WO2018135761A1 - Antifouling composition for skin, containing extract of nymphoides sp. plant as active ingredient - Google Patents
Antifouling composition for skin, containing extract of nymphoides sp. plant as active ingredient Download PDFInfo
- Publication number
- WO2018135761A1 WO2018135761A1 PCT/KR2017/014764 KR2017014764W WO2018135761A1 WO 2018135761 A1 WO2018135761 A1 WO 2018135761A1 KR 2017014764 W KR2017014764 W KR 2017014764W WO 2018135761 A1 WO2018135761 A1 WO 2018135761A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- skin
- composition
- nymphoides
- extract
- plant
- Prior art date
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K8/00—Cosmetics or similar toiletry preparations
- A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
- A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
- A61K8/31—Hydrocarbons
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K8/00—Cosmetics or similar toiletry preparations
- A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
- A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
- A61K8/33—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds containing oxygen
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K8/00—Cosmetics or similar toiletry preparations
- A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
- A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
- A61K8/40—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds containing nitrogen
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K8/00—Cosmetics or similar toiletry preparations
- A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
- A61K8/96—Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution
- A61K8/97—Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution from algae, fungi, lichens or plants; from derivatives thereof
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
- A61Q19/00—Preparations for care of the skin
Definitions
- Example 1 when treated with benzopyrene, when the composition of Example 1 was treated with 75 ⁇ g / ml, it was confirmed that the cell viability superior to 35.85% or more compared to the group treated with benzopyrene alone (FIG. 1).
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- General Health & Medical Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- Epidemiology (AREA)
- Birds (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Botany (AREA)
- Biotechnology (AREA)
- Engineering & Computer Science (AREA)
- Emergency Medicine (AREA)
- Dermatology (AREA)
- Cosmetics (AREA)
- Medicines Containing Plant Substances (AREA)
Abstract
Disclosed in the present specification are an antifouling composition for the skin and a composition for protecting skin cells, the compositions containing an extract of Nymphoides sp. plant as an active ingredient. The compositions have an anti-fouling effect which protects the skin from chemical substances that are toxic to skin cells. Particularly, when the compositions are applied to the skin to which toxic chemical substances have been applied, skin cell death caused by chemical substances can be minimized and the synthesis of filaggrin can be increased, such that the condition of skin having deteriorated because of toxic chemical substances can be improved.
Description
본 명세서에는 어리연꽃속 식물 추출물을 유효성분으로 함유하는 피부 안티폴루션용 조성물, 및 피부 세포 보호용 조성물이 개시된다.Disclosed herein is a composition for skin antipollution, and a composition for protecting skin cells, which contains the extract of S. aureus as an active ingredient.
피부는 외부 환경에 직접적으로 노출되는 신체 부위로서, 우리 몸의 중요한 기관들을 외부로부터 보호하는 보호막 역할을 할 뿐만 아니라, 수분 증발을 조절하고 외부 감염으로부터 몸을 보호하는 역할을 한다. 그러나, 현대인들의 피부는 산업화와 함께 개발된 각종 화학물질들의 제조 과정 또는 폐기 과정에서 발생하는 공해물질과, 강한 자외선에 끊임없이 노출되면서, 홍반, 부종, 가려움 등의 피부 트러블과 급격한 피부 노화를 호소하는 사례가 증가하고 있다. 이러한 피부 트러블은 미관상 문제가 될 뿐만 아니라, 염증 반응 과정에서 생성되는 물질들이 부수적으로 피부의 색소 침착을 일으키고, 피부 탄력 섬유의 붕괴를 촉진시켜 피부 주름 증가에까지 영향을 미치는 것으로 알려져 있다. 이와 관련하여, 자외선을 차단하기 위한 화장품 개발은 활발히 이루어지고 있으나, 화학물질로부터 피부를 보호하기 위한 제품의 개발은 아직 미미한 실정이다. 최근 피부에 오염물질 또는 공해물질의 침투나 부착을 방지하기 위한 화장품이나, 오염물질 세정력이 강화된 세정제 등이 개발되고 있으나, 이러한 제품들은 오염물질의 피부 침투 방지력이 미미하며, 단지 피부로부터 오염원을 제거하는데 불과하여 오염물질로부터 피부를 근본적으로 보호하지 못한다는 한계가 있으며, 화학물질을 주성분으로 포함하기 때문에 오히려 피부 트러블을 발생시키는 사례도 다수 보고되고 있다. 따라서, 피부에 자극성이 없는 자연물 추출물을 이용하고, 화학물질로 인해 오염된 피부의 상태를 근본적으로 개선할 수 있는 조성물의 개발이 필요한 실정이다.The skin is a part of the body that is directly exposed to the external environment. It not only acts as a protective shield to protect the vital organs of our body from the outside, but also regulates water evaporation and protects the body from external infections. However, the skin of modern people is exposed to the pollutants generated during the manufacturing or disposal of various chemicals developed with industrialization and strong ultraviolet rays, and it causes skin troubles such as erythema, edema and itching and sudden skin aging. The case is increasing. Such skin troubles are not only aesthetic problems, it is known that the substances produced during the inflammatory reaction incidentally cause pigmentation of the skin and promote the collapse of the skin elastic fibers to affect the increase of skin wrinkles. In this regard, the development of cosmetics to block ultraviolet rays has been actively made, but the development of products for protecting the skin from chemicals is still insignificant. Recently, cosmetics to prevent the penetration or adhesion of contaminants or pollutants to the skin, or cleaners with enhanced contaminant cleaning power have been developed, but these products have a poor ability to prevent contaminants from penetrating the skin. There is a limit that does not fundamentally protect the skin from contaminants, but only because it is removed, many cases have been reported to cause skin problems because it contains a chemical as a main component. Therefore, there is a need for the development of a composition that uses natural extracts that are not irritating to the skin and which can fundamentally improve the condition of the skin contaminated by chemicals.
[선행기술문헌][Preceding technical literature]
(비특허문헌 1) Marcelo C.L. et al, J.invest. Dermatol.,pages 37-44, 1983(Non-Patent Document 1) Marcelo C.L. et al, J. invest. Dermatol., Pages 37-44, 1983
일 측면에서, 본 발명의 목적은 어리연꽃속 식물의 신규한 용도를 제공하는 것이다.In one aspect, the object of the present invention is to provide a novel use of the lotus plant.
일 측면에서, 본 발명의 목적은 자연물인 어리연꽃속 식물 추출물을 유효성분으로 함유하는 조성물을 이용하여, 피부 자극을 최소화하면서 효과적으로 오염물질로부터 피부를 보호하는 것이다.In one aspect, an object of the present invention is to effectively protect the skin from contaminants while minimizing skin irritation by using a composition containing a natural plant extract as an active ingredient.
일 측면에서, 본 발명의 목적은 화학물질로 인한 피부 각질 세포의 사멸을 최소화하는 것이다.In one aspect, the object of the present invention is to minimize the killing of skin keratinocytes by chemicals.
일 측면에서, 본 발명의 목적은 필라그린의 발현을 증가시키는 것이다.In one aspect, the object of the present invention is to increase the expression of filaggrin.
상기 목적을 달성하기 위하여, 본 발명은 어리연꽃속 식물 추출물을 유효성분으로 함유하는 조성물을 제공한다.In order to achieve the above object, the present invention provides a composition containing an extract of the lotus plant as an active ingredient.
본 발명의 일 측면인 어리연꽃속 식물 추출물을 유효성분으로 함유하는 조성물은, 피부 세포에 대해 독성이 있는 화학물질로부터 피부를 보호하는 항오염 효능을 갖는다. 구체적으로, 독성 화학물질이 처리된 피부에 상기 조성물을 처리하면, 피부 세포의 사멸을 최소화할 수 있고, 필라그린의 합성을 증가시켜서, 독성 화학물질로 인해 저하된 피부 상태를 개선할 수 있다.The composition containing the lotus plant extract, which is an aspect of the present invention, as an active ingredient, has an antifouling effect of protecting the skin from chemicals that are toxic to skin cells. Specifically, the treatment of the composition on skin treated with toxic chemicals can minimize the death of skin cells and increase the synthesis of filaggrin, thereby improving the skin condition degraded by toxic chemicals.
도 1은 벤조피렌을 처리한 후 본 발명의 일 측면에 따른 조성물을 처리하였을 때 피부 각질 세포의 생존율을 확인한 도이다.1 is a diagram confirming the survival rate of the keratinocytes of the skin when the benzopyrene is treated and the composition according to an aspect of the present invention.
도 2는 질산암모늄을 처리한 후 본 발명의 일 측면에 따른 조성물을 처리하였을 때 피부 각질 세포의 생존율을 확인한 도이다.Figure 2 is a diagram confirming the survival rate of the keratinocytes of the skin after treatment with the composition according to an aspect of the present invention after treatment with ammonium nitrate.
도 3은 포름알데하이드를 처리한 후 본 발명의 일 측면에 따른 조성물을 처리하였을 때 피부 각질 세포의 생존율을 확인한 도이다.Figure 3 is a diagram confirming the survival rate of the keratinocytes of the skin when treated with the composition according to an aspect of the present invention after the treatment of formaldehyde.
도 4와 5는 본 발명의 일 측면에 따른 조성물을 처리하였을 때 필라그린의 단백질 발현 변화(도 4)와 mRNA 발현 변화(도 5)를 관찰한 도이다(NIE는 어리연꽃을 의미함).4 and 5 is a diagram observing the protein expression change (FIG. 4) and mRNA expression change (FIG. 5) of the filaggrin when the composition according to an aspect of the present invention (NIE means a lotus).
본 연구는 한국콜마㈜의 주관 하에 대한민국 보건복지부 산하 글로벌코스메틱연구개발사업단의 글로벌화장품신소재/신기술연구개발지원 사업의 지원에 의하여 이루어진 것으로, 연구과제명은 스마트 식물공장 재배 어리연꽃속 수생식물을 이용한 항노화 화장품 개발(과제고유번호: HN15C0103)이고, 연구기간은 2015.11.01 ~ 2018.10.31이다.This research was supported by the Global Cosmetics New Materials / New Technology R & D Support Project of the Ministry of Health and Welfare of the Ministry of Health and Welfare under the auspices of Kolmar Korea. Development of aging cosmetics (task no .: HN15C0103), and the research period is from November 1, 2015 to October 31, 2018.
이하, 본 발명을 상세히 설명한다.Hereinafter, the present invention will be described in detail.
본 발명은 일 측면에서 어리연꽃속(Nymphoides) 식물 추출물을 유효성분으로 포함하는 피부 항오염용 조성물이다.The present invention in one aspect is a composition for anti-fouling skin comprising a Nyphoides plant extract as an active ingredient.
또한, 본 발명은 일 측면에서 어리연꽃속(Nymphoides) 식물 추출물을 유효성분으로 포함하는 피부 세포 보호용 조성물이다.In another aspect, the present invention is a composition for protecting skin cells comprising as an active ingredient extract of the genus (Nymphoides) plant.
어리연꽃속(Nymphoides) 식물 추출물을 유효성분으로 포함하는 피부 세포 사멸 억제 또는 방지용 조성물이다.It is a composition for inhibiting or preventing skin cell death, including a plant extract of Nymphoides as an active ingredient.
본 명세서에서 "피부"라 함은, 동물의 체표를 덮는 조직을 의미하는 것으로서, 얼굴 또는 바디 등의 체표를 덮는 조직뿐만 아니라, 두피를 포함하는 광범위한 개념이다. As used herein, the term "skin" refers to a tissue covering the body surface of an animal, and is a broad concept including not only tissues covering the body surface such as the face or body, but also the scalp.
본 명세서에서 용어 "항오염(anti-pollution)"은, 피부에 독성이 있는 물질로 인한 피부 상태의 저하를 방지하거나 개선하는 것을 의미할 수 있다.As used herein, the term “anti-pollution” may mean preventing or ameliorating the deterioration of the skin condition due to a substance toxic to the skin.
또한, 본 명세서에서 용어 "피부 세포 보호"는, 피부 세포의 괴사 또는 사멸을 최소화하거나, 세포 증식 저해를 개선하는 것을 의미할 수 있다.In addition, the term “skin cell protection” herein may mean minimizing necrosis or death of skin cells or improving inhibition of cell proliferation.
본 명세서에서 "추출물"은 추출 방법, 추출 용매, 추출된 성분 또는 추출물의 형태를 불문하고, 천연물의 성분을 뽑아냄으로써 얻어진 물질을 모두 포함하는 것이며 또한 천연물의 성분을 뽑아내어 얻어진 물질을 추출 후 다른 방법으로 가공 또는 처리하여 얻어질 수 있는 물질을 모두 포함하는 광범위한 개념이다.As used herein, the term "extract" includes all materials obtained by extracting the components of natural products, regardless of the extraction method, extraction solvent, extracted components or the form of the extract, and extracts the substances obtained by extracting the components of natural products. It is a broad concept that includes all of the materials that can be obtained by processing or processing in a method.
본 명세서에서 "어리연꽃속 식물 추출물"은 추출 방법, 추출 용매, 추출된 성분 또는 추출물의 형태를 불문하고, 어리연꽃속 식물의 성분을 뽑아냄으로써 얻어진 물질을 모두 포함하는 것이며 그 성분을 뽑아내는 과정에서 열, 산(acid), 염기(base), 효소 등으로 처리하는 공정을 포함하는 추출 방법을 통해 얻어진 물질을 포함하며 또한 어리연꽃속 식물의 성분을 뽑아내어 얻어진 물질을 추출 후 다른 방법으로 가공 또는 처리하여 얻어질 수 있는 물질을 모두 포함하는 광범위한 개념이다.As used herein, "a lotus plant extract" includes any material obtained by extracting a component of a lotus plant, regardless of an extraction method, an extraction solvent, an extracted component or an extract form, and a process of extracting the component. Including the material obtained by the extraction method including the process of treatment with heat, acid, base, enzymes, etc., and extracting the components of the plant of the lotus family to extract the material and then processed by another method Or a broad concept that includes all of the materials that can be obtained by treatment.
일 측면에서, 상기 어리연꽃속 식물은 바람직하게, 어리연꽃(Nymphoides indica)일 수 있다. In one aspect, the lotus plant is preferably, Nymphoides indica.
어리연꽃(Nymphoides indica)은 진흙 속에서 잔뿌리가 사방으로 퍼지고 긴 잎자루 끝에 1~3개의 잎이 달려있다. 잎은 물 위에 뜨고 원심형이며 한쪽이 깊게 갈라지고 가장자리가 밋밋하다. 꽃은 8워에 피고 흰 바탕에 중심부는 황색이며 10여개가 잎자루의 밑부분으로 싸여서 달려있다. 어리연꽃은 구갈(口渴), 구건(口乾) 등의 병을 치료하는데 사용됐었다.Nymphoides indica has small roots spread all over the mud and one to three leaves at the end of long petioles. Leaves float on water, centrifugal, deeply split on one side, flat on edge. Flowers bloom in August, and the center is yellow on white background, and about 10 are wrapped around the bottom of petiole. The lotus was used to treat diseases such as gugal and gugun.
일 측면에서, 상기 조성물은, 화학물질에 의한 피부 오염, 피부 세포 사멸 또는 피부 세포 증식 저해, 또는 피부 상태 저하를 개선하는 것일 수 있다.In one aspect, the composition may be to improve skin contamination by chemicals, inhibiting skin cell death or skin cell proliferation, or lowering skin condition.
상기 화학물질은, 다환 방향족 탄화수소(polycyclic aromatic hydrocarbon), 알데하이드류 및 질소산화물류를 포함할 수 있다.The chemicals may include polycyclic aromatic hydrocarbons, aldehydes and nitrogen oxides.
구체적으로, 상기 다환 방향족 탄화수소는 벤조피렌을 포함할 수 있고, 상기 알데하이드류는 포름알데하이드를 포함할 수 있다. 또한, 상기 질소산화물류는, NOx의 화학식으로 표현되는 질소산화물을 포함할 수 있고, 예컨대, NO, NO2, N2O, N4O, N2O3, N2O4, N2O5, N4O6 또는 이들의 이온화물을 포함할 수 있다. 또한, 상기 질소산화물류는, 암모늄 또는 그 염을 포함할 수 있고, 예컨대, 상기 암모늄의 그 염은 암모늄의 질산염인, 질산암모늄을 포함할 수 있다.Specifically, the polycyclic aromatic hydrocarbon may include benzopyrene, and the aldehydes may include formaldehyde. In addition, the nitrogen oxides may include a nitrogen oxide represented by the formula of NOx, and may include, for example, NO, NO 2, N 2 O, N 4 O, N 2 O 3, N 2 O 4, N 2 O 5, N 4 O 6, or ionization thereof. In addition, the nitrogen oxides may include ammonium or a salt thereof, and for example, the salt of ammonium may include ammonium nitrate, which is a nitrate of ammonium.
벤조피렌은, 자동차 배기가스 또는 담배 연기 등 불완전 연소로 인해 생성되며, 에폭시드로의 대사전환과 DNA와의 반응을 통해 세포 손상을 일으키는 유독 물질이다.Benzopyrene is produced by incomplete combustion such as automobile exhaust or tobacco smoke, and is a toxic substance that causes cell damage through metabolic conversion to epoxide and reaction with DNA.
포름알데하이드는, 메탄알(methanal)이라고도 불리우며, 포르말린 제조, 합판 제조, 합성수지 및 화학제품 제조, 석유 정제 등에서 발생하는데, 인체 독성이 강하여, 호흡기 장애, 두통, 구토, 설사, 심하게는 독성 폐기종까지 유발할 수 있는 유독 물질이다(양지연 등(2007), 실내 환경 중 알데하이드 농도 분포 및 영향 요인 평가, J. ENVIRON. TOXICOL. Vol. 22, No. 1, 37~47).Formaldehyde, also called methanal, occurs in formalin, plywood, synthetic resins and chemicals, and petroleum refining, which is highly toxic to humans, causing respiratory failure, headache, vomiting, diarrhea and even toxic emphysema. Toxic substances (Yang, Ji-yeon et al. (2007), assessment of aldehyde concentration distribution and influence factors in indoor environment, J. ENVIRON. TOXICOL. Vol. 22, No. 1, 37 ~ 47).
또한, 질소산화물류는, 주로 석유나 석탄 등의 연소에 의해 발생하며, 폐기종, 기관지염과 같은 호흡기 질환의 원인이 되는 유독 물질이다.In addition, nitrogen oxides are mainly toxic substances generated by combustion of petroleum or coal and are causes of respiratory diseases such as emphysema and bronchitis.
일 측면에서, 상기 조성물은, 총 중량을 기준으로, 상기 어리연꽃속 식물 추출물을 0.01~30 중량%, 바람직하게는, 0.1~20 중량%, 더욱 바람직하게는, 1~10중량%, 더욱 바람직하게는 1~5중량%로 포함할 수 있다. 상기 어리연꽃속 식물 추출물이 0.01 중량% 미만으로 포함되면, 상기 나열된 효과들을 기대할 수 없다.In one aspect, the composition, based on the total weight, 0.01 to 30% by weight, preferably, 0.1 to 20% by weight, more preferably, 1 to 10% by weight, more preferably the extract of the zinnia plant Preferably it may include 1 to 5% by weight. If the zinnia plant extract is included in less than 0.01% by weight, the effects listed above cannot be expected.
일 측면에서, 상기 조성물은 필라그린의 합성을 촉진하는 것일 수 있다. In one aspect, the composition may be to promote the synthesis of filaggrin.
피부 질환들은, 많은 경우 피부 장벽(skin barrier) 기능의 약화 또는 와해로부터 비롯되는데, 피부 장벽 기능에 중요한 역할을 하는 것이 필라그린이다. 필라그린의 감소에 의해 피부장벽 및 보습력이 약해지고, 그 결과, 아토피성 피부염과 같은 피부 질환으로 이어질 수 있다. 일반적으로 공해물질들은 산화반응을 유도하여 고반응성 활성산소 라디칼을 형성하는데, 고반응성 활성산소 라디칼에 의해 염증반응이 유도되고, 그 결과 T helper cell 2(Th2)의 면역반응이 유도되어, IL-4, IL-13 의 분비가 증가하고, 그로 인해 필라그린의 합성이 억제되게 된다. 따라서, 필라그린의 합성을 촉진하는 물질은, 피부 상태를 개선하는데 중요한 역할을 할 수 있다 (Michael D. et al(2009), Cytokine modulation of atopic dermatitis filaggrin skin expression, Journal of Allergy and Clinical Immunology, 2009, vol. 124 (3)) Skin diseases, in many cases, result from the weakening or deterioration of the skin barrier function, which plays a key role in the skin barrier function. The reduction of filaggrins weakens the skin barrier and moisturizing power, and as a result can lead to skin diseases such as atopic dermatitis. In general, pollutants induce oxidation reactions to form highly reactive reactive oxygen radicals. Inflammatory reactions are induced by highly reactive reactive oxygen radicals, resulting in immune responses in T helper cell 2 (Th2). 4, secretion of IL-13 increases, thereby inhibiting the synthesis of filaggrin. Thus, substances that promote the synthesis of filaggrins may play an important role in improving skin conditions (Michael D. et al (2009), Cytokine modulation of atopic dermatitis filaggrin skin expression, Journal of Allergy and Clinical Immunology, 2009 , vol. 124 (3))
본 명세서의 일 측면에서, 어리연꽃속 식물 추출물은 어리연꽃속 식물을 세척하고 건조하는 단계; 건조한 어리연꽃속 식물을 용매 추출하는 단계; 및 추출한 어리연꽃속 식물을 여과하는 단계를 거쳐 수득할 수 있다. 상기에서 용매는 물, 유기 용매 및 물과 유기 용매의 혼합물로 이루어진 군에서 선택된 하나 이상을 포함한다. 상기에서 물은 증류수 또는 정제수를 포함하고, 유기 용매는 C1-6 의 저급 알코올을 예로 들 수 있는 알코올, 아세톤, 에테르, 에틸아세테이트, 디에틸에테르, 에틸메틸케톤 및 클로로포름으로 이루어진 군에서 선택된 하나 이상을 포함하나, 이에 제한되는 것은 아니다.In one aspect of the present disclosure, the zinnia plant extract is a step of washing and drying the zinnia plant; Solvent extracting the dry young lotus plant; And it can be obtained through the step of filtering the extracted lotus flower plants. In the above, the solvent includes at least one selected from the group consisting of water, an organic solvent, and a mixture of water and an organic solvent. In the above, water includes distilled or purified water, and the organic solvent is one selected from the group consisting of alcohol, acetone, ether, ethyl acetate, diethyl ether, ethyl methyl ketone, and chloroform, for example, C 1-6 lower alcohol. Including but not limited to the above.
상기 어리연꽃속 식물 추출물은 어리연꽃속 식물의 C1-6 알코올 추출물을 포함할 수 있고, 구체적으로 상기 알코올은 메탄올 또는 에탄올일 수 있으며, 바람직하게는 메탄올일 수 있다.The lotus plant extract may comprise a C 1-6 alcohol extract of the lotus plant, specifically, the alcohol may be methanol or ethanol, preferably methanol.
본 명세서에서 상기 어리연꽃속 식물 추출물은 물, C1-6 알콜, 및 이들이 조합으로 구성된 그룹에서 선택된 용매의 조추출물일 수 있다. 상기 C1-6 알콜은 구체적으로 메탄올일 수 있다. 어리연꽃속 식물을 용매로 추출 시, 어리연꽃속 식물의 약 5 내지 15배 정도에 해당하는 용매를 가하여 추출하는 것이 바람직하며, 구체적으로 약 10 배의 용매를 가하여 추출하는 것이 바람직하나, 이에 한정되는 것은 아니다. 상기 추출은 가열 추출, 냉침 추출, 환류냉각 추출, 또는 초음파 추출 등이 이용될 수 있으며, 당업자에게 자명한 추출법이라면 제한이 없다. 상기 추출은 실온에서 수행할 수도 있으나, 보다 효율적인 추출을 위해서는 가온 조건 하에서 수행할 수 있으며, 바람직하게는 약 40 내지 100, 더욱 바람직하게는 약 80의 온도에서 추출할 수 있으나, 이에 한정되는 것은 아니다. 추출시간은 바람직하게는 약 2 내지 4시간, 더욱 바람직하게는 약 3 시간 동안 수행할 수 있으나 이에 한정되는 것은 아니며, 추출 용매 및 추출 온도 등의 조건에 따라 달라질 수 있다. 상기 추출은 활성성분을 보다 다량 수득하기 위해 1 회 이상 여러 번 추출할 수 있으며, 바람직하게는 1 내지 5회, 더욱 바람직하게는 3회 연속 추출하여 합한 추출액을 이용할 수 있다.In the present specification, the lotus plant extract may be a crude extract of water, a C 1-6 alcohol, and a solvent selected from the group consisting of a combination thereof. The C 1-6 alcohol may specifically be methanol. When extracting a lotus plant with a solvent, it is preferable to extract by adding a solvent corresponding to about 5 to 15 times of the lotus plant, specifically, it is preferable to extract by adding a solvent of about 10 times, but is not limited thereto. It doesn't happen. The extraction may be a heat extraction, cold extraction, reflux cooling extraction, or ultrasonic extraction, and the like, there is no limitation if the extraction is obvious to those skilled in the art. The extraction may be performed at room temperature, but for more efficient extraction, the extraction may be performed under heating conditions. Preferably, the extraction may be performed at a temperature of about 40 to 100, more preferably about 80, but is not limited thereto. . The extraction time is preferably about 2 to 4 hours, more preferably about 3 hours, but is not limited thereto, and may vary depending on conditions such as extraction solvent and extraction temperature. The extraction may be extracted one or more times several times in order to obtain a larger amount of the active ingredient, preferably one to five times, more preferably three times the extraction can be used combined extracts.
본 명세서에서 어리연꽃속 식물 추출물은 상기와 같이 어리연꽃속 식물의 조추출물을 포함할 수 있고, 상기 조추출물을 극성이 낮은 유기 용매로 더욱 추출하여 얻어진 유기 용매의 가용성 분획물로서 포함할 수도 있다. 상기 유기 용매로는 헥산, 메틸렌클로라이드, 에틸 아세테이트, n-부탄올 등이 이용될 수 있으나, 이에 한정되는 것은 아니다. 상기의 방법으로 추출한 추출물 또는 그 추출물의 가용성 분획물은 그대로 사용할 수도 있으나, 여과 후 농축하여 엑기스 형태로 사용할 수 있으며, 농축 후 동결 건조하여 동결건조물의 형태로서 사용할 수 있다.In the present specification, the lotus plant extract may include the crude extract of the lotus plant as described above, and may include the crude extract as a soluble fraction of the organic solvent obtained by further extracting the organic extract with a low polarity. Hexane, methylene chloride, ethyl acetate, n-butanol, and the like may be used as the organic solvent, but is not limited thereto. The extract extracted by the above method or a soluble fraction of the extract may be used as it is, but may be used in the form of an extract by concentrating after filtration, it may be used as a lyophilized form by lyophilization after concentration.
일 구현예에서 상기 어리연꽃속 식물 추출물은 어리연꽃속 식물의 전초 추출물일 수 있다.In one embodiment the lotus plant extract may be an outpost extract of the lotus plant.
일 측면에서, 상기 조성물은, 화장료 조성물일 수 있다. In one aspect, the composition may be a cosmetic composition.
상기 화장료 조성물은 피부학적으로 허용가능한 부형제와 함께 기초 화장품 조성물 (화장수, 크림, 에센스, 클렌징 폼 및 클렌징 워터와 같은 세안제, 팩, 보디오일), 색조 화장품 조성물 (화운데이션, 립스틱, 마스카라, 메이크업 베이스), 두발 또는 두피 제품 조성물(샴푸, 린스, 헤어컨디셔너, 헤어젤) 및 비누 등의 형태로 제조될 수 있다. The cosmetic composition comprises a basic cosmetic composition (cosmetics, creams, essences, cleansing foams and cleansing water, packs, body oils), color cosmetic compositions (foundation, lipstick, mascara, makeup base) together with dermatologically acceptable excipients. , Hair or scalp product compositions (shampoos, rinses, hair conditioners, hair gels) and soaps and the like.
상기 부형제로는 이에 한정되지는 않으나 예를 들어, 피부연화제, 피부 침투 증강제, 착색제, 방향제, 유화제, 농화제 및 용매를 포함할 수 있다. 또한, 향료, 색소, 살균제, 산화방지제, 방부제 및 보습제 등을 추가로 포함할 수 있으며, 물성개선을 목적으로 점증제, 무기염류, 합성 고분자 물질 등을 포함할 수 있다. 예를 들면, 본 발명의 화장료 조성물로 세안제 및 비누를 제조하는 경우에는 통상의 세안제 및 비누 베이스에 본 발명의 바이아릴아미드 유도체를 첨가하여 용이하게 제조할 수 있다. 크림을 제조하는 경우에는 일반적인 수중유적형 (O/W)의 크림베이스에 본 발명의 바이아릴아미드 유도체를 첨가하여 제조할 수 있다. 여기에 향료, 킬레이트제, 색소, 산화방지제, 방부제 등과 물성개선을 목적으로 한 단백질, 미네랄, 비타민 등 합성 또는 천연소재를 추가로 첨가할 수 있다.The excipients include, but are not limited to, emollients, skin penetration enhancers, colorants, fragrances, emulsifiers, thickeners and solvents. In addition, fragrances, pigments, fungicides, antioxidants, preservatives and moisturizing agents may be further included, and may include thickeners, inorganic salts, synthetic polymer materials and the like for the purpose of improving the properties. For example, in the case of preparing the face wash and the soap with the cosmetic composition of the present invention, the biarylamide derivative of the present invention can be easily prepared by adding the face wash and the soap base. When the cream is prepared, it can be prepared by adding the biarylamide derivative of the present invention to a cream base of general oil-in-water type (O / W). To this, synthetic or natural materials, such as proteins, minerals, vitamins, etc., for the purpose of improving physical properties, such as flavors, chelating agents, pigments, antioxidants, and preservatives, may be added.
일 구현예에서, 상기 피부 세포는 피부 각질 세포를 포함할 수 있다.In one embodiment, the skin cells may comprise skin keratinocytes.
이하, 실시예 및 시험예를 들어 본 발명의 구성 및 효과를 보다 구체적으로 설명한다. 그러나 이들은 본 발명에 대한 이해를 돕기 위해 예시의 목적으로만 제공된 것일 뿐 본 발명의 범주 및 범위가 하기 예에 의해 제한되는 것은 아니다.Hereinafter, the configuration and effects of the present invention will be described in more detail with reference to Examples and Test Examples. However, these are provided only for the purpose of illustration to help the understanding of the present invention is not limited to the scope and scope of the present invention by the following examples.
[실시예 1] 어리연꽃 메탄올 추출물의 제조Example 1 Preparation of Citric Lotus Methanol Extract
어리연꽃(Nymphoides indica) 전초 50g에 500ml의 메탄올을 넣고, 상온에서 24시간 동안 침지 시킨 후, 추출액을 거름종이로 여과하였다. 여과된 여과액을 농축기를 통하여 용매를 휘발시킨 뒤 동결 건조하여 어리연꽃의 메탄올 추출물을 제조하였다.50 ml of methanol was added to 50 g of Nymphoides indica outpost, and the mixture was immersed at room temperature for 24 hours, and then the extract was filtered through a filter paper. The filtrate was filtered and the solvent was volatilized through a concentrator and lyophilized to prepare a methanol extract of the lotus.
[실험예 1] 항오염 활성 측정Experimental Example 1 Antifouling Activity Measurement
일반적으로 공해 물질과 직접적으로 맞닿게 되는 피부 각질세포를 사용하여 공해물질에 의한 세포 손상 정도를 측정하고, 실시예 1의 어리연꽃 추출물을 농도별로 처리하고, 피부 세포 손상 억제 효과를 확인하였다. 사람 각질 세포 HaCaT를 5 X 103 cells/ml 농도로 96-well plate에 분주하고 24시간 배양시킨 후, 벤조피렌(10μM), 질산암모늄(500㎍/ml), 및 포름알데하이드(1.5㎍/ml) 각각과 실시예 1의 어리연꽃 추출물을 처리하고, 45시간 동안 추가로 배양하였다. 그 후 5mg/ml 농도의 MTT solution을 넣고 3시간 배양한 다음 배지를 제거하고 dimethyl sulfoxide를 150ul 씩 각 well에 넣어주고 10분간 shaking 하고, 570nm로 흡광도를 측정하였다.In general, the degree of cellular damage caused by the pollutants was measured using the skin keratinocytes directly contacting the pollutants, the extract of the lotus flower of Example 1 was treated by concentration, and the effect of inhibiting skin cell damage was confirmed. Human keratinocytes HaCaT were dispensed in 96-well plates at a concentration of 5 × 10 3 cells / ml and incubated for 24 hours, followed by benzopyrene (10 μM), ammonium nitrate (500 μg / ml), and formaldehyde (1.5 μg / ml). Each and the lotus extract of Example 1 were treated and further incubated for 45 hours. After that, MTT solution of 5mg / ml concentration was added and cultured for 3 hours. The medium was removed, dimethyl sulfoxide was added to each well of 150ul, shaking for 10 minutes, and absorbance was measured at 570nm.
그 결과, 본 발명의 추출물을 처리하였을 때, 농도 의존적으로 공해물질에 의한 세포 손상 억제 효과를 확인할 수 있었다. As a result, when the extract of the present invention was treated, it was possible to confirm the effect of inhibiting cell damage by the pollutant in a concentration-dependent manner.
특히, 벤조피렌을 처리한 경우, 실시예 1의 조성물을 75μg/ml로 처리시 벤조피렌만 처리한 군에 비하여 35.85% 이상 우수한 세포 생존율을 확인할 수 있었다(도 1).In particular, when treated with benzopyrene, when the composition of Example 1 was treated with 75μg / ml, it was confirmed that the cell viability superior to 35.85% or more compared to the group treated with benzopyrene alone (FIG. 1).
또한, 질산암모늄을 처리하고 50㎍/ml의 실시예 1의 조성물을 처리한 경우, 질산암모늄을 처리한 군에 비하여 약 16% 이상 향상된 세포 생존율을 확인할 수 있었다(도 2). 또한, 포름알데하이드를 처리하고 50㎍/ml의 실시예 1의 조성물을 처리한 경우, 포름알데하이드를 처리한 군에 비하여 약 25% 이상 향상된 세포 생존율을 확인할 수 있었다(도 3).In addition, when treated with ammonium nitrate and 50 ㎍ / ml of the composition of Example 1, it was confirmed that improved cell viability of about 16% or more compared to the group treated with ammonium nitrate (Fig. 2). In addition, when treated with formaldehyde and 50 ㎍ / ml of the composition of Example 1, it was confirmed that improved cell viability of about 25% or more compared to the formaldehyde-treated group (Fig. 3).
[실험예 2] 필라그린(filaggrin) 합성 촉진 능력 확인Experimental Example 2 Confirmation of Filaggrin Synthesis Promoting Ability
[실험예 2-1] 필라그린 단백질 합성 확인Experimental Example 2-1 Confirmation of Filaggrin Protein Synthesis
HaCat 세포내에서 HAS와 filaggrin protein 활성을 보기 위하여 60mm tissue culture dish에 cell seeding 후 24시간 동안 배양하여 cell을 안정화 시켰다. 배지를 제거한 후 추출물을 농도별로 처리한 배지로 24시간 배양한 후 다시 배지를 제거하고 PBS로 2번 세척해주었다. RIPA buffer 10ml에 complete mini 1 tab를 가하고 100uL로 용해해서 4℃ 12,000rmp에서 20분간 원심 분리 하였다. 원심 분리하여 얻은 상층액은 Bradford assay로 정량하여 30ul의 단백질을 10%의 SDS-PAGE사에서 전기 영동하여 분리하였다. 분리된 단백질은 semi dry transfer cell 기기 (Hofer, USA)를 이용하여 PVDF membrane에 옮긴 다음 실온에서 1시간 blocking buffer (5% skim milk in TBST)에서 incubation 시켰다. 1차 항체를 희석하여 4℃에서 over night한 다음, 다시 10분 간격으로 TBST로 3회 washing 하고 mouse anti-rabbit IgG HRP 2차 항체를 1:1,000로 희석하여 실온에서 1시간 동안 배양한다. 3회 washing한 뒤 LAS 4,000 기기를 이용하여 밴드를 확인하고 정량하였다.In order to see HAS and filaggrin protein activity in HaCat cells, cells were stabilized by incubating for 24 hours after cell seeding in a 60 mm tissue culture dish. After the medium was removed, the extracts were incubated with the medium treated with the concentration for 24 hours, and then the medium was removed again and washed twice with PBS. Complete mini 1 tab was added to 10 ml of RIPA buffer, dissolved in 100 uL, and centrifuged at 12,000 rmp for 20 minutes. The supernatant obtained by centrifugation was quantified by Bradford assay and 30ul of protein was separated by electrophoresis at 10% SDS-PAGE. The separated proteins were transferred to PVDF membrane using a semi dry transfer cell instrument (Hofer, USA) and incubated in blocking buffer (5% skim milk in TBST) for 1 hour at room temperature. After diluting the primary antibody over night at 4 ℃, washed three times with TBST again every 10 minutes, the mouse anti-rabbit IgG HRP secondary antibody diluted 1: 1,000 and incubated for 1 hour at room temperature. After washing three times, the band was identified and quantified using an LAS 4,000 device.
그 결과, 어리연꽃 추출물의 경우 모두 농도 의존적으로 필라그린의 합성을 촉진시키는 것을 확인하였다(도 4).As a result, it was confirmed that all of the lotus extract to promote the synthesis of filaggrin concentration-dependent (Fig. 4).
[실험예 2-2] 필라그린 mRNA 발현 측정Experimental Example 2-2 Measurement of Filaggrin mRNA Expression
세포를 60mm dish에 cell seeding한 뒤 24시간 동안 배양한 후 샘플을 농도별로 처리 하여 24시간 동안 배양하였다. 배지 상등액을 제거한 후 trizol lysis buffer를 각 well에 1ml씩 분주하여 세포를 lysis한 후 -70℃에 보관하였다. 세포로부터 추출되어진 RNA를 260nm과 280nm에서 흡광도를 측정하여 정량하였다. 정량한 RNA를 5μg, Oligo(dT)15 0.5μg/reaction, Nuclease-Free Water(promega kit, USA)와 혼합한 뒤 70℃에서 5분동안 얼음을 이용하여 식혔다. Reaction mixture로 10배의 RT buffer, MgCl2 DTT, RNase를 섞어 준비 하였다. 25℃에서 10분 42℃에서 50분간 70℃에서 15분간 가열하여 inactivate 시키고 얼음으로 식혔다. cDNA와 2X SYBR green mix, primer, ROX를 각각 넣어 ABI step one plus (Applied biosystem, USA) 기기를 이용하여 실시간 정량 분석을 한 뒤 분석프로그램을 이용하여 결과를 분석하였다. After seeding the cells in a 60mm dish and incubating for 24 hours, the samples were treated by concentration and incubated for 24 hours. After removing the media supernatant, 1 ml of trizol lysis buffer was dispensed into each well to lyse the cells and stored at -70 ° C. RNA extracted from the cells was quantified by measuring the absorbance at 260nm and 280nm. Quantitative RNA was mixed with 5 μg, Oligo (dT) 15 0.5 μg / reaction, Nuclease-Free Water (promega kit, USA) and cooled on ice at 70 ° C. for 5 minutes. The reaction mixture was prepared by mixing 10 times RT buffer, MgCl 2 DTT, and RNase. Inactivated by heating at 25 ° C. for 10 minutes at 42 ° C. for 50 minutes at 70 ° C. for 15 minutes and cooling with ice. The cDNA, 2X SYBR green mix, primer, and ROX were added to each other, and real-time quantitative analysis was performed using ABI step one plus (Applied biosystem, USA).
사용된 필라그린의 프라이머 서열은 다음 표 1과 같다.The primer sequences of filaggrin used are shown in Table 1 below.
필라그린Pill-green | forwardforward | TTGTTCTTTGATGCAGTCAGCTTGTTCTTTGATGCAGTCAGC |
reversereverse | GATTTGCGCCAAAAGTGCGATTTGCGCCAAAAGTGC | |
β-actinβ-actin | forwardforward | ATTGTTGCCATCAATGACCCATTGTTGCCATCAATGACCC |
reversereverse | AGTAGAGGCAGGGATGATAGTAGAGGCAGGGATGAT |
그 결과, 어리연꽃 추출물의 경우 모두 농도 의존적으로 필라그린 mRNA를 합성능이 있음을 확인하였다(도 5).As a result, it was confirmed that all of the lotus extract has the ability to synthesize filaggrin mRNA in a concentration-dependent manner (Fig. 5).
서열목록 1과 2는 필라그린의 프라이머 서열에 관한 것(서열목록 1: 정방향, 서열목록 2: 역방향)이고, 서열목록 3과 4는 베타-액틴의 프라이머 서열(서열목록 3: 정방향, 서열목록 4: 역방향)에 관한 것이다.SEQ ID NO: 1 and 2 relates to the primer sequence of filaggrin (SEQ ID NO: 1: forward, SEQ ID NO: 2: reverse), SEQ ID NO: 3 and 4 is the primer sequence of the beta-actin (SEQ ID NO: 3: forward, sequence 4: reverse direction).
Claims (11)
- 어리연꽃속(Nymphoides) 식물 추출물을 유효성분으로 포함하는 피부 항오염용 조성물.A composition for anti-fouling skin comprising Nymphoides plant extract as an active ingredient.
- 어리연꽃속(Nymphoides) 식물 추출물을 유효성분으로 포함하는 피부 세포 보호용 조성물.A composition for protecting skin cells comprising as an active ingredient Nymphoides plant extract.
- 어리연꽃속(Nymphoides) 식물 추출물을 유효성분으로 포함하는 피부 세포 사멸 억제 또는 방지용 조성물.A composition for inhibiting or preventing skin cell death, including a plant extract of Nymphoides .
- 제1항 내지 제3항 중 어느 한 항에 있어서,The method according to any one of claims 1 to 3,상기 어리연꽃속 식물은, The young lotus plant,어리연꽃(Nymphoides indica)으로 이루어진 군으로부터 선택된 하나 이상을 포함하는, 조성물.A lotus flower ( Nymphoides indica ), comprising one or more selected from the group consisting of.
- 제1항 내지 제3항 중 어느 한 항에 있어서,The method according to any one of claims 1 to 3,상기 조성물은,The composition,화학물질에 의한 피부 오염, 피부 세포 사멸 또는 피부 세포 증식 저해를 개선하는 것인, 조성물.To improve skin contamination, skin cell death or inhibition of skin cell proliferation by chemicals.
- 제1항 내지 제3항 중 어느 한 항에 있어서,The method according to any one of claims 1 to 3,상기 조성물은, The composition,필라그린의 합성을 촉진하는 것인, 조성물.To facilitate the synthesis of filaggrin, composition.
- 제1항 내지 제3항 중 어느 한 항에 있어서,The method according to any one of claims 1 to 3,상기 어리연꽃속 식물 추출물의 추출용매는, Extraction solvent of the E. lotus plant extract,물, 유기용매 또는 이들의 혼합물을 포함하는, 조성물.A composition comprising water, an organic solvent or a mixture thereof.
- 제1항 내지 제3항 중 어느 한 항에 있어서,The method according to any one of claims 1 to 3,상기 조성물은, 화장료 조성물인, 조성물.The composition is a cosmetic composition.
- 제2항 또는 제3항에 있어서,The method according to claim 2 or 3,상기 피부 세포는, 피부 각질 세포를 포함하는, 조성물.Wherein said skin cells comprise skin keratinocytes.
- 제5항에 있어서,The method of claim 5,상기 화학물질은, 다환 방향족 탄화수소(polycyclic aromatic hydrocarbon), 알데하이드류 및 질소산화물류를 포함하는, 조성물.The chemical composition comprises a polycyclic aromatic hydrocarbon, aldehydes and nitrogen oxides.
- 제10항에 있어서,The method of claim 10,상기 다환 방향족 탄화수소는, 벤조피렌을 포함하고,The polycyclic aromatic hydrocarbon includes benzopyrene,상기 알데하이드류는 포름알데하이드를 포함하고,The aldehydes include formaldehyde,상기 질소산화물류는 질산암모늄을 포함하는, 조성물.The nitrogen oxides composition comprising ammonium nitrate.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201780083933.3A CN110214003B (en) | 2017-01-23 | 2017-12-14 | Composition for preventing skin fouling comprising an extract of plants of the genus California as active ingredient |
Applications Claiming Priority (4)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR20170010672 | 2017-01-23 | ||
KR10-2017-0010672 | 2017-01-23 | ||
KR1020170108733A KR101886688B1 (en) | 2017-01-23 | 2017-08-28 | Composition for skin anti-polution comprising extract of nymphoides as an effective ingredient |
KR10-2017-0108733 | 2017-08-28 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2018135761A1 true WO2018135761A1 (en) | 2018-07-26 |
Family
ID=62908681
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/KR2017/014764 WO2018135761A1 (en) | 2017-01-23 | 2017-12-14 | Antifouling composition for skin, containing extract of nymphoides sp. plant as active ingredient |
Country Status (1)
Country | Link |
---|---|
WO (1) | WO2018135761A1 (en) |
Citations (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR100619508B1 (en) * | 2004-09-06 | 2006-09-12 | 배삼훈 | Manufacturing method of combustion and bath material of moxibustion and incense using lead |
US20080025930A1 (en) * | 2006-07-31 | 2008-01-31 | Hugo Corstjens | Anti-aging Compositions Comprising Menyanthes Trifoliata Leaf Extracts and Methods of Use Thereof |
KR20140033039A (en) * | 2011-04-06 | 2014-03-17 | 마리 케이 인코포레이티드 | Topical skin care formulations comprising plant extracts |
CN106109865A (en) * | 2016-07-06 | 2016-11-16 | 丘利锦 | A kind of herbal tea treating eczema |
KR101715367B1 (en) * | 2015-10-30 | 2017-03-14 | 한국과학기술연구원 | Composition for treating inflammatory disease or allergic disease comprising Nymphoides peltata extract or fraction thereof |
KR20170095423A (en) * | 2016-02-12 | 2017-08-23 | 한국콜마주식회사 | Cosmetic composition comprising extract of plant belonging to the genus nynphoides for improving skin |
-
2017
- 2017-12-14 WO PCT/KR2017/014764 patent/WO2018135761A1/en active Application Filing
Patent Citations (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR100619508B1 (en) * | 2004-09-06 | 2006-09-12 | 배삼훈 | Manufacturing method of combustion and bath material of moxibustion and incense using lead |
US20080025930A1 (en) * | 2006-07-31 | 2008-01-31 | Hugo Corstjens | Anti-aging Compositions Comprising Menyanthes Trifoliata Leaf Extracts and Methods of Use Thereof |
KR20140033039A (en) * | 2011-04-06 | 2014-03-17 | 마리 케이 인코포레이티드 | Topical skin care formulations comprising plant extracts |
KR101715367B1 (en) * | 2015-10-30 | 2017-03-14 | 한국과학기술연구원 | Composition for treating inflammatory disease or allergic disease comprising Nymphoides peltata extract or fraction thereof |
KR20170095423A (en) * | 2016-02-12 | 2017-08-23 | 한국콜마주식회사 | Cosmetic composition comprising extract of plant belonging to the genus nynphoides for improving skin |
CN106109865A (en) * | 2016-07-06 | 2016-11-16 | 丘利锦 | A kind of herbal tea treating eczema |
Non-Patent Citations (1)
Title |
---|
AMIN, ADNAN ET AL.: "Phytochemical and Pharmacological Investigations on Nymphoides Indica Leaf Extracts", PHYTOTHERAPY RESEARCH, vol. 30, no. 10, 2016, pages 1624 - 1633, XP055506188 * |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
KR101886688B1 (en) | Composition for skin anti-polution comprising extract of nymphoides as an effective ingredient | |
KR102078670B1 (en) | A cosmetic composition for extracting Perilla leaves having antipollution effect and a method for producing the same | |
KR20110067216A (en) | Cosmetic compositions comprising mixed extracts of zanthoxylum schinifolium, pulsatilla koreana, usnea barbata, illicium verum hooker fil., echinacea and propolis | |
CN107809998B (en) | Hydroalcoholic extract of mastic from the animal of the genus mastic, cosmetic composition containing it and cosmetic use thereof | |
JPH10279491A (en) | Interleukin 4 production inhibitor | |
WO2013180526A1 (en) | Skin regeneration and hair growth promoter containing edelweiss extract | |
KR102107194B1 (en) | Cosmetic Composition For Preventing Hair Loss Containing Arctium Lappa Seed Extract | |
WO2019225786A1 (en) | Antibacterial and antifungal composition comprising extract from clove, hibiscus, and coconut as effective ingredient | |
WO2012093738A1 (en) | Composition for combating oxidation and alleviating detrimental effects on skin caused by asian dust | |
WO2005025587A1 (en) | Composition comprising ginkgolides and bilobalide | |
WO2018135761A1 (en) | Antifouling composition for skin, containing extract of nymphoides sp. plant as active ingredient | |
JPH11124318A (en) | Gray hair inhibitor | |
KR102211099B1 (en) | A cosmetic composition for improving skin condition comprising functional lipopeptides | |
KR20210091430A (en) | Cosmetic composition containing natural complex extracts as active ingredient | |
JP5230212B2 (en) | Melanin production inhibitor and whitening agent containing the same | |
KR20130078055A (en) | Antibacterial compositions containing plant extracts or fractions | |
KR20170059615A (en) | Cosmetic composition for the protection skin damage by air pollutants | |
JP2022006397A (en) | Barrier function enhancer | |
JP2002138047A (en) | Skin activator composition | |
WO2023282367A1 (en) | Cosmetic composition comprising cynanchum atratum extract | |
KR102492106B1 (en) | Cosmetic composition | |
JPH10298095A (en) | Antibacterial agent | |
WO2019059527A1 (en) | Composition for treating fine dust-caused skin cell damage, comprising prunus mume flower extract | |
KR102428868B1 (en) | Cosmetic composition containing microbiome Centella asiatica fermentation | |
WO2023074951A1 (en) | Composition for preventing or ameliorating atopic dermatitis |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 17892945 Country of ref document: EP Kind code of ref document: A1 |
|
NENP | Non-entry into the national phase |
Ref country code: DE |
|
122 | Ep: pct application non-entry in european phase |
Ref document number: 17892945 Country of ref document: EP Kind code of ref document: A1 |