WO2018125964A1 - Modified crispr rna and uses thereof - Google Patents

Modified crispr rna and uses thereof Download PDF

Info

Publication number
WO2018125964A1
WO2018125964A1 PCT/US2017/068642 US2017068642W WO2018125964A1 WO 2018125964 A1 WO2018125964 A1 WO 2018125964A1 US 2017068642 W US2017068642 W US 2017068642W WO 2018125964 A1 WO2018125964 A1 WO 2018125964A1
Authority
WO
WIPO (PCT)
Prior art keywords
compound
modified
crrna
recognition portion
sugar moiety
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2017/068642
Other languages
English (en)
French (fr)
Inventor
Meghdad RAHDAR
Thazha P. Prakash
Eric E. Swayze
C. Frank Bennett
Moira A. MCMAHON
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Ludwig Institute for Cancer Research Ltd
Ionis Pharmaceuticals Inc
Original Assignee
Ludwig Institute for Cancer Research Ltd
Ionis Pharmaceuticals Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Ludwig Institute for Cancer Research Ltd, Ionis Pharmaceuticals Inc filed Critical Ludwig Institute for Cancer Research Ltd
Priority to AU2017388379A priority Critical patent/AU2017388379A1/en
Priority to JP2019533110A priority patent/JP2020503017A/ja
Priority to CA3047330A priority patent/CA3047330A1/en
Priority to EP17886910.3A priority patent/EP3562942A4/en
Priority to US16/470,464 priority patent/US20190382751A1/en
Publication of WO2018125964A1 publication Critical patent/WO2018125964A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/102Mutagenizing nucleic acids
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/111General methods applicable to biologically active non-coding nucleic acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/20Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/315Phosphorothioates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/3212'-O-R Modification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/3222'-R Modification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/323Chemical structure of the sugar modified ring structure
    • C12N2310/3231Chemical structure of the sugar modified ring structure having an additional ring, e.g. LNA, ENA
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/34Spatial arrangement of the modifications
    • C12N2310/346Spatial arrangement of the modifications having a combination of backbone and sugar modifications
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/35Nature of the modification
    • C12N2310/352Nature of the modification linked to the nucleic acid via a carbon atom
    • C12N2310/3521Methyl
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/35Nature of the modification
    • C12N2310/353Nature of the modification linked to the nucleic acid via an atom other than carbon
    • C12N2310/3533Halogen
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/50Methods for regulating/modulating their activity
    • C12N2320/51Methods for regulating/modulating their activity modulating the chemical stability, e.g. nuclease-resistance

Definitions

  • CRISPR Cluster Regulatory Interspaced Short Palindromic Repeats
  • modified crRNA have improved stability relative to unmodified crRNA.
  • modified crRNA is stabilized at the 5' end and/or the 3' .
  • stabilized crRNA is resistant to exonuclease and/or endonucleoase digestion.
  • modified crRNA have improved affinity for target DNA or RNA relative to unmodified crRNA.
  • modified crRNA have improved selectivity for target DNA or RNA relative to unmodified crRNA.
  • modified crRNA have improved cellular uptake relative to unmodified crRNA.
  • modified crRNA increase gene editing activity of a CRISPR system relative to unmodified crRNA.
  • modified crRNA increases affinity for the target DNA or RNA allowing the modified crRNA to be shortened while retaining sufficient affinity to hybridize to target DNA or RNA and/or associate with other CRISPR system components.
  • modified crRNA is shorter than unmodified crRNA.
  • modified crRNA is 35-45 linked nucleosides in length.
  • modified crRNA is 35-43 linked nucleosides in length.
  • modified crRNA is 35-42 linked nucleosides in length.
  • modified crRNA is 36-43 linked nucleosides in length.
  • modified crRNA is 36-42 linked nucleosides in length.
  • modified crRNA is 36-40 linked nucleosides in length. In certain embodiments, the target recognition portion of modified crRNA is 15-23 linked nucleosides in length. In certain embodiments, the target recognition portion of modified crRNA is 15-22 linked nucleosides in length. In certain embodiments, the target recognition portion of modified crRNA is 16-22 linked nucleosides in length. In certain embodiments, the target recognition portion of modified crRNA is 17-22 linked nucleosides in length. In certain embodiments, the target recognition portion of modified crRNA is 18-22 linked nucleosides in length. In certain embodiments, the target recognition portion of modified crRNA is 16-20 linked nucleosides in length.
  • the target recognition portion of modified crRNA is 18-20 linked nucleosides in length. In certain embodiments, the CRISPR recognition portion of modified crRNA is 17-20 linked nucleosides in length. In certain embodiments, the CRISPR recognition portion of modified crRNA is 18-20 linked nucleosides in length. In certain embodiments, such shorter crRNA have improved uptake properties and/or are easier to synthesize than longer crRNA. In certain embodiments, modified crRNA are taken into cells without transfection reagents or electroporation. In certain such embodiments, the cells are in an animal. In certain embodiments, the animal expresses a CRISPR nuclease.
  • the animal is previously or concomitantly treated with a means of expressing a CRISPR nuclease.
  • such treatment comprises administration of a vector for delivering a CRISPR nuclease.
  • such vector is a viral vector, for example adeno-associated virus (AAV).
  • AAV adeno-associated virus
  • the viral vector expresses a bacterial derived CRISPR nuclease that fits into an AAV vector.
  • the CRISPR nuclease is a Cpfl nuclease.
  • the CRISPR system is inhibited after the target gene is edited.
  • the modified crRNA inside a cell is degraded after the target gene has been edited.
  • the CRISPR nuclease continues to be expressed in the cell but is no longer active because it requires crRNA in order to exhibit nuclease activity.
  • off-target effects of the CRISPR system such as undesired cleavage of an off-target gene, are decreased relative to a CRISPR system in which all of the components necessary for nuclease activity continue to be expressed indefinitely, e.g. by a viral vector.
  • degradation of the modified crRNA is facilitated by hybridization to an oligonucleotide complementary to the crRNA.
  • degradation of the modified crRNA is facilitated by nucleases present in the cell.
  • the CRISPR system is inhibited after the target gene is edited via degradation of a tracrRNA inside the cell.
  • degradation of the tracrRNA is facilitated by hybridization to an oligonucleotide complementary to the tracrRNA.
  • degradation of the tracrRNA is facilitated by nucleases present in the cell.
  • the CRISPR system is inhibited after the target gene is edited via inhibition of the expression of the CRISPR nuclease.
  • the nuclease gene is edited by a modified crR A.
  • the nuclease transcript is degraded following hybridization of the nuclease transcript to an oligonucleotide complementary to the nuclease transcript.
  • Figure 1 shows a gel that illustrates the extent of gene editing of DNMT1 by modified crRNAs described in Example 12.
  • 2'-deoxynucleoside means a nucleoside comprising 2'-H(H) furanosyl sugar moiety, as found in naturally occurring deoxyribonucleic acids (DNA).
  • DNA deoxyribonucleic acids
  • a 2'-deoxynucleoside is a modified nucleoside.
  • 2 '-substituted nucleoside or “2 -modified nucleoside” means a nucleoside comprising a 2 '-substituted or 2 '-modified sugar moiety.
  • “2 '-substituted” or “2 -modified” in reference to a sugar moiety in a crRNA means a furanosyl sugar moiety comprising a 2'-substituent group in place of the 2' -OH of an unmodified sugar moiety.
  • modified oligonucleotide in reference to a modified oligonucleotide means a modified oligonucleotide that comprises at least one stabilizing modification or is connected to a stablizing conjugate group, wherein the at least one modification and/or the conjugate group increases the stability of the 3 '- terminus of the modified oligonucleotide in cells or in an animal relative to a corresponding oligonucleotide that does not comprise the at least one stabilizing modification or is not connected to the stabilizing conjugate group.
  • modified crRNAs are 3 '-stabilized.
  • the 3'- terminal nucleoside of the modified crRNA comprises the stabilizing modification.
  • the 3 '-terminal internucleoside linkage of the crRNA comprises the stabilizing modification.
  • modified oligonucleotide in reference to a modified oligonucleotide means a modified oligonucleotide that comprises at least one stabilizing modification or is connected to a stabilizing conjugate group, wherein the at least one modification and/or the conjugate group increases the stability of the 5 '- terminus of the modified oligonucleotide in cells or in an animal relative to a corresponding oligonucleotide that does not comprise the at least one stabilizing modification or is not connected to the stabilizing conjugate group.
  • modified crR As are 5 '-stabilized.
  • the 5'- terminal nucleoside of the modified crRNA comprises the stabilizing modification.
  • the 5 '-terminal nucleoside of the modified crRNA is a linker nucleoside.
  • bicyclic nucleoside or “BNA” means a nucleoside comprising a bicyclic sugar moiety.
  • bicyclic sugar or “bicyclic sugar moiety” means a modified sugar moiety comprising two rings, wherein the second ring is formed via a bridge connecting two of the atoms in the first ring thereby forming a bicyclic structure.
  • the first ring of the bicyclic sugar moiety is a furanosyl moiety.
  • the bicyclic sugar moiety does not comprise a furanosyl moiety.
  • cell-targeting moiety means a conjugate group or portion of a conjugate group that is capable of binding to a particular cell type or particular cell types.
  • nucleobase sequence of such oligonucleotide or one or more regions thereof matches the nucleobase sequence of another oligonucleotide or nucleic acid or one or more regions thereof when the two nucleobase sequences are aligned in opposing directions.
  • Nucleobase matches or complementary nucleobases, as described herein, are limited to adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), and 5- methyl cytosine ( m C) and guanine (G) unless otherwise specified.
  • oligonucleotides and/or nucleic acids need not have nucleobase complementarity at each nucleoside. Rather, some mismatches are tolerated.
  • "fully complementary” or “100% complementary” in reference to oligonucleotides means that such oligonucleotides are complementary to another oligonucleotide or nucleic acid at each nucleoside. In such embodiments, mismatches are not tolerated.
  • conjugate group means a group of atoms that is directly or indirectly attached to a parent compound, e.g. , an oligonucleotide.
  • conjugate linker means a group of atoms that connects a conjugate group to a parent compound, e.g., an oligonucleotide.
  • oligonucleotide refers to nucleosides, nucleobases, sugar moieties, or internucleoside linkages that are immediately adjacent to each other.
  • contiguous nucleobases means nucleobases that are immediately adjacent to each other
  • crRNA or “CRISPR RNA” means an oligonucleotide that comprises a target recognition portion and a CRISPR recognition portion.
  • a “target recognition portion” is a portion of an oligonucleotide with a nucleobase sequence that is complementary to a DNA or RNA target.
  • CRISPR recognition portion is a portion of an oligonucleotide that can bind to, associate with, or contribute to the binding or association with a CRISPR nuclease or a molecule that binds to or associates with a CRISPR nuclease.
  • the CRISPR recognition portion of a crRNA is not complementary to the DNA or RNA target of the target recognition portion of the crRNA. Thus, although the target recognition portion of a crRNA may associate with a CRISPR nuclease, the target recognition and CRISPR recognition portions of a crRNA do not overlap.
  • a CRISPR nuclease is a protein that directly or indirectly associates with a crRNA and cleaves the target DNA or RNA.
  • the CRISPR nuclease is a Cpf 1 nuclease.
  • the CRISPR recognition portion of a crRNA binds to or associates with a Cpf 1 nuclease.
  • the CRISPR recognition portion of a crRNA binds to or associates with a tracrRNA.
  • crRNAs comprise a self-complementary region. In certain such embodiments, the CRISPR recognition portion partially or completely overlaps with the self-complementary region. In certain embodiments, crRNAs comprise one or more linker nucleosides.
  • linker nucleosides in the context of a crRNA means one or more nucleosides that are linked to the target recognition portion and/or the CRISPR recognition portion of a crRNA. Linker nucleosides are not part of either the target recognition portion or the CRISPR recognition portion of the crRNA. In certain embodiments, such linker nucleosides are located at the 5 '-terminus of a crRNA, the 3'- terminus of the crRNA, and/or in between the target recognition and CRISPR recognition portions of a crRNA.
  • oligonucleotide in which each sugar moiety is modified.
  • Uniformly modified in reference to an oligonucleotide means a fully modified oligonucleotide in which each at least one modification of each sugar moiety is the same.
  • nucleosides of a uniformly modified oligonucleotide can each have a 2'-MOE modification but different nucleobase modifications, and the internucleoside linkages may be different.
  • gene editing means any process mediated by a complex comprising a CRISPR nuclease and a modified or unmodified crRNA, including but not limited to gene knock-down, gene knockout, gene disruption, deletion, insertion, and gene activation.
  • hybridization means the pairing or annealing of complementary oligonucleotides and/or nucleic acids. While not limited to a particular mechanism, the most common mechanism of hybridization involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleobases.
  • oligonucleotide means that the effect is greater in the presence of the oligonucleotide containing a certain modification than the effect is in the presence of a corresponding oligonucleotide that does not contain the certain modification.
  • internucleoside linkage means a group that forms a covalent linkage between adjacent nucleosides in an oligonucleotide.
  • modified internucleoside linkage means any internucleoside linkage other than a naturally occurring, phosphate internucleoside linkage.
  • Non-phosphate linkages are referred to herein as modified internucleoside linkages.
  • Phosphorothioate linkage means a linkage between nucleosides wherein the phosphodiester bond of a phosphate linkage is modified by replacing one of the non-bridging oxygen atoms with a sulfur atom.
  • a phosphorothioate linkage is a modified internucleoside linkage.
  • linearly modified sugar or “linearly modified sugar moiety” means a modified sugar moiety that comprises an acyclic or non-bridging modification. Such linear modifications are distinct from bicyclic sugar modifications.
  • linked nucleosides are nucleosides that are connected in a continuous sequence (i.e. no additional nucleosides are present between those that are linked) and are linked by internucleoside linkages.
  • mismatch or means a nucleobase of a first oligonucleotide that is not capable of pairing with the corresponding nucleobase of a second oligonucleotide or target nucleic acid when the first and second oligomeric compound are aligned.
  • MOE means methoxyethyl.
  • 2'-MOE means a -OCH 2 CH 2 OCH 3 group at the 2' position of a furanosyl ring.
  • motif means the pattern of unmodified and/or modified sugar moieties, nucleobases, and/or internucleoside linkages, in an oligonucleotide.
  • nucleobase means a heterocyclic moiety capable of pairing with a second, different nucleobase.
  • nucleobase sequence means the order of contiguous nucleobases independent of any sugar or internucleoside linkage modification.
  • modified nucleobase means a nucleobase other than adenine (A), thymine (T), cytosine (C), uracil (U), and guanine (G), herein defined as the five, unmodified nucleobases.
  • a universal base is a nucleobase that can pair with any one of the five unmodified nucleobases.
  • nucleoside means a compound comprising a nucleobase and a sugar moiety.
  • the nucleobase and sugar moiety are each, independently, unmodified or modified.
  • modified nucleoside means a nucleoside comprising a modified nucleobase and/or a modified sugar moiety. Modified nucleosides include abasic nucleosides.
  • oligonucleotide means a strand of linked nucleosides connected via internucleoside linkages, wherein each nucleoside and internucleoside linkage may be modified or unmodified. Unless otherwise indicated, oligonucleotides consist of 8-50 linked nucleosides.
  • modified oligonucleotide means an oligonucleotide, wherein at least one nucleoside or internucleoside linkage is modified.
  • unmodified oligonucleotide means an oligonucleotide that does not comprise any nucleoside modifications or internucleoside modifications.
  • pharmaceutically acceptable carrier or diluent means any substance suitable for use in administering to an animal. Certain such carriers enable pharmaceutical compositions to be formulated as, for example, tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspension and lozenges for the oral ingestion by a subject.
  • pharmaceutically acceptable salts means physiologically and pharmaceutically acceptable salts of compounds, such as oligomeric compounds, i.e., salts that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto.
  • a pharmaceutical composition means a mixture of substances suitable for administering to a subject.
  • a pharmaceutical composition may comprise an crRNA compound and a sterile aqueous solution.
  • a pharmaceutical composition shows activity in free uptake assay in certain cell lines.
  • phosphorus moiety means a group of atoms comprising a phosphorus atom.
  • a phosphorus moiety comprises a mono-, di-, or tri-phosphate, or phosphorothioate.
  • prodrug means a therapeutic agent in an inactive form that is converted to an active form within the body or cells thereof by the action of endogenous enzymes or other chemicals and/or physiologic conditions.
  • self-complementary in reference to an oligonucleotide means an oligonucleotide that is at least partially complementary to itself. In certain embodiments, a self-complementary
  • oligonucleotide forms a hairpin when a portion of the self-complementary oligonucleotide hybridizes to itself.
  • sugar moiety means a group of atoms that can link a nucleobase to another group, such as an internucleoside linkage, conjugate group, or terminal group.
  • a sugar moiety is attached to a nucleobase to form a nucleoside.
  • unmodified sugar moiety in the context of crRNA means a 2'-OH(H) furanosyl moiety, as found in R A. Unmodified sugar moieties have one hydrogen at each of the ⁇ , 3 ' , and 4 ' positions, an oxygen at the 3 ' position, and two hydrogens at the 5 ' position.
  • modified sugar moiety or “modified sugar” means a sugar surrogate or a furanosyl moiety comprising any substitution relative to an unmodified sugar moiety.
  • a modified sugar moiety is a 2 '-substituted sugar moiety.
  • modified sugar moieties include bicyclic sugars and linearly modified sugars.
  • sugar surrogate means a modified sugar moiety having other than a furanosyl moiety that can link a nucleobase to another group, such as an internucleoside linkage, conjugate group, or terminal group.
  • Modified nucleosides comprising sugar surrogates can be incorporated into one or more positions within an oligonucleotide. In certain embodiments, such oligonucleotides are capable of hybridizing to complementary oligomeric compounds or nucleic acids.
  • target nucleic acid means a nucleic acid to which the target recognition portion of a crRNA is complementary.
  • a crRNA is designed to affect the target nucleic acid.
  • An "off-target gene” is a gene that a crRNA is not designed to affect. In certain embodiments, the editing of an off-target gene is deleterious.
  • terminal group means a chemical group or group of atoms that is covalently linked to a terminus of an oligonucleotide.
  • CRISPR systems and certain oligonucleotides for use in CRISPR systems
  • the present invention provides modified oligonucleotides for use in CRISPR.
  • CRISPR employs CRISPR RNA (crRNA), which hybridizes to target DNA or RNA and directly or indirectly recruits a nuclease that cleaves the target DNA or RNA.
  • the crRNA in such systems has two functions: (1) recognition and hybridization to the target DNA or RNA and (2) recognition by a CRISPR nuclease or a molecule that recruits a CRISPR nuclease.
  • the crRNA comprises two portions which correspond to these two functions: a target recognition portion and a CRISPR recognition portion.
  • the present invention provides modified oligonulcleotides that may be used as crRNA. Such modified oligonucleotides may have modifications in the target recognition portion and/or CRISPR recognition portion.
  • the CRISPR recognition portion of the crRNA comprises a portion of the direct repeat sequence from a bacterial organism that has a Cpf 1 nuclease or a Cpfl ortholog. In certain such embodiments, the CRISPR recognition portion of the crRNA comprises a sequence selected from the table below. In certain embodiments, the CRISPR recognition portion of the crRNA comprises 16, 17, 18, 19, or 20 nucleobases of a sequence selected from the table below. In certain embodiments, the CRISPR recognition portion of the crRNA consists of 16, 17, 18, 19, or 20 nucleobases of a sequence selected from the table below.
  • the target recognition portion of the crRNA comprises a nucleobase sequence that is complementary to a target DNA. In certain such embodiments, the entire nucleobase sequence of the target recognition portion is complementary to a target DNA. In certain embodiments, the nucleobase sequence of the target recognition portion is at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to a target DNA. In certain embodiments, the target DNA is a DNMT1 gene. In certain embodiments, the nucleobase sequence of the target DNMT1 gene is GENBANK Accession Number NT_011295.10 truncated from nucleobases 1506424 to 1569013, herein referred to as SEQ ID NO: 66. In certain embodiments, the target DNA is a GRIN2B gene. In certain embodiments, the nucleobase sequence of the target GRIN2B gene is GENBANK Accession Number NC_000012.12 truncated from nucleobases
  • the target DNA is a LDLR gene.
  • the nucleobase sequence of the target LDLR gene is GENBANK Accession Number NC_000019.10 truncated from nucleobases 11086001 to 11137000, herein referred to as SEQ ID NO: 68.
  • the target DNA is a complement component 5 (C5) gene.
  • the nucleobase sequence of the target C5 gene is GENBANK Accession Number
  • the target DNA is an empty spiracles homologl (EMX1) gene.
  • the nucleobase sequence of the target EMX 1 gene is GENBANK Accession Number
  • modified crRNA comprises a target recognition portion, a CRISPR recognition portion, and linker nucleosides.
  • the linker nucleosides are not part of the target recognition or CRISPR recognition portions of the crRNA.
  • linker nucleosides are modified in order to provide nuclease stability. In certain such embodiments, the linker nucleosides provide exonuclease stability.
  • modified crRNA contain no linker nucleosides. In certain embodiments, modified crRNA comprise 2 linker nucleosides.
  • modified crRNA comprise a CRISPR recognition portion, a target recognition portion, and optional, one or more linker nucleosides.
  • the CRISPR recognition and target recognition portions and the optional linker nucleosides may be in any orientation relative to each other, as shown below, wherein "CR” is the CRISPR recognition portion, “Ta” is the target recognition portion, and “Ln” is the linker nucleoside(s).
  • modified crR A are represented by one of the following formulas:
  • a compound comprising a modified crRNA comprises a conjugate group.
  • the conjugate group is connected to the 5 '-terminus of the modified crRNA.
  • the conjugate group is connected to the 3 '-terminus of the modified crRNA.
  • the conjugate group is connected to an internal nucleoside or internucleoside linkage of the modified crRNA.
  • the modified crRNA is 5'-stabilized and/or 3 '-stabilized.
  • the 5'- or 3 '-terminal nucleoside of the 5' - or 3 '-stabilized crRNA comprises a stabilizing modification, respectively.
  • the nucleoside comprising the stabilizing modification is the terminal nucleoside of the CRISPR recognition portion.
  • the nucleoside comprising the stabilizing modification is the terminal nucleoside of the target recognition portion.
  • the nucleoside comprising the stabilizing modification is a linker nucleoside.
  • the 5'- or 3'-stabilized crRNA is connected to a stabilizing conjugate group at the 5'- or 3'- terminus, respectively.
  • the conjugate group does not comprise a cleavable moiety.
  • modified crRNAs comprise a modified oligonucleotide. In certain embodiments, modified crRNAs consist of a modified oligonucleotide. Modified oligonucleotides described herein are suitable for use as crRNA.
  • modified crRNAs comprise at least three of the following features:
  • modified crRNA b. 1 st , 8 th , and/or 9 th nucleoside from the 5'-end of the target recognition portion of the modified crRNA independently comprising 2'-F or 2'-H(H) modified sugar moiety; c. at least one terminal phosphorothioate internucleoside linkage at each of the 3' and 5' termini of the modified crRNA
  • each nucleoside of the CRISPR recognition portion comprising an unmodified sugar moiety
  • each nucleoside of the CRISPR recognition portion comprising an unmodified sugar moiety
  • each nucleoside of the CRISPR recognition portion comprising an unmodified sugar moiety
  • each nucleoside of the CRISPR recognition portion comprising an unmodified sugar moiety
  • each nucleoside of the CRISPR recognition portion comprising an unmodified sugar moiety
  • one to five 3 '-terminal nucleosides of the modified crRNA comprising independently
  • the modified crRNA comprises features (b), (d), and (e).
  • the modified crRNA comprises features (b), (c), and (e). In certain embodiments, the modified crRNA comprises features (b), (c), and (d). In certain embodiments, the modified crRNA comprises features (b), (c), (d) and (e). In certain embodiments, the modified crRNA comprises features (a), (b), and (e). In certain embodiments, the modified crRNA comprises features (a), (c), and (e). In certain embodiments, the modified crRNA comprises features (a), (c), and (e). In certain embodiments, the modified crRNA comprises features (a), (b), and (d). In certain embodiments, the modified crRNA comprises features (a), (b), (d) and (e). In certain embodiments, the modified crRNA comprises features (a), (b), (c) and (e). In certain embodiments, the modified crRNA comprises features (a), (b), (c), (d), and (e).
  • modified crRNAs comprise at least three of the following features:
  • recognition portion comprises a modified sugar moiety
  • the modified crRNA comprises features (b), (d), and (e).
  • the modified crRNA comprises features (b), (c), and (e). In certain embodiments, the modified crRNA comprises features (b), (c), and (d). In certain embodiments, the modified crRNA comprises features (b), (c), (d) and (e). In certain embodiments, the modified crRNA comprises features (a), (b), and (e). In certain embodiments, the modified crRNA comprises features (a), (c), and (e). In certain embodiments, the modified crRNA comprises features (a), (c), and (e). In certain embodiments, the modified crRNA comprises features (a), (b), and (d). In certain embodiments, the modified crRNA comprises features (a), (b), (c) and (e). In certain embodiments, the modified crRNA comprises features (a), (b), (c) and (e).
  • the modified crRNA comprises features (a), (b), (c), (d), and (e). In certain embodiments, the modified crRNA comprises any combination of features (a), (b), (c), (d), and (e) listed in the table below, wherein one selection is made for each of (a), (b), (c), (d), and (e).
  • modified oligonucleotides have one or more asymmetric center and thus give rise to enantiomers, diastereomers, and other stereoisomeric configurations that may be defined, in terms of absolute stereochemistry, as (R) or (S), as a or ⁇ such as for sugar anomers, or as (D) or (L) such as for amino acids etc. Included in the modified oligonucleotides provided herein are all such possible isomers, including their racemic and optically pure forms, unless specified otherwise. Likewise, all cis- and trans-isomers and tautomeric forms are also included. In certain embodiments, such modified oligonucleotides may contain any combination of the modified sugar moieites, modified nucleobases, modified internucleoside linkages, motifs, and/or lengths described herein.
  • methods comprising contacting a cell with a compound comprising a modified crRNA are in vitro methods. In certain embodiments, methods comprising contacting a cell with a compound comprising a modified crRNA are ex vivo methods. In certain embodiments, methods comprising contacting a cell with a compound comprising a modified crRNA are in vivo methods.
  • CRISPR nuclease variants both naturally occurring and genetically engineered, can be used in the methods of the present invention.
  • Such variants include but are not limited to inactive nuclease mutants that are used in applications that do not require target nucleic acid cleavage, such as gene activation; and truncated nuclease variants that are suitable for expression in certain vectors, such as AAV vectors.
  • the CRISPR nuclease variant is a Cpf 1 nuclease variant.
  • methods comprising contacting a cell with a compound comprising a modified crRNA further comprise contacting the cell with a second compound to inhibit (or turn off) the CRISPR system after the target gene is edited.
  • gene editing methods comprising contacting a cell with a compound comprising a modified crRNA produce fewer and/or less deleterious off-target effects than gene editing methods that use of an unmodified crRNA in place of the modified crRNAs of the invention.
  • Embodiment 1 A compound comprising a modified crRNA consisting of 35-45 linked nucleosides.
  • Embodiment 2 A compound comprising a modified crRNA, wherein the CRISPR recognition
  • portion of the modified crRNA consists of 17-20 linked nucleosides.
  • Embodiment 3 A compound comprising a modified crRNA, wherein the target recognition portion of the modified crRNA consists of 18-23 linked nucleosides.
  • Embodiment 4 A compound comprising a modified crRNA, wherein the modified crRNA comprises at least one linker nucleoside.
  • Embodiment 5 A compound comprising a 5 '-stabilized modified crRNA.
  • Embodiment 6 The compound of any of embodiments 1-5, wherein the compound comprises a stabilizing conjugate group.
  • Embodiment 7 The compound of any of embodiments 1-5, wherein the crRNA comprises at least one linker nucleoside comprising a stabilizing modification.
  • Embodiment 8 The compound of any of embodiments 1-4, wherein the modified crRNA is 5'- stabilized.
  • Embodiment 9 The compound of any of embodiments 1-8, wherein the modified crRNA is 3'- stabilized.
  • Embodiment 10 The compound of any of embodiments 1-9, wherein the CRISPR recognition portion of the modified crRNA binds to a Cpfl nuclease.
  • Embodiment 11 The compound of any of embodiments 1-10, wherein the target recognition portion of the modified crRNA comprises at least one modification that increases affinity of the crRNA for a target DNA or RNA.
  • Embodiment 12 The compound of any of embodiments 10-11, wherein the CRISPR recognition portion of the modified crRNA comprises at least one modification that increases affinity of the crRNA for a Cpfl nuclease.
  • Embodiment 13 The compound of any of embodiments 1-12, wherein at least one nucleobase of the modified crRNA is thymine.
  • Embodiment 14 The compound of any of embodiments 1-13, wherein at least one nucleobase of the modified crRNA is a modified nucleobase.
  • Embodiment 15 The compound of embodiment 14, wherein the modified nucleobase is 5 -methyl cytosine.
  • Embodiment 16 The compound of any of embodiments 1-15, wherein modified crRNA consists of
  • Embodiment 17 The compound of any of clams 1-15, wherein the modified crRNA consists of 36-40 linked nucleosides.
  • Embodiment 18 The compound of any of embodiments 1-17, wherein the modified crRNA comprises at least two linker nucleosides.
  • Embodiment 19 The compound of embodiment 18, wherein at least two linker nucleosides are linked to the CRISPR recognition portion of the modified crRNA.
  • Embodiment 20 The compound of embodiment 19, wherein at least two linker nucleosides are linked to the 5 '-end of the CRISPR recognition portion of the modified crRNA.
  • Embodiment 21 The compound of any of embodiments 1-20, wherein the CRISPR recognition
  • portion of the modified crRNA consists of 18-20 linked nucleosides.
  • Embodiment 22 The compound of embodiment 21, wherein the CRISPR recognition portion of the modified crRNA consists of 18 linked nucleosides.
  • Embodiment 23 The compound of embodiment 21, wherein the CRISPR recognition portion of the modified crRNA consists of 19 linked nucleosides.
  • Embodiment 24 The compound of embodiment 21, wherein the CRISPR recognition portion of the modified crRNA consists of 20 linked nucleosides.
  • Embodiment 25 The compound of any of embodiments 1-24, wherein the target recognition protion of the modified crRNA consists of 18-22 linked nucleosides.
  • Embodiment 26 The compound of any of embodiments 1-24, wherein the target recognition protion of the modified crRNA consists of 18-20 linked nucleosides.
  • Embodiment 27 The compound of embodiment 26, wherein the target recognition protion of the modified crRNA consists of 18 linked nucleosides.
  • Embodiment 28 The compound of embodiment 26, wherein the target recognition protion of the modified crRNA consists of 19 linked nucleosides.
  • Embodiment 29 The compound of embodiment 26, wherein the target recognition protion of the modified crRNA consists of 20 linked nucleosides.
  • Embodiment 30 The compound of any of embodiments 1-29, wherein at least one intemucleoside linkage of the modified crRNA is a modified intemucleoside linkage.
  • Embodiment 31 The compound of embodiment 30, wherein at least one intemucleoside linkage is a phosphorothioate intemucleoside linkage.
  • Embodiment 32 The compound of embodiment 30 or 31, wherein each intemucleoside linkage of the modified crRNA is a modified intemucleoside linkage.
  • Embodiment 33 The compound of any of embodiments 30-32, wherein at least one intemucleoside linkage is a neutral intemucleoside linkage.
  • Embodiment 34 The compound of embodiment 33, wherein at least one modified intemucleoside linkage comprises a methoxypropyl group.
  • Embodiment 35 The compound of embodiment 33, wherein at least one modified intemucleoside linkage comprises a phosphonoacetate.
  • Embodiment 36 The compound of embodiment 33, wherein at least one modified intemucleoside linkage comprises a methylphosphonate.
  • Embodiment 37 The compound of any of embodiments 1-31, wherein each intemucleoside linkage of the modified crRNA is a phosphodiester intemucleoside linkage or a phosphorothioate
  • Embodiment 38 The compound of any of embodiments 30, 31, or 33-37, wherein at least two
  • intemucleoside linkages of the modified crRNA are modified intemucleoside linkages.
  • Embodiment 39 The compound of embodiment 38, wherein at least two modified intemucleoside linkages of the modified crRNA are the same as one another.
  • Embodiment 40 The compound of any of embodiments 1-39, wherein the modified crRNA comprises one to five contiguous phosphorothioate intemucleoside linkages at the 5 '-end of the modified crRNA.
  • Embodiment 41 The compound of embodiment 40, wherein the modified crRNA comprises one phosphorothioate intemucleoside linkage at the 5 '-end of the modified crRNA.
  • Embodiment 42 The compound of embodiment 40, wherein the modified crRNA comprises two contiguous phosphorothioate intemucleoside linkages at the 5 '-end of the modified crRNA.
  • Embodiment 43 The compound of any of embodiments 1-42, wherein the modified crRNA comprises at least one linker nucleoside that is linked to the CRISPR recognition portion of the modified crRNA by a modified intemucleoside linkage.
  • Embodiment 44 The compound of embodiment 43, wherein the modified intemucleoside linkage that links the at least one linker nucleoside to the CRISPR recognition portion of the modified crRNA is a phosphorothiaote intemucleoside linkage.
  • Embodiment 45 The compound of embodiment 44, wherein the modified crRNA comprises two linker nucleosides.
  • Embodiment 46 The compound of embodiment 45, wherein the linker nucleosides are linked to each other by a modified intemucleoside linkage .
  • Embodiment 47 The compound of embodiment 46, wherein the modified intemucleoside that links the linker nucleosides to each other is a phosphorothioate intemucleoside linkage.
  • Embodiment 48 The compound of any embodiments 43-44, wherein the modified crRNA comprises more than two linker nucleosides.
  • Embodiment 49 The compound of any of embodiments 1-48, wherein the modified crRNA comprises one to six modified intemucleoside linkages within the target recognition portion of the modified crRNA.
  • Embodiment 50 The compound of embodiment 49, wherein the one to six modified intemucleoside linkages within the target recognition portion of the modified crRNA are contiguous.
  • Embodiment 51 The compound of embodiment 49, wherein the one to six modified intemucleoside linkages within the target recognition portion of the modified crRNA alternate with unmodified intemucleoside linkages.
  • Embodiment 52 The compound of any of embodiments 49-51, wherein the 3'-end of the target
  • Embodiment 53 The compound of any of embodiments 50-52, wherein the target recognition portion of the modified crRNA comprises one modified intemucleoside linkage.
  • Embodiment 54 The compound of any of embodiments 50-52, wherein the target recognition portion of the modified crRNA comprises two modified intemucleoside linkages.
  • Embodiment 55 The compound of any of embodiments 50-52, wherein the target recognition portion of the modified crRNA comprises three modified intemucleoside linkages.
  • Embodiment 56 The compound of any of embodiments 50-52, wherein the target recognition portion of the modified crRNA comprises four modified intemucleoside linkages.
  • Embodiment 57 The compound of any of embodiments 50-52, wherein the target recognition portion of the modified crRNA comprises five modified intemucleoside linkages.
  • Embodiment 58 The compound of any of embodiments 50-52, wherein the target recognition portion of the modified crRNA comprises six modified intemucleoside linkages.
  • Embodiment 59 The compound of any of embodiments 49-58, wherein at least one intemucleoside linkage within the target recognition portion of the modified crRNA is a phosphorothioate intemucleoside linkage.
  • Embodiment 60 The compound of any of embodiments 49-58, wherein all of the modified
  • Embodiment 61 The compound of any of embodiments 1-60, wherein the target recognition portion of the modified crRNA is directly or indirectly linked to the 3' end of the CRISPR recognition portion of the modified crRNA.
  • Embodiment 62 The compound of any of embodiments 1-61, wherein at least one nucleoside of the modified crRNA comprises a modified sugar moiety.
  • Embodiment 63 The compound of embodiment 62, wherein the 5 '-terminal nucleoside of the crRNA comprises a modified sugar moiety.
  • Embodiment 64 The compound of embodiment 63, wherein the 5'-terminal nucleoside comprises a linearly modified sugar moiety.
  • Embodiment 65 The compound of embodiment 64, wherein the 5 '-terminal nucleoside comprises a
  • Embodiment 66 The compound of embodiment 63, wherein the 5'-terminal nucleoside comprises a bicyclic sugar moiety.
  • Embodiment 67 The compound of embodiment 63, wherein the 5'-terminal nucleoside comprises a modified sugar moiety selected from among: 2'-0-methyl, 2'-MOE, 2'-F, cEt, and LNA.
  • Embodiment 68 The compound of any of embodiments 1-67, wherein the 5'-terminal nucleoside is a linker nucleoside.
  • Embodiment 69 The compound of any of embodiments 62-68, wherein the 5 th nucleoside from the 5'- end of the CRISPR recognition portion comprises a modified sugar moiety.
  • Embodiment 70 The compound of any of embodiments 62-69, wherein the 6 th nucleoside from the 5'- end of the CRISPR recognition portion comprises a modified sugar moiety.
  • Embodiment 71 The compound of any of embodiments 62-70, wherein the 7 th nucleoside from the 5'- end of the CRISPR recognition portion comprises a modified sugar moiety.
  • Embodiment 72 The compound of any of embodiments 62-71, wherein the 10 th nucleoside from the
  • Embodiment 73 The compound of any of embodiments 62-72, wherein the 14 th nucleoside from the
  • Embodiment 74 The compound of any of embodiments 62-73, wherein the 1st nucleoside from the 3'-end of the CRISPR recognition portion comprises a modified sugar moiety.
  • Embodiment 75 The compound of any of embodiments 69-74, wherein at least one modified sugar moiety selected from among: 2'-0-methyl, 2'-MOE, 2'-F, cEt, and LNA.
  • Embodiment 76 The compound of any of embodiments 69-74, wherein each modified sugar moiety is independently selected from among: 2'-0-methyl, 2'-MOE, 2'-F, cEt, and LNA.
  • Embodiment 77 The compound of embodiment 62, wherein the 3 '-terminal nucleoside of the
  • modified crRNA comprises a modified sugar moiety.
  • Embodiment 78 The compound of embodiment 77, wherein the 3 '-terminal nucleoside comprises a linearly modified sugar moiety.
  • Embodiment 79 The compound of embodiment 78, wherein the 3'-terminal nucleoside comprises a 2' -modified sugar moiety.
  • Embodiment 80 The compound of embodiment 77, wherein the 3'-terminal nucleoside comprises a bicyclic sugar moiety.
  • Embodiment 81 The compound of embodiment 77, wherein the 3 ' -terminal nucleoside comprises a modified sugar moiety selected from among: 2'-0-methyl, 2'-MOE, 2'-F, cEt, and LNA.
  • Embodiment 82 The compound of any of embodiments 62-81, wherein the 1st nucleoside from the
  • 5 '-end of the target recognition portion comprises a modified sugar moiety.
  • Embodiment 83 The compound of any of embodiments 62-82, wherein the 8th nucleoside from the
  • 5 '-end of the target recognition portion comprises a modified sugar moiety.
  • Embodiment 84 The compound of any of embodiments 62-83, wherein the 9th nucleoside from the 5 '-end of the target recognition portion comprises a modified sugar moiety.
  • Embodiment 85 The compound of any of embodiments 62-84, wherein one to five 3 '-terminal
  • nucleosides of the target recognition portion of the modified crRNA each comprise a modified sugar moiety.
  • Embodiment 86 The compound of embodiment 85, wherein the one to five 3'-terminal nucleosides of the target recognition portion of the modified crRNA each comprise the same modified sugar moiety.
  • Embodiment 87 The compound of embodiment 84 or 85, wherein the modified sugar moieties of the one to five 3 '-terminal nucleosides of the target recognition portion are each independently selected from among 2'-0-methyl, 2'-MOE, 2'-F, cEt, and LNA.
  • Embodiment 88 The compound of any of embodiments 1-87, wherein the target recognition portion of the modified crRNA comprises at least one unmodified sugar moiety.
  • Embodiment 89 The compound of any of embodiments 1-88, wherein the CRISPR recognition
  • portion of the modified crRNA comprises at least one unmodified sugar moiety.
  • Embodiment 90 The compound of any of embodiments 1-89, wherein the modified crRNA comprises at least one linker nucleoside that comprises an unmodified sugar moiety.
  • Embodiment 91 The compound of any of embodiments 1-90, wherein the compound consists of the modified crRNA.
  • Embodiment 92. The compound of any of embodiments 1-91, wherein the nucleobase sequence of the target recognition portion of the modified crRNA is at least 90% complementary to a target DNA or RNA.
  • Embodiment 93 The compound of embodiment 92, wherein the nucleobase sequence of the target recognition portion of the modified crRNA is 100% complementary to a target DNA or RNA.
  • Embodiment 94 The compound of any of embodiments 1-93, wherein the modified crRNA comprises a self-complementary region.
  • Embodiment 95 The compound of embodiment 94, wherein the self-complementary region is within the CRISPR recognition portion of the modified crRNA.
  • Embodiment 96 The compound of embodiment 94 or 95, wherein the self-complementary region can form a hairpin.
  • Embodiment 97 The compound of any of embodiments 94-96, wherein the self-complementary
  • region comprises at least one modification that increases the stability of the self-complementary region.
  • Embodiment 98 The compound of any of embodiments 94-97, wherein the self-complementary
  • region comprises at least one modification that increases the hybridization affinity of the self- complementary region.
  • Embodiment 99 The compound of any of embodiments 1-98, wherein the nucleobase sequence of the CRISPR recognition portion of the modified crRNA comprises at least 12 contiguous nucleobases of a sequence selected from Table A.
  • Embodiment 100 The compound of any of embodiments 1-98, wherein the nucleobase sequence of the CRISPR recognition portion of the modified crRNA consists of a sequence or a portion of a sequence selected from Table A.
  • Embodiment 101 The compound of any of embodiments 1-100, wherein the nucleobase sequence of the CRISPR recognition portion of the modified crRNA comprises the sequence XCXACX, wherein each X is, independently, a U nucleobase or a T nucleobase.
  • Embodiment 102 The compound of any of embodiments 1-100, wherein the nucleobase sequence of the CRISPR recognition portion of the modified crRNA comprises the sequence GXAGAX, wherein each X is, independently, a U nucleobase or a T nucleobase.
  • Embodiment 103 The compound of any of embodiments 1-100, wherein the nucleobase sequence of the CRISPR recognition portion of the modified crRNA comprises the sequence XCXACX and the sequence GXAGAX, wherein each X is, independently, a U nucleobase or a T nucleobase.
  • Embodiment 104 The compound of any of embodiments 1-90 or 92-103, wherein the compound
  • Embodiment 105 The compound of embodiment 104, wherein the conjugate group comprises GalNAc.
  • Embodiment 106 The compound of embodiment 104, wherein the conjugate group is lipophilic.
  • Embodiment 107 The compound of embodiment 106, wherein the conjugate group comprises a lipid.
  • Embodiment 108. A pharmaceutical composition comprising the compound of any of embodiments 1- 107.
  • Embodiment 109 A method comprising contacting a cell with the compound or composition of any of embodiments 1-108.
  • Embodiment 110 The method of embodiment 109, wherein the cell expresses a Cpfl nuclease.
  • Embodiment 111 A method comprising contacting a cell with the compound or composition of any of embodiments 1-108 and a plasmid that encodes a Cpfl nuclease.
  • Embodiment 112. A method comprising contacting a cell with the compound or composition of any of embodiments 1-108 and an mR A that encodes a Cpfl nuclease.
  • Embodiment 113 The method of any of embodiments 109-112, wherein the modified crRNA is taken up by the cell in the absence of a transfection reagent.
  • Embodiment 114 The method of any of embodiments 109-113, wherein the cell is in an animal.
  • Embodiment 115. A method comprising administering to an animal the compound or composition of any of embodiments 1-108.
  • Embodiment 116 The method of embodiment 115, wherein the administration is subcutaneous.
  • Embodiment 117. The method of embodiment 115, wherein the administration is intrathecal.
  • Embodiment 118 The method of any of embodiments 115-117 comprising administering a plasmid that encodes a Cpfl nuclease.
  • Embodiment 119 The method of any of embodiments 115-117 wherein the animal expresses a Cpfl nuclease.
  • Embodiment 120 The method of embodiment 111 or 118, wherein the plasmid is delivered to cells within the animal via an adeno-associated virus (AAV).
  • AAV adeno-associated virus
  • Embodiment 121 The method of embodiment 111 or 118, wherein the plasmid is delivered to cells within the animal via a lentivirus.
  • Embodiment 122 The method of any of embodiments 109-121, wherein a target gene is edited.
  • Embodiment 123 The method of embodiment 122, wherein the modified crRNA is degraded in a cell after the target gene is edited in the cell.
  • Embodiment 124 The method of any of embodiments 110-112 or 118-123, wherein the Cpfl nuclease does not exhibit nuclease activity in the absence of the modified crRNA.
  • Embodiment 125 The method of any of embodiments 109-124 comprising contacting the cell with a second compound that degrades or inhibits the activity or expression of the modified crRNA or a
  • Embodiment 126 The method of embodiment 125, wherein the cell is contacted with the second compound after a target gene has been edited.
  • Embodiment 127 The method of embodiment 125 or 126, wherein the second compound comprises an oligonucleotide that is complementary to the modified crRNA.
  • Embodiment 128 The method of embodiment 125 or 126, wherein the second compound comprises a crRNA that targets a Cpf 1 nuclease gene.
  • Embodiment 129 The method of embodiment 125 or 126, wherein the second compound comprises an oligonucleotide that is complementary to a Cpf 1 transcript.
  • Embodiment 130 The method of embodiment 128 or 129, wherein the expression of the Cpfl nuclease is inhibited.
  • Embodiment 131 The method of any of embodiments 114-130, wherein the animal is a human.
  • Embodiment 132 The method of any of embodiments 109-131, wherein editing of at least one off-target gene is reduced relative to editing the at least one off-target gene when unmodified crRNA or a compound comprising more than 45 nucleosides is used in place of the modified crRNA.
  • Embodiment 133 The method of any of embodiments 115 or 118-132, wherein the administration is intravitreal.
  • Embodiment 134 The method of any of embodiments 109-113, wherein the cell is a plant cell.
  • Embodiment 135. The method of any of embodiments 109-114, wherein the cell is a T-cell.
  • Embodiment 136 A method of treating a disease in an individual comprising administering the
  • Embodiment 137 Use of the compound of any of embodiments 1-107 or the composition of
  • embodiment 108 for the treatment of a disease.
  • Embodiment 138 Use of the compound of any of embodiments 1-107 or the composition of
  • embodiment 108 for preparation of a medicament.
  • Embodiment 139 A method of administering the compound of any of embodiments 1-107 or the
  • composition of embodiment 108 to an animal, and harvesting an organ from the animal for transplantation into a human.
  • Embodiment 140 The compound of any of embodiments 90-107, wherein the 5 '-terminal nucleoside comprises a cEt modified sugar moiety.
  • Embodiment 141 The compound of embodiment 140, wherein the 3 '-end of the target recognition portion of the modified crRNA contains two contiguous phosphorothioate intemucleoside linkages.
  • Embodiment 142 The compound of any of embodiments 140-141, wherein each intemucleoside
  • linkage of the CRISPR recognition portion of the modified crRNA is phosphorothioate.
  • Embodiment 143 The compound of any of embodiments 140-142, wherein the two 3 '-terminal
  • nucleosides of the target recognition portion of the modified crRNA each comprise a 2'-0-methyl modified sugar moiety.
  • Embodiment 144 The compound of any of embodiments 140-143, wherein the 1 st nucleoside from the
  • 5 '-end of the CRISPR recognition portion comprises an unmodified sugar moiety.
  • Embodiment 145 The compound of any of embodiments 140-144, wherein the modified crRNA
  • Embodiment 146 The compound of embodiment 145, wherein the modified crRNA comprises 36 unmodified sugar moieties.
  • Embodiment 147 A pharmaceutical composition comprising the compound of any of embodiments
  • Embodiment 148 A method comprising contacting a cell with the compound or composition of any of embodiments 140-147.
  • Embodiment 149 The method of embodiment 148, wherein the cell expresses a Cpfl nuclease.
  • Embodiment 150 A method comprising contacting a cell with the compound or composition of any of embodiments 140-147 and a plasmid that encodes a Cpfl nuclease.
  • Embodiment 151 A method comprising contacting a cell with the compound or composition of any of embodiments 140-147 and an mR A that encodes a Cpfl nuclease.
  • Embodiment 152 The method of any of embodiments 148-151, wherein the modified crRNA is taken up by the cell in the absence of a transfection reagent.
  • Embodiment 153 The method of any of embodiments 148-152, wherein the cell is in an animal.
  • Embodiment 154. A method comprising administering to an animal the compound or composition of any of embodiments 140-147.
  • Embodiment 155 The method of embodiment 154, wherein the administration is subcutaneous.
  • Embodiment 156. The method of embodiment 154, wherein the administration is intrathecal.
  • Embodiment 157 The method of any of embodiments 154-156 comprising administering a plasmid that encodes a Cpfl nuclease.
  • Embodiment 158 The method of any of embodiments 154-156 wherein the animal expresses a Cpfl nuclease.
  • Embodiment 159 The method of embodiment 150 or 157, wherein the plasmid is delivered to cells within the animal via an adeno-associated virus (AAV).
  • AAV adeno-associated virus
  • Embodiment 160 The method of embodiment 150 or 157, wherein the plasmid is delivered to cells within the animal via a lenti virus.
  • Embodiment 161 The method of any of embodiments 148-160, wherein a target gene is edited.
  • Embodiment 162 The method of embodiment 161, wherein the modified crRNA is degraded in a cell after the target gene is edited in the cell.
  • Embodiment 163 The method of any of embodiments 149-151 or 157-162, wherein the Cpfl nuclease does not exhibit nuclease activity in the absence of the modified crRNA.
  • Embodiment 164. The method of any of embodiments 148-163 comprising contacting the cell with a second compound that degrades or inhibits the activity or expression of the modified crRNA or a Cpfl nuclease.
  • Embodiment 165 The method of embodiment 164, wherein the cell is contacted with the second
  • Embodiment 166 The method of embodiment 164 or 165, wherein the second compound comprises an oligonucleotide that is complementary to the modified crRNA.
  • Embodiment 167 The method of embodiment 164 or 165, wherein the second compound comprises a crRNA that targets a Cpfl nuclease gene.
  • Embodiment 168 The method of embodiment 164 or 165, wherein the second compound comprises an oligonucleotide that is complementary to a Cpfl transcript.
  • Embodiment 169 The method of embodiment 167 or 168, wherein the expression of the Cpfl nuclease is inhibited.
  • Embodiment 170 The method of any of embodiments 153-169, wherein the animal is a human.
  • Embodiment 171 The method of any of embodiments 148-170, wherein editing of at least one off-target gene is reduced relative to editing the at least one off-target gene when unmodified crRNA or a compound comprising more than 45 nucleosides is used in place of the modified crRNA.
  • Embodiment 172 The method of any of embodiments 154 or 157-171, wherein the administration is intravitreal.
  • Embodiment 173 The method of any of embodiments 148-152, wherein the cell is a plant cell.
  • Embodiment 174 The method of any of embodiments 148-153, wherein the cell is a T-cell.
  • Embodiment 175. A method of treating a disease in an individual comprising administering the
  • Embodiment 176 A method of treating a disease in an individual comprising administering the
  • Embodiment 177 Use of the compound of any of embodiments 140-146 or the composition of
  • embodiment 147 for the treatment of a disease.
  • Embodiment 178 Use of the compound of any of embodiments 140-146 or the composition of
  • embodiment 147 for preparation of a medicament for preparation of a medicament.
  • Embodiment 179 A method of administering the compound of any of embodiments 140-146 or the composition of embodiment 147 to an animal, and harvesting an organ from the animal for transplantation into a human.
  • Embodiment 180 The compound of any of embodiments 91-107 or 140-146, wherein at least one modified nucleoside of the modified crRNA is a 2'-deoxynucleoside.
  • Embodiment 181. The compound of any of embodiments 91-107 or 140-146, wherein at least one modified nucleoside of the modified crRNA comprises a linearly modified sugar moiety having a 2'- H substitution.
  • Embodiment 182 The compound of any of embodiments 91-107 or 140-146, wherein at least one modified nucleoside of the modified crRNA comprises a modified 2'-H(H) sugar moiety as found in naturally occurring DNA.
  • Embodiment 183 The compound of any of embodiments 91-107, 140-146, or 180-182, wherein the modified crRNA consists of 40 linked nucleosides.
  • Embodiment 184 The compound of any of embodiments 91-107, 140-146, or 180-182, wherein the modified crRNA consists of 43 linked nucleosides.
  • Embodiment 185 The compound of any of embodiments 91-107, 140-146, or 180-182, wherein the modified crRNA consists of 45 linked nucleosides.
  • Embodiment 186 The compound of any of embodiments 91-107, 140-146, or 180-185, wherein the target recognition portion of the modified crRNA is at least 90% complementary to a DNMT1 nucleic acid.
  • Embodiment 187 The compound of embodiment 186, wherein the target recognition portion is 100% complementary to a DNMT1 nucleic acid.
  • Embodiment 188 The compound of embodiment 186 or 187, wherein the DNMT1 nucleic acid is a deoxyribonucleic acid.
  • Embodiment 189 The compound of embodiment 188, wherein the DNMT1 nucleic acid is a human deoxyribonucleic acid.
  • Embodiment 190 The compound of any of embodiments 91-107, 140-146, or 180-185, wherein the target recognition portion of the modified crRNA is at least 90% complementary to a LDLR nucleic acid.
  • Embodiment 191 The compound of embodiment 190, wherein the target recognition portion is 100% complementary to a LDLR nucleic acid.
  • Embodiment 192 The compound of embodiment 191, wherein the LDLR nucleic acid is a human deoxyribonucleic acid.
  • Embodiment 193 The compound of any of embodiments 91-107, 140-146, or 180-192, wherein the two 3 '-terminal nucleosides of the modified crRNA comprise independently selected modified sugar moieities.
  • Embodiment 194 The compound of any of embodiments 91-107, 140-146, or 180-192, wherein the three 3 '-terminal nucleosides of the modified crRNA comprise independently selected modified sugar moieities.
  • Embodiment 195 The compound of any of embodiments 91-107, 140-146, or 180-192, wherein the four 3 '-terminal nucleosides of the modified crRNA comprise independently selected modified sugar moieities.
  • Embodiment 196 The compound of any of embodiments 91-107, 140-146, or 180-192, wherein the five 3 '-terminal nucleosides of the modified crRNA comprise independently selected modified sugar moieities.
  • Embodiment 197 The compound of any of embodiments 77 or 193-196, wherein the modified sugar moieties of the 3'-terminal modified nucleosides are selected from among 2'-H(H), 2'-0-methyl, 2'- F, cEt, and LNA modified sugar moieties.
  • Embodiment 198 The compound of embodiment 197, wherein the modified sugar moieties of the 3'- terminal modified nucleosides are selected from among 2'-H(H), 2'-0-methyl, and cEt modified sugar moieties.
  • Embodiment 199 The compound of embodiment 197, wherein the modified sugar moieties of the 3'- terminal modified nucleosides are selected from among 2'-H(H) and 2 '-O-methyl modified sugar moieties.
  • Embodiment 200 The compound of embodiment 197, wherein the modified sugar moieties of the 3'- terminal modified nucleosides are selected from among cEt and LNA modified sugar moieties.
  • Embodiment 201 The compound of any of embodiments 82-107, 140-146, or 180-200, wherein the 1st nucleoside from the 5 '-end of the target recognition portion comprises a 2'-H(H) or 2'-F modified sugar moiety.
  • Embodiment 202 The compound of any of embodiments 82-107, 140-146, or 180-201, wherein the 8th nucleoside from the 5 '-end of the target recognition portion comprises a 2'-H(H) or 2'-F modified sugar moiety.
  • Embodiment 203 The compound of any of embodiments 82-107, 140-146, or 180-202, wherein the 9th nucleoside from the 5 '-end of the target recognition portion comprises a 2'-H(H) or 2'-F modified sugar moiety.
  • Embodiment 204 The compound of any of embodiments 91-107, 140-146, or 180-203, wherein the modified crRNA comprises at least three of the following features:
  • each nucleoside of the CRISPR recognition portion comprising an unmodified sugar moiety e. one to five 3 '-terminal nucleosides of the modified crRNA comprising independently selected modified sugar moieities
  • Embodiment 205 The compound of any of embodiments 1-107, 140-146, or 180-204, wherein the modified crRNA is a salt.
  • Embodiment 206 A pharmaceutical composition comprising the compound of any of embodiments 180-205.
  • Embodiment 207 The pharmaceutical composition of any of embodiments 108, 147, or 206, wherein the pharmaceutical composition comprises a ribonucleoprotein complex.
  • Embodiment 208 The pharmaceutical composition of embodiment 207, wherein the ribonucleoprotein complex comprises a Cpf 1 nuclease and the compound comprising the modified crRNA.
  • Embodiment 209 A method comprising contacting a cell with the compound or composition of any of embodiments 180-208.
  • Embodiment 210 A method comprising contacting a cell with the compound or composition of any of embodiments 180-207, wherein the cell expresses a Cpfl nuclease.
  • Embodiment 211 A method comprising contacting a cell with the compound or composition of any of embodiments 180-207 and a plasmid that encodes a Cpfl nuclease.
  • Embodiment 212 A method comprising contacting a cell with the compound or composition of any of embodiments 180-207 and an mRNA that encodes a Cpfl nuclease.
  • Embodiment 213 The method of any of embodiments 209-212, wherein the modified crRNA is taken up by the cell in the absence of a transfection reagent.
  • Embodiment 214 The method of any of embodiments 209-213, wherein the cell is in an animal.
  • Embodiment 215. A method comprising administering to an animal the compound or composition of any of embodiments 180-208.
  • Embodiment 216 The method of embodiment 215, wherein the administration is subcutaneous.
  • Embodiment 217 The method of embodiment 215, wherein the administration is intrathecal.
  • Embodiment 218 The method of any of embodiments 215-217 comprising administering a plasmid that encodes a Cpfl nuclease.
  • Embodiment 219. The method of any of embodiments 215-217 wherein the animal expresses a Cpfl nuclease.
  • Embodiment 220 The method of embodiment 211 or 218, wherein the plasmid is delivered to cells within the animal via an adeno-associated virus (AAV).
  • AAV adeno-associated virus
  • Embodiment 22 The method of embodiment 211 or 218, wherein the plasmid is delivered to cells within the animal via a lenti virus.
  • Embodiment 222 The method of any of embodiments 209-221, wherein a target gene is edited.
  • Embodiment 223. The method of embodiment 222, wherein the modified crRNA is degraded in a cell after the target gene is edited in the cell.
  • Embodiment 224. The method of any of embodiments 210-212 or 215-223, wherein the Cpfl nuclease does not exhibit nuclease activity in the absence of the modified crRNA.
  • Embodiment 225 The method of any of embodiments 209-224 comprising contacting the cell with a second compound that degrades or inhibits the activity or expression of the modified crRNA or a Cpfl nuclease.
  • Embodiment 226 The method of embodiment 225, wherein the cell is contacted with the second
  • Embodiment 227 The method of embodiment 225 or 226, wherein the second compound comprises an oligonucleotide that is complementary to the modified crRNA.
  • Embodiment 228 The method of embodiment 225 or 226, wherein the second compound comprises a crRNA that targets a Cpfl nuclease gene.
  • Embodiment 229. The method of embodiment 225 or 226, wherein the second compound comprises an oligonucleotide that is complementary to a Cpfl transcript.
  • Embodiment 230 The method of embodiment 228 or 229, wherein the expression of the Cpfl nuclease is inhibited.
  • Embodiment 23 The method of any of embodiments 214-230, wherein the animal is a human.
  • Embodiment 232 The method of any of embodiments 209-231, wherein editing of at least one off-target gene is reduced relative to editing the at least one off-target gene when unmodified crRNA or a compound comprising more than 45 nucleosides is used in place of the modified crRNA.
  • Embodiment 233 The method of any of embodiments 215 or 218-232, wherein the administration is intravitreal.
  • Embodiment 23 The method of any of embodiments 209-213, wherein the cell is a plant cell.
  • Embodiment 235 The method of any of embodiments 209-214, wherein the cell is a T-cell.
  • Embodiment 236 A method of treating a disease in an individual comprising administering the
  • Embodiment 237 A method of treating a disease in an individual comprising administering the
  • Embodiment 238 Use of the compound of any of embodiments 180-205 or the composition of any of embodiments 206-208 for the treatment of a disease.
  • Embodiment 23 Use of the compound of any of embodiments 180-205 or the composition of any of embodiments 206-208 for preparation of a medicament.
  • Embodiment 240 A method of administering the compound of any of embodiments 180-205 or the composition of any of embodiments 206-208 to an animal, and harvesting an organ from the animal for transplantation into a human.
  • Embodiment 241. The compound of any of embodiments 1-107, 140-146, or 180-205, wherein the
  • CRISPR recognition portion of the modified crRNA comprises at least one modified sugar moiety.
  • Embodiment 242. The compound of embodiment 241, wherein the at least one modified sugar moiety of the CRISPR recognition portion is a linearly modified sugar moiety.
  • Embodiment 243 The compound of embodiment 241 , wherein the at least one modified sugar moiety of the CRISPR recognition portion is a bicyclic sugar moiety.
  • Embodiment 244 The compound of embodiment 243, wherein the bicyclic sugar moiety is cEt or
  • Embodiment 245. The compound of embodiment 243, wherein the bicyclic sugar moiety is cEt.
  • Embodiment 246 The compound of any of claims 241-245, wherein the 2nd nucleoside from the 3'- end of the CRISPR recognition portion comprises the at least one modified sugar moiety.
  • Embodiment 247 The compound of any of claims 241-245, wherein the 3rd nucleoside from the 3'-end of the CRISPR recognition portion comprises the at least one modified sugar moiety.
  • Embodiment 248 The compound of any of claims 241-245, wherein the 4th nucleoside from the 3'-end of the CRISPR recognition portion comprises the at least one modified sugar moiety.
  • Embodiment 249. The compound of any of claims 241-245, wherein the 5th nucleoside from the 3 '-end of the CRISPR recognition portion comprises the at least one modified sugar moiety.
  • Embodiment 250 The compound of any of claims 241-245, wherein the 6th nucleoside from the 3 '-end of the CRISPR recognition portion comprises the at least one modified sugar moiety.
  • Embodiment 251 The compound of any of claims 241-245, wherein the 7th nucleoside from the 3 '-end of the CRISPR recognition portion comprises the at least one modified sugar moiety.
  • Embodiment 252 The compound of any of claims 241-245, wherein the 8th nucleoside from the 3'-end of the CRISPR recognition portion comprises the at least one modified sugar moiety.
  • Embodiment 253 The compound of any of claims 241-245, wherein the 9th nucleoside from the 3 '-end of the CRISPR recognition portion comprises the at least one modified sugar moiety.
  • Embodiment 254 The compound of any of claims 241-245, wherein the 11th nucleoside from the 3'- end of the CRISPR recognition portion comprises the at least one modified sugar moiety.
  • Embodiment 255 The compound of any of claims 241-245, wherein the 12th nucleoside from the 3'- end of the CRISPR recognition portion comprises the at least one modified sugar moiety.
  • Embodiment 256 The compound of any of claims 241-245, wherein the 13th nucleoside from the 3'- end of the CRISPR recognition portion comprises the at least one modified sugar moiety.
  • Embodiment 257 The compound of any of claims 241-245, wherein the 18 th nucleoside from the 3'- end of the CRISPR recognition portion comprises the at least one modified sugar moiety.
  • Embodiment 258 The compound of any of claims 241-245, wherein the 11 th and 12 th nucleosides from the 3 '-end of the CRISPR recognition portion each comprise a modified sugar moiety.
  • Embodiment 260 The compound of any of claims 241-259, wherein the 10 th nucleoside from the 3'- end of the CRISPR recognition portion comprises an unmodified sugar moiety.
  • Embodiment 261 The compound of any of claims 241-260, wherein the 14 th nucleoside from the 3'- end of the CRISPR recognition portion comprises an unmodified sugar moiety.
  • Embodiment 262 The compound of any of claims 241-261, wherein the 15 th nucleoside from the 3'- end of the CRISPR recognition portion comprises an unmodified sugar moiety.
  • Embodiment 263 The compound of any of claims 241-262, wherein the 16 th nucleoside from the 3'- end of the CRISPR recognition portion comprises an unmodified sugar moiety.
  • Embodiment 264 The compound of any of claims 241-263, wherein the 17 th nucleoside from the 3'- end of the CRISPR recognition portion comprises an unmodified sugar moiety.
  • Embodiment 265. The compound of any of claims 241-264, wherein the 1st nucleoside from the 5 '-end of the CRISPR recognition portion comprises an unmodified sugar moiety.
  • Embodiment 266 The compound of any of claims 241-265, wherein the 2nd nucleoside from the 5'- end of the CRISPR recognition portion comprises an unmodified sugar moiety.
  • Embodiment 267 The compound of any of claims 241-266, wherein the 3rd nucleoside from the 5'-end of the CRISPR recognition portion comprises an unmodified sugar moiety.
  • Embodiment 268 The compound of any of claims 1-107, 140-146, 180-205, or 241-267, wherein the 14 th nucleoside from the 5 '-end of the target recognition portion comprises a modified sugar moiety.
  • Embodiment 269. The compound of any of claims 1-107, 140-146, 180-205, or 241-268, wherein the
  • Embodiment 270 The compound of any of claims 1-107, 140-146, 180-205, or 241-269, wherein the
  • 16 th nucleoside from the 5 '-end of the target recognition portion comprises a modified sugar moiety.
  • Embodiment 271. The compound of any of claims 268-270, wherein each modified sugar moiety at position 14, 15, and/or 16 from the 5'-end of the target recognition portion is a linearly modified sugar moiety.
  • Embodiment 272 The compound of claim 271, wherein each modified sugar moiety at position 14, 15, and/or 16 from the 5 '-end of the target recognition portion is independently selected from 2'-H(H) and 2'-F modified sugar moieties.
  • Embodiment 273 The compound of claim 272, wherein each modified sugar moiety at position 14, 15, and/or 16 from the 5 '-end of the target recognition portion is a 2'-H(H) modified sugar moiety.
  • Embodiment 27 The compound of any of claims 1-107, 140-146, 180-205, or 241-273, wherein the modified crRNA comprises at least three of the following features: (a) two linker nucleosides linked to the 5 '-end of the CRISPR recognition portion of the modified crRNA;
  • At least one nucleoside at position 5, 6, 7, 8, 11, or 12 from the 3'-end of the CRISPR recognition portion comprises a modified sugar moiety
  • Embodiment 275 The compound of claim 274, wherein the modified crRNA comprises features (a), (c), and (e).
  • Embodiment 276 The compound of claim 274, wherein the modified crRNA comprises features (a), (c), and (d).
  • Embodiment 277 The compound of claim 274, wherein the modified crRNA comprises features (a),
  • Embodiment 278 The compound of claim 274, wherein the modified crRNA comprises features (a), (b), (c), and (e).
  • Embodiment 279. The compound of claim 274, wherein the modified crRNA comprises features (a), (c), (d), and (e).
  • Embodiment 280 The compound of claim 274, wherein the modified crRNA comprises features (a), (b), (c), (d), and (e).
  • Embodiment 28 A pharmaceutical composition comprising the compound of any of claims 241-280.
  • Embodiment 282. The pharmaceutical composition of claim 281, wherein the pharmaceutical
  • composition comprises a ribonucleoprotein complex.
  • Embodiment 283 The pharmaceutical composition of claim 282, wherein the ribonucleoprotein
  • complex comprises a Cpf 1 nuclease and the compound comprising the modified crRNA.
  • Embodiment 284. A method comprising contacting a cell with the compound or composition of any of claims 241-283.
  • Embodiment 285. A method comprising contacting a cell with the compound or composition of any of claims 241-283, wherein the cell expresses a Cpfl nuclease.
  • Embodiment 286 A method comprising contacting a cell with the compound or composition of any of claims 241-283 and a plasmid that encodes a Cpfl nuclease.
  • Embodiment 287 A method comprising contacting a cell with the compound or composition of any of claims 241-283 and an mR A that encodes a Cpfl nuclease.
  • Embodiment 288 The method of any of claims 284-287, wherein the modified crRNA is taken up by the cell in the absence of a transfection reagent.
  • Embodiment 289. The method of any of claims 284-288, wherein the cell is in an animal.
  • Embodiment 290 A method comprising administering to an animal the compound or composition of any of claims 241-283.
  • Embodiment 291. The method of claim 290, wherein the administration is subcutaneous.
  • Embodiment 292 The method of claim 290, wherein the administration is intrathecal.
  • Embodiment 293. The method of any of claims 290-292 comprising administering a plasmid that
  • Embodiment 294 The method of any of claims 290-292 wherein the animal expresses a Cpfl nuclease.
  • Embodiment 295. The method of claim 286 or 293, wherein the plasmid is delivered to cells within the animal via an adeno-associated virus (AAV).
  • AAV adeno-associated virus
  • Embodiment 296 The method of claim 286 or 293, wherein the plasmid is delivered to cells within the animal via a lenti virus.
  • Embodiment 297 The method of any of claims 284-296, wherein a target gene is edited.
  • Embodiment 298 The method of claim 297, wherein the modified crRNA is degraded in a cell after the target gene is edited in the cell.
  • Embodiment 299. The method of any of claims 285-287 or 293-298, wherein the Cpfl nuclease does not exhibit nuclease activity in the absence of the modified crRNA.
  • Embodiment 300 The method of any of claims 284-299 comprising contacting the cell with a second compound that degrades or inhibits the activity or expression of the modified crRNA or a Cpfl nuclease.
  • Embodiment 301 The method of claim 300, wherein the cell is contacted with the second compound after a target gene has been edited.
  • Embodiment 302. The method of claim 300 or 301, wherein the second compound comprises an
  • oligonucleotide that is complementary to the modified crRNA.
  • Embodiment 303 The method of claim 300 or 301, wherein the second compound comprises a crRNA that targets a Cpfl nuclease gene.
  • Embodiment 304 The method of claim 300 or 301, wherein the second compound comprises an
  • oligonucleotide that is complementary to a Cpfl transcript.
  • Embodiment 305 The method of claim 303 or 304, wherein the expression of the Cpfl nuclease is inhibited.
  • Embodiment 306 The method of any of claims 289-305, wherein the animal is a human.
  • Embodiment 307. The method of any of claims 284-306, wherein editing of at least one off-target gene is reduced relative to editing the at least one off-target gene when unmodified crRNA or a compound comprising more than 45 nucleosides is used in place of the modified crRNA.
  • Embodiment 308 The method of any of claims 290 or 293-297, wherein the administration is
  • Embodiment 309 The method of any of claims 284-288, wherein the cell is a plant cell.
  • Embodiment 310 The method of any of claims 284-289, wherein the cell is a T-cell.
  • Embodiment 311 A method of treating a disease in an individual comprising administering the
  • Embodiment 312 A method of treating a disease in an individual comprising administering the
  • Embodiment 31 Use of the compound of any of claims 241-280 or the composition of any of claims
  • Embodiment 31 Use of the compound of any of claims 241-280 or the composition of any of claims
  • Embodiment 315 A method of administering the compound of any of claims 241-280 or the
  • composition of any of claims 281-283 to an animal, and harvesting an organ from the animal for transplantation into a human.
  • Embodiment 316 The pharmaceutical composition of any of embodiemnts 108, 147, 206, or 281 comprising a liposome or lipid nanoparticle.
  • Embodiment 317 The pharmaceutical composition of any of embodiments 108, 147, 206, 281, or 316 comprising mRNA that encodes a Cpfl nuclease.
  • Embodiment 318 The pharmaceutical composition of embodiment 317, wherein the compound
  • Embodiment 319 The method of any of embodiments 212-214, 151-153, 212-214, or 287-289, wherein the mRNA encoding the Cpfl nuclease and the compound comprising the modified crRNA are contained within a liposome or lipid nanoparticle.
  • Embodiment 320 A method of treating a disease in an individual comprising administering the
  • Embodiment 32 A method of treating a disease in an individual comprising administering the
  • modified nucleosides include modified nucleosides. Unless otherwise provided, the following modified nucleosides, without limitation, are suitable for such incorporation into modifed oligonucleotides for use as crRNA.
  • modified oligonucleotides comprise at least one modified nucleoside.
  • modified nucleosides comprise a modified sugar moiety or a modified nucleobase or both a modifed sugar moiety and a modified nucleobase.
  • modified oligonucleotides such as modified crR As, comprise one or more modified nucleosides comprising a modified sugar moiety.
  • modified oligonucleotides comprising one or more sugar-modified nucleosides may have desirable properties, such as enhanced nuclease stability or increased binding affinity with a target nucleic acid relative to oligonucleotides lacking such sugar-modified nucleosides.
  • modified sugar moieties are linearly modified sugar moieties.
  • modified sugar moieties are bicyclic or tricyclic sugar moieties.
  • modified sugar moieties are sugar surrogates. Such sugar surrogates may comprise one or more substitutions corresponding to those of substituted sugar moieties.
  • modified sugar moieties are linearly modified sugar moieties comprising a furanosyl ring with one or more acyclic substituent, including but not limited to substituents at the 2' and/or 5' positions.
  • 2'-substituent groups suitable for linearly modified sugar moieties for use in modified crRNA include but are not limited to: 2'-H, 2'-F, 2'-OCH 3 ("OMe” or "O-methyl"), and 2'- 0(CH 2 ) 2 OCH3 (“MOE").
  • the 2 '-substituent groups of such linearly modified sugar moieties replace the 2'- OH group that is present in unmodified sugar moities.
  • 2' -substituent groups are selected from among: halo, allyl, amino, azido, SH, CN, OCN, CF3, OCF3, O-Ci-Cio alkoxy, O-Ci-Cio substituted alkoxy, O-Ci-Cio alkyl, O-Ci-Cio substituted alkyl, S-alkyl, N(R m )-alkyl, O-alkenyl, S-alkenyl, N(R m )-alkenyl, O-alkynyl, S-alkynyl, N(R m )-alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O- alkaryl, O-aralkyl, 0(CH 2 ) 2 SCH 3 , 0(CH 2 )20N(R m )(R note) or OCH 2
  • 2'-substituent groups can be further substituted with one or more substituent groups independently selected from among: hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro (NO2), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl and alkynyl.
  • substituent groups independently selected from among: hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro (NO2), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl and alkynyl.
  • substituent groups independently selected from among: hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro (NO2), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl and al
  • linearly modified sugars comprise more than one non-bridging sugar substituent, for example, 2'-F-5 '-methyl sugar moieties (see, e.g., PCT International Application WO 2008/101157, for additional 2', 5'-bis substituted sugar moieties and nucleosides).
  • a 2'-substituted nucleoside or 2'-linearly modified nucleoside comprises a sugar moiety comprising a linear 2' -substituent group selected from: H, F, NH2, N3, OCF3, OCH3,
  • a 2'-substituted nucleoside or 2'-linearly modified nucleoside comprises a sugar moiety comprising a linear 2' -substituent group selected from: H, F, OCH3, and OCH2CH2OCH3.
  • Nucleosides comprising modified sugar moieties are referred to by the position(s) of the substitution(s) on the sugar moiety of the nucleoside.
  • nucleosides comprising 2 '-substituted or 2-modified sugar moieties are referred to as 2' -substituted nucleosides or 2-modified nucleosides.
  • Certain modifed sugar moieties comprise a bridging sugar substituent that forms a second ring resulting in a bicyclic sugar moiety.
  • the bicyclic sugar moiety comprises a bridge between the 4' and the 2' furanose ring atoms.
  • 4' to 2' bridging sugar substituents include but are not limited to: 4'-CH 2 -2', 4'-(CH 2 ) 2 -2', 4'-(CH 2 )3-2', 4'-CH 2 -0-2' ("LNA"), 4'-CH 2 -S-2', 4'- (CH 2 ) 2 -0-2' ("ENA”), 4'-CH(CH 3 )-0-2' (referred to as "constrained ethyl” or "cEt” when in the S configuration), 4'-CH 2 -0-CH 2 -2', 4'-CH 2 -N(R)-2', 4'-CH(CH 2 OCH 3 )-0-2' (“constrained MOE” or "cMOE”) and analogs thereof (see, e.g., U.S.
  • Patent 7,399,845) 4'-C(CH 3 )(CH 3 )-0-2' and analogs thereof (see, e.g., WO2009/006478), 4'-CH2-N(OCH 3 )-2' and analogs thereof (see, e.g., WO2008/150729), 4'-CH 2 -0-N(CH 3 )- 2' (see, e.g., US2004/0171570), 4'-CH 2 -C(H)(CH 3 )-2' (see, e.g., Chattopadhyaya, et al, J. Org.
  • x 0, 1, or 2;
  • n 1, 2, 3, or 4;
  • bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by isomeric configuration.
  • an LNA nucleoside (described above) may be in the a-L configuration or in the ⁇ -D configuration.
  • bicyclic nucleosides include both isomeric configurations.
  • positions of specific bicyclic nucleosides e.g., LNA or cEt
  • they are in the ⁇ -D configuration, unless otherwise specified.
  • modified sugar moieties comprise one or more non-bridging sugar substituent and one or more bridging sugar substituent (e.g., 5 '-substituted and 4'-2' bridged sugars), (see, e.g., WO 2007/134181, wherein LNA nucleosides are further substituted with, for example, a 5'-methyl or a 5'-vinyl group, and see, e.g., U.S. Patents 7,547,684; 7,750, 131; 8,030,467; 8,268,980; 7,666, 854; and 8,088,746).
  • modified sugar moieties are sugar surrogates.
  • the oxygen atom of the sugar moiety is replaced, e.g., with a sulfur, carbon or nitrogen atom.
  • modified sugar moieties also comprise bridging and/or non-bridging substituents as described above.
  • certain sugar surrogates comprise a 4'-sulfur atom and a substitution at the 2'- position (see, e.g., US2005/0130923) and/or the 5' position.
  • sugar surrogates comprise rings having other than 5 atoms.
  • a sugar surrogate comprises a six-membered tetrahydropyran ("THP").
  • THP tetrahydropyran
  • Such tetrahydropyrans may be further modified or substituted. Nucleosides comprising such modified
  • tetrahydropyrans include but are not limited to hexitol nucleic acid (“HNA”), anitol nucleic acid (“ANA”), manitol nucleic acid (“MNA”) (see Leumann, CJ. Bioorg. & Med. Chem. 2002, 10, 841-854), fluoro HNA:
  • F-HNA see e.g., US Patents 8,088,904; 8,440,803; and 8,796,437
  • F-HNA can also be referred to as a F- THP or 3'-fluoro tetrahydropyran
  • nucleosides comprising additional modified THP compounds having the formula:
  • Bx is a nucleobase moiety
  • T3 and T4 are each, independently, an internucleoside linking group linking the modified THP nucleoside to the remainder of an oligonucleotide or one of T3 and T4 is an internucleoside linking group linking the modified THP nucleoside to the remainder of an oligonucleotide and the other of T3 and T4 is H, hydroxyl protecting group, a linked conjugate group, or a 5' or 3'-terminal group;
  • modified THP nucleosides are provided wherein qi, q 2 , q3, q4, qs, qe and q7 are each H. In certain embodiments, at least one of qi, q 2 , q 3 , q4, qs, qe and q7 is other than H. In certain embodiments, at least one of qi, q 2 , q 3 , q4, qs, qe and q7 is methyl. In certain embodiments, modified THP nucleosides are provided wherein one of Ri and R 2 is F. In certain embodiments, Ri is F and R 2 is H, in certain embodiments, Ri is methoxy and R 2 is H, and in certain embodiments, Ri is methoxyethoxy and R 2 is H.
  • sugar surrogates comprise rings having more than 5 atoms and more than one heteroatom.
  • nucleosides comprising morpholino sugar moieties and their use in oligonucleotides have been reported (see, e.g., Braasch et al., Biochemistry, 2002, 41, 4503-4510 and U.S. Patents 5,698,685; 5, 166,315; 5,185,444; and 5,034,506).
  • morpholino means a sugar surrogate having the following structure:
  • morpholinos may be modified, for example by adding or altering various substituent groups from the above morpholino structure.
  • sugar surrogates are refered to herein as "modifed morpholinos.”
  • sugar surrogates comprise acyclic moieites.
  • nucleosides and oligonucleotieds comprising such acyclic sugar surrogates include but are not limited to: peptide nucleic acid (“PNA”), acyclic butyl nucleic acid (see, e.g., Kumar et al., Org. Biomol. Chem. , 2013, 11, 5853-5865), and nucleosides and oligonucleotides described in WO2011/133876.
  • PNA peptide nucleic acid
  • acyclic butyl nucleic acid see, e.g., Kumar et al., Org. Biomol. Chem. , 2013, 11, 5853-5865
  • modified oligonucleotides such as modified crRNAs, comprise one or more nucleoside comprising an unmodified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleoside comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleoside that does not comprise a nucleobase, referred to as an abasic nucleoside.
  • modified nucleobases are selected from: 5-substituted pyrimidines, 6- azapyrimidines, alkyl or alkynyl substituted pyrimidines, alkyl substituted purines, and N-2, N-6 and 0-6 substituted purines.
  • modified nucleobases are selected from: 2-aminopropyladenine, 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N- methyladenine, 2-propyladenine , 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl (-C ⁇ C-CH3) uracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-ribosyluracil (pseudouracil), 4- thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza and other 8-substituted purines, 5-halo, particularly 5-bromo, 5-trifluoromethyl, 5-halouracil, and 5-halocytosine, 7-methylguanine, 7-methyl
  • nucleobases include tricyclic pyrimidines, such as l,3-diazaphenoxazine-2-one, l,3-diazaphenothiazine-2-one and 9-(2-aminoethoxy)-l,3-diazaphenoxazine-2- one (G-clamp).
  • Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example, 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2- pyridone.
  • Further nucleobases include those disclosed in United States Patent No.
  • nucleosides of modified oligonucleotides may be linked together using any intemucleoside linkage.
  • the two main classes of intemucleoside linking groups are defined by the presence or absence of a phosphorus atom.
  • Modified intemucleoside linkages can be used to alter, typically increase, nuclease resistance of the oligonucleotide.
  • intemucleoside linkages having a chiral atom can be prepared as a racemic mixture, or as separate enantiomers.
  • Representative chiral internucleoside linkages include but are not limited to alkylphosphonates and phosphorothioates. Methods of preparation of phosphorous-containing and non-phosphorous-containing internucleoside linkages are well known to those skilled in the art.
  • Further neutral internucleoside linkages include nonionic linkages comprising siloxane (dialkylsiloxane), carboxylate ester, carboxamide, sulfide, sulfonate ester and amides (See for example: Carbohydrate Modifications in Antisense Research; Y.S. Sanghvi and P.D. Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Further neutral internucleoside linkages include nonionic linkages comprising mixed N, O, S and CH2 component parts.
  • oligonucleotides for use as crRNA further comprise conjugate groups and/or terminal groups.
  • compounds comprising oligonucleotides for use as crRNA further comprise a conjugate group or terminal group.
  • oligonucleotides are covalently attached to one or more conjugate group.
  • conjugate groups modify one or more properties of the attached oligonucleotide, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, cellular distribution, cellular uptake, charge and clearance.
  • conjugate groups impart a new property on the attached oligonucleotide, e.g., fluorophores or reporter groups that enable detection of the oligonucleotide.
  • Conjugate groups and/or terminal groups may be added to oligonucleotides having any of the modifications or motifs described above.
  • Conjugate groups include, without limitation, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates, vitamin moieties, polyethylene glycols, thioethers, polyethers, cholesterols, thiocholesterols, cholic acid moieties, folate, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins, fluorophores, and dyes.
  • Certain conjugate groups have been described previously, for example: cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci.
  • an aliphatic chain e.g., do-decan-diol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBSLett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993 , 75, 49-54), a phospholipid, e.g., di-hexadecyl-rac -glycerol or
  • Acids Res., 1990, 18, 3777-3783 a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654), a palmityl moiety (Mishra et al., Biochim.
  • a conjugate group comprises an active drug substance, for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fen-bufen, ketoprofen, ( ⁇ S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folinic acid, a
  • an active drug substance for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fen-bufen, ketoprofen, ( ⁇ S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folinic acid, a
  • benzothiadiazide chlorothiazide, a diazepine, indo-methicin, a barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an antibacterial or an antibiotic.
  • Conjugate groups are attached directly or via an optional conjugate linker to a parent compound, such as a crRNA oligonucleotide. In certain embodiments, conjugate groups are directly attached to
  • conjugate groups are indirectly attached to oligonucleotides via conjugate linkers.
  • the conjugate linker comprises a chain structure, such as a hydrocarbyl chain, or an oligomer of repeating units such as ethylene glycol or amino acid units.
  • conjugate groups comprise a cleavable moiety.
  • conjugate groups are attached to oligonucleotides via a cleavable moiety.
  • conjugate linkers comprise a cleavable moiety. In certain such embodiments, conjugate linkers are attached to oligonucleotides via a cleavable moiety.
  • a conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain such embodiments, the conjugate linker comprises groups selected from alkyl, amino, oxo, amide and ether groups. In certain embodiments, the conjugate linker comprises groups selected from alkyl and amide groups. In certain embodiments, the conjugate linker comprises groups selected from alkyl and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorus moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, the conjugate linker includes at least one neutral linking group.
  • conjugate linkers are bifunctional linking moieties, e.g., those known in the art to be useful for attaching conjugate groups to parent compounds, such as the crRNA oligonucleotides provided herein.
  • a bifunctional linking moiety comprises at least two functional groups. One of the functional groups is selected to bind to a particular site on a parent compound and the other is selected to bind to a conjugate group. Examples of functional groups used in a bifunctional linking moiety include but are not limited to electrophiles for reacting with
  • bifunctional linking moieties comprise one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl.
  • conjugate linkers include but are not limited to pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl) cyclohexane-l-carboxylate (SMCC) and 6-aminohexanoic acid (AHEX or AHA).
  • ADO 8-amino-3,6-dioxaoctanoic acid
  • SMCC succinimidyl 4-(N-maleimidomethyl) cyclohexane-l-carboxylate
  • AHEX or AHA 6-aminohexanoic acid
  • conjugate linkers include but are not limited to substituted or unsubstituted Ci- Cio alkyl, substituted or unsubstituted C2-C10 alkenyl or substituted or unsubstituted C2-C10 alkynyl, wherein a nonlimiting list of preferred substituent groups includes hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl.
  • a cleavable moiety is a cleavable bond. In certain embodiments, a cleavable moiety comprises a cleavable bond. In certain embodiments, a cleavable moiety is a group of atoms comprising at least one cleavable bond. In certain embodiments, a cleavable moiety comprises a group of atoms having one, two, three, four, or more than four cleavable bonds. In certain embodiments, a cleavable moiety is selectively cleaved inside a cell or subcellular compartment, such as a lysosome. In certain embodiments, a cleavable moiety is selectively cleaved by endogenous enzymes, such as nucleases.
  • a cleavable bond is selected from among: an amide, an ester, an ether, one or both esters of a phosphodiester, a phosphate ester, a carbamate, or a disulfide. In certain embodiments, a cleavable bond is one or both of the esters of a phosphodiester. In certain embodiments, a cleavable moiety comprises a phosphate or phosphodiester. In certain embodiments, the cleavable moiety is a phosphate linkage between an oligonucleotide and a conjugate linker or conjugate group.
  • Conjugate groups may be attached to either or both ends of an oligonucleotide and/or at any internal position. In certain embodiments, conjugate groups are attached to the 2'-position of a nucleoside of a modified oligonucleotide. In certain embodiments, conjugate groups that are attached to either or both ends of an oligonucleotide are terminal groups. In certain such embodiments, conjugate groups or terminal groups are attached at the 3' and/or 5 '-end of oligonucleotides. In certain such embodiments, conjugate groups (or terminal groups) are attached at the 3'-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 3'-end of oligonucleotides. In certain embodiments, conjugate groups (or terminal groups) are attached at the 5 '-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 5 '-end of oligonucleotides.
  • terminal groups include but are not limited to conjugate groups, capping groups, phosphate moieties, protecting groups, modified or unmodified nucleosides, and two or more nucleosides that are independently modified or unmodified.
  • a conjugate group is a cell-targeting moiety.
  • a conjugate group, optional conjugate linker, and optional cleavable moiety have the general formula: wherein n is from 1 to about 3, m is 0 when n is 1, m is 1 when n is 2 or greater, j is 1 or 0, and k is 1 or O.
  • n is 1, j is 1 and k is 0. In certain embodiments, n is 1, j is 0 and k is 1. In certain embodiments, n is 1, j is 1 and k is 1. In certain embodiments, n is 2, j is 1 and k is 0. In certain embodiments, n is 2, j is 0 and k is 1. In certain embodiments, n is 2, j is 1 and k is 1. In certain embodiments, n is 2, j is 1 and k is 1. In certain embodiments, n is 2, j is 1 and k is 1. In certain
  • n is 3, j is 1 and k is 0. In certain embodiments, n is 3, j is 0 and k is 1. In certain
  • n is 3, j is 1 and k is 1.
  • conjugate groups comprise cell -targeting moieties that have at least one tethered ligand.
  • cell-targeting moieties comprise two tethered ligands covalently attached to a branching group.
  • cell -targeting moieties comprise three tethered ligands covalently attached to a branching group.
  • the cell-targeting moiety comprises a branching group comprising one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether and hydroxylamino groups.
  • the branching group comprises a branched aliphatic group comprising groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether and hydroxylamino groups.
  • the branched aliphatic group comprises groups selected from alkyl, amino, oxo, amide and ether groups.
  • the branched aliphatic group comprises groups selected from alkyl, amino and ether groups. In certain such embodiments, the branched aliphatic group comprises groups selected from alkyl and ether groups. In certain embodiments, the branching group comprises a mono or polycyclic ring system.
  • each tether of a cell-targeting moiety comprises one or more groups selected from alkyl, substituted alkyl, ether, thioether, disulfide, amino, oxo, amide, phosphodiester, and polyethylene glycol, in any combination.
  • each tether is a linear aliphatic group comprising one or more groups selected from alkyl, ether, thioether, disulfide, amino, oxo, amide, and polyethylene glycol, in any combination.
  • each tether is a linear aliphatic group comprising one or more groups selected from alkyl, phosphodiester, ether, amino, oxo, and amide, in any combination.
  • each tether is a linear aliphatic group comprising one or more groups selected from alkyl, ether, amino, oxo, and amid, in any combination. In certain embodiments, each tether is a linear aliphatic group comprising one or more groups selected from alkyl, amino, and oxo, in any combination. In certain embodiments, each tether is a linear aliphatic group comprising one or more groups selected from alkyl and oxo, in any combination. In certain embodiments, each tether is a linear aliphatic group comprising one or more groups selected from alkyl and phosphodiester, in any combination. In certain embodiments, each tether comprises at least one phosphorus linking group or neutral linking group.
  • each tether comprises a chain from about 6 to about 20 atoms in length. In certain embodiments, each tether comprises a chain from about 10 to about 18 atoms in length. In certain embodiments, each tether comprises about 10 atoms in chain length.
  • each ligand of a cell-targeting moiety has an affinity for at least one type of receptor on a target cell. In certain embodiments, each ligand has an affinity for at least one type of receptor on the surface of a mammalian liver cell. In certain embodiments, each ligand has an affinity for the hepatic asialoglycoprotein receptor (ASGP-R). In certain embodiments, each ligand is a carbohydrate. In certain embodiments, each ligand is, independently selected from galactose, N-acetyl galactoseamine (GalNAc), mannose, glucose, glucoseamine and fucose. In certain embodiments, each ligand is N-acetyl galactoseamine (GalNAc).
  • the cell-targeting moiety comprises 3 GalNAc ligands. In certain embodiments, the cell -targeting moiety comprises 2 GalNAc ligands. In certain embodiments, the cell- targeting moiety comprises 1 GalNAc ligand.
  • the present invention provides pharmaceutical compositions comprising one or more crRNA.
  • such pharmaceutical composition comprises a tracrRNA.
  • the pharmaceutical composition comprises a means of expressing a CRISPR nuclease.
  • such means of expressing the CRISPR nuclease is a plasmid or a viral vector.
  • the pharmaceutical composition comprises a suitable pharmaceutically acceptable diluent or carrier.
  • a pharmaceutical composition comprises a modified crRNA.
  • the modified crRNA is a component of a ribonucleoprotein particle or or complex (RNP).
  • the RNP also comprises a nuclease.
  • a pharmaceutical composition comprises a liposome or lipid nanoparticle.
  • the liposome or lipid nanoparticle contains the modified crRNA.
  • the liposome or lipid nanoparticle contains an mRNA encoding a Cpfl nuclease.
  • a pharmaceutical composition comprises a sterile saline solution and one or more antisense compound.
  • such pharmaceutical composition consists of a sterile saline solution and one or more antisense compound.
  • the sterile saline is pharmaceutical grade saline.
  • a pharmaceutical composition comprises one or more antisense compound and sterile water. In certain embodiments, a pharmaceutical composition consists of one antisense compound and sterile water. In certain embodiments, the sterile water is pharmaceutical grade water. In certain embodiments, a pharmaceutical composition comprises one or more antisense compound and phosphate-buffered saline (PBS). In certain embodiments, a pharmaceutical composition consists of one or more antisense compound and sterile PBS. In certain embodiments, the sterile PBS is pharmaceutical grade PBS.
  • RNA nucleoside comprising a 2' -OH sugar moiety and a thymine base
  • RNA having a modified sugar 2' -OH for the natural 2'-H of DNA
  • RNA having a modified base thymine (methylated uracil) for natural uracil of RNA
  • nucleic acid sequences provided herein are intended to encompass nucleic acids containing any combination of natural or modified RNA and/or DNA, including, but not limited to such nucleic acids having modified nucleobases.
  • an oligomeric compound having the nucleobase sequence is intended to encompass nucleic acids containing any combination of natural or modified RNA and/or DNA, including, but not limited to such nucleic acids having modified nucleobases.
  • an oligomeric compound having the nucleobase sequence are intended to encompass nucleic acids containing any combination of natural or modified RNA and/or DNA, including, but not limited to such nucleic acids having modified nucleobases.
  • an oligomeric compound having the nucleobase sequence is intended to encompass nucleic acids containing any combination of natural or modified RNA and/or DNA, including, but not limited to such nucleic acids having modified nucleobases.
  • ATCGATCG encompasses any oligomeric compounds having such nucleobase sequence, whether modified or unmodified, including, but not limited to, such compounds comprising RNA bases, such as those having sequence "AUCGAUCG” and those having some DNA bases and some RNA bases such as
  • AUCGATCG and oligomeric compounds having other modified or naturally occurring bases, such as "AT ⁇ GAUCG,” wherein m C indicates a cytosine base comprising a methyl group at the 5-position.
  • Example 1 Gene editing effects of truncated crRNAs
  • Truncated crRNAs comprising a target recognition portion that is complementary to DNA (cytosine- 5)-methyltransferase 1 (DNMTl) were designed and synthesized to test their effects on gene editing of DNMTl .
  • HEK293T cells were transfected with a plasmid encoding Cpf 1 and a double -stranded gblock (IDT, Coralville, Iowa) encoding a crRNA listed in the table below. 48 hours later, genomic DNA was isolated from cells and used in a SURVEYOR assay (Integrated DNA Technologies) according to the manufacturer's directions.
  • the PCR primers used to amplify the crRNA target site in the DNMT1 gene were forward: 5'- CTGGGACTCAGGCGGGTCAC-3 ' (SEQ ID NO: 1) and reverse: 5'- CCTCACACAACAGCTTCATGTCAGC-3 ' (SEQ ID NO: 2).
  • the DNA was run on a gel.
  • Gene editing of DNMT1 was evaluated by measuring the extent of non-homologous end joining (NHEJ) within DMTl .
  • NHEJ non-homologous end joining
  • NHEJ (%) 100 x (1 -(fraction cut of target gene) 0 5 ), wherein the fraction cut of the target gene was determined by dividing the fluorescent signal of the cut target gene fragment(s) by the total fluorescent signal of the cut and intact target gene fragment(s).
  • the NHEJ incidence for each truncated crRNA was normalized to the NHEJ incidence of the positive control, full-length crRNA 002, and the normalized value was referred to as the gene disruption percentage.
  • nucleosides in the table above are unmodified ribonucleosides comprising 2'-hydroxy sugar moieties, and all of the internucleoside linkages in the table above are phosphate internucleoside linkages.
  • the underlined portion of each crRNA is the target recognition portion, and the portion that is not underlined is the CRISPR recognition portion of each crRNA.
  • the CRISPR recognition portions of the crRNAs recognize Cpf 1.
  • Modified crRNAs comprising a target recognition portion that is complementary to DNMTl were designed and synthesized to test their effects on gene editing of DNMTl .
  • HEK293T cells were transfected with a plasmid encoding Cpfl using Lipofectamine 3000 (Life Technologies, Carlsbad, CA). The next morning, the cells were transfected with a modified crRNA listed in the table below using Lipofectamine RNAi max (Life Technologies). 24 hours later, genomic DNA was isolated from cells and analyzed as described in Example 1 in order to determine the extent of gene editing of DNMTl .
  • the NHEJ incidence for each modified crRNA was normalized to the NHEJ incidence observed for crRNA 1034621, which was also tested in Example 1. The normalized values are referred to as the gene disruption percentages.
  • the results, shown in the table below, indicate that multiple modified crRNAs edited the target gene. An entry of "n.d.” indicates no data due to the lack of detectable cleavage bands in the gel.
  • a subscript "m” indicates a 2'-0-methyl modification.
  • a subscript “r” indicates an unmodified, 2'-hydroxy sugar moiety.
  • a subscript "o” indicates a phosphate internucleoside linkage, and a subscript "s” indicates a phosphorothioate internucleoside linkage.
  • the underlined portion of each crRNA is the target recognition portion, and the portion that is not underlined is the CRISPR recognition portion of the crRNA. In the table above, the CRISPR recognition portions of the crRNAs recognize Cpf 1.
  • Modified crRNAs comprising a target recognition portion that is complementary to DNMTl were designed and synthesized to test their effects on gene editing of DNMTl .
  • HEK293T cells were transfected as described in Example 2, except the modified crRNAs are listed in the table below.
  • Genomic DNA was isolated and analyzed as described in Example 1.
  • the NHEJ incidence for each modified crRNA was normalized to the NHEJ incidence observed for crRNA 1034621, which was also tested in Examples 1 and 2.
  • the normalized values are referred to as the gene disruption percentages.
  • the results, shown in the table below, indicate that modified crRNAs edited the target gene. Nearly all of the modified crRNAs in the table below edited the target gene with greater efficacy than the unmodified control (crRNA 1034621).
  • a subscript "m” indicates a 2'-0-methyl modification.
  • a subscript "r” indicates an unmodified, 2'-hydroxy sugar moiety.
  • a subscript "o” indicates a phosphate internucleoside linkage, and a subscript "s” indicates a phosphorothioate internucleoside linkage.
  • the underlined portion of each crRNA is the target recognition portion, and the bolded nucleosides are linker nucleosides.
  • the portion that is neither bold nor underlined is the CRISPR recognition portion of each crRNA.
  • the CRISPR recognition portions of the crRNAs recognize Cpfl .
  • Modified crRNAs 1038273, 1038274, 1038276 and 990509 are 5 '-stabilized.
  • the CRISPR recognition portions of crRNAs 1038273 and 1038274 comprise one or more 5 '-stabilizing modifications.
  • the linker nucleosides of crRNAs 1038276 and 990509 comprise one
  • Modified crRNAs comprising a target recognition portion that is complementary to DNMTl were designed and synthesized to test their effects on gene editing of DNMTl .
  • HEK293T cells were transfected as described in Example 2, except the modified crRNAs are listed in the table below.
  • Genomic DNA was isolated and analyzed as described in Example 1. The NHEJ incidence for each modified crRNA was normalized to the NHEJ incidence observed for crRNA 1038299, which had the highest activity of those tested in this experiment. The normalized values are referred to as the gene disruption percentages. The results, shown in the table below, indicate that multiple modified crRNAs edited the target gene.
  • a subscript "m” indicates a 2'-0-methyl modification.
  • a subscript "r” indicates an unmodified, 2'-hydroxy sugar moiety.
  • a subscript "f ' indicates a 2'-F modification.
  • a subscript "o” indicates a phosphate internucleoside linkage, and a subscript "s” indicates a phosphorothioate internucleoside linkage.
  • the underlined portion of each crRNA is the target recognition portion, and the bolded nucleosides are linker nucleosides. The portion that is neither bold nor underlined is the CRISPR recognition portion of each crRNA.
  • the CRISPR recognition portions of the crRNAs recognize Cpf 1.
  • the modified crRNAs in the table above are 5 '-stabilized, and the linker nucleosides comprise the 5 '-stabilizing modifications.
  • Modified crRNAs comprising a target recognition portion that is complementary to DNMTl were designed and synthesized to test their effects on gene editing of DNMTl .
  • HEK293T cells were transfected as described in Example 2, except the modified crRNAs are listed in the table below.
  • Genomic DNA was isolated and analyzed as described in Example 1.
  • the NHEJ incidence for each modified crRNA was normalized to the NHEJ incidence observed for crRNA 1034621, which was also tested in Examples 1-3.
  • the normalized values are referred to as the gene disruption percentages.
  • An entry of "n.d.” indicates no data due to the lack of detectable cleavage bands in the gel.
  • results show that multiple modified crRNAs edited the target gene, and, in many cases, were more efficacious than the unmodified crRNA 1034621.
  • results also indicated that certain positions that tolerate nucleobase changes in the target recognition portion (see, e.g., Kleinstiver et al. in Nature Biotechnology, 34, 869 (2016)), also tolerate modified sugars.
  • a subscript "m” indicates a 2' -0-methyl modification.
  • a superscript “m” ac jacent to a "C” indicates a 5- methyl cytosine.
  • a subscript “r” indicates an unmodified, 2'-hydroxy sugar moiety.
  • a subscript “f” indicates a 2'-F modification.
  • a subscript “k” indicates a cEt modification.
  • a subscript "o” indicates a phosphate internucleoside linkage, and a subscript "s” indicates a phosphorothioate internucleoside linkage.
  • the underlined portion of each crRNA is the target recognition portion, and the bolded nucleosides are linker nucleosides.
  • the portion that is neither bold nor underlined is the CRISPR recognition portion of each crRNA.
  • the CRISPR recognition portions of the crRNAs recognize Cpf 1.Other than crRNA 1034621, the modified crRNAs in the table above are 5 '-stabilized, and the linker nucleosides comprise the 5 '-stabilizing modifications.
  • Modified crRNAs comprising a target recognition portion that is complementary to DNMTl were designed and synthesized to test their effects on gene editing of DNMTl .
  • HEK293T cells were transfected as described in Example 2, except the modified crRNAs are listed in the table below.
  • Genomic DNA was isolated and analyzed as described in Example 1.
  • the NHEJ incidence for each modified crRNA was normalized to the NHEJ incidence observed for crRNA 989549.
  • the normalized values are referred to as the gene disruption percentages.
  • a subscript "m” indicates a 2'-0-methyl modification.
  • a subscript "r” indicates an unmodified, 2'-hydroxy sugar moiety.
  • a subscript "o” indicates a phosphate internucleoside linkage, and a subscript "s” indicates a phosphorothioate internucleoside linkage.
  • the underlined portion of each crRNA is the target recognition portion, and the bolded nucleosides are linker nucleosides.
  • the portion that is neither bold nor underlined is the CRISPR recognition portion of each crRNA.
  • the CRISPR recognition portions of the crRNAs recognize Cpfl .
  • the modified crRNAs in the table above are 5 '-stabilized, and the linker nucleosides comprise the 5 '-stabilizing modifications.
  • Example 7 Gene editing effects of modified crRNAs
  • HEK293T cells were transfected as described in Example 2, with 3 of 100 ⁇ of a crRNA listed in the table below.
  • Genomic DNA was isolated and analyzed as described in Example 1.
  • the NHEJ incidence for each modified crRNA was normalized to the NHEJ incidence observed for crRNA 989549.
  • the normalized values are referred to as the gene disruption percentages.
  • the results, shown in the table below, indicate that multiple modified crRNAs edited the target gene.
  • a subscript "m” indicates a 2'-0-methyl modification.
  • a subscript "r” indicates an unmodified, 2'-hydroxy sugar moiety.
  • a subscript "o” indicates a phosphate intemucleoside linkage, and a subscript "s” indicates a phosphorothioate intemucleoside linkage.
  • a subscript "f ' indicates a 2'-F modification.
  • the underlined portion of each crRNA is the target recognition portion, and the bolded nucleosides are linker nucleosides. The portion that is neither bold nor underlined is the CRISPR recognition portion of each crRNA. In the table above, the CRISPR recognition portions of the crRNAs recognize Cpfl .
  • the modified crRNAs in the table above are 5 '-stabilized, and the linker nucleosides comprise the 5 '-stabilizing modifications.
  • Modified crRNAs comprising a target recognition portion that is complementary to DNMTl were designed and synthesized to test their effects on gene editing of DNMTl .
  • HEK293T cells were transfected as described in Example 2, with 3 of 100 ⁇ of a crRNA listed in the table below.
  • Genomic DNA was isolated and analyzed as described in Example 1.
  • the NHEJ incidence for each modified crRNA in Table 9 was normalized to the NHEJ incidence observed for modified crRNA 1090626. The normalized values are referred to as the gene disruption percentages.
  • the NHEJ incidence for each modified crRNAin Table 10 was not normalized, the absolute percentages of gene disruption observed are listed. The results, shown in the tables below, indicate that multiple modified crRNAs edited the target gene.
  • a subscript "r” indicates an unmodified, 2'-hydroxy sugar moiety.
  • a subscript “d” indicates a modified, 2'-deoxy sugar moiety.
  • a subscript “o” indicates a phosphate intemucleoside linkage.
  • a "C” following a superscript “m” indicates a 5 -methyl cytosine.
  • the underlined portion of each crRNA is the target recognition portion, and the bolded nucleosides are linker nucleosides. The portion that is neither bold nor underlined is the CRISPR recognition portion of each crRNA.
  • the CRISPR recognition portions of the crRNAs recognize Cpf 1.
  • Modified crRNAs comprising a target recognition portion that is complementary to Low Density Lipoprotein Receptor (LDLR) were designed and synthesized to test their effects on gene editing of LDLR.
  • HEK293T cells were transfected as described in Example 2, with 3 of 100 ⁇ of a crRNA listed in the table below.
  • Genomic DNA was isolated and analyzed as described in Example 1 except that the PCR primers used to amplify the crRNA target site in the LDLR gene were forward: 5'- GGAGACCCAAATACAACAAATC - 3' (SEQ ID NO: 56) and reverse: 5'-
  • CTAGACTCCGTCTCAAAGAAG -3' SEQ ID NO: 57.
  • the NHEJ incidence for each modified crRNA was normalized to the NHEJ incidence observed for crRNA 1091152.
  • the normalized values are referred to as the gene disruption percentages.
  • the results, shown in the table below, indicate that modified crRNAs edited the target gene.
  • a subscript "m” indicates a 2'-0-methyl modification.
  • a subscript “r” indicates an unmodified, 2'-hydroxy sugar moiety.
  • a subscript “d” indicates a modified, 2'-deoxy sugar moiety.
  • a subscript "o” indicates a phosphate intemucleoside linkage, and a subscript "s” indicates a phosphorothioate intemucleoside linkage.
  • the underlined portion of each crRNA is the target recognition portion, and the bolded nucleosides are linker nucleosides. The portion that is neither bold nor underlined is the CRISPR recognition portion of each crRNA. In the table above, the CRISPR recognition portions of the crRNAs recognize Cpf 1.
  • Example 10 Gene editing effects of modified crRNAs
  • Modified crRNAs comprising a target recognition portion that is complementary to LDLR were designed and synthesized to test their effects on gene editing of LDLR as described in Example 9.
  • the NHEJ incidence for each crRNA was not normalized.
  • the values in the table below are the absolute gene disruption percentages. The results indicate that modified crRNAs edited the target gene.
  • a subscript "m” indicates a 2'-0-methyl modification.
  • a subscript "r” indicates an unmodified, 2'-hydroxy sugar moiety.
  • a subscript “d” indicates a modified, 2'-deoxy sugar moiety.
  • a subscript “f” indicates a 2'-F modification.
  • a subscript "o” indicates a phosphate internucleoside linkage, and a subscript "s” indicates a phosphorothioate internucleoside linkage.
  • the underlined portion of each crRNA is the target recognition portion, and the bolded nucleosides are linker nucleosides. The portion that is neither bold nor underlined is the CRISPR recognition portion of each crRNA. In the table above, the CRISPR recognition portions of the crRNAs recognize Cpf 1.
  • crRNAs comprising target recognition portions complementary to various targets were designed and synthesized to test their effects on gene editing.
  • HEK293T cells were transfected as described in Example 2, with 3 of 100 ⁇ of a crRNA listed in the table below.
  • Genomic DNA was isolated and analyzed as described in Example 1 except that the PCR primers used to amplify the crRNA target site were one of the following: for the Complement 5 gene (C5, Table 13), forward: 5'- CATGGGGTAACCCAGCAAAC - 3' (SEQ ID NO: 58) and reverse: 5'- GGAAATAAGTGATGGGGCAGG -3' (SEQ ID NO: 59); for the Empty Spiracles Homeobox 1 gene (EMX1, Table 14), forward: 5'- CCATCCCCTTCTGTGAATGT -3' (SEQ ID NO: 60) and reverse: 5'- GGAGATTGGAGACACGGAGA -3' (SEQ ID NO: 61); for the Glutamate Ionotrp
  • Modified crRNAs comprising a target recognition portion that is complementary to DNMT1 were designed and synthesized to test their effects on gene editing of DNMT1 relative to unmodified crRNA 989549 (see Table 6).
  • HEK293T cells were transfected as described in Example 2, with 3 of 100 ⁇ of a modified crRNA listed in the table below, crRNA 989549 ("RNA Ctrl"), or no crRNA ("neg").
  • Genomic DNA was isolated and analyzed as described in Example 1 except that NHEJ incidence was not quantified.
  • the resulting DNA gel is shown in Figure 1 and indicates that multiple modified crRNAs comprising at least one modified sugar moiety in the CRISPR recognition portion edited the target gene.
  • a subscript "m” indicates a 2'-0-methyl modification.
  • a subscript “r” indicates an unmodified, 2'-hydroxy sugar moiety.
  • a subscript “k” indicates a cEt modification.
  • a subscript "o” indicates a phosphate internucleoside linkage, and a subscript "s” indicates a phosphorothioate internucleoside linkage.
  • the underlined portion of each crRNA is the target recognition portion, and the bolded nucleosides are linker nucleosides. The portion that is neither bold nor underlined is the CRISPR recognition portion of each crRNA. In the table above, the CRISPR recognition portions of the crRNAs recognize Cpf 1.
  • Modified crRNAs comprising a target recognition portion that is complementary to DNMT1 were designed to test their effects on gene editing of DNMT1.
  • HEK293T cells are transfected as described in Example 2.
  • Genomic DNA is isolated and analyzed as described in Example 1.
  • a subscript "m” indicates a 2 '-0 -methyl modification.
  • a subscript "r” indicates an unmodified, 2'-hydroxy sugar moiety.
  • a subscript “d” indicates a modified, 2'-deoxy sugar moiety.
  • a subscript "k” indicates a cEt modification.
  • a subscript "f ' indicates a 2'-F modification.
  • a subscript "o” indicates a phosphate internucleoside linkage, and a subscript "s” indicates a phosphorothioate internucleoside linkage.
  • the underlined portion of each crRNA is the target recognition portion, and the bolded nucleosides are linker nucleosides. The portion that is neither bold nor underlined is the CRISPR recognition portion of each crRNA. In the table above, the CRISPR recognition portions of the crRNAs recognize Cpf 1.

Landscapes

  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Medicinal Chemistry (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
PCT/US2017/068642 2016-12-28 2017-12-28 Modified crispr rna and uses thereof Ceased WO2018125964A1 (en)

Priority Applications (5)

Application Number Priority Date Filing Date Title
AU2017388379A AU2017388379A1 (en) 2016-12-28 2017-12-28 Modified CRISPR RNA and uses thereof
JP2019533110A JP2020503017A (ja) 2016-12-28 2017-12-28 修飾crispr rna及びその使用
CA3047330A CA3047330A1 (en) 2016-12-28 2017-12-28 Modified crispr rna and uses thereof
EP17886910.3A EP3562942A4 (en) 2016-12-28 2017-12-28 MODIFIED CRISPR-RNA AND ITS USES
US16/470,464 US20190382751A1 (en) 2016-12-28 2017-12-28 Modified crispr rna and uses thereof

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
US201662439828P 2016-12-28 2016-12-28
US62/439,828 2016-12-28
US201762491818P 2017-04-28 2017-04-28
US62/491,818 2017-04-28
US201762572361P 2017-10-13 2017-10-13
US62/572,361 2017-10-13

Publications (1)

Publication Number Publication Date
WO2018125964A1 true WO2018125964A1 (en) 2018-07-05

Family

ID=62710685

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2017/068642 Ceased WO2018125964A1 (en) 2016-12-28 2017-12-28 Modified crispr rna and uses thereof

Country Status (6)

Country Link
US (1) US20190382751A1 (enExample)
EP (1) EP3562942A4 (enExample)
JP (1) JP2020503017A (enExample)
AU (1) AU2017388379A1 (enExample)
CA (1) CA3047330A1 (enExample)
WO (1) WO2018125964A1 (enExample)

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2022086846A3 (en) * 2020-10-19 2022-07-21 Caribou Biosciences, Inc. Dna-containing polynucleotides and guides for crispr type v systems, and methods of making and using the same
JP2022538789A (ja) * 2019-06-14 2022-09-06 アーバー バイオテクノロジーズ, インコーポレイテッド 新規crispr dnaターゲティング酵素及びシステム
WO2023201270A3 (en) * 2022-04-13 2023-12-28 Caribou Biosciences, Inc. Therapeutic applications of crispr type v systems
US11866726B2 (en) 2017-07-14 2024-01-09 Editas Medicine, Inc. Systems and methods for targeted integration and genome editing and detection thereof using integrated priming sites
WO2024250634A1 (zh) * 2023-06-09 2024-12-12 江南大学 一种生产2ˊ-岩藻糖基乳糖的多层动态调控系统及其应用
US12338436B2 (en) 2018-06-29 2025-06-24 Editas Medicine, Inc. Synthetic guide molecules, compositions and methods relating thereto
US12390538B2 (en) 2023-05-15 2025-08-19 Nchroma Bio, Inc. Compositions and methods for epigenetic regulation of HBV gene expression
WO2025212120A1 (en) * 2024-04-05 2025-10-09 Arbor Biotechnologies, Inc. Chemical modifications of guide rnas for crispr nucleases
WO2025231432A1 (en) * 2024-05-03 2025-11-06 Caribou Biosciences, Inc. In vivo gene editing with crispr systems

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20150376587A1 (en) * 2014-06-25 2015-12-31 Caribou Biosciences, Inc. RNA Modification to Engineer Cas9 Activity
US20160024524A1 (en) * 2013-03-15 2016-01-28 The General Hospital Corporation Increasing Specificity for RNA-Guided Genome Editing
US20160289675A1 (en) * 2014-12-03 2016-10-06 Agilent Technologies, Inc. Guide RNA with chemical modifications

Family Cites Families (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
SG10201804715WA (en) * 2015-01-28 2018-07-30 Pioneer Hi Bred Int Crispr hybrid dna/rna polynucleotides and methods of use
US9790490B2 (en) * 2015-06-18 2017-10-17 The Broad Institute Inc. CRISPR enzymes and systems
EP3313989B1 (en) * 2015-06-29 2024-12-25 Ionis Pharmaceuticals, Inc. Modified crispr rna and modified single crispr rna and uses thereof
WO2017181107A2 (en) * 2016-04-16 2017-10-19 Ohio State Innovation Foundation Modified cpf1 mrna, modified guide rna, and uses thereof
CN106244591A (zh) * 2016-08-23 2016-12-21 苏州吉玛基因股份有限公司 修饰crRNA在CRISPR/Cpf1基因编辑系统中的应用
JP2019535287A (ja) * 2016-11-22 2019-12-12 インテグレイテツド・デイー・エヌ・エイ・テクノロジーズ・インコーポレイテツド Crispr/cpf1システム及び方法

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20160024524A1 (en) * 2013-03-15 2016-01-28 The General Hospital Corporation Increasing Specificity for RNA-Guided Genome Editing
US20150376587A1 (en) * 2014-06-25 2015-12-31 Caribou Biosciences, Inc. RNA Modification to Engineer Cas9 Activity
US20160289675A1 (en) * 2014-12-03 2016-10-06 Agilent Technologies, Inc. Guide RNA with chemical modifications

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See also references of EP3562942A4 *

Cited By (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11866726B2 (en) 2017-07-14 2024-01-09 Editas Medicine, Inc. Systems and methods for targeted integration and genome editing and detection thereof using integrated priming sites
US12338436B2 (en) 2018-06-29 2025-06-24 Editas Medicine, Inc. Synthetic guide molecules, compositions and methods relating thereto
JP2022538789A (ja) * 2019-06-14 2022-09-06 アーバー バイオテクノロジーズ, インコーポレイテッド 新規crispr dnaターゲティング酵素及びシステム
EP3983536A4 (en) * 2019-06-14 2023-11-29 Arbor Biotechnologies, Inc. NOVEL CRISPR DNA TARGETING ENZYMES AND SYSTEMS
WO2022086846A3 (en) * 2020-10-19 2022-07-21 Caribou Biosciences, Inc. Dna-containing polynucleotides and guides for crispr type v systems, and methods of making and using the same
AU2021364314B2 (en) * 2020-10-19 2024-11-21 Caribou Biosciences, Inc. DNA-containing polynucleotides and guides for CRISPR type V systems, and methods of making and using the same
AU2021364314C1 (en) * 2020-10-19 2025-02-20 Caribou Biosciences, Inc. DNA-containing polynucleotides and guides for CRISPR type V systems, and methods of making and using the same
WO2023201270A3 (en) * 2022-04-13 2023-12-28 Caribou Biosciences, Inc. Therapeutic applications of crispr type v systems
US12390538B2 (en) 2023-05-15 2025-08-19 Nchroma Bio, Inc. Compositions and methods for epigenetic regulation of HBV gene expression
WO2024250634A1 (zh) * 2023-06-09 2024-12-12 江南大学 一种生产2ˊ-岩藻糖基乳糖的多层动态调控系统及其应用
WO2025212120A1 (en) * 2024-04-05 2025-10-09 Arbor Biotechnologies, Inc. Chemical modifications of guide rnas for crispr nucleases
WO2025231432A1 (en) * 2024-05-03 2025-11-06 Caribou Biosciences, Inc. In vivo gene editing with crispr systems

Also Published As

Publication number Publication date
US20190382751A1 (en) 2019-12-19
CA3047330A1 (en) 2018-07-05
JP2020503017A (ja) 2020-01-30
EP3562942A1 (en) 2019-11-06
AU2017388379A1 (en) 2019-06-06
EP3562942A4 (en) 2020-12-09

Similar Documents

Publication Publication Date Title
US20230159919A1 (en) Modified crispr rna and modified single crispr rna and uses thereof
EP3011028B1 (en) Compositions and methods for modulation of target nucleic acids
WO2018125964A1 (en) Modified crispr rna and uses thereof
EP3485015A1 (en) Compounds and methods for modulation of dystrophin transcript
WO2017053999A1 (en) Conjugated antisense compounds and their use
WO2018014041A2 (en) Compounds and methods for modulation of smn2
EP3262174A1 (en) Compounds and methods for increasing antisense activity
WO2020072991A1 (en) Modified oligomeric compounds and uses thereof
EP3724206A1 (en) Conjugated antisense compounds and their use
EP3426349A1 (en) Methods and compositions for inhibiting pmp22 expression
EP4355338A1 (en) Compounds and methods for reducing ifnar1 expression
EP4291651A1 (en) Compounds and methods for reducing pln expression
EP3077510A2 (en) Antisense compounds and uses thereof
WO2020072883A1 (en) Chirally enriched oligomeric compounds
WO2016061263A1 (en) Antisense compounds and uses thereof
WO2022072787A1 (en) Compounds for modulating chmp7
WO2019245957A1 (en) Linkage modified oligomeric compounds
WO2021102341A2 (en) Compounds for modulating beta globin expression
WO2021202788A2 (en) Modified oligomeric compounds and uses thereof

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17886910

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2017388379

Country of ref document: AU

Date of ref document: 20171228

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2019533110

Country of ref document: JP

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 3047330

Country of ref document: CA

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2017886910

Country of ref document: EP

Effective date: 20190729