WO2018140573A1 - B-cell engineering - Google Patents
B-cell engineering Download PDFInfo
- Publication number
- WO2018140573A1 WO2018140573A1 PCT/US2018/015180 US2018015180W WO2018140573A1 WO 2018140573 A1 WO2018140573 A1 WO 2018140573A1 US 2018015180 W US2018015180 W US 2018015180W WO 2018140573 A1 WO2018140573 A1 WO 2018140573A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- cell
- cells
- protein
- transgene
- genetically modified
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/10—Cells modified by introduction of foreign genetic material
- C12N5/12—Fused cells, e.g. hybridomas
- C12N5/16—Animal cells
- C12N5/163—Animal cells one of the fusion partners being a B or a T lymphocyte
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
- A61K35/14—Blood; Artificial blood
- A61K35/17—Lymphocytes; B-cells; T-cells; Natural killer cells; Interferon-activated or cytokine-activated lymphocytes
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
- A61K35/28—Bone marrow; Haematopoietic stem cells; Mesenchymal stem cells of any origin, e.g. adipose-derived stem cells
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/43—Enzymes; Proenzymes; Derivatives thereof
- A61K38/46—Hydrolases (3)
- A61K38/48—Hydrolases (3) acting on peptide bonds (3.4)
- A61K38/482—Serine endopeptidases (3.4.21)
- A61K38/4846—Factor VII (3.4.21.21); Factor IX (3.4.21.22); Factor Xa (3.4.21.6); Factor XI (3.4.21.27); Factor XII (3.4.21.38)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K40/00—Cellular immunotherapy
- A61K40/10—Cellular immunotherapy characterised by the cell type used
- A61K40/13—B-cells
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K40/00—Cellular immunotherapy
- A61K40/20—Cellular immunotherapy characterised by the effect or the function of the cells
- A61K40/22—Immunosuppressive or immunotolerising
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K40/00—Cellular immunotherapy
- A61K40/20—Cellular immunotherapy characterised by the effect or the function of the cells
- A61K40/24—Antigen-presenting cells [APC]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K40/00—Cellular immunotherapy
- A61K40/40—Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
- A61K40/41—Vertebrate antigens
- A61K40/416—Antigens related to auto-immune diseases; Preparations to induce self-tolerance
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P7/00—Drugs for disorders of the blood or the extracellular fluid
- A61P7/02—Antithrombotic agents; Anticoagulants; Platelet aggregation inhibitors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/90—Stable introduction of foreign DNA into chromosome
- C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
- C12N15/907—Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0634—Cells from the blood or the immune system
- C12N5/0635—B lymphocytes
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2510/00—Genetically modified cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
- C12N2750/00011—Details
- C12N2750/14011—Parvoviridae
- C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
- C12N2750/14141—Use of virus, viral particle or viral elements as a vector
- C12N2750/14143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
Definitions
- the present disclosure is in the field of gene therapy, particularly genome editing and targeted delivery of transgene-encoding constructs to B cells for expression of beneficial (therapeutic) proteins.
- Gene therapy can be used to genetically engineer a cell to have one or more inactivated genes and/or to cause that cell to express a product not previously being produced in that cell (e.g., via transgene insertion and/or via correction of an endogenous sequence).
- transgene insertion include nuclease- mediated modification including the insertion of one or more genes encoding one or more novel therapeutic proteins, including therapeutic antibodies, insertion of a coding sequence encoding a protein that is lacking in the cell or in the individual, insertion of a wild type gene in a cell containing a mutated gene sequence, and/or insertion of a sequence that encodes a structural nucleic acid such as a microRNA or siRNA.
- These techniques can also be used to knock out expression of an endogenous gene and/or to alter the toxicity profile of the cell. See, e.g., U.S. Patent Nos.
- B cells function in humoral immunity by secreting antibodies against a variety of antigens. They are professional antigen presenting cells (APC) and are activated by helper T cells to differentiate into plasma cells that produce large amounts of antigen-specific antibodies.
- APC professional antigen presenting cells
- helper T cells to differentiate into plasma cells that produce large amounts of antigen-specific antibodies.
- B cell development takes place in both the fetal liver and the bone marrow, and a critical step in B cell development is the generation of a B cell receptor (BCR), a complex structure comprising unique heavy and light chains.
- BCR B cell receptor
- the process of BCR generation includes the rearrangement of the various immunoglobulin (Ig) gene segments in both the heavy and light chains of the BCR genes during the pro-B cell phase of B cell maturation.
- Pro-B cells become pre- B cells following successful pairing of rearranged heavy and light chains where the pre-BCR produced is expressed on the cell surface of the pre-B cells. Signaling through the pre-BCR drives further B cell development leading the pre-B cells to enlarge. Eventually, the large pre-B cells stop proliferating and additional light chain rearrangement occurs leading to the expression of a unique IgM BCR on the cell surface of what is now considered an immature B cell. These cells then exit the bone marrow and circulate in the periphery as transitional B cells.
- Maturation of the immature B cells occurs primarily in the spleen where selection also occurs such that B cells producing antibodies with high affinity to self-antigens will be destroyed (see Naradikian et al (2014) in Drugs Targeting B- Cells in Autoimmune Diseases, Milestones in Drug Therapy (X. Bosch et al (eds)) doi 10.1007/978-3-3-0348-0706-7_2, Springer Basel). Circulating B cells are able to enter secondary lymph nodes and spleen and acquire antigen from follicular dendritic cells.
- the B cells Upon entry into the lymph node/spleen and interaction with the dendritic cells, the B cells internalize the antigen and it is processed such that peptide fragments of the antigen are presented via MHC class II molecules to the cognate CD4+ T cells. These T cells have been previously activated by an APC presenting the same antigen. The interaction between B and T cells leads to a number of events, including the full activation of the T cell, resulting in T cell proliferation. T cells then produce cytokines that act directly on the B cells to induce B cell proliferation and class switching of the antibody expressed on the B cell surface. The proliferating B cells cluster in transient regions within the lymph nodes and spleen known as 'Germinal Centers'.
- activated B cells differentiate into either a specialized antibody secreting cells (plasmablast or plasma cell) that appear to undergo a pre-programmed number of divisions (typically 5-6) before they complete their final stage of differentiation to become non-proliferating plasma cells.
- the activated B cells leave the Germinal Center and differentiate into memory B cells (Zhang et al, (2016) Immunol Rev 270(1): 8-19).
- the genome mutator enzyme activation-induced cytidine deaminase (AID) is expressed which leads to somatic hypermutation in the antibody genes and class-switch recombination (CSR) altering antibody effector function.
- CSR class-switch recombination
- the somatic hypermutation occurs in the immunoglobulin variable region (IgV) gene to generate a repertoire of antibody mutants with varying affinities to the antigen (Klein and Heise (2015) Curr Opin Hematol 22(4): 379-387). This process takes place in the so-called 'dark zone' within the Germinal Center.
- IgV immunoglobulin variable region
- differentiated B cells migrate into the 'light zone' where B cells producing higher- affinity antibodies compete for available antigen and/or T cell help such that they receive survival signals through their B cell receptors.
- Lower affinity antibody producing B cells do not receive these survival signals because they cannot compete with their higher-affinity producing B cell siblings, and so they undergo apoptosis.
- the higher affinity antibody producing B cells can then either re-enter the dark zone for additional rounds of proliferation and somatic hypermutation, can leave the Germinal Center and differentiate into plasmablasts or can differentiate into long- lived memory B cells (Recaldin and Fear (2015) Clin andExp Immunol 183 :65-75).
- B cells are induced to express large amounts of antibodies against antigens for protection of the body from a number of potential threats.
- pathogens e.g. parasites, bacteria, viruses
- pathogens include a number of agents responsible for a great deal of human disease including but not limited to Plasmodium, Schistosomia, Mycobacterium, HIV, HCV and HBV (Borhis and Richard (2015) BMC Immunology 16: 15 doi 10.1186/sl2865-015-0079- y).
- lymphocytes (Vincent et al (2011) PLoS ONE 6(10):e26315.
- CDld high CD5+ B cells isolated from CLL patients treated with rituximab revealed that anti-CD20-mediated B-cell depletion mostly enriched a Breg pool.
- the enriched Bregs were postulated to suppress the anti-tumor immunity required for the clearance of anti-CD20-bound tumor cells, causing patients to develop lymphoma resistance towards anti-CD20 therapy and/or eventually relapse as a result of enhanced cancer progression (Bodogai et al, (2013) Cancer Res 73 :2127-2138).
- B-cell antitumor immunity may involve the secretion of effector cytokines, such as IFN- ⁇ , by B cells, which could polarize T cells towards a Thl or Th2 response or promote T-cell responses through their role as antigen-presenting cells (Sarvaria et al (2017) CellMol Immunol 14(8): 662-674).
- effector cytokines such as IFN- ⁇
- Clotting disorders are fairly common genetic disorders where factors in the clotting cascade are aberrant in some manner, i.e., lack of expression or production of a mutant protein. Most clotting disorders result in hemophilias such as hemophilia A (factor VIII deficiency), hemophilia B (factor IX deficiency), or hemophilia C (factor XI deficiency). Treatment for these disorders is often related to the severity.
- Alpha-1 antitrypsin (A1AT) deficiency is an autosomal recessive disease caused by defective production of alpha 1 -antitrypsin which leads to inadequate Al AT levels in the blood and lungs. It can be associated with the development of chronic obstructive pulmonary disease (COPD) and liver disorders. Currently, treatment of the diseases associated with this deficiency can involve infusion of exogenous Al AT and lung or liver transplant.
- A1AT Alpha-1 antitrypsin
- Lysosomal storage diseases are a group of rare metabolic monogenic diseases characterized by the lack of functional individual lysosomal proteins normally involved in the breakdown of waste lipids, glycoproteins and mucopolysaccharides. These diseases are characterized by a buildup of these compounds in the cell since it is unable to process them for recycling due to the mis- functioning of a specific enzyme. Common examples include Gaucher' s
- GBA glycocerebrosidase deficiency- gene name: GBA
- Fabry's a galactosidase deficiency- GLA
- Hunter's iduronate-2-sulfatase deficiency-IDS
- Hurler's alpha-L iduronidase deficiency- IDUA
- Niemann-Pick's sphingomyelin
- Type I diabetes is a disorder in which immune-mediated destruction of pancreatic beta cells results in a profound deficiency of insulin, which is the primary secreted product of these cells. Restoration of baseline insulin levels provide substantial relief from many of the more serious complications of this disorder which can include "macrovascular" complications involving the large vessels: ischemic heart disease (angina and myocardial infarction), stroke and peripheral vascular disease, as well as "microvascular” complications from damage to the small blood vessels.
- ischemic heart disease angina and myocardial infarction
- stroke and peripheral vascular disease as well as "microvascular” complications from damage to the small blood vessels.
- Microvascular complications may include diabetic retinopathy, which affects blood vessel formation in the retina of the eye, and can lead to visual symptoms, reduced vision, and potentially blindness, and diabetic nephropathy, which may involve scarring changes in the kidney tissue, loss of small or progressively larger amounts of protein in the urine, and eventually chronic kidney disease requiring dialysis.
- diabetic retinopathy which affects blood vessel formation in the retina of the eye, and can lead to visual symptoms, reduced vision, and potentially blindness
- diabetic nephropathy which may involve scarring changes in the kidney tissue, loss of small or progressively larger amounts of protein in the urine, and eventually chronic kidney disease requiring dialysis.
- provision of therapeutic proteins to treat disorders in a subject may be limited by the subject's own immune response to the therapeutic protein, including the production of antibodies by B-cells in the subject, which may limit the efficacy of such treatments.
- hemophilia patients receiving ERT of the clotting factor(s) in which they are deficient or lacking may develop antibodies to these needed proteins (e.g., anti-F9 antibodies). It is estimated that 15- 50% of hemophilia A patients develop inhibitory antibodies against therapeutic Factor 8 protein (Krudysz-Amblo et al, (2009) Blood 113(11):2587-2594).
- the reactions may be severe (anaphylactic shock) leading to a situation where the needed ERT causes harmful side-effects in the patient (see e.g. JM Lusher (2000) Semin Thromb Hemost 26(2): 179-188).
- antibodies are secreted protein products whose binding plasticity has been exploited for development of a diverse range of therapies.
- Therapeutic antibodies can be used for neutralization of target proteins that directly cause disease (e.g. VEGF in macular degeneration) as well as for highly selective killing of cells whose persistence and replication endanger the host (e.g. cancer cells, as well as certain immune cells in autoimmune diseases, including B cells that produce that antibodies to self-antigens).
- therapeutic antibodies take advantage of the body's normal response to its own antibodies to achieve selective killing, neutralization, or clearance of target proteins or cells bearing the antibody' s target antigen.
- antibody therapy has been widely applied to many human conditions including oncology, rheumatology, transplant, and ocular disease.
- Site-specific modification of B cells at one or more genetic loci would enhance B-cell function (including enhancing antibody production by these cells and/or targeting B-cells to produce proteins that limit unwanted innate immune responses), differentiation into plasmablasts and engraftment capabilities.
- Controlling B-cells via target genetic modification e.g., disruption and/or genomic or epiosomal gene addition
- target genetic modification allows for efficient and less toxic protein replacement therapies and in addition allows communication within Germinal Centers to be programmed.
- the present invention describes compositions and methods for modulating expression of a target gene in a B cell and/or expressing a transgene in a B cell (including derivative plasmablast or plasma cells).
- a B cell including derivative plasmablast or plasma cells.
- genetically modified B cells including B cells descended from genetically modified hematopoietic stem cells or other B cell prescursors
- B cells comprising one or more of the following modifications: inclusion of one or more transgenes in the cell; and/or insertions and/or deletions which modify (i) B cell receptor genes, and/or (ii) cellular interactions in Germinal Centers; and/or (c) modifications that inhibit suppression of any B cell function associated with pathogen infection or cancer regulation.
- the transgene(s) may be expressed extra-chromosomally (episomally) and/or may be integrated into the genome of the B cell (e.g., via nuclease-mediated targeted integration, for example into a safe harbor locus).
- one or more transgenes are maintained episomally and one or more transgenes are integrated into the genome of the cell (B cell or HSC that is differentiated into a B cell).
- the transgene encodes a protein involved in the clotting cascade.
- the transgene encodes an enzyme defective in a lysosomal storage disorder or encodes a therapeutic antibody.
- the transgene encodes a molecule that targets a B cell producing an undesirable antibody, for example, an antibody against a therapeutic protein, including but not limited to antibodies against an endogenous protein (e.g., autoantibodies in an autoimmune diseases) and/or an exogenous protein (e.g., a protein supplied by ERT such as a clotting factor).
- an endogenous protein e.g., autoantibodies in an autoimmune diseases
- an exogenous protein e.g., a protein supplied by ERT such as a clotting factor
- the transgene can encode an antibody that recognizes the B cell receptor on B cells that are sensitive to the desirable protein (endogenous protein in autoimmune disease and/or ERT-supplied protein) to target the B cell population that is producing the undesirable antibodies against the desirable protein.
- Non-limiting examples of such antibodies include antibodies that recognize a B cell receptor associated with a B cell producing antibodies against ERT-supplied proteins such as clotting factors in hemophilia (e.g., B-cells that product anti-F9 or anti-F8 antibodies); and/or recognize a B cell receptor on a B cell producing antibodies against auto/self-antigens including but not limited to myelin basic protein (MBP) in MS, Antinuclear antibodies (ANAs) in systemic lupus erythematosus (SLE), glycoproteins in the heart, joint and other tissues in acute rheumatic fever, antibodies to Fc portion of IgG in rheumatoid arthritis (RA), as well as B cells producing autoantibodies in Reiter's syndrome, Sjogren's syndrome, Systemic sclerosis
- MBP myelin basic protein
- ANAs Antinuclear antibodies
- SLE systemic lupus erythematosus
- RA rheuma
- compositions and methods described herein result in high levels of protein production both in vitro and in vivo, including at levels sufficient to show clinically relevant (therapeutic) effects in vivo.
- a polynucleotide expression construct comprising at least one B cell specific promoter, which promoter drives expression of one or more transgenes.
- the B cell promoter can be selected from any promoter that is active in B cells, including but not limited to the immunoglobulin kappa chain promoter (IgK, Why et al (2007) Gene Ther 14(23): 1623-31), B29 (Hermanson et al (1989) Proc Nat ⁇ Acad Sci 86: 7341-7345), BCL6 (Ramachandrareddy et al (2010) Proc Nat ⁇ Acad Sci 107(26): 11930-11935), CIITA promoter III (Deffernnes et al (2001) J. Immunol 167(1): 98-106), mb-1 (see e.g. Malone and Wall (2001) J.
- the immunoglobulin kappa chain promoter IgK, Why et al (2007) Gene Ther 14(23): 1623-31
- B29 Hermanson et al (1989) Proc Nat ⁇ Acad Sci 86: 7341-7345
- the EEK promoter comprising the light chain promoter (VKp) preceded by an intronic enhancer ( ⁇ ), an MAR, and a 3 ' enhancer (3 ' EK) ⁇ see U.S. Patent 8133727).
- the B cell specific promoter used is normally expressed in the Germinal Center such that the transgene is expressed when the cell is in a Germinal Center ⁇ e.g. BCL6, Basso et al (2010) Blood 115(5):975-984).
- the transgene is inserted via nuclease- mediated targeted integration such that it is controlled by the B cell specific promoter in the genome of the cell.
- the B cell promoter-transgene construct is part of a DNA vector that is maintained extra-chromosomally.
- the B cell promoter-transgene construct is inserted in a transcriptionally silent and/or safe harbor region of the B cell genome such as into an albumin gene or a gene encoding a subunit of the T cell receptor ⁇ e.g., TCRA or TCRB).
- the transgene encodes an enzyme that is lacking or insufficient in subject.
- the transgene encodes a clotting factor such as Factor VII, Factor VIII, Factor IX, Factor X, Factor XI or Factor XII.
- the transgene encodes an enzyme deficient in a lysosomal storage disease, including but not limited to glucocerebrosidase (GBA), a galactosidase (GLA), ⁇ -glucuronidase (GUSB), iduronate-2-sulfatase (IDS), alpha-L iduronidase (IDUA), sphingomyelin phosphodiesterase 1 (SMPD1), or alpha-glucosidase (GAA).
- GBA glucocerebrosidase
- GLA galactosidase
- GUSB ⁇ -glucuronidase
- IDDS iduronate-2-sulfatase
- IDUA alpha-L iduronidase
- SMPD1 sphingomyelin phosphodiesterase 1
- GAA alpha-glucosidase
- the transgene encodes Al AT.
- Non-limiting examples of proteins that may be expressed as described herein also include fibrinogen, prothrombin, tissue factor, Factor V, von Willebrand factor, prekallikrein, high molecular weight kininogen (Fitzgerald factor), fibronectin, antithrombin III, heparin cofactor II, protein C, protein S, protein Z, protein Z-related protease inhibitor, plasminogen, alpha 2-antiplasmin, tissue plasminogen activator, urokinase, plasminogen activator inhibitor- 1, plasminogen activator inhibitor-2, MMAA,
- MMAB MMACHC, MMADHC (C2orf25), MTRR, LMBRD1, MTR, propionyl- CoA carboxylase (PCC) (PCCA and/or PCCB subunits), a glucose-6-phosphate transporter (G6PT) protein or glucose-6-phosphatase (G6Pase), an LDL receptor (LDLR), ApoB, LDLRAP-1, a PCSK9, a mitochondrial protein such as NAGS (N- acetylglutamate synthetase), CPS1 (carbamoyl phosphate synthetase I), and OTC (ornithine transcarbamylase), ASS (argininosuccinic acid synthetase), ASL
- argininosuccinase acid lyase and/or ARG1 (arginase), and/or a solute carrier family 25 (SLC25A13, an aspartate/glutamate carrier) protein, a UGTlAl or UDP glucuronsyltransferase polypeptide Al, a fumarylacetoacetate hydrolyase (FAH), an alanine-glyoxylate aminotransferase (AGXT) protein, a glyoxylate
- the transgene encodes a FVIII polypeptide.
- the FVIII polypeptide comprises a deletion of the B domain.
- transgene construct encoding a replacement protein results in 1% of normal levels of the protein produced, while in others, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 30%, 50%, 80%, 100%, 150%, 200%, or more of normal levels of the protein are produced.
- the transgene encodes a polypeptide that circumvents the inhibition of the antibody response by virus, bacteria or parasite.
- the transgene encodes a therapeutic protein such as a single chain antibody.
- the single chain antibody is a scFv while in others, the single chain antibody is a camelid antibody or nanobody (see e.g. Mejias et al (2016) Sci Reports 6: srep24913, doi: 10: 1038).
- more than one transgene is expressed in the B cell.
- the more than one transgenes include the sequences necessary to express a full antibody or fragment thereof, or another antigen-binding protein (e.g. monobody, aptamer, darpin, adnectins, affibodies, anticalins, kunitz-type inhibitors etc. (Gebauer and Skerra (2009) Curr Opin Chem Biol 13(3):245-55).
- another antigen-binding protein e.g. monobody, aptamer, darpin, adnectins, affibodies, anticalins, kunitz-type inhibitors etc. (Gebauer and Skerra (2009) Curr Opin Chem Biol 13(3):245-55).
- a population of B cells comprising a transgene encoding a therapeutic protein of interest is engineered ex vivo and then re-introduced into a subject in need thereof.
- the B cell population may be engineered as described herein at any stage of development, including but not limited to as a hematopoietic stem cell (HSC), a lymphoid progenitor cell or a mature B cell.
- HSC hematopoietic stem cell
- Stem or progenitor of B cells may be engineered and then differentiated in vitro and administered as progenitor (lineage-committed B cells) or mature cells to a subject.
- engineered stem or B cell progenitor cells may be engineered in vitro as described herein and fully differentiated into mature B cells in vivo following administration.
- the B cell populations as described herein may be heterogenous in that they include stem, progenitor and/or mature B cells are various stages of development.
- the populations of B cells may homogenous and include only stem, progenitor or mature cells.
- the engineered B cells are made in vivo using a delivery vector that can transduce B cells.
- the delivery vector is a viral vector, preferably an adeno associate virus (AAV).
- AAV vector is an AAV6 vector.
- the delivery vector is non-viral, for example mRNA, a lipid nanoparticle (LNP) or plasmid vector.
- engineered B cells as described herein are grown in vitro for the production of a protein encoded by a transgene.
- the protein is an antibody or antigen binding protein ⁇ e.g., an antibody that binds to endogenous B cells producing undesirable antibodies in the subject, including endogenous B cells producing antibodies against ERT-supplied proteins such as clotting factors and/or B cells producing antibodies against self-proteins in autoimmune disorders), or an antibody that neutralizes the unwanted antibodies.
- the protein produced from the B cells may be isolated and used for protein therapy such as enzyme replacement therapy and/or in conjunction with enzyme replacement therapy to reduce and/or eliminate innate production of undesirable antibodies ⁇ e.g., anti-ERT antibodies developed following ERT).
- the invention provides methods and compositions to deliver a B cell or plasma cell that expresses a transgene that crosses the blood brain barrier, useful for the treatment and/or prevention of a disease of or which impacts the CNS.
- the transgene encodes an enzyme lacking in a subject with a lysosomal storage disorder.
- the transgene encodes glucocerebrosidase (GB A), a galactosidase (GLA), ⁇ -glucuronidase (GUSB), iduronate-2-sulfatase (IDS), alpha-L iduronidase (IDUA), sphingomyelin
- SMPD1 phosphodiesterase 1
- GAA alpha-glucosidase
- SMPD1 phosphodiesterase 1
- GAA alpha-glucosidase
- Fabry disease MPS type VII (Sly et al (1973) J Pediatr. 1973 Feb; 82(2):249-57), MPS II, MPS I, Niemann-Pick or Pompe disease, respectively.
- the methods and compositions of the invention include a modified B cell or B cell derivative (plasmablast, plasma cell) comprising a transgene and also one or more further modifications.
- the transgene-comprising B cells further comprise additional protein or peptide sequences (or polynucleotides encoding the same) that aid in the efficiency of crossing of the blood brain barrier.
- the peptide comprises a peptide known in the art to facilitate crossing into the brain.
- the peptide is an antibody expressed on the B cell surface that targets the transferrin receptor, while in other embodiments, the peptide is a metallotransferrin (Karkan et al (2008) PLoS ONE 3(6):e2469.
- the peptide is a receptor such as VLA-4, ICAM-1, IL-8Ra (CXCRl), or IL-8Rb (CXCR2) (Alter et al (2003) J. Immunol 170:4497-4505).
- the transgene may encode an enzyme lacking in a lysosomal storage disease such as those described above such that the enzyme is delivered into the CNS of a subject in need thereof.
- the engineered B cells of the invention comprise further modifications ⁇ e.g., mutations) that aid in engraftment after transplant.
- expression of specific genes is inhibited ⁇ e.g., via transient repression or permanent knock-out) to increase engraftment and/or size of the germinal center.
- Genes subject to such inhibition include, but are not limited to, inositol hexakisphosphate kinases (Zhang et al (2014) Basic Res Cardio 109(4): 417), Glycogen synthase kinase-3p (GSK-3p, see Ko et al ⁇ 20 ⁇ ⁇ ) Stem Cells 29(1): 108- 18), CD26 (DPPIV/dipeptidylpeptidase IV) peptidase, (Tian et al (2006) Gene Ther 13(7):652-8), RhoA (Ghiaur et al (2006) Blood 108(6):2087-94), EAF2 (Li et al, (2016) Nat Com 7; doi: 10.1038/ncommsl0836), autophagy proteins such as Atg5 (Pengo et al, (2013) Nat Immunol 14(3):298-305) and the like.
- inositol hexakisphosphate kinases Zhang et al (2014) Basic Res Cardio
- the engineered B cells may be further engineered to repress ⁇ e.g., knock out) genes associated with induction of a graft-versus-host reaction.
- genes encoding the B cell receptor are knocked out to prevent stimulation of a B cell in a host.
- the engineered B cells of the invention comprise further modification (mutations such as genomic insertions and/or deletions; episomal expression of transgenes, etc.) which regulate cellular interactions (e.g., T cell-B cell interactions) in Germinal Centers and/or inhibit suppression of any B cell function (e.g., antibody production, cytokine expression, signaling, etc.) associated with pathogen infection.
- the engineered B cells of the invention further comprise proteins (or sequences encoding these proteins) for the inhibition of B cells that are involved in oncogenic behavior.
- the engineered B cells comprise a surface expressed antibody against ubiquitin hydrolase UCH-L1 (including a transgene encoding the same) to suppress B cells involved in some types of large B-cell lymphoma (Bedekovics et al (2016) Blood 127(12): 1564- 74).
- UCH-L1 including a transgene encoding the same
- compositions comprising one or more of the cells, expression constructs and/or optional nucleases described herein are provided.
- any nuclease can be used, including but not limited to, one or more zinc finger nucleases (ZFNs), TALENs, CRISPR/Cas nucleases and/or TtAgo nucleases, such that the expression construct is integrated into the region (gene) cleaved by the nuclease(s).
- ZFNs zinc finger nucleases
- TALENs CRISPR/Cas nucleases
- TtAgo nucleases such that the expression construct is integrated into the region (gene) cleaved by the nuclease(s).
- one or more pairs of nucleases are employed.
- the nucleases may be introduced in mRNA form or may be administered to the cell using non-viral or viral vectors.
- the nuclease polynucleotides may be delivered by lentivirus or by non-integrating lentivirus.
- the expression cassette may be delivered by AAV and/or DNA oligos.
- expression cassettes and/or nucleases may be carried on an AAV vector, including but not limited to
- polynucleotides are delivered using the same AAV vector types.
- the polynucleotides are delivered using the same AAV vector types.
- polynucleotides are delivered using different AAV vector types.
- the polynucleotides may be delivered using one or more vectors.
- polynucleotides are delivered via a lipid nanoparticle (LNP).
- LNP lipid nanoparticle
- the polynucleotides are delivered via administration into the spleen or lymph node of an intact animal.
- the polynucleotides are delivered via intravenous administration in a peripheral vein.
- compositions are introduced into a live, intact mammal.
- the mammal may be at any stage of development at the time of delivery, e.g., embryonic, fetal, neonatal, infantile, juvenile or adult.
- targeted cells may be healthy or diseased.
- one or more of the compositions are delivered to a specific tissue ⁇ e.g., spleen or lymph node), intra- arterially, intraperitoneally, or intramuscularly.
- Ex vivo delivery may be performed with homogeneous or heterogenous populations of cells including stem cells, B cell progenitor cells and/or mature B cells.
- kits comprising one or more of the expression constructs, AAV vectors, B cell and/or pharmaceutical compositions described herein, is also provided.
- the kit may further comprise nucleic acids encoding nucleases, ⁇ e.g. RNA molecules encoding ZFNs, TALENs or Cas and modified Cas proteins, and guide RNAs), or aliquots of the nuclease proteins, cells, instructions for performing the methods of the invention, and the like.
- Figure 1 is a schematic showing an overview of the in vitro B cell thawing and differentiation protocol followed (see Jourdan et al (2009) Blood
- Figures 2A through 2C are graphs demonstrating the ability of the in vitro differentiated B cells to produce antibodies, including IgM antibodies (Figure 2A), IgG antibodies ( Figure 2B) and IgA antibodies ( Figure 2C).
- Samples were treated with cytokines ("+ cytokines") or not, and then the amount of antibody detected by ELISA.
- Supernatants were collected on days t4, t7 and tlO and total IgM, IgG, and IgA antibody levels were quantified by specific ELISA. Data represents technical duplicates. Error bars represent standard deviation.
- Figures 3A through 3D are graphs depicting the percent of GFP positive cells following mRNA electroporation into the B cells 0 days ( Figure 3 A), 1 day (Figure 3B), 2 days ( Figure 3C) or 3 days ( Figure 3D) following thaw.
- CD 19+ B cells were electroporated with mRNA on tO, tl, t2 and t3 where t equals days following thaw to determine the optimal time point for mRNA addition.
- CD 19+ positive B cells (2.0E+05 cells) were mixed with GFP mRNA (2 ⁇ g) followed by electroporation. Cells were collected 24 hours later and analyzed by flow cytometry to assess GFP levels. Day 2 post thaw (t2) was had the highest levels of GFP and was chosen for further studies. Data represents technical duplicates. Error bars represent standard deviation.
- Figures 4A and 4B are graphs depicting flow cytometry gating for
- Figure 4A defines the areas of the plot associated with side scatter (“SSC") and forward scatter (“FSC”).
- Figure 4B exemplifies the differences between a mock treated set of B cells (left panel) and those electroporated with GFP encoding mRNA (right panel). As can be seen in the right panel of Figure 4B, the expression of the GFP mRNA results in an increase in GFP generated fluorescence that can is quantifiable following gating.
- Figure 5 A depicts genome editing at the AAVS1 locus at days 4, 7, and 10.
- Figure 5B shows a similar data set at the CCR5 locus while Figure 5C shows the data at the TCRA (TRAC) locus.
- Figures 6A through 6C show the effect of a transient cold shock on B cell genome editing.
- CD 19+ B cells 2.0E+5 cells
- ZFN mRNA (0.75, 1.5, 3 and 6 ⁇ g) followed by electroporation.
- Post-electroporation cells were split into two groups. One group was placed in a 37 °C incubator for 4 days. The second group was placed in a 30 °C overnight, then transferred to a 37 °C incubator for 3 days.
- Deep sequencing revealed an increase in genome editing (% indels) in cells treated with the transient cold shock.
- Figures 7A and 7B depict the transduction ability of several AAV serotypes tested for delivery of a CMV promoter-GFP donor into CD 19+ B cells.
- Figure 7A shows the results for recombinant AAV serotypes 2, 5, 6, 8 and 9 harboring CMV-GFP delivered at vector doses of 2.4E+6, 1.2E+6, 6.0E+5, 3.0E+5 vector genomes (vg)/cell .
- Figure 7B is a schematic depiction of the expression cassette used in experiments shown.
- Figure 8 depicts exemplary AAV expression cassettes used.
- AAVSI has a left (“AAVSI -L”) and right (“AAVSI -R”) homology arm consisting of 801 and 568 base pairs in length, respectively.
- CCR5 has a left (“CCR5-L”) and right (“CCR5-R”) homology arm consisting of 473 and 1431 base pairs in length, respectively.
- TCRA has a left (“TRAC-L”) and right (“TRAC-R”) homology arm consisting of 925 and 989 base pairs in length, respectively.
- Donors contained either a phosphogly cerate kinase ("PGK”) or B cell specific promoter (“EEK”, comprising the light chain promoter (VKp) preceded by an intronic enhancer (iE t ), a MAR, and a 3 enhancer (3 ' E ⁇ ); U.S. Patent 8, 133,727) followed by GFP-encoding transgene (“GFP”) and a bovine growth hormone polyadenylation signal (“pA”).
- GFP phosphogly cerate kinase
- MAR light chain promoter
- 3 enhancer 3 ' E ⁇
- U.S. Patent 8, 133,727 followed by GFP-encoding transgene (“GFP”) and a bovine growth hormone polyadenylation signal (“pA”).
- GFP GFP-encoding transgene
- pA bovine growth hormone polyadenylation signal
- AAV2 inverted terminal repeats were used to enable packaging into AAV capsids.
- Figures 9A through 9C are graphs showing that a combination of
- ZFN mRNA and rAAV2/6 vectors promoted high levels of transgene addition at multiple loci.
- AAVSI Figure 9A
- CCR5 Figure 9B
- TCRA TraC, Figure 9C loci were evaluated for transgene addition.
- FIG. 9 A “Donor: PGK -AAVSI” indicates that the GFP transgene was driven from the PGK promoter, and that the GFP coding sequence was flanked by homology arms with homology to the nuclease site in the AAVSI gene).
- Figures 9A through 9C the left panel shows results following collection 4 days (t4) after transfection; the middle panel shows results following collection 7 days (t7) after transfection; and the right panel shows results following collection 10 days after transfection.
- Figure 11 is a graph depicting the results to determine whether homology-driven recombination (FIDR) or end capture via non-homologous end joining (NHEJ) are used by the B cells for targeted integration.
- the table below the graph shows the ZFN specificity and the donor configuration. All donors used the PGK promoter, but only experiment #1 had the donor GFP transgene flanked by homology arms matching the nuclease cut site. Mismatched ZFN and donor homology arm samples show similar expression of GFP as donor only without any added nuclease. The greatest targeted integration occurred when the homology arms matched the nuclease target site, demonstrating that FIDR is used for integration in B cells.
- FIG 12 is a graph depicting the comparison of the PGK promoter driving GFP expression with a B cell-specific promoter EEK driving the GFP expression.
- B cells were mixed with ZFN mRNA (4 ⁇ g) targeting the TCRA (TRAC) locus, followed by electroporation. Following electroporation, CD 19+ B cells were then transduced with AAV6 containing TRAC homology arms flanking the transgene expression cassette and either a PGK or B cell specific promoter (EEK) driving GFP transgene expression. These were delivered at vector dose of 2.4E+06 vg/cell.
- the data demonstrate that the use of the B cell specific promoter (EEK) showed a slight increase in GFP expression compared to the PGK promoter.
- FIGS 13A through 13D are graphs depicting the amount of GFP transgene expression in the CD 19+ B cells at a range of donor AAV doses.
- the GFP transgene was being integrated into the TCRA (TRAC) locus using TCRA-specific nucleases. Also shown in each graph of the GFP expression results when the transduction was done in the absence of the nucleases.
- the donor constructs comprised TCRA-specific homology arms and either an EEK promoter as described above or a PGK promoter.
- the range of AAV used included 3.0E+05vg/cell ( Figure 13D), 6.0E+05vg/cell ( Figure 13C), 1.2E+06vg/cell (Figure 13B) and 2.4E+06vg/cell ( Figure 13 A).
- CD 19+ positive B cells were mixed with ZFN encoding mRNA (4 ⁇ g) targeting the TCRA locus, followed by electroporation. After electroporation, CD 19+ B cells were transduced with AAV containing TCRA homology arms, with either a PGK or B cell specific (EEK) promoter driving GFP expression. These were delivered at vector doses of 2.4E+06, 1.2E+06, 6.0E+05 and 3.0E+05 vg/cell.
- the percentage of GFP expression driven by the PGK promoter decreased as dose decreased whereas the B cell specific promoter maintained GFP expression over an 8- fold dilution. There is almost a 5-fold difference at 3.0E+05 vg/cell between the two promoters.
- Figures 14A through 14C are graphs depicting impact on antibody production following the genome editing manipulations demonstrating no major loss of IgG in vitro production as measured by ELISA as a result of the manipulations.
- Total secreted IgG levels are similar independent of treatment over the course of the experiment (representing combined secreted IgG levels on days 4, 7 andlO) indicating electroporation and transduction do not negatively impact IgG production.
- Addition of cytokines is essential for IgG production.
- CD 19+ B cells were treated with either AAVS1 specific ZFN (Figure 14A), CCR5 specific ZFN ( Figure 14B) or TCRA (TRAC) specific ZFN ( Figure 14C).
- the various conditions used for each data set included the specific ZFN paired with the GFP transgene with the matching homology arms ("ZFN:Donor”), GFP transgene and homology arms (“Donor”), specific ZFN alone (“ZFN”), CD 19+ B cells treated in the BTX device with buffer only (“BTX cells”), untreated CD 19+ B cells plus cytokines ("B cells”) and untreated CD 19+ B cell with no cytokines ("B cells-Cytos").
- the ZFN:Donor, Donor, ZFN, BTX Cells and B cells were all treated with cytokines.
- Figures 15A through 15C are graphs depicting impact on antibody production following the genome editing manipulations demonstrating no major loss of IgM in vitro production as measured by ELISA.
- CD 19+ B cells were treated with either AAVS1 specific ZFN (Figure 15 A), CCR5 specific ZFN ( Figure 15B) or TCRA (TRAC) specific ZFN ( Figure 15C). Samples are as described above in Figure 14.
- Figure 16 is a graph depicting IgM production from differentiated
- CD 19+ B cells treated with cytokines from a single human donor were subject to treatment with AAV2, 5, 6, 8 or 9 virus.
- IgM production was 'boosted' when treated with the AAV2 only.
- Prevalence of antibodies to wild-type AAV in the human population is robust and has not been associated with disease. Shown here is a potential boost of antibody production due to what would be considered re-infection by AAV.
- Figures 17A and 17B are illustrations depicting a potential mechanism for the increased IgM expression as a result of the AAV2 'boost' .
- Figure 17A Depicted in the left panel ( Figure 17A) is a simplified scenario of production of antibodies in a B cell following AAV infection.
- the panel shown on the right ( Figure 17B) is an example denoting how the AAV could be harnessed to function as a booster to increase expression of an inserted transgene driven from an antibody promoter in an engineered B cell.
- compositions for genetic engineering of a B cell including knocking out endogenous genes and inserting (stably or episomally) expression cassettes for expression of a transgene.
- the methods can be carried out in vitro, ex vivo or in vivo and can be used to express any transgene(s) for the treatment and/or prevention of any disease or disorder which can be ameliorated by the provision of one or more of the transgenes.
- nucleic acid refers to a deoxyribonucleotide or ribonucleotide polymer, in linear or circular conformation, and in either single- or double-stranded form.
- polynucleotide refers to a deoxyribonucleotide or ribonucleotide polymer, in linear or circular conformation, and in either single- or double-stranded form.
- these terms are not to be construed as limiting with respect to the length of a polymer.
- the terms can encompass known analogues of natural nucleotides, as well as nucleotides that are modified in the base, sugar and/or phosphate moieties (e.g., phosphorothioate backbones).
- an analogue of a particular nucleotide has the same base-pairing specificity; i.e., an analogue of A will base-pair with T.
- amino acid polymers in which one or more amino acids are chemical analogues or modified derivatives of a corresponding naturally-occurring amino acids.
- Recombination refers to a process of exchange of genetic information between two polynucleotides, including but not limited to, capture by non-homologous end joining (NHEJ) and homologous recombination.
- NHEJ non-homologous end joining
- homologous recombination FIR refers to the specialized form of such exchange that takes place, for example, during repair of double-strand breaks in cells via homology-directed repair mechanisms.
- one or more targeted nucleases as described herein create a double-stranded break (DSB) in the target sequence (e.g., cellular chromatin) at a predetermined site (e.g., albumin gene).
- the DSB mediates integration of a construct as described herein.
- the construct has homology to the nucleotide sequence in the region of the break.
- the expression construct may be physically integrated or, alternatively, the expression cassette is used as a template for repair of the break via homologous recombination, resulting in the introduction of all or part of the nucleotide sequence as in the expression cassette into the cellular chromatin.
- a first sequence in cellular chromatin can be altered and, in certain embodiments, can be converted into a sequence present in an expression cassette.
- replacement or replacement
- replacement can be understood to represent replacement of one nucleotide sequence by another, (i.e., replacement of a sequence in the informational sense), and does not necessarily require physical or chemical replacement of one polynucleotide by another.
- the exogenous nucleotide sequence (the "expression construct” or “expression cassette” or “vector”) can contain sequences that are homologous, but not identical, to genomic sequences in the region of interest, thereby stimulating homologous recombination to insert a non-identical sequence in the region of interest.
- portions of the expression cassette sequence that are homologous to sequences in the region of interest exhibit between about 80 to 99% (or any integer therebetween) sequence identity to the genomic sequence that is replaced.
- the homology between the expression cassette and genomic sequence is higher than 99%, for example if only 1 nucleotide differs as between the homology regions of the expression cassette and genomic sequences of over 100 contiguous base pairs.
- a non-homologous portion of the expression cassette can contain sequences not present in the region of interest, such that new sequences are introduced into the region of interest.
- the non-homologous sequence is generally flanked by sequences of 50-1,000 base pairs (or any integral value therebetween) or any number of base pairs greater than 1,000, that are homologous or identical to sequences in the region of interest.
- sequence refers to a nucleotide sequence of any length, which can be DNA or RNA; can be linear, circular or branched and can be either single-stranded or double stranded.
- transgene refers to a nucleotide sequence that is inserted into a genome.
- a transgene can be of any length, for example between 2 and 100,000,000 nucleotides in length (or any integer value therebetween or thereabove), preferably between about 100 and 100,000 nucleotides in length (or any integer therebetween), more preferably between about 2000 and 20,000 nucleotides in length (or any value therebetween) and even more preferable, between about 5 and 15 kb (or any value therebetween).
- a "chromosome,” is a chromatin complex comprising all or a portion of the genome of a cell.
- the genome of a cell is often characterized by its karyotype, which is the collection of all the chromosomes that comprise the genome of the cell.
- the genome of a cell can comprise one or more chromosomes.
- An "episome” is a replicating nucleic acid, nucleoprotein complex or other structure comprising a nucleic acid that is not part of the chromosomal karyotype of a cell.
- Examples of episomes include plasmids and certain viral genomes.
- the liver specific constructs described herein may be episomally maintained or, alternatively, may be stably integrated into the cell.
- an "exogenous" molecule is a molecule that is not normally present in a cell, but can be introduced into a cell by one or more genetic, biochemical or other methods. "Normal presence in the cell" is determined with respect to the particular developmental stage and environmental conditions of the cell. Thus, for example, a molecule that is present only during embryonic development of muscle is an exogenous molecule with respect to an adult muscle cell. Similarly, a molecule induced by heat shock is an exogenous molecule with respect to a non-heat- shocked cell.
- An exogenous molecule can comprise, for example, a functioning version of a malfunctioning endogenous molecule or a malfunctioning version of a normally- functioning endogenous molecule.
- An exogenous molecule can be, among other things, a small molecule, such as is generated by a combinatorial chemistry process, or a macromolecule such as a protein, nucleic acid, carbohydrate, lipid, glycoprotein, lipoprotein,
- Nucleic acids include DNA and RNA, can be single- or double-stranded; can be linear, branched or circular; and can be of any length. Nucleic acids include those capable of forming duplexes, as well as triplex-forming nucleic acids. See, for example, U.S. Patent Nos. 5,176,996 and 5,422,251.
- Proteins include, but are not limited to, DNA-binding proteins, transcription factors, chromatin remodeling factors, methylated DNA binding proteins, polymerases, methylases, demethylases, acetylases, deacetylases, kinases, phosphatases, ligases, deubiquitinases, integrases, recombinases, ligases,
- topoisomerases gyrases and helicases.
- an exogenous molecule can be the same type of molecule as an endogenous molecule, e.g., an exogenous protein or nucleic acid.
- an exogenous nucleic acid can comprise an infecting viral genome, a plasmid or episome introduced into a cell, or a chromosome that is not normally present in the cell.
- exogenous molecules into cells are known to those of skill in the art and include, but are not limited to, lipid-mediated transfer (i.e., liposomes, including neutral and cationic lipids), electroporation, direct injection, cell fusion, particle bombardment, calcium phosphate co-precipitation, DEAE-dextran- mediated transfer and viral vector-mediated transfer.
- An exogenous molecule can also be the same type of molecule as an endogenous molecule but derived from a different species than the cell is derived from.
- a human nucleic acid sequence may be introduced into a cell line originally derived from a mouse or hamster.
- an "endogenous" molecule is one that is normally present in a particular cell at a particular developmental stage under particular environmental conditions.
- an endogenous nucleic acid can comprise a chromosome, the genome of a mitochondrion, chloroplast or other organelle, or a naturally- occurring episomal nucleic acid.
- Additional endogenous molecules can include proteins, for example, transcription factors and enzymes.
- the term "product of an exogenous nucleic acid” includes both polynucleotide and polypeptide products, for example, transcription products (polynucleotides such as RNA) and translation products (polypeptides).
- a "fusion" molecule is a molecule in which two or more subunit molecules are linked, preferably covalently.
- the subunit molecules can be the same chemical type of molecule, or can be different chemical types of molecules.
- fusion molecules include, but are not limited to, fusion proteins (for example, a fusion between a protein DNA-binding domain and a cleavage domain), fusions between a polynucleotide DNA-binding domain (e.g., sgRNA) operatively associated with a cleavage domain, and fusion nucleic acids (for example, a nucleic acid encoding the fusion protein).
- fusion proteins for example, a fusion between a protein DNA-binding domain and a cleavage domain
- fusions between a polynucleotide DNA-binding domain e.g., sgRNA
- fusion nucleic acids for example, a nucleic acid encoding the fusion protein.
- Fusion protein in a cell can result from delivery of the fusion protein to the cell or by delivery of a polynucleotide encoding the fusion protein to a cell, wherein the polynucleotide is transcribed, and the transcript is translated, to generate the fusion protein.
- Trans-splicing, polypeptide cleavage and polypeptide ligation can also be involved in expression of a protein in a cell. Methods for polynucleotide and polypeptide delivery to cells are presented elsewhere in this disclosure.
- Gene expression refers to the conversion of the information, contained in a gene, into a gene product.
- a gene product can be the direct
- Gene products also include RNAs which are modified, by processes such as capping, polyadenylation, methylation, and editing, and proteins modified by, for example, methylation, acetylation, phosphorylation, ubiquitination, ADP-ribosylation, myristilation, and glycosylation.
- Modulation of gene expression refers to a change in the activity of a gene. Modulation of expression can include, but is not limited to, gene activation and gene repression. Genome editing ⁇ e.g., cleavage, alteration, inactivation, random mutation) can be used to modulate expression. Gene inactivation refers to any reduction in gene expression as compared to a cell that does not include a ZFP, TALE or CRISPR/Cas system as described herein. Thus, gene inactivation may be partial or complete.
- a "genetically modified" cell includes cells with any change to the genetic material in the cell, including but not limited to episomal and/or genomic
- Non-limiting examples of genetic modifications includes insertions and/or deletions (for example episomal and/or targeted integration of one or more transgenes, RNAs or non-coding sequences) and/or mutations (for example point mutations, substitutions, etc.) that alter protein expression within the cell).
- a "region of interest” is any region of cellular chromatin, such as, for example, a gene or a non-coding sequence within or adjacent to a gene, in which it is desirable to bind an exogenous molecule. Binding can be for the purposes of targeted DNA cleavage and/or targeted recombination.
- a region of interest can be present in a chromosome, an episome, an organellar genome ⁇ e.g., mitochondrial, chloroplast), or an infecting viral genome, for example.
- a region of interest can be within the coding region of a gene, within transcribed non-coding regions such as, for example, leader sequences, trailer sequences or introns, or within non-transcribed regions, either upstream or downstream of the coding region.
- a region of interest can be as small as a single nucleotide pair or up to 2,000 nucleotide pairs in length, or any integral value of nucleotide pairs.
- Eukaryotic cells include, but are not limited to, fungal cells (such as yeast), plant cells, animal cells, mammalian cells and human cells (e.g., B-cells), including stem cells (pluripotent and multipotent).
- operative linkage and "operatively linked” (or “operably linked”) are used interchangeably with reference to a juxtaposition of two or more components (such as sequence elements), in which the components are arranged such that both components function normally and allow the possibility that at least one of the components can mediate a function that is exerted upon at least one of the other components.
- a transcriptional regulatory sequence such as a promoter
- a transcriptional regulatory sequence is operatively linked to a coding sequence if the transcriptional regulatory sequence controls the level of transcription of the coding sequence in response to the presence or absence of one or more transcriptional regulatory factors.
- transcriptional regulatory sequence is generally operatively linked in cis with a coding sequence, but need not be directly adjacent to it.
- an enhancer is a transcriptional regulatory sequence that is operatively linked to a coding sequence, even though they are not contiguous.
- a "functional fragment" of a protein, polypeptide or nucleic acid is a protein, polypeptide or nucleic acid whose sequence is not identical to the full-length protein, polypeptide or nucleic acid, yet retains the same function as the full-length protein, polypeptide or nucleic acid.
- a functional fragment can possess more, fewer, or the same number of residues as the corresponding native molecule, and/or can contain one or more amino acid or nucleotide substitutions.
- Methods for determining the function of a nucleic acid e.g., coding function, ability to hybridize to another nucleic acid
- methods for determining protein function are well-known.
- the B-domain deleted human Factor VIII is a functional fragment of the full-length Factor VIII protein.
- a polynucleotide "vector” or “construct” is capable of transferring gene sequences to target cells.
- vector construct means any nucleic acid construct capable of directing the expression of a gene of interest and which can transfer gene sequences to target cells.
- expression vector means any nucleic acid construct capable of directing the expression of a gene of interest and which can transfer gene sequences to target cells.
- the term includes cloning, and expression vehicles, as well as integrating vectors.
- subject and patient are used interchangeably and refer to mammals such as human patients and non-human primates, as well as experimental animals such as rabbits, dogs, cats, rats, mice, and other animals. Accordingly, the term “subject” or “patient” as used herein means any mammalian patient or subject to which the expression cassettes of the invention can be administered. Subjects of the present invention include those with a disorder.
- expression cassettes for use in directing expression of a transgene in a B cell (including plasmablasts and plasma cells), including in vivo following administration of the expression cassette(s) to the subject ⁇ e.g., intravenous delivery).
- the expression construct may be maintained episomally and drive expression of the transgene extrachromosomally or,
- the expression construct may be integrated into the genome of a B cell, for example by nuclease-mediated targeted integration.
- any suitable promoter sequence can be used in the expression cassettes of the invention.
- the promoter is a constitutive promoter.
- the promoter is inducible and/or is a B cell specific promoter.
- Promoterless constructs in which the transgene is driven by an endogenous B cell promoter are also contemplated for genetic modification of cells as described herein.
- any transgene can be used in the constructs described herein.
- the individual expression construct components (promoter, enhancer, insulator, intron, transgene, etc.) of the constructs described herein may be present or not, and may mixed and matched in any combination.
- constructs described herein may be contained within any viral or non-viral vector.
- the constructs may be maintained episomally or may be integrated into the genome of the cell ⁇ e.g., via nuclease-mediated targeted integration).
- Non-viral vectors include DNA or RNA plasmids, DNA MCs, naked nucleic acid, and nucleic acid complexed with a delivery vehicle such as a liposome, lipid nanoparticle, nanoparticle or poloxamer.
- Viral vectors that may be used to carry the expression cassettes described herein include, but are not limited to, retroviral, lentivirus, adenoviral, adeno-associated viral vectors, vaccinia and herpes simplex virus vectors. Integration in the host genome is possible with the retrovirus, lentivirus, and adeno-associated virus gene transfer methods, and as described herein may be facilitated by nuclease-mediated integration.
- the constructs are included in an adeno-associated virus ("AAV") vector or vector system that may be maintained episomally or integrated into the genome of a B cell (e.g., via nuclease-mediated targeted integration).
- AAV adeno-associated virus
- Construction of recombinant AAV vectors is in a number of publications, including U.S. Pat. No. 5, 173,414; Tratschin et al., Mol. Cell. Biol. 5:3251-3260 (1985); Tratschin, et al., Mol. Cell. Biol. 4:2072-2081 (1984); Hermonat & Muzyczka, PNAS 81 :6466-6470 (1984); and Samulski et al, J. Virol. 63 :03822- 3828 (1989).
- the expression construct is carried on an
- AAV construct and further comprises 5' and 3' ITRs flanking the expression constructs elements ⁇ e.g., enhancer, promoter, optional intron, transgene, etc.) as described herein.
- spacer molecules are also included between one or more of the components of the expression construct, for example, between the 5' ITR and the enhancer and/or between the polyadenylation signal and the 3' ITR.
- the spacers may function as homology arms to facilitate recombination into a safe-harbor locus ⁇ e.g. albumin).
- the construct is a construct as shown in Figure 8.
- the AAV vectors as described herein can be derived from any AAV.
- the AAV vector is derived from the defective and nonpathogenic parvovirus adeno-associated type 2 virus. All such vectors are derived from a plasmid that retains only the AAV 145 bp inverted terminal repeats flanking the transgene expression cassette. Efficient gene transfer and stable transgene delivery due to integration into the genomes of the transduced cell are key features for this vector system. (Wagner et al, Lancet 351.9111 1702-3 (1998), Kearns et al, Gene Ther. 9:748-55 (1996)).
- AAV serotypes including AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9 and AAVrh.10 and any novel AAV serotype can also be used in accordance with the present invention.
- chimeric AAV is used where the viral origins of the ITR sequences of the viral nucleic acid are heterologous to the viral origin of the capsid sequences.
- Non-limiting examples include chimeric vims with ITR derived from AAV2 and capsids derived from AAV5, AAV6, AAV8 or AAV9 (i.e. AAV2/5, AAV2/6, AAV2/8 and AAV2/9, respectively).
- Retroviral vectors include those based upon murine leukemia virus (MuLV), gibbon ape leukemia virus (GaLV), Simian Immunodeficiency virus (SIV), human immunodeficiency virus (HIV), and combinations thereof (see, e.g., Buchscher et al, J. Virol. 66:2731-2739 (1992); Johann et a/., J. Virol. 66: 1635-1640 (1992); Sommerfelt et a/., Virol. 176:58-59 (1990); Wilson et al., J. Virol. 63 :2374-2378 (1989); Miller et al, J. Virol. 65:2220-2224 (1991); PCT/US94/05700).
- MiLV murine leukemia virus
- GaLV gibbon ape leukemia virus
- SIV Simian Immunodeficiency virus
- HAV human immunodeficiency virus
- constructs described herein may also be incorporated into an adenoviral vector system.
- Adenoviral based vectors are capable of very high transduction efficiency in many cell types and do not require cell division. With such vectors, high titer and high levels of expression have been obtained. This vector can be produced in large quantities in a relatively simple system.
- pLASN and MFG-S are examples of retroviral vectors that have been used in clinical trials (Dunbar et al, Blood 85:3048-305 (1995); Kohn et al, Nat. Med. 1 : 1017-102 (1995); Malech et al, PNAS 94:22 12133-12138 (1997)).
- PA317/pLASN was the first therapeutic vector used in a gene therapy trial. (Blaese et al, Science 270:475-480 (1995)). Transduction efficiencies of 50% or greater have been observed for MFG-S packaged vectors. (Ellem et al, Immunol Immunother. 44(1): 10-20 (1997); Dranoff et al, Hum. Gene Ther. 1 : 111-2 (1997).
- Replication-deficient recombinant adenoviral vectors can also be used with the polynucleotides described herein. Most adenovirus vectors are engineered such that a transgene replaces the Ad El a, Elb, and/or E3 genes;
- Ad vectors can transduce multiple types of tissues in vivo, including nondividing, differentiated cells such as those found in liver, kidney and muscle. Conventional Ad vectors have a large carrying capacity.
- An example of the use of an Ad vector in a clinical trial involved polynucleotide therapy for antitumor immunization with intramuscular injection (Sterman et al, Hum. Gene Ther. 7: 1083-9 (1998)). Additional examples of the use of adenovirus vectors for gene transfer in clinical trials include Rosenecker et al, Infection 24: 1 5-10 (1996); Sterman et al, Hum. Gene Ther.
- Packaging cells are used to form virus particles that are capable of infecting a host cell.
- Such cells include HEK293 and Sf9 cells, which can be used to package AAV and adenovirus, and ⁇ 2 cells or PA317 cells, which package retrovirus.
- Viral vectors used in gene therapy are usually generated by a producer cell line that packages a nucleic acid vector into a viral particle.
- the vectors typically contain the minimal viral sequences required for packaging and subsequent integration into a host (if applicable), other viral sequences being replaced by an expression cassette encoding the protein to be expressed. The missing viral functions are supplied in trans by the packaging cell line.
- AAV vectors used in gene therapy typically only possess inverted terminal repeat (ITR) sequences from the AAV genome which are required for packaging and integration into the host genome.
- Viral DNA is packaged in a cell line, which contains a helper plasmid encoding the other AAV genes, namely rep and cap, but lacking ITR sequences.
- the cell line is also infected with adenovirus as a helper.
- the helper virus promotes replication of the AAV vector and expression of AAV genes from the helper plasmid.
- the helper plasmid is not packaged in significant amounts due to a lack of ITR sequences.
- Contamination with adenovirus can be reduced by, e.g., heat treatment to which adenovirus is more sensitive than AAV.
- AAV is produced using a baculovirus expression system (see e.g. U. S. Patents 6,723,551 and
- AAV particles from a 293 or baculovirus system typically involves growth of the cells which produce the virus, followed by collection of the viral particles from the cell supernatant or lysing the cells and collecting the virus from the crude lysate.
- AAV is then purified by methods known in the art including ion exchange chromatography ⁇ e.g. see U. S. Patents 7,419,817 and
- the gene therapy vector be delivered with a high degree of specificity to a particular tissue type.
- a viral vector can be modified to have specificity for a given cell type by expressing a ligand as a fusion protein with a viral coat protein on the outer surface of the virus.
- the ligand is chosen to have affinity for a receptor known to be present on the cell type of interest.
- Han et al Proc. Natl. Acad. Sci. USA 92:9747- 9751 (1995), reported that Moloney murine leukemia virus can be modified to express human heregulin fused to gp70, and the recombinant virus infects certain human breast cancer cells expressing human epidermal growth factor receptor.
- filamentous phage can be engineered to display antibody fragments (e.g., FAB or Fv) having specific binding affinity for virtually any chosen cellular receptor.
- the polynucleotides described herein may include one or more non- natural bases and/or backbones.
- an expression cassette as described herein may include methylated cytosines to achieve a state of transcriptional quiescence in a region of interest.
- the expression constructs as described herein may also include additional transcriptional or translational regulatory or other sequences, for example, Kozak sequences, additional promoters, enhancers, insulators, introns, internal ribosome entry sites, sequences encoding 2A peptides, furin cleavage sites and/or polyadenylation signals.
- additional transcriptional or translational regulatory or other sequences for example, Kozak sequences, additional promoters, enhancers, insulators, introns, internal ribosome entry sites, sequences encoding 2A peptides, furin cleavage sites and/or polyadenylation signals.
- control elements of the genes of interest can be operably linked to reporter genes to create chimeric genes (e.g., reporter expression cassettes).
- Described herein are genetically modified B cells comprising one or more of the following modifications: (a) the provision in the cell of one or more transgenes (episomal and/or integrated in any combinations); (b) insertions and/or deletions in one or more genes which modify (i) B cell receptor genes, and/or (ii) cellular interactions in Germinal Centers; and/or (c) modifications (mutations) that inhibit suppression of any B cell function associated with pathogen infection or cancer regulation. Genetically modified B cells as described herein may also be descended from HSCs comprising one or more of these genetic modifications.
- the constructs described herein can be used for B cell expression of any transgene(s).
- One or more transgenes may be expressed episomally in the modified B cells and/or following nuclease-mediated targeted integration of one or more of the transgenes.
- Exemplary transgenes include, but are not limited to any polypeptide coding sequence (e.g., cDNAs), promoter sequences, enhancer sequences, epitope tags, marker genes, cleavage enzyme recognition sites and/or various types of expression constructs.
- Marker genes include, but are not limited to, sequences encoding proteins that mediate antibiotic resistance (e.g., ampicillin resistance, neomycin resistance, G418 resistance, puromycin resistance), sequences encoding colored or fluorescent or luminescent proteins (e.g., green fluorescent protein, enhanced green fluorescent protein, red fluorescent protein, luciferase), and proteins which mediate enhanced cell growth and/or gene amplification (e.g., dihydrofolate reductase).
- Epitope tags include, for example, one or more copies of FLAG, His, myc, Tap, HA or any detectable amino acid sequence.
- the transgene comprises a polynucleotide encoding any polypeptide of which expression in the cell is desired, including, but not limited to antibodies, antigens, enzymes, receptors (cell surface or nuclear), hormones, lymphokines, cytokines, reporter polypeptides, growth factors, and functional fragments of any of the above.
- the coding sequences may be, for example, cDNAs.
- the transgene(s) encode(s) functional versions of proteins lacking of deficient in any genetic disease, including but not limited to, lysosomal storage disorders (e.g., Gaucher, Fabry, Hunter, Hurler, Neimann-Pick, etc.), metabolic disorders, and/or blood disorders such as hemophilias and
- the transgene may comprise a sequence encoding a polypeptide that is lacking or non-functional in the subject having a genetic disease, including but not limited to any of the following genetic diseases: achondroplasia, achromatopsia, acid maltase deficiency, adenosine deaminase deficiency (OMTM No.102700), adrenoleukodystrophy, aicardi syndrome, alpha- 1 antitrypsin deficiency, alpha-thalassemia, androgen insensitivity syndrome, apert syndrome, arrhythmogenic right ventricular, dysplasia, ataxia telangictasia, barth syndrome, beta-thai as semi a, blue rubber bleb nevus syndrome, canavan disease, chronic granulomatous diseases (CGD), cri du chat syndrome, cystic fibrosis, dercum's disease, ectodermal dysplasia, fanconi anemia, fibrodys
- CCD chronic
- hemochromatosis the hemoglobin C mutation in the 6 th codon of beta-globin (HbC), hemophilia, Huntington's disease, Hurler Syndrome, hypophosphatasia, Klinefleter syndrome, Krabbes Disease, Langer-Giedion Syndrome, leukocyte adhesion deficiency (LAD, OMIM No.
- leukodystrophy long QT syndrome, Marfan syndrome, Moebius syndrome, mucopolysaccharidosis (MPS), nail patella syndrome, nephrogenic diabetes insipdius, neurofibromatosis, Neimann-Pick disease, osteogenesisimperfecta, porphyria, Prader-Willi syndrome, progeria, Proteus syndrome, retinoblastoma, Rett syndrome, Rubinstein-Taybi syndrome, Sanfilippo syndrome, severe combined immunodeficiency (SCID), Shwachman syndrome, sickle cell disease (sickle cell anemia), Smith-Magenis syndrome, Stickler syndrome, Tay- Sachs disease, Thrombocytopenia Absent Radius (TAR) syndrome, Treacher Collins syndrome, trisomy, tuberous sclerosis, Turner's syndrome, urea cycle disorder, von Hippel-Landau disease, Waardenburg syndrome, Williams syndrome, Wilson's disease, Wiskott-Aldrich syndrome
- mucopolysaccahidosis e.g. Hunter disease, Hurler disease
- hemoglobinopathies e.g., sickle cell diseases, HbC, a-thalassemia, ⁇ -thalassemia
- hemophilias e.g., hemophilias.
- Non-limiting examples of proteins that may be expressed as described herein include fibrinogen, prothrombin, tissue factor, Factor V, Factor VII, Factor VIII, Factor IX, Factor X, Factor XI, Factor XII (Hageman factor), Factor XIII (fibrin-stabilizing factor), von Willebrand factor, prekallikrein, high molecular weight kininogen (Fitzgerald factor), fibronectin, antithrombin III, heparin cofactor II, protein C, protein S, protein Z, protein Z-related protease inhibitor, plasminogen, alpha 2- antiplasmin, tissue plasminogen activator, urokinase, plasminogen activator inhibitor- 1, plasminogen activator inhibitor-2, glucocerebrosidase (GBA), a-galactosidase A (GLA), iduronate sulfatase
- reductase/hydroxypyruvate reductase GRHPR
- TTR transthyretin gene
- PAH phenylalanine hydroxylase
- LPL lipoprotein lyase
- the engineered B-cells described herein include one or more transgenes encoding one or more antibodies that are engineered molecules designed to target immune cells via specific molecular targets expressed on cell surfaces.
- the engineered B-cells express antibodies designed to target endogenous B cells. These antibodies may induce antibody meditated killing (e.g., through ADCC or complement mediated killing) of B cells or other immune cells involved in attenuating an immune response.
- B cells as described herein can be genetically modified to produce one or more antibodies that are specific for B cells producing undesirable antibodies.
- B cells producing undesirable antibodies include B cells producing antibodies against proteins administered in ERT (clotting factors such as F8, F9, etc. in hemophilia patients, and/or proteins lacking or deficient in lysosomal storage disorders).
- the antibody-encoding constructs are introduced into the B-cell precursor or B-cell ex vivo, such that when the cell is re-introduced into the patient the antibody producing B-cells specifically target cells (B cells) producing the protein (e.g. antibody) bound by the engineered antibody.
- the engineered antibody is specific for antibodies directed against a therapeutic protein supplied exogenously (via ERT and/or gene therapy) such that the antibodies against the therapeutic proteins are neutralized.
- the compositions and methods described herein include engineered B-cells that produce antibodies that specifically target antibodies (e.g., anti-F9 antibodies) produced by in the patient.
- the engineered B-cells of these compositions and methods may be administered to the subject as mature B-cells, or as precursor cells (such as HSCs or lymphoid progenitor cells) that differentiate in the subject after administration or, alternatively, may be genetically modified in vivo.
- the proteins produced from the transgenes (for example anti-ERT antibodies) of the genetically modified B-cells are isolated an administered to the subject in need thereof, for example a patient in need of antibodies to the anti-ERT antibodies their body has generated.
- the transgene may be an antibody specific for a B cell that is sensitive to a protein involved in an autoimmune disease.
- autoimmune disease refers to any disease or disorder in which the subject mounts a destructive immune response against its own tissues. Autoimmune disorders can affect almost every organ system in the subject ⁇ e.g., human), including, but not limited to, diseases of the nervous, gastrointestinal, and endocrine systems, as well as skin and other connective tissues, eyes, blood and blood vessels.
- autoimmune diseases include, but are not limited to Hashimoto's thyroiditis, Systemic lupus erythematosus, Sjogren's syndrome, Graves' disease, Scleroderma, Rheumatoid arthritis, Multiple sclerosis, Myasthenia gravis and Diabetes.
- the B cells as described herein can comprise a molecule ⁇ e.g., engineered antibody) directed to a B cell population in a subject that is sensitive to (and produces antibodies against) an autoantigen involved in an autoimmune disease, including but not limited to myelin basic protein (MBP), insulin, ANA, joint or muscle proteins, thyroid proteins and the like.
- MBP myelin basic protein
- the transgene can comprise a marker gene (described above), allowing selection of cells that have undergone targeted integration, and a linked sequence encoding an additional functionality.
- marker genes include GFP, drug selection marker(s) and the like.
- constructs described herein may also be used for delivery of non- coding transgenes. Sequences encoding antisense RNAs, RNAi, shRNAs and micro RNAs (miRNAs) may also be used for targeted insertions.
- the transgene includes sequences ⁇ e.g., coding sequences, also referred to as transgenes) greater than 1 kb in length, for example between 2 and 200 kb, between 2 and 10 kb (or any value therebetween).
- the transgene may also include one or more nuclease target sites.
- the transgene may also comprise one or more homology arms.
- the homology arms comprise sequences with a high degree of homology to those flanking a nuclease cleavage target site.
- a homology arm can comprise 50, 100, 200, 500, 1000, 2000 or more nucleotides or any value therebetween.
- the transgene When integrated (e.g., via nuclease-mediate integration), the transgene may be inserted into an endogenous gene such that all, some or none of the endogenous gene is expressed.
- the expression cassettes may be maintained episomally or may be integrated into the genome of the cell. Integration may be random.
- integration of the transgene construct(s) is targeted to a specified gene following cleavage of the target gene by one or more nucleases (e.g., zinc finger nucleases ("ZFNs"), TALENs, TtAgo, CRISPR/Cas nuclease systems, and homing endonucleases) and the construct integrated by either homology directed repair (HDR) or by end capture during non-homologous end joining (HEJ) driven processes.
- ZFNs zinc finger nucleases
- TALENs TALENs
- TtAgo TALENs
- CRISPR/Cas nuclease systems homing endonucleases
- HDR homology directed repair
- HEJ non-homologous end joining
- nuclease can be used for targeted integration of the transgene expression construct.
- the nuclease comprises a zinc finger nuclease
- ZFN which comprises a zinc finger DNA-binding domain and a cleavage (nuclease) domain.
- the nuclease comprises a TALEN, which comprises a TAL-effector DNA binding domain and a cleavage (nuclease) domain. See, e.g., U.S. Patent No. 8,586,526 and U.S. Publication No. 20130196373.
- the nuclease comprises a CRISPR/Cas nuclease system, which includes a single guide RNA for recognition of the target site and one or more cleavage domains. See, e.g., U.S. Patent Publication No.
- the CRISPR-Cpfl system is used (see
- CRISPR/Cas refers to both CRISPR/Cas and CRISPR/Cfpl systems.
- the cleavage domains of the nucleases may be wild-type or mutated, including non-naturally occurring (engineered) cleavage domains that form obligate heterodimers. See, e.g., U.S. Patent Nos. 8,623,618; 7,888, 121; 7,914,796; and 8,034,598 and U.S. Publication No. 20110201055.
- the nuclease(s) may make one or more double-stranded and/or single- stranded cuts in the target site.
- the nuclease comprises a catalytically inactive cleavage domain ⁇ e.g., Fokl and/or Cas protein). See, e.g., U.S.
- the catalytically inactive cleavage domain may, in combination with a catalytically active domain act as a nickase to make a single-stranded cut.
- nickases can be used in combination to make a double-stranded cut in a specific region. Additional nickases are also known in the art, for example,
- the nuclease cleaves a safe harbor gene ⁇ e.g., CCR5, Rosa, albumin, AAVS1, TCRA, TCRB, etc. See, e.g., U.S. Patent Nos.
- the nuclease cleaves an endogenous albumin gene such that the expression cassette is integrated into the endogenous albumin locus of a liver cell.
- Albumin-specific nucleases are described, for example, in U.S. Patent No. 9,150,847; and U.S.
- nucleases may be delivered in vivo by any suitable means into any cell type, preferably to the spleen or secondary lymph nodes.
- nucleases when used in combination with nucleases for targeted integration, the nucleases may be delivered in polynucleotide and/or protein form, for example using non-viral vector(s), viral vectors(s) and/or in RNA form, e.g., as mRNA.
- Methods of non-viral delivery of nucleic acids include electroporation, lipofection, microinjection, biolistics, virosomes, liposomes, lipid nanoparticles, immunoliposomes, other nanoparticle, poly cation or lipid:nucleic acid conjugates, naked DNA, artificial virions, and agent-enhanced uptake of DNA. Sonoporation using, e.g., the Sonitron 2000 system (Rich-Mar) can also be used for delivery of nucleic acids. Additional exemplary nucleic acid delivery systems include those provided by Amaxa Biosystems (Cologne, Germany), Maxcyte, Inc. (Rockville, Maryland), BTX Molecular Delivery Systems (Holliston, MA) and Copernicus Therapeutics Inc., ⁇ see for example US6008336).
- the expression constructs are AAV vectors.
- the optional nucleases may be administered in mRNA form or using one or more viral vectors (AAV, Ad, etc.). Administration can be by any means in which the polynucleotides are delivered to the desired target cells. Both in vivo and ex vivo methods are contemplated. Intravenous injection in a peripheral blood vessel is a preferred method of administration. Other in vivo administration modes include, for example, direct injection into tissues comprising B cells including lymph nodes, bone marrow, plasma, lymphatic system and the spleen.
- the two or more polynucleotide(s) are delivered using one or more of the same and/or different vectors.
- the nuclease in polynucleotide form may be delivered in mRNA form and the B-cell-specific constructs as described herein may be delivered via other modalities such as viral vectors ⁇ e.g., AAV), minicircle DNA, plasmid DNA, linear DNA, liposomes, lipid nanoparticles, nanoparticles and the like.
- compositions are determined in part by the particular composition being administered, as well as by the particular method used to administer the composition. Accordingly, there is a wide variety of suitable formulations of pharmaceutical compositions available, as described below (see, e.g., Remington 's Pharmaceutical Sciences, 17th ed., 1989).
- the effective amount of expression cassette (and optional nuclease(s), and/or modified cells) to be administered will vary from patient to patient.
- compositions e.g., cells
- appropriate dosages can be determined readily by one of ordinary skill in the art.
- Analysis of the serum, plasma or other tissue levels of the therapeutic polypeptide and comparison to the initial level prior to administration can determine whether the amount being administered is too low, within the right range or too high.
- Suitable regimes for initial and subsequent administrations are also variable, but are typified by an initial administration followed by subsequent administrations if necessary. Subsequent administrations may be administered at variable intervals, ranging from daily to annually to every several years.
- Formulations for both ex vivo and in vivo administrations include suspensions (e.g., of genetically modified cells, liposomes, lipid nanoparticles or nanoparticles) in liquid or emulsified liquids.
- the active ingredients often are mixed with excipients which are pharmaceutically acceptable and compatible with the active ingredient. Suitable excipients include, for example, water, saline, dextrose, glycerol, ethanol or the like, and combinations thereof.
- the composition may contain minor amounts of auxiliary substances, such as, wetting or emulsifying agents, pH buffering agents, stabilizing agents or other reagents that enhance the effectiveness of the pharmaceutical composition.
- the methods and compositions disclosed herein are for providing therapies for any disease by provision of a transgene that expresses a product that is lacking or deficient in the disease or otherwise treats or prevents the disease.
- the cell may be modified in vivo or may be modified ex vivo and subsequently administered to a subject.
- the methods and compositions provide for the treatment and/or prevention of such genetic diseases.
- the methods and compositions disclosed herein allow for modification of B cells such that these cells exhibit modified toxicity, antibody production and/or processing characteristics.
- nuclease comprises a zinc finger nuclease (ZFN).
- ZFN zinc finger nuclease
- STEMCELL Technologies (Vancouver, Canada). An in vitro B cell differentiation culture system (see Figure 1) has been described previously (Jourdan et al, ibid). All cultures were performed in Iscove's Modified Dulbecco's Medium (Corning, Corning, NY) and 10% fetal bovine serum (VWR, Radnor, PA).
- Cells were cultured in a 24-well plate at a density of 2.0E+5 cells per well in 0.5 mL of culture media. Cells were thawed and cultured for 4 days in B cell Activation Media containing Anti-His Ab (5 ⁇ g/mL), ODN (10 ⁇ g/mL), sCD40L (50 ng/mL), IL-2 (10 ng/mL), IL-10 (50 ng/mL), and IL-15 (10 ng/mL).
- B cell Activation Media containing Anti-His Ab (5 ⁇ g/mL), ODN (10 ⁇ g/mL), sCD40L (50 ng/mL), IL-2 (10 ng/mL), IL-10 (50 ng/mL), and IL-15 (10 ng/mL).
- PB Plasma Blast
- IL-2 10 ng/mL
- IL-6 40-50 ng/mL
- IL-10 50ng/mL
- IL-15 10 ng/mL
- PC Plasma Cell
- ZFNs were designed to target TCRA (TRAC, SBS53909 and
- TRAC ZFN mRNA was produced from linear DNA templates (one for each ZFN) via PCR amplification of ZFN-encoding sequence with Accuprime PFX DNA Polymerase Kit (Invitrogen, Carlsbad, CA). PCR products were used as templates for mRNA synthesis. mRNA was prepared using the mMESSAGE mMACHINE T7 ULTRA Kit (Life Technologies, Carlsbad, CA) per manufacturer's protocol.
- RNA encoding the ZFN was used as template for mRNA synthesis, incubated at 37 °C for two hours in supplied buffer, followed by DNAse digestion supplied with kit.
- the in vitro poly-A tailing reaction was not performed because a poly-T tail was incorporated on the DNA template during PCR generation of the TRAC template.
- the AAVSl and CCR5 templates contain a poly-T template in the vector.
- mRNA was then purified using the RNeasy Mini Kit (Qiagen, Carlsbad, CA) per the manufacturer's protocol and quantified on the Nanodrop 8000 (ThermoScientific, Waltham, MA).
- the primers used for the mRNA templates were Forward Primer: 5' GCAGAGCTCTCTGGCTAACTAGAG (SEQ ID NO: l) and Reverse Primer:
- AAV donor templates for AAVSl, CCR5 and TRAC contained homology arms to their target loci.
- AAVSl had a left and right homology arm of 801 and 568 base pairs in length, respectively.
- CCR5 had a left and right homology arm of 473 and 1431 base pairs in length, respectively.
- TRAC had a left and right homology arm of 925 and 989 base pairs in length, respectively.
- a GFP expression cassette comprising a promoter, a GFP sequence and a human growth hormone polyadenylation signal (hGHpA) was cloned in between the right and left homology arms.
- hGHpA human growth hormone polyadenylation signal
- the promoter was either a phosphoglycerate kinase (PGK) or B cell specific (EEK) promoter.
- the B cell specific (EEK) promoter consisted of a 3 '-enhancer, a MAR, and an intronic enhancer upstream of human ⁇ light chain promoter (Luo et al (2009) Blood 113 : 1422-1431).
- the TRAC donor template was cloned into a pAAV vector.
- AAVS1 and CCR5 donors templates were cloned into a customized plasmid pRS165 (Lombardo et al (2011) Nat Methods 8:861-869; Wang et al (2012) Genome Res 22: 1316-1326) derived from pAAV-MCS (Agilent Technologies, Santa Clara, CA).
- AAV2 inverted terminal repeats (ITRs) were used to enable packaging as AAV vectors using the triple-transfection method (Xiao and Samulski (1998) J. Virol 72:2224-2232).
- HEK 293 cells were plated in 10-layer CellSTACK chambers (Corning, Acton, MA), grown for 3 days to a density of 80%, then transfected using the calcium phosphate method with an AAV helper plasmid expressing AAV2 Rep and serotype specific Cap genes, an adenovirus helper plasmid, and an ITR-containing donor vector plasmid. After 3 days the cells were lysed by three rounds of freeze/thaw, and cell debris removed by centrifugation. AAV vectors were precipitated from the lysates using polyethylene glycol, and purified by ultracentrifugation overnight on a cesium chloride gradient. Vectors were formulated by dialysis and filter sterilized.
- IgM, IgG, IgA were assayed using commercial enzyme-linked immunosorbent assay (ELISA) kits (Bethyl Laboratories; Montgomery, TX) according to the manufacture's protocol. Briefly, supernatant was added to the plate, incubated with rocking at room temperature for one hour, followed by washing four times with buffer provided in the kit. Detecting antibody provided with the kit was added and incubated for 1 hour at room
- the CD 19+ B cells were thawed and cultured as described above and illustrated in Figure 1. Culture supematants were collected on days t4, t7 and tlO and total IgM, IgG and IgA were detected by ELISA as described above.
- the cultured B cells were treated with mRNAs encoding a transgene (GFP) to determine the best time frame for introduction of the mRNA.
- the CD 19+ B cells (2.0E+05 cells) were electroporated with 2 ⁇ g GFP mRNA at days tO, tl, t2 or t3, where tO is the day the cells were thawed ( Figure 1).
- the electroporated cells were analyzed by FACs analysis where the gating was performed as shown in Figure 4.
- the results ( Figures 3 A-3D) demonstrated that electroporation at day t2 resulted in the highest GFP expression so this time frame was chosen for the follow-on studies.
- ZFNs specific for three loci, AAVS1, CCR5 and TCRA were used to cleave their targets in the cultured B cells.
- CD 19+ B cells were thawed and cultured for 2 days in B cell Activation Media. The cells were washed 2 times with DPBS then resuspended in BTXpress high performance electroporation solution (Harvard Apparatus, Holliston, MA) to a final density of 2.0E+6 cells/mL. Cells (100 ⁇ .) and electroporation solution were mixed with ZFN mRNA (4 ⁇ g) followed by
- the CCR5 amplicon was:
- the TCRA amplicon was:
- Example 5 B cell AAV serotype transduction comparison
- AAV virus comprising a transgene (GFP) expression cassette were used to compare the ability of different AAV serotypes to transduce the cultured B cells.
- GFP transgene
- cells were thawed and cultured for 2 days in B cell Activation Media in a 24-well plate at a density of 2.0E+5 cells/well. Cells were collected, counted and then plated in a 24-well plate at a density of 2.0E+5 cells/well.
- B cells were transduced with AAV serotypes 2, 5, 6, 8 and 9 at vector doses of 2.4E+6, 1.2E+6, 6.0E+5, 3.0E+5 vector genomes (vg)/cell.
- AAV vector genomes contained CMV promoter-driven eGFP expression cassette and inverted terminal repeats (ITRs), see Figure 7B.
- ITRs inverted terminal repeats
- GFP transgene donor
- Figure 8 comprising a GFP transgene flanked by homology arms where the arms had homology to the region surrounding either the AAVSl, CCR5 or TCRA cleavage target.
- two different promoters either PGK or EEK were tested.
- CD 19+ B cells were thawed and cultured for 2 days in B cell
- Activation Media A combination of ZFN mRNA and AAV donor or mRNA donor targeting the same loci (AAVSl, TCRA, CCR5, albumin, HPRT, etc.) was used. The cells were washed 2 times with DPBS then resuspended in BTXpress high performance electroporation solution (Harvard Apparatus, Holliston, MA) to a final density of 2.0E+6 cells/mL.
- cell culture was harvested, 25 ⁇ _, of cell culture was collected, mixed with DPBS (175 ⁇ ) for flow cytometry analysis, the remaining cell culture was spun down in a table top centrifuge, supernatants collected, and cells washed with DPBS before being transferred to Plasma Blast Generation Media.
- cell culture was harvested, 25 ⁇ _, of cell culture was collected, mixed with DPBS (175 ⁇ ) for flow cytometry analysis, the remaining cell culture was spun down in a table top centrifuge, supernatants collected and cells washed with DPBS before being transferred to Plasma Cells Generation Media.
- cell culture (25 ⁇ ⁇ from the 500 ⁇ ⁇ in a single well of a 24- well plate) was collected and mixed with PBS (175 ⁇ ) for flow cytometry analysis, the remaining cell culture was spun down in a table top centrifuge, supernatants collected, cells washed with DPBS and harvested for gDNA.
- AAVS1 Reverse 1 5' GTGTGTCACCAGATAAGGAATCTG (SEQ ID NO: 1
- Step 2 PCR Primers:
- AAVS1 Forward 2 5' CGTCTCTCTCCTGAGTCCG (SEQ ID NO: 1
- AAVS1 Reverse 2 5' GTGTGTCACCAGATAAGGAATCTG (SEQ ID NO: 1
- CCR5 Forward 1 5' GCTCTACTCACTGGTGTTCATCTTT (SEQ ID NO: 12) .
- CCR5 Reverse 1 5' CTCTGTCTCCTTCTACAGCCAAGC (SEQ ID NO: 1' CTCTGTCTCCTTCTACAGCCAAGC (SEQ ID NO: 1' CTCTGTCTCCTTCTACAGCCAAGC (SEQ ID NO: 1
- CCR5 Reverse 2 5' CCAGCAATAGATGATCCAACTCAAATTCC
- a titration comparing varying amounts of the AAV-donor construct was carried out using a constant dose of ZFN mRNA.
- the culture B cells were treated with 4 ⁇ of TCRA (TRAC)-specific ZFN by electroporation, and then transduced with a range of donor AAV, from 3.0E+05 to 2.4E+06 vg/cell.
- TCRA TCRA
- IgG and IgM levels were analyzed by ELISA as described above for the cultured B cells that had undergone electroporation for delivery of the ZFN pairs and also GFP donor.
- the results demonstrate that the levels of antibodies produced by the B cells was not highly impacted by electroporation or by electroporation followed by AAV-donor transduction.
- Example 8 Potential booster function of AAV in cultured B cells
- Example 9 Boost of transgene expression following AAV2 exposure in vivo.
- Transgene donor cassettes are constructed for insertion of a transgene downstream of a B cell promoter.
- the B cells are treated ex vivo with a specific nuclease, and a donor construct comprising an antibody specific promoter linked to a transgene of interest.
- B cells chosen for this work are previously verified to produce anti-AAV2 antibodies.
- the cells are reintroduced into a subject and after a short period of time for engraftment, the subject is treated with AAV2, or AAV2 peptides.
- the AAV boost upregulates the antibody promoter causing a spike in transgene expression.
- Example 10 B cell modification by targeted integration of B cell-specific antibody
- Transgene donor cassettes are constructed for insertion of an antibody-encoding transgenes in which the antibody is(are) specific for B cell producing undesirable antibodies (e.g. inhibitors) against a protein delivered by ERT (or an autoantigen), for example B cell producing antibodies against a clotting factor such as F9 (anti-F9 antibodies).
- Donor cassettes can include homology arms to nuclease target loci (e.g., albumin, TCRA, CCR5, AAVSl, etc.) and are administered in vivo in combination with the suitable nuclease and/or ex vivo to B cell populations (mature, stem and/or B-cell progenitor cell populations) to a subject in need thereof (hemophilia patient with anti-F9 antibodies).
- nuclease target loci e.g., albumin, TCRA, CCR5, AAVSl, etc.
- the antibody-producing B cells secrete the targeted antibodies which bind to the B cells producing the undesirable antibodies. These targeted antibodies then mediate lysis through mobilization and activation of antibody-dependent cytotoxic cells or though complement mediated lysis. Thus, in the patient these introduced B cells cause a reduction in the endogenous B cells that are producing undesirable antibodies for example, against proteins delivered by ERT or the autoantigen.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Veterinary Medicine (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Epidemiology (AREA)
- Zoology (AREA)
- Immunology (AREA)
- Organic Chemistry (AREA)
- Cell Biology (AREA)
- Wood Science & Technology (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- General Engineering & Computer Science (AREA)
- Hematology (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Developmental Biology & Embryology (AREA)
- Virology (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Mycology (AREA)
- Gastroenterology & Hepatology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Diabetes (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Priority Applications (12)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201880021264.1A CN110536963A (zh) | 2017-01-26 | 2018-01-25 | B细胞工程改造 |
| CA3051113A CA3051113A1 (en) | 2017-01-26 | 2018-01-25 | B-cell engineering |
| EP18744407.0A EP3573464A4 (en) | 2017-01-26 | 2018-01-25 | B CELL ENGINEERING |
| RU2019126606A RU2783116C2 (ru) | 2017-01-26 | 2018-01-25 | Модификация b-клеток |
| MX2019008844A MX2019008844A (es) | 2017-01-26 | 2018-01-25 | Ingenieria de celulas b. |
| KR1020197023790A KR20190111063A (ko) | 2017-01-26 | 2018-01-25 | B-세포 조작 |
| AU2018212652A AU2018212652B2 (en) | 2017-01-26 | 2018-01-25 | B-cell engineering |
| BR112019015355A BR112019015355A2 (pt) | 2017-01-26 | 2018-01-25 | modificação genética de células b |
| JP2019540095A JP2020505044A (ja) | 2017-01-26 | 2018-01-25 | B細胞操作 |
| IL268110A IL268110B2 (en) | 2017-01-26 | 2018-01-25 | B-cell engineering |
| US16/480,939 US20190352614A1 (en) | 2017-01-26 | 2018-01-25 | B-cell engineering |
| JP2022173206A JP2022191524A (ja) | 2017-01-26 | 2022-10-28 | B細胞操作 |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201762450917P | 2017-01-26 | 2017-01-26 | |
| US62/450,917 | 2017-01-26 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2018140573A1 true WO2018140573A1 (en) | 2018-08-02 |
Family
ID=62979713
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2018/015180 Ceased WO2018140573A1 (en) | 2017-01-26 | 2018-01-25 | B-cell engineering |
Country Status (11)
| Country | Link |
|---|---|
| US (1) | US20190352614A1 (https=) |
| EP (1) | EP3573464A4 (https=) |
| JP (2) | JP2020505044A (https=) |
| KR (1) | KR20190111063A (https=) |
| CN (1) | CN110536963A (https=) |
| AU (1) | AU2018212652B2 (https=) |
| BR (1) | BR112019015355A2 (https=) |
| CA (1) | CA3051113A1 (https=) |
| IL (1) | IL268110B2 (https=) |
| MX (1) | MX2019008844A (https=) |
| WO (1) | WO2018140573A1 (https=) |
Cited By (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110536963A (zh) * | 2017-01-26 | 2019-12-03 | 桑格摩生物治疗股份有限公司 | B细胞工程改造 |
| US10704021B2 (en) | 2012-03-15 | 2020-07-07 | Flodesign Sonics, Inc. | Acoustic perfusion devices |
| US10785574B2 (en) | 2017-12-14 | 2020-09-22 | Flodesign Sonics, Inc. | Acoustic transducer driver and controller |
| EP3595681A4 (en) * | 2017-03-16 | 2020-12-16 | Seattle Children's Hospital (DBA Seattle Children's Research Institute) | TRANSPLANT CELL-BASED IMMUNOTHERAPY FOR LONG-PERIOD ADMINISTRATION OF THERAPEUTIC PROTEIN |
| US10975368B2 (en) | 2014-01-08 | 2021-04-13 | Flodesign Sonics, Inc. | Acoustophoresis device with dual acoustophoretic chamber |
| WO2021085504A1 (ja) * | 2019-11-01 | 2021-05-06 | 京都府公立大学法人 | B細胞抗体受容体、及びその利用 |
| US11214789B2 (en) | 2016-05-03 | 2022-01-04 | Flodesign Sonics, Inc. | Concentration and washing of particles with acoustics |
| US11377651B2 (en) | 2016-10-19 | 2022-07-05 | Flodesign Sonics, Inc. | Cell therapy processes utilizing acoustophoresis |
| US11708572B2 (en) | 2015-04-29 | 2023-07-25 | Flodesign Sonics, Inc. | Acoustic cell separation techniques and processes |
| US11913023B2 (en) | 2020-03-31 | 2024-02-27 | Walking Fish Therapeutics, Inc. | Modified B cells and methods of use thereof |
| US12214023B2 (en) | 2018-10-18 | 2025-02-04 | Intellia Therapeutics, Inc. | Compositions and methods for expressing factor IX |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2023192936A2 (en) * | 2022-03-30 | 2023-10-05 | Fred Hutchinson Cancer Center | Systems and methods to produce b cells that express selected antibodies and gene products |
| WO2024151683A2 (en) * | 2023-01-09 | 2024-07-18 | Walking Fish Therapeutics, Inc. | HUMAN B CELL ENGINEERED TO EXPRESS IgA AND IgM ANTIBODIES FOR THERAPEUTIC USE |
| WO2024196669A2 (en) * | 2023-03-17 | 2024-09-26 | Walking Fish Therapeutics, Inc. | Methods for in vivo editing of b cells |
| WO2024220447A2 (en) * | 2023-04-17 | 2024-10-24 | Be Biopharma, Inc. | Engineered cell preparations for treatment of niemann pick b disease |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20110287532A1 (en) * | 2004-09-22 | 2011-11-24 | St. Jude Children's Research Hospital | Expression of factor ix in gene therapy vectors |
| US20160376373A1 (en) * | 2015-06-24 | 2016-12-29 | Janssen Biotech, Inc. | Immune Modulation and Treatment of Solid Tumors with Antibodies that Specifically Bind CD38 |
| US20170016027A1 (en) * | 2015-07-13 | 2017-01-19 | Sangamo Biosciences, Inc. | Delivery methods and compositions for nuclease-mediated genome engineering |
| US20170202931A1 (en) * | 2016-01-15 | 2017-07-20 | Sangamo Therapeutics, Inc. | Methods and compositions for the treatment of neurologic disease |
Family Cites Families (15)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU2003901511A0 (en) * | 2003-03-28 | 2003-04-17 | Bionomics Limited | Nucleic acid molecules associated with angiogenesis II |
| EP2419511B1 (en) * | 2009-04-09 | 2018-01-17 | Sangamo Therapeutics, Inc. | Targeted integration into stem cells |
| CN105683376A (zh) * | 2013-05-15 | 2016-06-15 | 桑格摩生物科学股份有限公司 | 用于治疗遗传病状的方法和组合物 |
| WO2016014837A1 (en) * | 2014-07-25 | 2016-01-28 | Sangamo Biosciences, Inc. | Gene editing for hiv gene therapy |
| DK3194570T3 (da) * | 2014-09-16 | 2021-09-13 | Sangamo Therapeutics Inc | Fremgangsmåder og sammensætninger til nukleasemedieret genommodificering og -korrektion i hæmatopoietiske stamceller |
| DK3234107T3 (da) * | 2014-12-19 | 2022-10-17 | Immusoft Corp | B-celler til in vivo-levering af terapeutiske midler |
| CA2981077A1 (en) * | 2015-04-03 | 2016-10-06 | Dana-Farber Cancer Institute, Inc. | Composition and methods of genome editing of b-cells |
| BR112019015355A2 (pt) * | 2017-01-26 | 2020-05-19 | Sangamo Therapeutics Inc | modificação genética de células b |
| SG11201909058WA (en) * | 2017-04-10 | 2019-10-30 | Immatics Biotechnologies Gmbh | Peptides and combination of peptides for use in immunotherapy against leukemias and other cancers |
| CA3066641A1 (en) * | 2017-06-16 | 2018-12-20 | Sangamo Therapeutics, Inc. | Targeted disruption of t cell and/or hla receptors |
| AU2018313167A1 (en) * | 2017-08-08 | 2020-02-27 | Sangamo Therapeutics, Inc. | Chimeric antigen receptor mediated cell targeting |
| BR112020008568A2 (pt) * | 2017-11-09 | 2020-10-06 | Sangamo Therapeutics, Inc. | modificação genética de gene de proteína contendo sh2 indutível por citoquina (cish) |
| US20230158070A1 (en) * | 2018-01-30 | 2023-05-25 | Cellectis | Combination comprising allogeneic immune cells deficient for an antigen present on both t-cells and pathological cells and therapeutic antibody against said antigen |
| CA3111087A1 (en) * | 2018-08-29 | 2020-03-05 | Nanjing Legend Biotech Co., Ltd. | Anti-mesothelin chimeric antigen receptor (car) constructs and uses thereof |
| WO2020112860A1 (en) * | 2018-11-30 | 2020-06-04 | Intima Bioscience, Inc. | Methods of identifying immunomodulatory genes |
-
2018
- 2018-01-25 BR BR112019015355A patent/BR112019015355A2/pt not_active IP Right Cessation
- 2018-01-25 WO PCT/US2018/015180 patent/WO2018140573A1/en not_active Ceased
- 2018-01-25 US US16/480,939 patent/US20190352614A1/en not_active Abandoned
- 2018-01-25 KR KR1020197023790A patent/KR20190111063A/ko not_active Ceased
- 2018-01-25 MX MX2019008844A patent/MX2019008844A/es unknown
- 2018-01-25 CA CA3051113A patent/CA3051113A1/en active Pending
- 2018-01-25 AU AU2018212652A patent/AU2018212652B2/en not_active Ceased
- 2018-01-25 CN CN201880021264.1A patent/CN110536963A/zh active Pending
- 2018-01-25 EP EP18744407.0A patent/EP3573464A4/en not_active Withdrawn
- 2018-01-25 IL IL268110A patent/IL268110B2/en unknown
- 2018-01-25 JP JP2019540095A patent/JP2020505044A/ja not_active Withdrawn
-
2022
- 2022-10-28 JP JP2022173206A patent/JP2022191524A/ja active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20110287532A1 (en) * | 2004-09-22 | 2011-11-24 | St. Jude Children's Research Hospital | Expression of factor ix in gene therapy vectors |
| US20160376373A1 (en) * | 2015-06-24 | 2016-12-29 | Janssen Biotech, Inc. | Immune Modulation and Treatment of Solid Tumors with Antibodies that Specifically Bind CD38 |
| US20170016027A1 (en) * | 2015-07-13 | 2017-01-19 | Sangamo Biosciences, Inc. | Delivery methods and compositions for nuclease-mediated genome engineering |
| US20170202931A1 (en) * | 2016-01-15 | 2017-07-20 | Sangamo Therapeutics, Inc. | Methods and compositions for the treatment of neurologic disease |
Non-Patent Citations (3)
| Title |
|---|
| AHANGARANI ET AL.: "In Vivo Induction of Type 1-Like Regulatory T Cells Using Genetically Modified B Cells Confers Long-Term IL -10-Dependent Antigen-Specific Unresponsiveness", THE JOURNAL OF IMMUNOLOGY, vol. 183, no. 12, 15 December 2009 (2009-12-15), pages 8232 - 8243, XP055531512 * |
| STASI ET AL.: "Selective B- cell depletion with rituximab for the treatment of patients with acquired hemophilia", BLOOD, vol. 103, no. 12, 15 June 2004 (2004-06-15), pages 4424 - 4428, XP055519642 * |
| WANG ET AL.: "Immune tolerance induction to factor IX through B cell gene transfer: TLR9 signaling delineates between tolerogenic and immunogenic B cells", MOLECULAR THERAPY, vol. 22, no. 6, 1 June 2014 (2014-06-01), pages 1139 - 1150, XP055519644 * |
Cited By (14)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10704021B2 (en) | 2012-03-15 | 2020-07-07 | Flodesign Sonics, Inc. | Acoustic perfusion devices |
| US10975368B2 (en) | 2014-01-08 | 2021-04-13 | Flodesign Sonics, Inc. | Acoustophoresis device with dual acoustophoretic chamber |
| US11708572B2 (en) | 2015-04-29 | 2023-07-25 | Flodesign Sonics, Inc. | Acoustic cell separation techniques and processes |
| US11214789B2 (en) | 2016-05-03 | 2022-01-04 | Flodesign Sonics, Inc. | Concentration and washing of particles with acoustics |
| US11377651B2 (en) | 2016-10-19 | 2022-07-05 | Flodesign Sonics, Inc. | Cell therapy processes utilizing acoustophoresis |
| CN110536963A (zh) * | 2017-01-26 | 2019-12-03 | 桑格摩生物治疗股份有限公司 | B细胞工程改造 |
| EP3595681A4 (en) * | 2017-03-16 | 2020-12-16 | Seattle Children's Hospital (DBA Seattle Children's Research Institute) | TRANSPLANT CELL-BASED IMMUNOTHERAPY FOR LONG-PERIOD ADMINISTRATION OF THERAPEUTIC PROTEIN |
| US11939594B2 (en) | 2017-03-16 | 2024-03-26 | Seattle Children's Hospital | Engraftable cell-based immunotherapy for long-term delivery of therapeutic proteins |
| US10785574B2 (en) | 2017-12-14 | 2020-09-22 | Flodesign Sonics, Inc. | Acoustic transducer driver and controller |
| US12214023B2 (en) | 2018-10-18 | 2025-02-04 | Intellia Therapeutics, Inc. | Compositions and methods for expressing factor IX |
| WO2021085504A1 (ja) * | 2019-11-01 | 2021-05-06 | 京都府公立大学法人 | B細胞抗体受容体、及びその利用 |
| JP7656830B2 (ja) | 2019-11-01 | 2025-04-04 | 京都府公立大学法人 | B細胞抗体受容体、及びその利用 |
| US11913023B2 (en) | 2020-03-31 | 2024-02-27 | Walking Fish Therapeutics, Inc. | Modified B cells and methods of use thereof |
| US12037604B2 (en) | 2020-03-31 | 2024-07-16 | Walking Fish Therapeutics, Inc. | Modified B cells and methods of use thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| KR20190111063A (ko) | 2019-10-01 |
| JP2020505044A (ja) | 2020-02-20 |
| EP3573464A1 (en) | 2019-12-04 |
| RU2019126606A3 (https=) | 2021-06-11 |
| CN110536963A (zh) | 2019-12-03 |
| IL268110B1 (en) | 2023-09-01 |
| IL268110A (en) | 2019-09-26 |
| MX2019008844A (es) | 2019-09-10 |
| BR112019015355A2 (pt) | 2020-05-19 |
| US20190352614A1 (en) | 2019-11-21 |
| IL268110B2 (en) | 2024-01-01 |
| AU2018212652A1 (en) | 2019-08-01 |
| JP2022191524A (ja) | 2022-12-27 |
| AU2018212652B2 (en) | 2024-03-28 |
| CA3051113A1 (en) | 2018-08-02 |
| EP3573464A4 (en) | 2020-12-30 |
| RU2019126606A (ru) | 2021-02-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU2018212652B2 (en) | B-cell engineering | |
| US20230119850A1 (en) | Liver-specific constructs, factor viii expression cassettes and methods of use thereof | |
| US11634463B2 (en) | Methods and compositions for treating hemophilia | |
| EP3058072B1 (en) | Delivery methods and compositions for nuclease-mediated genome engineering | |
| EP3322297B1 (en) | Delivery methods and compositions for nuclease-mediated genome engineering | |
| RU2783116C2 (ru) | Модификация b-клеток | |
| RU2774874C2 (ru) | Печень-специфичные конструкции, экспрессионные кассеты фактора viii и способы их применения | |
| HK1226756B (zh) | 用於治疗血友病的方法和组合物 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 18744407 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 3051113 Country of ref document: CA |
|
| ENP | Entry into the national phase |
Ref document number: 2019540095 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2018212652 Country of ref document: AU Date of ref document: 20180125 Kind code of ref document: A |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112019015355 Country of ref document: BR |
|
| ENP | Entry into the national phase |
Ref document number: 20197023790 Country of ref document: KR Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 2018744407 Country of ref document: EP Effective date: 20190826 |
|
| ENP | Entry into the national phase |
Ref document number: 112019015355 Country of ref document: BR Kind code of ref document: A2 Effective date: 20190725 |
|
| WWW | Wipo information: withdrawn in national office |
Ref document number: 2018744407 Country of ref document: EP |