WO2018135761A1 - Antifouling composition for skin, containing extract of nymphoides sp. plant as active ingredient - Google Patents

Abstract

Disclosed in the present specification are an antifouling composition for the skin and a composition for protecting skin cells, the compositions containing an extract of Nymphoides sp. plant as an active ingredient. The compositions have an anti-fouling effect which protects the skin from chemical substances that are toxic to skin cells. Particularly, when the compositions are applied to the skin to which toxic chemical substances have been applied, skin cell death caused by chemical substances can be minimized and the synthesis of filaggrin can be increased, such that the condition of skin having deteriorated because of toxic chemical substances can be improved.

Description

Composition for skin antipollution comprising asia active plant extract as an active ingredient

Disclosed herein is a composition for skin antipollution, and a composition for protecting skin cells, which contains the extract of S. aureus as an active ingredient.

The skin is a part of the body that is directly exposed to the external environment. It not only acts as a protective shield to protect the vital organs of our body from the outside, but also regulates water evaporation and protects the body from external infections. However, the skin of modern people is exposed to the pollutants generated during the manufacturing or disposal of various chemicals developed with industrialization and strong ultraviolet rays, and it causes skin troubles such as erythema, edema and itching and sudden skin aging. The case is increasing. Such skin troubles are not only aesthetic problems, it is known that the substances produced during the inflammatory reaction incidentally cause pigmentation of the skin and promote the collapse of the skin elastic fibers to affect the increase of skin wrinkles. In this regard, the development of cosmetics to block ultraviolet rays has been actively made, but the development of products for protecting the skin from chemicals is still insignificant. Recently, cosmetics to prevent the penetration or adhesion of contaminants or pollutants to the skin, or cleaners with enhanced contaminant cleaning power have been developed, but these products have a poor ability to prevent contaminants from penetrating the skin. There is a limit that does not fundamentally protect the skin from contaminants, but only because it is removed, many cases have been reported to cause skin problems because it contains a chemical as a main component. Therefore, there is a need for the development of a composition that uses natural extracts that are not irritating to the skin and which can fundamentally improve the condition of the skin contaminated by chemicals.

[Preceding technical literature]

(Non-Patent Document 1) Marcelo C.L. et al, J. invest. Dermatol., Pages 37-44, 1983

In one aspect, the object of the present invention is to provide a novel use of the lotus plant.

In one aspect, an object of the present invention is to effectively protect the skin from contaminants while minimizing skin irritation by using a composition containing a natural plant extract as an active ingredient.

In one aspect, the object of the present invention is to minimize the killing of skin keratinocytes by chemicals.

In one aspect, the object of the present invention is to increase the expression of filaggrin.

In order to achieve the above object, the present invention provides a composition containing an extract of the lotus plant as an active ingredient.

The composition containing the lotus plant extract, which is an aspect of the present invention, as an active ingredient, has an antifouling effect of protecting the skin from chemicals that are toxic to skin cells. Specifically, the treatment of the composition on skin treated with toxic chemicals can minimize the death of skin cells and increase the synthesis of filaggrin, thereby improving the skin condition degraded by toxic chemicals.

1 is a diagram confirming the survival rate of the keratinocytes of the skin when the benzopyrene is treated and the composition according to an aspect of the present invention.

Figure 2 is a diagram confirming the survival rate of the keratinocytes of the skin after treatment with the composition according to an aspect of the present invention after treatment with ammonium nitrate.

Figure 3 is a diagram confirming the survival rate of the keratinocytes of the skin when treated with the composition according to an aspect of the present invention after the treatment of formaldehyde.

4 and 5 is a diagram observing the protein expression change (FIG. 4) and mRNA expression change (FIG. 5) of the filaggrin when the composition according to an aspect of the present invention (NIE means a lotus).

This research was supported by the Global Cosmetics New Materials / New Technology R & D Support Project of the Ministry of Health and Welfare of the Ministry of Health and Welfare under the auspices of Kolmar Korea. Development of aging cosmetics (task no .: HN15C0103), and the research period is from November 1, 2015 to October 31, 2018.

Hereinafter, the present invention will be described in detail.

The present invention in one aspect is a composition for anti-fouling skin comprising a Nyphoides plant extract as an active ingredient.

In another aspect, the present invention is a composition for protecting skin cells comprising as an active ingredient extract of the genus (Nymphoides) plant.

It is a composition for inhibiting or preventing skin cell death, including a plant extract of Nymphoides as an active ingredient.

As used herein, the term "skin" refers to a tissue covering the body surface of an animal, and is a broad concept including not only tissues covering the body surface such as the face or body, but also the scalp.

As used herein, the term “anti-pollution” may mean preventing or ameliorating the deterioration of the skin condition due to a substance toxic to the skin.

In addition, the term “skin cell protection” herein may mean minimizing necrosis or death of skin cells or improving inhibition of cell proliferation.

As used herein, the term "extract" includes all materials obtained by extracting the components of natural products, regardless of the extraction method, extraction solvent, extracted components or the form of the extract, and extracts the substances obtained by extracting the components of natural products. It is a broad concept that includes all of the materials that can be obtained by processing or processing in a method.

As used herein, "a lotus plant extract" includes any material obtained by extracting a component of a lotus plant, regardless of an extraction method, an extraction solvent, an extracted component or an extract form, and a process of extracting the component. Including the material obtained by the extraction method including the process of treatment with heat, acid, base, enzymes, etc., and extracting the components of the plant of the lotus family to extract the material and then processed by another method Or a broad concept that includes all of the materials that can be obtained by treatment.

In one aspect, the lotus plant is preferably, Nymphoides indica.

Nymphoides indica has small roots spread all over the mud and one to three leaves at the end of long petioles. Leaves float on water, centrifugal, deeply split on one side, flat on edge. Flowers bloom in August, and the center is yellow on white background, and about 10 are wrapped around the bottom of petiole. The lotus was used to treat diseases such as gugal and gugun.

In one aspect, the composition may be to improve skin contamination by chemicals, inhibiting skin cell death or skin cell proliferation, or lowering skin condition.

The chemicals may include polycyclic aromatic hydrocarbons, aldehydes and nitrogen oxides.

Specifically, the polycyclic aromatic hydrocarbon may include benzopyrene, and the aldehydes may include formaldehyde. In addition, the nitrogen oxides may include a nitrogen oxide represented by the formula of NOx, and may include, for example, NO, NO 2, N 2 O, N 4 O, N 2 O 3, N 2 O 4, N 2 O 5, N 4 O 6, or ionization thereof. In addition, the nitrogen oxides may include ammonium or a salt thereof, and for example, the salt of ammonium may include ammonium nitrate, which is a nitrate of ammonium.

Benzopyrene is produced by incomplete combustion such as automobile exhaust or tobacco smoke, and is a toxic substance that causes cell damage through metabolic conversion to epoxide and reaction with DNA.

Formaldehyde, also called methanal, occurs in formalin, plywood, synthetic resins and chemicals, and petroleum refining, which is highly toxic to humans, causing respiratory failure, headache, vomiting, diarrhea and even toxic emphysema. Toxic substances (Yang, Ji-yeon et al. (2007), assessment of aldehyde concentration distribution and influence factors in indoor environment, J. ENVIRON. TOXICOL. Vol. 22, No. 1, 37 ~ 47).

In addition, nitrogen oxides are mainly toxic substances generated by combustion of petroleum or coal and are causes of respiratory diseases such as emphysema and bronchitis.

In one aspect, the composition, based on the total weight, 0.01 to 30% by weight, preferably, 0.1 to 20% by weight, more preferably, 1 to 10% by weight, more preferably the extract of the zinnia plant Preferably it may include 1 to 5% by weight. If the zinnia plant extract is included in less than 0.01% by weight, the effects listed above cannot be expected.

In one aspect, the composition may be to promote the synthesis of filaggrin.

Skin diseases, in many cases, result from the weakening or deterioration of the skin barrier function, which plays a key role in the skin barrier function. The reduction of filaggrins weakens the skin barrier and moisturizing power, and as a result can lead to skin diseases such as atopic dermatitis. In general, pollutants induce oxidation reactions to form highly reactive reactive oxygen radicals. Inflammatory reactions are induced by highly reactive reactive oxygen radicals, resulting in immune responses in T helper cell 2 (Th2). 4, secretion of IL-13 increases, thereby inhibiting the synthesis of filaggrin. Thus, substances that promote the synthesis of filaggrins may play an important role in improving skin conditions (Michael D. et al (2009), Cytokine modulation of atopic dermatitis filaggrin skin expression, Journal of Allergy and Clinical Immunology, 2009 , vol. 124 (3))

In one aspect of the present disclosure, the zinnia plant extract is a step of washing and drying the zinnia plant; Solvent extracting the dry young lotus plant; And it can be obtained through the step of filtering the extracted lotus flower plants. In the above, the solvent includes at least one selected from the group consisting of water, an organic solvent, and a mixture of water and an organic solvent. In the above, water includes distilled or purified water, and the organic solvent is one selected from the group consisting of alcohol, acetone, ether, ethyl acetate, diethyl ether, ethyl methyl ketone, and chloroform, for example, C _1-6 lower alcohol. Including but not limited to the above.

The lotus plant extract may comprise a C _1-6 alcohol extract of the lotus plant, specifically, the alcohol may be methanol or ethanol, preferably methanol.

In the present specification, the lotus plant extract may be a crude extract of water, a C _1-6 alcohol, and a solvent selected from the group consisting of a combination thereof. The C _1-6 alcohol may specifically be methanol. When extracting a lotus plant with a solvent, it is preferable to extract by adding a solvent corresponding to about 5 to 15 times of the lotus plant, specifically, it is preferable to extract by adding a solvent of about 10 times, but is not limited thereto. It doesn't happen. The extraction may be a heat extraction, cold extraction, reflux cooling extraction, or ultrasonic extraction, and the like, there is no limitation if the extraction is obvious to those skilled in the art. The extraction may be performed at room temperature, but for more efficient extraction, the extraction may be performed under heating conditions. Preferably, the extraction may be performed at a temperature of about 40 to 100, more preferably about 80, but is not limited thereto. . The extraction time is preferably about 2 to 4 hours, more preferably about 3 hours, but is not limited thereto, and may vary depending on conditions such as extraction solvent and extraction temperature. The extraction may be extracted one or more times several times in order to obtain a larger amount of the active ingredient, preferably one to five times, more preferably three times the extraction can be used combined extracts.

In the present specification, the lotus plant extract may include the crude extract of the lotus plant as described above, and may include the crude extract as a soluble fraction of the organic solvent obtained by further extracting the organic extract with a low polarity. Hexane, methylene chloride, ethyl acetate, n-butanol, and the like may be used as the organic solvent, but is not limited thereto. The extract extracted by the above method or a soluble fraction of the extract may be used as it is, but may be used in the form of an extract by concentrating after filtration, it may be used as a lyophilized form by lyophilization after concentration.

In one embodiment the lotus plant extract may be an outpost extract of the lotus plant.

In one aspect, the composition may be a cosmetic composition.

The cosmetic composition comprises a basic cosmetic composition (cosmetics, creams, essences, cleansing foams and cleansing water, packs, body oils), color cosmetic compositions (foundation, lipstick, mascara, makeup base) together with dermatologically acceptable excipients. , Hair or scalp product compositions (shampoos, rinses, hair conditioners, hair gels) and soaps and the like.

The excipients include, but are not limited to, emollients, skin penetration enhancers, colorants, fragrances, emulsifiers, thickeners and solvents. In addition, fragrances, pigments, fungicides, antioxidants, preservatives and moisturizing agents may be further included, and may include thickeners, inorganic salts, synthetic polymer materials and the like for the purpose of improving the properties. For example, in the case of preparing the face wash and the soap with the cosmetic composition of the present invention, the biarylamide derivative of the present invention can be easily prepared by adding the face wash and the soap base. When the cream is prepared, it can be prepared by adding the biarylamide derivative of the present invention to a cream base of general oil-in-water type (O / W). To this, synthetic or natural materials, such as proteins, minerals, vitamins, etc., for the purpose of improving physical properties, such as flavors, chelating agents, pigments, antioxidants, and preservatives, may be added.

In one embodiment, the skin cells may comprise skin keratinocytes.

Hereinafter, the configuration and effects of the present invention will be described in more detail with reference to Examples and Test Examples. However, these are provided only for the purpose of illustration to help the understanding of the present invention is not limited to the scope and scope of the present invention by the following examples.

Example 1 Preparation of Citric Lotus Methanol Extract

50 ml of methanol was added to 50 g of Nymphoides indica outpost, and the mixture was immersed at room temperature for 24 hours, and then the extract was filtered through a filter paper. The filtrate was filtered and the solvent was volatilized through a concentrator and lyophilized to prepare a methanol extract of the lotus.

Experimental Example 1 Antifouling Activity Measurement

In general, the degree of cellular damage caused by the pollutants was measured using the skin keratinocytes directly contacting the pollutants, the extract of the lotus flower of Example 1 was treated by concentration, and the effect of inhibiting skin cell damage was confirmed. Human keratinocytes HaCaT were dispensed in 96-well plates at a concentration of 5 × 10 ³ cells / ml and incubated for 24 hours, followed by benzopyrene (10 μM), ammonium nitrate (500 μg / ml), and formaldehyde (1.5 μg / ml). Each and the lotus extract of Example 1 were treated and further incubated for 45 hours. After that, MTT solution of 5mg / ml concentration was added and cultured for 3 hours. The medium was removed, dimethyl sulfoxide was added to each well of 150ul, shaking for 10 minutes, and absorbance was measured at 570nm.

As a result, when the extract of the present invention was treated, it was possible to confirm the effect of inhibiting cell damage by the pollutant in a concentration-dependent manner.

In particular, when treated with benzopyrene, when the composition of Example 1 was treated with 75μg / ml, it was confirmed that the cell viability superior to 35.85% or more compared to the group treated with benzopyrene alone (FIG. 1).

In addition, when treated with ammonium nitrate and 50 ㎍ / ml of the composition of Example 1, it was confirmed that improved cell viability of about 16% or more compared to the group treated with ammonium nitrate (Fig. 2). In addition, when treated with formaldehyde and 50 ㎍ / ml of the composition of Example 1, it was confirmed that improved cell viability of about 25% or more compared to the formaldehyde-treated group (Fig. 3).

Experimental Example 2 Confirmation of Filaggrin Synthesis Promoting Ability

Experimental Example 2-1 Confirmation of Filaggrin Protein Synthesis

In order to see HAS and filaggrin protein activity in HaCat cells, cells were stabilized by incubating for 24 hours after cell seeding in a 60 mm tissue culture dish. After the medium was removed, the extracts were incubated with the medium treated with the concentration for 24 hours, and then the medium was removed again and washed twice with PBS. Complete mini 1 tab was added to 10 ml of RIPA buffer, dissolved in 100 uL, and centrifuged at 12,000 rmp for 20 minutes. The supernatant obtained by centrifugation was quantified by Bradford assay and 30ul of protein was separated by electrophoresis at 10% SDS-PAGE. The separated proteins were transferred to PVDF membrane using a semi dry transfer cell instrument (Hofer, USA) and incubated in blocking buffer (5% skim milk in TBST) for 1 hour at room temperature. After diluting the primary antibody over night at 4 ℃, washed three times with TBST again every 10 minutes, the mouse anti-rabbit IgG HRP secondary antibody diluted 1: 1,000 and incubated for 1 hour at room temperature. After washing three times, the band was identified and quantified using an LAS 4,000 device.

As a result, it was confirmed that all of the lotus extract to promote the synthesis of filaggrin concentration-dependent (Fig. 4).

Experimental Example 2-2 Measurement of Filaggrin mRNA Expression

After seeding the cells in a 60mm dish and incubating for 24 hours, the samples were treated by concentration and incubated for 24 hours. After removing the media supernatant, 1 ml of trizol lysis buffer was dispensed into each well to lyse the cells and stored at -70 ° C. RNA extracted from the cells was quantified by measuring the absorbance at 260nm and 280nm. Quantitative RNA was mixed with 5 μg, Oligo (dT) 15 0.5 μg / reaction, Nuclease-Free Water (promega kit, USA) and cooled on ice at 70 ° C. for 5 minutes. The reaction mixture was prepared by mixing 10 times RT buffer, MgCl 2 DTT, and RNase. Inactivated by heating at 25 ° C. for 10 minutes at 42 ° C. for 50 minutes at 70 ° C. for 15 minutes and cooling with ice. The cDNA, 2X SYBR green mix, primer, and ROX were added to each other, and real-time quantitative analysis was performed using ABI step one plus (Applied biosystem, USA).

The primer sequences of filaggrin used are shown in Table 1 below.

Pill-green	forward	TTGTTCTTTGATGCAGTCAGC
	reverse	GATTTGCGCCAAAAGTGC
β-actin	forward	ATTGTTGCCATCAATGACCC
	reverse	AGTAGAGGCAGGGATGAT

As a result, it was confirmed that all of the lotus extract has the ability to synthesize filaggrin mRNA in a concentration-dependent manner (Fig. 5).

SEQ ID NO: 1 and 2 relates to the primer sequence of filaggrin (SEQ ID NO: 1: forward, SEQ ID NO: 2: reverse), SEQ ID NO: 3 and 4 is the primer sequence of the beta-actin (SEQ ID NO: 3: forward, sequence 4: reverse direction).

Claims (11)

1. A composition for anti-fouling skin comprising Nymphoides plant extract as an active ingredient.
2. A composition for protecting skin cells comprising as an active ingredient Nymphoides plant extract.
3. A composition for inhibiting or preventing skin cell death, including a plant extract of Nymphoides .
4. The method according to any one of claims 1 to 3,

   The young lotus plant,

   A lotus flower ( Nymphoides indica ), comprising one or more selected from the group consisting of.
5. The method according to any one of claims 1 to 3,

   The composition,

   To improve skin contamination, skin cell death or inhibition of skin cell proliferation by chemicals.
6. The method according to any one of claims 1 to 3,

   The composition,

   To facilitate the synthesis of filaggrin, composition.
7. The method according to any one of claims 1 to 3,

   Extraction solvent of the E. lotus plant extract,

   A composition comprising water, an organic solvent or a mixture thereof.
8. The method according to any one of claims 1 to 3,

   The composition is a cosmetic composition.
9. The method according to claim 2 or 3,

   Wherein said skin cells comprise skin keratinocytes.
10. The method of claim 5,

    The chemical composition comprises a polycyclic aromatic hydrocarbon, aldehydes and nitrogen oxides.
11. The method of claim 10,

    The polycyclic aromatic hydrocarbon includes benzopyrene,

    The aldehydes include formaldehyde,

    The nitrogen oxides composition comprising ammonium nitrate.

Images