining Kit (Sigma-Aldr ich, USA)로 염색 하였다. 섬유증 영역은 Image J 소프트웨어 (NIH, USA)로 청색 염색 부위를 검출함으로써 정량화하였다. 처리군 당 5개의 마우스 간 (cryo-sectioned) 또는 BAT(paraf fin-sectioned)로 준비된 섹션에서 무작위로 8 ~ 10 개의 캡처된 현미경 이미지를 정량 (배율: 200x)에 사용하였다. 실시예 18. 간성상세포의 검출
간 성상 세포는 α-SMA 염색으로 검출하였다. 성상 세포는 a-SMA 및 DAPI 이중 표지된 세포를 계수하여 정량화하였다. 각각의 처리군에서 5마리의 마우스 간으로부터 무작위로 캡처된 10개의 cryo-sect ion 현미경 이미지를 정량화 (배율: 200x)에 사용하였다. 실시예 19. 해마의 미토콘드리아 DNA정량
해마에 있는 미토콘드리아 DNA(mtDNA) 함량을 정량하였다. 페놀- 클로로포름-이소아밀 알코올을 사용하여 DNA를 정제하고, 18S 핵 (Mm03928990_gl) 또는 16S 미토콘드리아 (Mm04260181_sl) DNA(Appl ied Biosys terns , USA)를 위한 TaqMan 프라이머를 갖는 384-웰 플레이트의 각 웰에 2 ng을 로딩 하였다. 각 처리군의 6 마리의 마우스로부터 해마 mtDNA를 정량하였다. 실시예 20· 해마뉴런의 Nissl 염색
해마의 뉴런은 NovaUltra Nissl 염색 키트 ( IHC World, USA)를 사용하여 시각화하였다. 6마리의 SFD, 5마리의 HFD, 6마리의 rosigl itazone 처리된 HFD 및 5마리의 ENOblock 처리된 HFD 마우스에서 얻은 4개의 해마 섹션을 염색에 사용하였다. 실시예 21. 지방세포크기의 측정
지방 조직 절편을 H&E로 염색하고 지방 세포와 크기 분포를 Image J 소프트웨어를 사용하여 측정하였다. 처리군당 5마리의 마우스로부터 생식선 지방 조직을 염색하고 무작위로 선택된 100개의 지방 세포를 각 마우스로부터 측정하였다. 실시예 22. 유동세포분석을 위한지방조직 면역 세포의 분리
생식선 지방 조직을 희생시킨 마우스로부터 해부하였다. 무게를 측정하고 사진을 찍은 후, 지방 조직을 콜라게나제로 소화시켰다. 처리군 당 6마리의 생식선 조직을 면역 세포 분석에 사용하였다. 면역 세포를 함유하는 기질 혈관 분획 펠렛을 FACS 완층액 (칼슘 및 마그네슘 불포함 IX DPBS, 2 mM EDTA 및 1% FCS)에 현탁시키고 CD68(매크로시알린) 및 CD206 만노즈 수용체)에 대한 항체로 염색 하였다. 염색된 세포의 집단을 FACS CantolKBD Biosciences, USA) 및 Flowlogic 소프트웨어 (Miltenyi Biotech, 대한민국)로 분석하였다. ' 실험예 1. ENOblock의 비만증 치료 효과
비만증 치료제로서 ENOblock의 잠재성을 평가하기 위하여 , 지방 세포에서 지질생성 관련 유전자 발현을 분화의 여러 단계로 측정하였다. 본 실험에서는 하기 유전자를 평가하였다: 지질생성 조절 유전자, 아디포넥틴 지방 세포 단백질 2G4 ), 퍼옥시좀 증식 활성 수용체 감마 (/¾ r-j , 레시스틴 0¾to), 앤지오텐신 ( 훼), CCAAT/증폭체 결합 단백질 -a.(( b a) 및 CCAAT/증폭체 결합 단백질 -p Cfebpb).
β-3 아드레날린 작용제 길항근과 같은 비만증 치료 화합물의 수는 백색 지방 세포에서 산화적 인산화 또는 열발생을 조절하는 유전자의 발현을 향상시키는 기능을 나타내었다. 따라서, 산화적 인산화 마커 (핵 호흡 인자 l(Nrfl), 시토크롬 c 산화 효소 서브유닛 Vinb( ¾r< ) 및 카르니틴 팔미토일트란스퍼레이스 \ Cptlb)) 또는 열발생 (비결합 단백질 1-3 {Ucp-1, Ucp- 2, Ucp-3) , 퍼옥시좀 증식 활성 수용체 감마 보조 활성제 1-알파 (/ τ- α) 및 PR domain containing 16( ^^))에서 ENOblock의 효과를 평가하였다.
첫 번째 테스트로서, 쥐의 지방전구세포의 일차 배양물을 72시간 동안 10 μΜ의 ENOblock으로 처리하였다. 유전자 발현 패턴의 효과를 10 μΜ의 포스콜린 (forskolin 열발생 (1 μΜ 이상의 농도에서)을 유도하는 adenylyl
cyclase의 활성제) 또는 1 μΜ의 라파마이신 (rapamycin) (지방생성을 억제하는 mTOR 억제제)으로 처리된 지방전구세포와 비교하였다.
이를 도 102 내지 도 105에 나타내었다 (ns: 크게 다르지 않음; *, ** 또는 p <0.05, p <0.01 또는 p <0.0이로 해당 '대조군' 또는 '치료되지 않은 사람'과 크게 다름; ##또는 漏: 상웅하는 'ENOblock' 처리군과 크게 다름;
해당 'Forskolin' 처리군과 크게 다름).
도 102 내지 도 105에 나타난 바와 같이, ENOblock 처리 72시간 후, ENOblock 처리된 지방전구세포는 지방생성 조절 유전자, Adipoq, Ppar- γ , Cebpa 및 Cebpb^\ 발현에서 유의한 변화를 보이지 않았고, Ap2및 의 발현을 하향 조절함을 보였고, 12의 발현을 상향조절함을 보였다 (도 102 및 도 103).
ENOblock 처리는 산화적 인산화 조절 유전자, Cox8b 및 Cptlb^ 발현을 상향 조절하였고, Nrfl마커의 발현을 하향 조절하였다 (도 104). 또한, ENOblock 처리는 열발생 마커인 Ucp- 발현을 상향 조절한 반면, Prdnd6 발현을 하향 조절하였고, Ucp-3 및 Pgc-1 α는 발현에는 유의한 변화를 나타내지 않았다 (도 105). 실험예 2. ENOblock의 지방생성 유도 효과
ENOblock의 지방생성 유도 효과를 확인하기 위하여, 지방전구세포를 10 μΜ의 forskolin, 1 μΜ의 rapamycin 또는 10 μΜ의 ENOblock으로 72시간 동안 처리하였다. 이후, 지방세포화 인자를 5일 동안 관찰하였다. 이를 도 106 내지 도 109에 나타내었다 (ns: 크게 다르지 않음; *, ** 또는 ***: p <0.05, p <0.01 또는 p <0.0이로 해당 '대조군' 또는 '치료되지 않은 사람'과 크게 다름; ## 또는 麵: 상웅하는 'ENOblock' 처리군과 크게 다름; ^, xac 또는 ∞: 해당 'Forskolin' 처리군과 크게 다름 .).
도 106 내지 도 109에 나타난 바와 같이, ENOblock 처리된 세포는
지방생성 유전자인 Adipoq, Ap2, Ppar- γ , Retn, Agt , Cebpa 및 Cebp≠\ 하향 조절을 나타내었다. rapamyc in 처리는 Adipoq, Ap2, Ppar- γ 및 Retn^\ 하향 조절을 유도한 반면, Agt , Cebpa 및 Cebpb^\ 하향 조절을 유도하지 않았다 (도 107) . ENOblock은 산화적 인산화 마커 유전자인 Nrfl 및 Cox8l 상향 조절하였고, Cptlb 하향 조절하였다 (도 108) .
또한, ENOblock 처리는 열발생 마커인 Ucp-3^\ 발현을 증가시킨 반면, Ucp-1, Prdmie 또는 Pgc-l a ^\ 발현을 증가시키지 않았다. forskol in 처리는 Ucp-3및 마커의 발현을 증가시켰다 (도 109) . 한편 , qPCR을 사용을 통해 관찰한지방세포의 분화과정에서 [Jcp-2발^을 관찰할 수 없었다. 실험예 3. 지방세포에 대한 ENOblock의 효과
실험예 3.1. 백색 지방세포
지방 생성을 일으키는 지방 세포에 대한 ENOblock의 효과를 조사하기 위해, 마우스에서 직접 분리한 분화 중인 백색 지방 세포를 ΙΟ μ Μ의 forskol in, 1 μ Μ의 rapamycin , 10 μ Μ의 ENOblock 또는 1 mM의 NaF를 72시간 동안 처리하였다. 이후, 지방 생성 인자를 5일 동안 관찰하였다. ENOblock 처리에 따른 효과는 ENOblock과 달리 에놀라제 핵 전위를 유발하지 않는 또 다른 에놀라제 효소 억제제인 NaF와 비교하였다. 그 결과를 도 110 내지 113에 나타내었다.
도 110 내지 도 113에 나타난 바와 같이, 지방 세포 전구체를 이용하여 분화하는 과정에서, ENOblock 처리는 지방 생성 유전자인 Adipoq, Ap2, Ppar- γ , Retn, Agt , Cebpa 및 Cebpb^ 발현을 억제했다. NaF 처리는 Adipoq, Ap2, Retn 및 Cebpa^ 하향 조절하였지만, Ppar- y 및 Cebpb는 하향조절하지 않았다.
ENOblock과 마찬가지로, rapamycin의 처리는 지방 생성 관련 유전자 7종 모두의 발현을 낮추었다 (도 111) . ENOblock 처리는 산화적 인산화 마커인 Nrfl,
Cox8b 및 Q? b의 발현을 억제하고 열 생성관련 마커인 UcP- 발현을 증가 시켰으나 Ucp-2, UcP—3맣 Pgc-la은 발현을 증가하지 않았다. 또한, Forskolin의 처리는 UCP- 발현을 상향 조절하고 Nrfl, Cox8b및 Cptlb^\ 발현을 하향 조절 하였다. NaF의 처리는 Cox8b^\ 발현을 하향 조절하였으며, Nrfl, Cptlb 또는 Ucp- 발현에 유의한 영향을 미치지 않았다 (도 112 및 도 113). 실험예 3.2. 갈색 지방세포
지방 생성, 산화적 인산화 및 열 생성에 대한 ENOblock 처리의 효과를 갈색 지방 조직 (BAT)에서 분리된 갈색 지방전구세포를 이용한 초기 배양 및 분화 실험을 통해 확인하였다. 그 결과를 도 114 내지 117에 나타내었다.
도 114 내지 117에 나타난 바와 같이 , 지방 생성 유전자 Adipoq, Ap2, Ppar-γ , Retn, Agt 및 Cebpa는 ENOblock 처리에 의해 유의한 영향을 받지 않았다 (도 114 및 도 115). 산화적 인산화 마커인 Nrfl^ Cptlb는 ENOblock에 의해 하향 조절되었고 (도 116), 열 생성 마커인 Ucp-1, Ucp-2 발현은 유의성 있는 결과를 얻지 못하였다 (도 117). 실험예 4. ENOblock의 지방조직 열 생성 유도
실험예 4.1. ENOblock의 지방전구세포의 미토콘드리아막 전위 조절 항 비만제는 갈색 지방 조직 (BAT)과 백색 지방 조직 (WAT)의 열 생성을 유도 할 수 있으며, 이는 내부 미토콘드리아 막에서 양성자 누출로 검출될 수 있다. 3T3-L1 백색 지방전구세포와 갈색 지방전구세포에 10 μΜ의 ENOblock, 1 mM의 NaF, 1 μΜ의 rapamycin, 또는 10 μΜ의 forskolin을 처리하였다. 미토콘드리아 막 전위는 tetramethylrhodamine, ethyl ester(TMRE, mitochondrial membrane potential의 지시자)를 사용하여 측정하였다. 그 결과를 도 118 및 도 119, 및 도 122에 나타내었다.
도 118 및 도 119, 및 도 122에 나타난 바와 같이, ENOblock, rapamycin 및 forskol in 처리된 3T3-L1과 갈색 지방전구세포는 감소된 막 전위 효과를 보였다.
또한, 막 전위에 대한 ENOblock의 억제 효과를 자동 현미경 검사 (LionheratFX)를 사용하여 백색 지방 조직에서 분리된 백색 지방전구세포에서 확인하였다. 그 결과를 도 120 내지 도 121에 나타내었다. 도 120 내지 도 121에 나타난 바와 같이, rapamycin 처리된 백색 지방전구세포에서 막 전위가 감소하였다. NaF 처리는 막 전위를 감소시키지 않았다. 실험예 4.2. 지질 축적에 대한 ENOblock의 효과
ENOblock이 지방 생성을 억제하는지 확인하기 위해, 분화 배양 중인 3T3- L1 백색 지방전구세포를 10 μ Μ의 ENOblock, 10 μ Μ의 forskol in 또는 1 μ Μ의 rapamycin으로 72시간 동안 처리하고 Oi l Red 0로 염색하여 지질 축적을 시각화하였다.
그 결과를 도 123 및 도 124에 나타내었다 (ns : 유의미한 차이를 보이지 않음; *, ** 또는 *** : 해당하는 '대조군' 또는 'untreated' 그룹에 각각 p<0.05 , p<0.01 또는 pO .0()l의 유의미한 차이를 보임; ## 또는 ###: NaF 샘플과 각각 ρθ .01 또는 ρθ .001의 유의미한 차이를 보임; , X , ENOblock 샘플과 각각 ρ<0.05, ρ<0.01 또는 ρ<0.0()1의 유의미한 차이를 보임 . ) .
도 123 및 도 124에 나타난 바와 같이 , ENOblock 처리 시 분화하는 지방 세포에서 지질 축적의 감소가 확인되었다. 실험예 5. 비만에 대한 ENOblock의 효과
ENOblock의 화학 구조는 도 125에 나타내었다. 고지방식 (HFD)으로 유도된
비만 마우스 모델에서 ENOblock의 영향을 조사하기 위한 처리 프로토콜을 도 126에 나타내었다. ENOblock 또는 로지글리타존을 8주간 HFD 마우스 모델에 처리하였다.
그 결과를 도 127 및 도 132에 나타내었다 (SFD= 표준 사료를 먹인 쥐; HFD= 고지방사료를 먹인 쥐; HFD-EN0= ENOblock을 처리한 HFD 쥐; HFD-Rosi = 로지글리타존을 처리한 HFD 쥐; *, .** 또는 해당하는 'SFD-Normal ' 또는
'SFD-Control ' (SFD-약물을 처리하지 않은 건강한 쥐 그룹)에 각각 p<0.05, ρ<0.01 또는 ρθ .001의 유의미한 차이를 보임; ## 또는 漏: 'HFD-none' 또는 'HFD-Control ' (HFD-약물을 처리하지 않은 대조군 쥐 그룹)에 각각 p<0.01 또는 ρ<0 ·001의 유의미한 차이를 보임; , , x x x : 'HFD-Rosi ' 샘플에 각각 ρ<0.05 , ρθ .01 또는 ρθ .001의 유의미한 차이를 보임 . ) .
도 127 내지 도 132에 나타난 바와 같이, ENOblock을 처리한 마우스는 로지글리타존으로 처리한 마우스과 비교하였을 때 현저히 감소된 비만 유도 양상을 보였다. 또한, 약물 투여를 받지 않거나 로지글리타존을 처리한 HFD 마우스는 기름진 체모가 발견되었는데, 이것은 ENOblock을 처리한 HFD 마우스에서 발견되지 않았다 (도 127 및 도 128) .
ENOblock 또는 로지글리타존 처리 8주 동안, ENOblock이 처리된 HFD 마우스의 체증 증가는 약물을 처리하지 않은 HFD 마우스 및 로시글리타존이 처리된 HFD 마우스에 비해 감소되었다. ENOblock이 처리된 HFD 마우스 및 처리되지 않은 HFD 마우스 사이의 체중 감소는 3주 후에 통계적으로 그 유의성을 나타내었다.
7주간의 투여 후, ENOblock을 처리한 HFD 마우스의 체중은 표준 식이가 도입된 (SFD 그룹) 마우스와 유의한 차이가 없었다 (도 129) . 음식 섭취량을 측정한 결과, 처리군 간에 유의한 차이는 보이지 않았다 (도 130) . ENOblock 처리한 마우스 그룹은 처리하지 않거나 로지글리타존을 처리한 마우스 그룹에
비해 체온이 유의하게 상승되는 효과가 약물을 처리한 6주차에 나타났다.
약물 처리 6주차에 ENOblock으로 처리한 마우스의 체온은 SFD 마우스에 비해 유의하지 않았지만, 로시글리타존을 처리한 마우스의 체온은 SFD 마우스보다 유의성 있게 감소하였다 (도 131) . 약물 처리 3, 5 및 7주차에는' ENOblock 또는 로지글리타존을 처리한 마우스 그룹이 고지방식 (HFD)으로 유도된 마우스에 비해 공복 혈당치가유의하게 감소하였다 (도 132) . 실험예 6. 포도당, 인슐린 및 피루브산내성에 대한 ENOblock의 효과
ENOblock 처리 4주차에 마우스에게 포도당 내성 검사 (GTT)를 수행하였다. 그 결과를 도 133 및 도 134에 나타내었다. 또한, ENOblock 처리 5주차에 마우스에게 인슐린 내성 검사 ( ΠΤ)를 수행하였다. 그 결과를 도 135 및 도 136에 나타내었다. 또한, ENOblock 처리된 마우스에서 과인슐린혈증 (hyperinsul inemia) 및 인슐린 저항성을 평가하였다. 이를 도 137 및 도 138에 나타내었다.
또한, ENOblock 처리 7주차에 마우스에게 피루브산 내성 테스트 (PTT)를 수행하였다. 그 결과를 도 139 및 도 140에 나타내었다 (SFD= 표준 쥐를 먹인 마우스; HFO= 고지방 사료 급여 마우스; HFD-ENO EN0 차단된 HFD 마우스; HFD- Rosi= 로지글리타존 처리된 HFD 마우스; ns : 유의미한 차이를 보이지 않음; *, ** 또는 *** : 각각 p <0.05 , p <0.01 또는 p <0.05 인 경우 해당 SFD- 정상 또는 SFD- 대조군 (표준 지방식이 - 처리되지 않은 정상 건강 마우스 그룹) 0.001 ; ## 또는 ###: p <0.01 또는 p <0.001 인 해당 ' HFD-none ' 또는 ' HFD—Control ' (HFD- 비 처리 대조군 마우스 그룹) 샘플과는 유의미한 차이가 없음; , X X 또는 ∞ : p <0.05, p <0.01 또는 p <0.0이로 해당 ' HFD-Rosi ' 표본과 크게 다름.;) . 도 133 내지 도 140에 나타난 바와 같이, ENOblock 및 로지글리타존 처리된 마우스는 처리되지 않은 HFD 마우스보다 포도당 내성이 향상됨을 나타내었다 (도 133 및 도 134) . ENOblock 및 로지글리타존 처리된 마우스는
처리되지 않은 HFD 마우스와 비교했을 때 향상된 인슐린 내성을 나타낸 반면, SFD 마우스의 인술린 내성과는 크게 다르지 않았다 (도 135 및 도 136) .
ENOblock 및 로지글리타존 처리된 마우스는 처리되지 않은 HFD 마우스와 비교했을 때 과인슐린혈증이 감소하였고, 생체 항상성 모델 평가에서 인슐린 저항성이 (H0MA-IR) 감소하였다 (도 137 및 도 138) . 또한, ENOblock 또는 로지글리타존 처리된 HFD 마우스는 처리되지 않은 HFD 마우스보다 피루브산 챌린지 이후 향상된 혈당 반웅을 나타내었다. PTT 후 혈당 수치는 SFD 마우스와 ENOblock 또는 로지글리타존 처리된 HFD 마우스 사이에 통계적인 유의성을 보이지 않았다 (도 139 및 도 140) . 실험예 7. 간의 지방증 및 섬유증에 대한 ENOblock의 효과
실험예 7.1. ENOblock처리에 따른 간중량 평가
HFD 마우스의 대표적인 해부-간 조직 사진을 도 141에 나타내었다. HFD 또는 로지글리타존을 처리한 마우스 그룹을 SFD 또는 ENOblock을 처리한 HFD 마우스와 비교하였다. 그 결과를 도 141 및 도 142에 나타내었다.
도 141 및 도 142에 나타난 바와 같이, HFD 또는 로지글리타존을 처리한 마우스 그룹의 간 조직에서 눈에 띄게 열은 패치를 발견할 수 있었다. ENOblock을 처리한 HFD 마우스는 HFD 및 SFD 마우스와 비교하여 유의하게 더 작은 간 중량을 나타냈다. 실험예 7.2. ENOblock처리에 따른 간독성 평가
ENOblock 처리에 따른 잠재적인 간 독성을 평가하기 위해, ALT( serum alanine aminotransferase) 분석을 시행하였다. 그 결과를 도 143에 나타내었다. 도 143에 나타난 바와 같이, 어떤 약물도 투여 받지 않은 HFD와 로지글리타존으로 처리한 HFD 마우스는 SFD 마우스에 비해 유의하게 높은 혈청
ALT를 보였다. 또한, ENOblock을 처리한 마우스의 ALT 수준은 SFO 마우스와 비교하여 유의하게 상승하지 않았다. 실험예 7.3. ENOblock처리에 따른 간지질 축적 평가
간장 지질 축적을 평가하기 위해, Oil red 0 염색, H&E 염색, Masson의 Tri chrome 염색 및 알파-평활근 액틴 (α-SMA)에 대한 면역 염색을 시행하였다. 그 결과를 도 144 내지 도 153에 나타내었다 (스케일 바= 100 μπι; ns: 크게 다르지 않음; *, ** 또는 ***: SFD-정상 또는 SFD-대조군 (Standard Fat Diet을 처리하지 않은 정상 마우스 그룹)에 대해서 각각 p <0.05, p <0.01 또는 p <0.05; ## or 漏: p <0.01 또는 p O.001값으로 'HFD-free' 또는 'HFD-컨트를 ' (HFD- 처리하지 않은 대조군 마우스 그룹) 샘플들과 유의한 차이가 없음; , X 또는 M p <0.05, p <0.01 또는 p <0.0이값으로 'HFD-Rosi'표본과 유의하게 다름.)
도 144 내지 도 153에 나타난 바와 같이, HFD 마우스는 SFD 마우스와 비교하여 유의한 지질 축적을 나타내었으며, 이는 ENOblock 처리에 의해 억제되었다. 로지글리타존 처리는 지질 축적을 감소시키지 못했다 (도 144 및 도 145). H&E 염색은 HFD 마우스가 간 미세 지방증을 소견을 보여주었다. ENOblock 처리는 미세 지방증을 감소시키는 반면, 로시글리타존 처리에 의한 유의한 효과가 없었다 (도 146 및 도 147).
Masson-Tri chrome 염색은 HFD 마우스에서 간 섬유화의 유의한 발달을 보였다. 로지글리타존이 아닌 ENOblock 처리는 SFD 마우스에서 관찰된 수준으로 섬유화를 감소시켰다 (도 148 및 도 149). 식이로 인해 유발된 비만유래의 간 섬유화의 발달은 알파-평활근 액틴 (α-SMA)에 대한 면역 염색으로 검출할 수 있는 간성상 세포의 활성화와 관련이 있다.
HFD 마우스는 SFD 마우스에 비해 간 성상 세포의 증가를 보였다.
로지글리타존은 아니지만 ENOblock을 처리한 마우스는 SFD 마우스에서 관찰된 수준으로 성상 세포 수를 감소시켰다. HFD 마우스의 간에서 섬유화의 발달을 감소시키는 ENOblock의 효과는 qPCR 및 α -SMA 발현의 웨스턴 블롯 분석에 의해 확인되었다 (도 150 내지 도 153) . 실험예 8. 염증에 대한 ENOblock의 효과
HFD 유도된 간 지방증은 만성 염증 및 간경변을 진행시킬 수 있다. 마우스에게 ENOblock을 8주간 처리하여 간 염증 마커의 평가를 진행하였다. 그 결과를 도 154 및 도 155에 나타내었다. S100 칼슘 -결합 단백질 9i S100a9는 골수세포 기능을 조절하며, 이는 비알콜성 지방간염의 바이오마커이다. ENOblock을 처리한 마우스에서 상기 단백질의 발현을 평가하였다. 그 결과를 도 156에 나타내었다.
도 154 및 도 155에 나타난 바와 같이, HFD가 인터루킨 -6( / - ) 및 종양 괴사 인자 -알파 ( Π- α )의 발현을 증가시켰다. 또한, ENOblock 또는 로지글리타존의 처리는 SFD 마우스와 비교했을 때 IL-6 및 TNF- a ^] 발현을 감소시켰다. 또한, 도 156에 나타난 바와 같이, SFD 마우스보다 HFD 마우스에서 S100a9 발현이 증가하였다. 로지글리타존의 처리는 HFD 마우스에서 S100a9 발현을 증가시킨 반면, ENOblock처리는 아무런 효과를 보이지 않았다. 실험예 9. ENOblock의 간 지질 항상성 및 글루코오스 신생 합성 억제 인자의 유도
스테를 규정 성분 결합 단백질 ( 5ra¾9-l3 및 Srebp-l( )은 지질 합성의 중요한 조절 인자이다. 마우스에게 ENOblock을 처리하여 상기 단백질의 발현을 평가하였다. 그 결과를 도 157에 나타내었다. 또한, Insig-1 및 Insig-2 단백질은 골지에서 Srebp-la 및 Srebp-lc엑 성숙을 막고, 자가분비 운동성 인자
수용체, 아이소품 2(Amfr 또는 Gp-78)에 의해 교대로 조절된다. 마우스에 ENOblock을 처리하여 상기 단백질의 발현을 평가하였다. 그 결과를 도 158에 나타내었다.
또한, ENOblock 처리된 마우스에서 간 X 수용체 (LXR) 타겟 유전자의 발현을 관찰하였다. 그 결과를 도 159에 나타내었다. 비만에서 당뇨병 전증의 시작은 포스포에놀피루브산 카르복시키나아제 에 의해 조절되는 글루코오스 신생 합성의 불규칙과 관련이 있다. ENOblock 처리된 마우스에서 상기 Pck 단백질의 발현을 측정하였다. 그 결과를 도 160에 나타내었다.
또한, 지방 생성의 중요한 조절 인자 ( ¾ g, Ap2, Ppar- γ , Retn 및 Cebpa)^ 발현을 측정함으로써, ENOblock이 HFD 마우스에서 지방증을 억제함을 평가하였다. 그 결과를 도 161에 나타내었다 (SFD= 표준 쥐를 먹인 마우스; HFD= 고지방 사료 급여 마우스; HFD-ENO EN0 차단된 HFD 마우스; HFD-Ros i = 로지글리타존 처리된 HFD 마우스; ns : 크게 다르지 않음; *, ** 또는 각각 p <0.05 , p <0.01 또는 p <0.05 인 경우 해당 SFD- 정상 또는 SFD-대조군 (표준 지방샥이- 처리되지 않은 정상 건강 마우스 그룹) 0.001 ; ## 또는 ###: p <0.01 또는 p <0.0이인 해당 ' HFD-none ' 또는 ' HFD-Control ' (HFD- 비 처리 대조군 마우스 그룹) 샘플과는 유의미한 차이가 없음; , ac 또는 ·Μ . ρ <0.05, ρ <0.01 또는 p O .001로 해당 ' HFD— Rosi ' 표본과 크게 다르지 않음 . ) .
도 157 내지 도 161에 나타난 바와 같이, Srebp-la 및 Srebp-lc톼 발현은 SFD 마우스보다 HFD 마우스의 간에서 상향 조절되었다. ENOblock 처리는 Srebp- la 및 Srebp-lc 발현을 억제하였다. 그리고, 로지글리타존 처리는 Srebp-la 및 Srebp-lc엑 발현을 억제하였다 (도 157) . 또한, ENOblock 처리는 Amfr 및 Insig- 의 발현에 큰 영향을 끼치지 않은 반면, Insig-2엑 발현을 억제하였다 (도 158) . 뿐만 아니라, 간 X수용체 (LXR) 타겟 유전자인 Scap및 Abcg5는 ENOblock 처리에 의해 각각 영향을 받지 않았거나 억제되었다 (도 159) .
HFD 마우스는 SFD 마우스보다 증가된 Pck-1 및 Pck-2^\ 발현을 나타내었다. ENOblock 또는 로지글리타존 처리는 HFD 마우스에서 Pck-1 및 Pck- 의 발현을 감소시켰다 (도 160) . 또한, HPD 마우스는 SFD 마우스보다모든 5개의 지방 생성 유전자의 발현이 상향 조절되었다. ENOblock 처리는 SFD 마우스에서 관찰된 수준으로 모든 5개의 지방 생성 유전자의 발현을 감소시켰다. HFD 마우스에서 로지글리타존 처리는 Ppar- γ , Retn및 Cebpa^ 발현을 감소시켰으나, Adipoq및 의 발현을 유의하게 감소시키지 않았다 (도 161) . 실험예 10. 해마 염증에 대한 ENOblock의 효과
실험예 10.1. ENOblock처리에 따른 해마 염증마커의 발현 평가
비만은 해마의 HFD 유발성 염증 반웅으로 인한 것으로 생각되는 해마 기능 장애 및 기억 장애와 관련이 있다고 알려져 있다. HFD 마우스와 SFD 마우스를 비교하여 해마 염증 마커인 를 유사 수용체 (Tl r4) , IL-6 , TNF- α 및 CDllc의 발현을 확인하였다. 그 결과를 도 162에 나타내었다.
도 162에 나타난 바와 같이 , HPD 마우스는 SFD 마우스와 비교하여 해마 염증 마커인 를 유사 수용체 ( 77r4) , IL-6, TNF- a 및 CD11( 발현이 증가한 것을 나타내었다. ENOblock 처리는 SFD 마우스 ( Π- α 및 Cdllc^ 경우) 또는 SFD 마우스 ( 77/ 및 의 경우)에서 관찰된 수준으로 HFD 마우스에서 이들 염증 마커들의 발현을 감소시켰다.
또한, 로지글리타존 처리는 해마의 염증성 마커들의 발현을 감소시켰다. 신경 pentraxin-2(^i )는 시냅스 소성을 조절하고 비 apoptot i c 신경 세포 death49의 친염증성 바이오 마커이다. Nptx2 발현은 SFD 마우스에 비해 HFD 마우스에서 상향 조절되었다. ENOblock의 처리는 SFD 마우스에서 관찰된 수준으로 HFD 마우스에서 Nptx2발현을 감소시켰다. 또한, 로지글리타존도 HFD 마우스에서 발현을 감소시켰다.
실험예 10.2. ENOblock 처리에 따른 미토콘드리아 관련 단백질의 발현 평가
HFD는 다양한 세포 유형에서 미토콘드리아 질량을 감소시켜 뇌의 에너지 및 기반 시설에서 변화를 일으킬 수 있다고 알려져 있다. 본 실험에서는 ENOblock 처리에 따른 미토콘드리아 관련 단백질의 발현을 확인하였다.
그 결과를 도 163 내지 도 165에 나타내었다 (스케일 바= 100 ii m ; SFD= 표준 사료 먹인 마우스; HFD= 고지방 사료먹인 마우스; HFD-EN0= ENOblock 처리한 HFD 마우스; HFD-Ros i= 로지글리타존 처리한 HFD 마우스; ns : 크게 다르지 않음; *, ** 또는 *** : 각각 p <0.05, p <0.01 또는 p 0.01값으로 SFD- 정상 또는 SFD- 대조군 (표준 지방식이 처리되지 않은 정상 마우스 그룹)과 유의미한 차이가 있음; ## 또는 漏: p <0.01 또는 p O .001값으로, ' HFD-none ' 또는 ' HFD— Control ' (HFD- 비 처리 대조군 마우스 그룹) 샘플과는 유의미한 차이가 없음; , 또는 : p <0.05, p <0.01 또는 p <0.001값으로
' HFD-Ros i ' 샘플과 유의미한 차이가 있음ᅳ) .
도 163 내지 도 165에 나타난 바와 같이, 미토콘드리아의 전사 인자 k Tfam)는 mi tochondr i al genome copy number의 조절과 양의 상관관계를 가진다. Tfam^\ 발현은 SFD 마우스에 비해 HFD 마우스의 해마에서 감소되었다. ENOblock의 처리는 SFD 마우스에서 관찰된 수준으로 Tfam 발현을 증가시켰다. 또한 로지글리타존 투여는 HFD 마우스에서 Tfam발현을 증가시켰다.
전사 인자 cAMP 반응 요소 결합 단백질 ( Creb)은 신경 세포의 에너자 상태의 변화에 민감하다. Creb 발현은 SFD 마우스에 비해 HFD 마우스에서 증가했다. 로지글리타존이 아닌 ENOblock은 HFD 마우스에서 Creb 발현올 감소시켰다. Nrf-1 및 Nrf-2는 신경 돌기 성장 및 미토콘드리아 생합성을 조절한다. Nrf-1 발현은 HFD 마우스에서 감소하였고 ENOb lock 투여는 Nrf-1
발현을 유의하게 증가시켰다. 대조적으로, Nrf-2 발현은 HFD 마우스에서 증가하고 ENOblock 처리에 의해 감소되었다. 로지글리타존 처리는 Nrf-1 발현에 영향을 미치지 않았으나, ENOblock 투여와 유사하게 Nrf2^\ 발현을 감소시켰다 (도 163) .
hi pocarapal bioenerget i cs에 대한 HFD의 부정적인 효과는 mtDNA 함량의 감소로 나타났다. ENOblock의 처리는 mtDNA 함량의 감소를 막았다. 또한, 로지글리타존 처리는 HFD 마우스에 비해 mtDNA 함량을 향상시켰지만, ENOblock 처리보다유의성이 적었다 (^0.05, θ .01) (도 164) . 해마 뉴런의 Ni ss l 염색은 SFD, HFD 또는 ENOblock 처리된 HFD 마우스에서 신경 생존에 조직학적 차이를 나타내지 않았다. 이는 로지글리타존이 해마에서 독성을 일으킬 수 있다고 알려진 최초의 보고이다 (도 165) . 상기 결과는 ENOblock의 투여가 식이요법으로 인한 비만으로 발생하는 해마 손상의 발병을 해결할 수 있는 가능성을 보여준다. 실험예 11. 혈청 지질에 대한 ENOblock의 효과
HFD 마우스에 ENOblock 또는 로지글리타존을 8주간 처리 후, 트리글리세라이드, HDL 및 LDL 콜레스테롤의 혈청 수치를 측정하여 지질의 혈청 농도를 평가하였다. 그 결과를 도 166 내지 도 168에 나타내었다.
도 166 내지 도 168에 나타난 바와 같이, HFO 마우스는 트리글리세리드, HDL 콜레스테를 및 LDL 콜레스테를의 혈청 농도가 증가됨올 보였다. 로지글리타존이 처리된 HFD 마우스에서 혈청 트리글리세리드 수치가 증가하였고, HDL 콜레스테를 수치가 감소하였으며, LDL 콜레스테를 수치는 유의한 변화가 없었다. ENOblock 처리된 HFD 마우스는 처리되지 않은 HFD 마우스보다 혈청 트리글리세리드 및 LDL 콜레스테를 수치가 감소하였다. ENOblock 처리된 HFD 마우스에서 혈청 LDL 콜레스테를 수치는 SFD 마우스와 동일한 범위에 도달하였다.
실험예 12. 지방과다증에 대한 ENOblock의 효과
실험예 12.1. 생식선의 백색 지방조직
생식선의 백색 지방 조직을 대표하는 사진을 도 169에 나타내었다. ENOblock을 처리한 HFD 마우스에서 생식선의 백색 지방 조직 무게와 조직에서 지방 세포의 크기, 지질생성 유도 및 염증마커의 발현을 측정하였다. 그 결과를 도 170 내지 도 174에 나타내었다.
도 170 내지 도 174에 나타난 바와 같이, HFD 마우스에서 ENOblock 처리는 생식선의 조직 무게를 감소시킨 반면, 로지글리타존 처리는 유의한 효과를 나타내지 않았다 (도 170) . 또한, ENOblock 처리에 의해, HFO 마우스의 생식선의 백색 지방 조직에서 지방 세포 크기의 증가가 억제되었다. 이는 지방 세포 크기를 감소시키는 로지글리타존보다 더 효과적이었다 (도 1기 및 도 172) . . 갈색 지방 조직에서 열발생 조절인자와 비만은 백색 지방 조직에서 지질생성을 유도하는 것을 보였다. H&E 염색은 ENOblock 처리된 HFD 마우스의 생식선의 백색 지방 조직에서 지방세포의 침투를 나타내었다 (도 173) . 또한, ENOblock 및 로지글리타존 처리는 생식선의 백색 지방 조직에서 염증 마커인 TNF- a 및 Cdllc^ 발현을 하향 조절한 반면, Mcp-l^ 발현을 하향 조절하지 않았다. 지질생성의 마스터 중재자인 ^ar- y의 발현은 생식선의 백색 지방 조직에서 ENOblock 처리에 의해 하향 조절되었다. 로지글리타존 처리는 ENOblock 보다 HFD 생식선의 백색 지방 조직에서 Ppar—y ^ 발현을 덜 억제하였다 (도 174) . 실험예 12.2. 견갑골사이의 갈색 지방조직
견갑골 사이의 갈색 지방 조직을 대표하는 사진을 도 175에 나타내었다. ENOblock을 처리한 HFD 마우스에서 견갑골 사이 갈색 지방 조직의 무게, 지방 세포의 크기, 염증 마커의 발현 및 섬유증 정도를 측정하였다.
그 결과를 도 176 내지 도 181에 나타내었다 (SFD= 표준 사료를 먹인
마우스; HFD= 고지방 사료 급여 마우스; HFD-EN0= ENOblock 처리한 HFD 마우스; HFD-Rosi= 로지글리타존 처리한 HFD 마우스; 스케일바= 100 μιη; ns: 크게 다르지 않음; *, ** 또는 ***: 각각 p <0.05, p <0.01 또는 p O.001의 값으로 SFD- 정상 또는 SFD- 대조군 (표준 지방 다이어트- 약물 처리하지 않은 정상 마우스 그룹)과 유의하게 다름; ## 또는 醒: p <0.01 또는 p O.001 값으로 'HFD-none' 또는 'HFD—Control' (HFD- 비 처리 대조군 마우스 그룹) 샘플과는 유의미한 차이가 없음; , X 또는 m '. p <0.05, p <0.01 또는 p O.001의 값으로 'HFD-Rosi' 표본과 크게 다름.) .
도 176 내지 도 181에 나타난 바와 같이, ENOblock 또는 로지글리타존을 처리한 HFD 마우스는 HFD 또는 SFD 마우스와 비교했을 때 견갑골 사이의 갈색 지방 조직 무게를 증가시켰다. 갈색 지방 조직 무게에서 ENOblock의 효과는 로지글리타존 처리된 마우스보다 크다 (도 176). 견갑골 사이 갈색 지방 조직의 H&E 염색은 HFD, 로지글리타존 처리된 HFD 및 SFD 마우스와 비교할 때 ENOblock 처리된 HFD 마우스에서 감소된 지방 세포 크기를 보였다 (도 177).
염증 마커인 TNF-a , Cdllc 및 Mcp-1, 그리고 지질생성의 마스터 조절 인자인 Ppar-Y는 모두 ENOblock 또는 로지글리타존 처리 이후 HFD 갈색 지방 조직에서 하향 조절되었다 (도 178). Masson-Tri chrome 염색은 ENOblock 또는 로지글리타존 처리가 HFD 갈색 지방 조직에서 섬유증의 진행을 억제함을 나타내었다 (도 180 및 도 181). 실험예 13. 당뇨병 전증의 증상에 대한 ENOblock의 효과
비만은 당뇨병 전증 /인슐린 저항의 진행과 연관이 있으며, 이는 식이 유도된 비만 마우스 모델에서 발생한다. 비만에서 당뇨병 전증을 예방하기 위한
ENOblock의 잠재적인 효과를 평가하기 위하여, HFD 마우스를 ENOblock 또는 metformin(GlucophageTM)으로 처리하였고, 이는 비만 환자의 당뇨병에 대한 가장
중요한 치료법이다.
HFD 마우스에서 ENOblock 또는 metformin의 처리 일정은 도 182에 나타내었다. 상기 결과를 도 183 내지 도 191에 나타내었다 (SFD= 표준 쥐를 먹인 마우스; HFD= 고지방 사료 급여 마우스; HFD-EN0= EN0 차단된 HFD 마우스; HFD- Met f= met formin 처리된 HFD 마우스; ns : 유의성 있는 차이가 없음; * , ** 또는 *** : 각각 p <0.05, p <0.01 또는 p <0.05인 경우 해당 SFD- 정상 또는 SFD- 대조군 (표준 지방식이- 처리되지 않은 정상 건강 마우스 그룹) 0.001; ## 또는 ###: p <0.01 또는 p <0.0이인 해당 'HFD-none ' 또는 'HFD-Control ' (HFD- 처리되지 않은 대조군 마우스 그룹) 샘플과는 유의미한 차이가 없었음; ^, 또는 p 0.05, p <0.01 또는 p O.001인 각각의 해당 'HFD-Metf ' 표본과 유의미한 차이가 있음 . ) .
도 183 내지 도 191에 나타난 바와 같이, 8주 뒤, met formin 또는 ENOblock 처리된 HFD.마우스는 감소된 양의 내장 지방을 나타냈다 (도 183) . 약물 처리 과정 동안, ENOblock 및 met form in은 모두 체증을 감소시켰다. 7주 후, ENOblock 처리된 마우스는 metformin 처리된 마우스보다 상당히 가벼워졌다 (도 184) . 공복혈당은 metformin 및 ENOblock 처리된 HFD 마우스 모두에서 감소하였다.
또한, 약물 처리 6주차에 met formin 처리된 마우스보다 ENOblock 처리된 마우스가 더 낮은 혈당수치를 나타냈다 (도 185) . 혈당 내성 테스트 (약물 처리 4주차) , 인슐린 내성 테스트 (약물 처리 5주차) 및 피루브산 내성 테스트 (약물 처리 7주차)는 ENOblock 및 metformin이 인슐린 저항 /감수성 및 글루코오스 신생 합성 수치에서 비슷하게 향상함을 나타내었다. SFD 마우스는 모든 범위 안에 포함되었다 (도 186 내지 도 191) . 실험예 14. 고인술린혈증 (hyperinsulinemia)에 대한 ENOblock의 효과
HFD 마우스에게 ENOblock 및 met formin을 8주간 처리하여 고인술린혈증에 대한 ENOblock의 효과를 확인하였다. 그 결과를 도 192 내지 도 197에 나타내었다 (ns : 크게 다르지 않음; *, ** 또는 *** : 'SFD-Normal ' 또는 'SFD- Control ' (Standard Fat Diet-none)과 유의한 차이가 없음; p <0.05, p <0.01 또는 p <0.001; ## 또는 漏: 각각 해당 HFD-none 또는 HFD—ControKHFD-none- treated p <0.01 또는 p O . OOl인 대조군 마우스 그룹) 샘플; p 0.05, p <0.01 또는 p <0.001 인 각각의 'HFD-Met f ' 샘플과 유의성 있는 차이가 있음.;) .
도 192 내지 도 197에 나타난 바와 같이, HFD 마우스는 고인슐린혈증과 증가된 H0MA-IR을 나타내었고, 이는 ENOblock 또는 met formin 처리에 의해 감소되었다. 약물 처리 8주 후, ENOblock 처리는 met formin 보다 고인슐린혈증 및 H0MA-IR을 상당히 감소시켰다 (도 192 및 도 193) . 해부된 생식선의 백색 지방 조직 사진을 도 194에 나타내었다. ENOblock 및 met formin 처리는 생식선의 갈색 지방 조직 무게를 감소시켰고, ENOblock이 met form in보다 더 큰 효과를 나타내었다 (도 195) . 비만은 지방 조직 염증과 관련이 있으며, 이는 항 염증 'M2' 형 대식세포의 감소된 수에 의해 특징지어진다. 백색 지방 조직으로부터 유래된 염증 세포 내에 판 대식세포 마커 CD68(macrosial in) 및 M2 대식세포 마커 CD206(mannose receptor)의 발현에 대한 유동세포분석은 SFD 마우스보다 HFD 마우스에서 M2 대식세포 수의 감소를 확인하였다. ENOblock 처리는 HFD 마우스의 지방 조직에서 M2 대식세포의 비율을 증가시켰다. met formin 처리는 HFD 마우스에서 가변적인 반응을 일으켰다. 전반적으로, M2 대식세포의 비율은 처리되지 않은 HFD 마우스보다 유의성 있는 변화가 없었다 (도 196 및 도 197) .
Claims
【청구항 1】
ENOblock을 유효성분으로 포함하는 비만 예방또는 치료용 약학조성물.
【청구항 2]
거 U항에 있어서,
상기 ENOblock은 하기 화학식 1로 표시되는 것을 특징으로 하는, 조성물: <화학식 1>
상기 화학식에서, R1은 H이고; R2는 H, -(CH2)q-(C0NH)-Cl-5 직쇄 또는 가지쇄의 알킬 (상기 q는 1-5의 정수이다), -(CH2)q-(C0NH)-Cl-5 직쇄 또는 가지쇄의 알킬알코올 (상기 q는 1-5의 정수이다), -(CH2)q-(C0NH)-[ (CH2)m-0]n- (CH2)p-NH2(상기 n, p 및 q는 각각 0-5의 정수이고, 상기 m은 1-5의 정수이다) 또는 _(CH2)ci-(C0NH)-[ (CH2)m-0]n-(CH2)p-CH3(상기 m, n 및 q는 각각 1-5의 정수이고, 상기 p는 0-5의 정수이다)이다.
【청구항 3]
거 11항에 있어서,
【청구항 4]
ENOblock을 유효성분으로 포함하는 섬유증 예방 또는 치료용 약학 조성물.
【청구항 5]
제 4항에 있어서,
상기 섬유증은 갼 섬유증, 신장 섬유증, 심근 섬유증 및 심장 섬유증으로 구성된 군으로부터 선택되는 어느 하나인 것을 특징으로 하는, 조성물.
【청구항 6】
ENOblock을 유효성분으로 포함하는 지방간 예방 또는 치료용 약학 조성물.
【청구항 7】
ENOblock을 유효성분으로 포함하는 당뇨 합병증 예방 또는 치료용 약학 조성물.
【청구항 8】
제 7항에 있어서,
상기 당뇨 합병증은 당뇨성 신장병, 당뇨성 간 장애, 당뇨성 심장질환, 당뇨성 뇌병증, 당뇨성 혈관합병증, 및 당뇨성 신경병증으로 구성된 군으로부터
선택되는 적어도 어느 하나인 것을 특징으로 하는, 조성물.
【청구항 9】
ENOblock을 유효성분으로 포함하는 고지혈증 예방 또는 치료용 약학 조성물. 【청구항 10]
ENOblock을 유효성분으로 포함하는 퇴행성 뇌질환 예방 또는 치료용 약학 조성물. 【청구항 11】
ENOblock을 개체에 투여하는 단계를 포함하는 비만, 섬유증, 지방간, 당뇨 합병증, 고지혈증 및 퇴행성 뇌질환으로 구성되는 군으로부터 선택되는 어느 하나의 질환을 예방 또는 치료하는 방법 .
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR20170017032 | 2017-02-07 | ||
| KR10-2017-0017032 | 2017-02-07 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2018147642A1 true WO2018147642A1 (ko) | 2018-08-16 |
Family
ID=63107720
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/KR2018/001662 Ceased WO2018147642A1 (ko) | 2017-02-07 | 2018-02-07 | Enoblock을 유효성분으로 포함하는 비만 예방 또는 치료용 약학 조성물 |
Country Status (2)
| Country | Link |
|---|---|
| KR (1) | KR102059649B1 (ko) |
| WO (1) | WO2018147642A1 (ko) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2025096754A1 (en) * | 2023-10-31 | 2025-05-08 | Musc Foundation For Research Development | The use of enolase inhibitor pomhex for treatment of fibrosis |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20120011664A (ko) * | 2010-07-29 | 2012-02-08 | 광주과학기술원 | 트리아진계 화합물을 유효성분으로 포함하는 당뇨병 예방 또는 치료용 약제학적 조성물 |
| KR20120011667A (ko) * | 2010-07-29 | 2012-02-08 | 광주과학기술원 | 당뇨병 치료제의 스크리닝 방법 |
| US20130217749A1 (en) * | 2010-06-10 | 2013-08-22 | Yale University | Modulation of phosphoenolpyruvate carboxykinase-mitchondrial (pepck-m) expression |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR101472083B1 (ko) * | 2012-10-22 | 2014-12-16 | 광주과학기술원 | ENOblock을 유효성분으로 포함하는 암 예방 또는 치료용 약제학적 조성물 |
-
2018
- 2018-02-07 KR KR1020180015101A patent/KR102059649B1/ko active Active
- 2018-02-07 WO PCT/KR2018/001662 patent/WO2018147642A1/ko not_active Ceased
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20130217749A1 (en) * | 2010-06-10 | 2013-08-22 | Yale University | Modulation of phosphoenolpyruvate carboxykinase-mitchondrial (pepck-m) expression |
| KR20120011664A (ko) * | 2010-07-29 | 2012-02-08 | 광주과학기술원 | 트리아진계 화합물을 유효성분으로 포함하는 당뇨병 예방 또는 치료용 약제학적 조성물 |
| KR20120011667A (ko) * | 2010-07-29 | 2012-02-08 | 광주과학기술원 | 당뇨병 치료제의 스크리닝 방법 |
Non-Patent Citations (2)
| Title |
|---|
| JUNG, D.-W.: "A Unique Small Molecule ''Inhibitor of Enolase Clarifies Its Role in Fundament al Biological Processes", ACS CHEMICAL BIOLOGY, vol. 8, no. 6, 2 April 2013 (2013-04-02), pages 1271 - 1282, XP055203703 * |
| JUNG, D.-W.: "Novel use of fluorescent glucose analogues to identify a new class of triazine-based insulin mimetics possessing useful secondary effects", MOLECULAR BIOSYSTEMS, 2011, pages 346 - 358, XP055193380 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2025096754A1 (en) * | 2023-10-31 | 2025-05-08 | Musc Foundation For Research Development | The use of enolase inhibitor pomhex for treatment of fibrosis |
Also Published As
| Publication number | Publication date |
|---|---|
| KR102059649B1 (ko) | 2019-12-27 |
| KR20180091771A (ko) | 2018-08-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Huang et al. | Berberine improves cognitive impairment by promoting autophagic clearance and inhibiting production of β-amyloid in APP/tau/PS1 mouse model of Alzheimer's disease | |
| Lee et al. | Berberine, a natural plant product, activates AMP-activated protein kinase with beneficial metabolic effects in diabetic and insulin-resistant states | |
| JP5358583B2 (ja) | 強心配糖体を用いた癌の化学療法における治療応答の確率を求める方法 | |
| Li et al. | Intrarenal renin-angiotensin system mediates fatty acid-induced ER stress in the kidney | |
| Cho et al. | ENOblock, a unique small molecule inhibitor of the non-glycolytic functions of enolase, alleviates the symptoms of type 2 diabetes | |
| Shi et al. | Sinomenine enhances microglia M2 polarization and attenuates inflammatory injury in intracerebral hemorrhage | |
| Zheng et al. | β-sitosterol alleviates neuropathic pain by affect microglia polarization through inhibiting TLR4/NF-κB signaling pathway | |
| WO2012027548A1 (en) | Compounds and methods for prevention and treatment of alzheimer's and other diseases | |
| EP3060204B1 (en) | Beta-catenin | |
| Fang et al. | Sipeimine ameliorates osteoarthritis progression by suppression of NLRP3 inflammasome-mediated pyroptosis through inhibition of PI3K/AKT/NF-κB pathway: an in vitro and in vivo study | |
| KR101665846B1 (ko) | Gpr119 리간드를 유효성분으로 포함하는 비알콜성 지방간 질환의 예방 또는 치료용 약학적 조성물 | |
| US20250082654A1 (en) | Azd3355 (lesogaberan) for treatment and prevention of nonalcoholic steatohepatitis (nash), liver fibrosis, and other liver conditions | |
| KR20160107610A (ko) | 대사 질환의 예방 또는 치료용 조성물 | |
| KR20160108258A (ko) | 대사 질환의 예방 또는 치료용 조성물 | |
| KR101915016B1 (ko) | 자가포식 향상물질 및 그 용도 | |
| JP2022527329A (ja) | 神経疾患を処置するために有用なレトロマー安定化剤としてのアミノグアニジンヒドラゾン | |
| Yoon et al. | Protective role of oryeongsan against renal inflammation and glomerulosclerosis in db/db mice | |
| Choi et al. | Green tea extract exhibits antidiabetic effects partly through regulating dipeptidyl peptidase-4 expression in adipose tissue | |
| Cho et al. | ENOblock inhibits the pathology of diet-induced obesity | |
| CN116854688A (zh) | Hdac6抑制剂及其制备方法和在抗肿瘤与肺纤维化中的用途 | |
| KR102059649B1 (ko) | ENOblock을 유효성분으로 포함하는 비만 예방 또는 치료용 약학 조성물 | |
| Krautbauer et al. | Adipocyte hypertrophy and improved postprandial lipid response in beta 2 syntrophin deficient mice | |
| Khan et al. | A new indanedione derivative alleviates symptoms of diabetes by modulating RAGE-NF-kappaB pathway in db/db mice | |
| Sui et al. | Renin-angiotensin system activation in renal adipogenesis | |
| KR101889097B1 (ko) | 대사 질환의 예방 또는 치료용 조성물 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 18751451 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 32PN | Ep: public notification in the ep bulletin as address of the adressee cannot be established |
Free format text: NOTING OF LOSS OF RIGHTS PURSUANT TO RULE 112(1) EPC (EPO FORM 1205N DATED 17.10.2019) |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 18751451 Country of ref document: EP Kind code of ref document: A1 |




