WO2018121743A1

WO2018121743A1 - Mir-96 for protecting livers, muscles, lungs, and kidneys, for regulating content of total protein and content of albumin in blood, and for insulin resistance

Info

Publication number: WO2018121743A1
Application number: PCT/CN2017/119889
Authority: WO
Inventors: 彭长庚; 温婷
Original assignee: 昆山彭济凯丰生物科技有限公司
Priority date: 2016-12-29
Filing date: 2017-12-29
Publication date: 2018-07-05
Also published as: CN108261546A

Abstract

Provided are an application of miR-96 function inhibition in protecting livers and muscles, in preventing and/or treating kidney diseases and complications thereof and diseases and symptoms related to the decrease of the content of total protein and the content of albumin in blood, and in insulin resistance, an application of miR-96 function enhancement in enhancing lung function, a method for miR-96 function enhancement, and an application of the detection of miR-96 expression level in blood in predicting whether an individual has the risk of suffering liver, kidney and lung diseases. By making a miR-96 inhibitor be in contact with a target cell expressing miR-96, diseases caused by the increase of the amount of miR-96 can be effectively prevented and/or treated; in addition, a miR-96 enhancer can increase lung weight, thereby protecting lung function.

Description

miR-96 is used to protect liver, muscle, lung and kidney and regulate blood total protein and albumin levels and insulin resistance

Technical field

The present invention relates to the field of biomedicine, and in particular to the protection of liver and muscle by inhibiting the function of miR-96, and the prevention and/or treatment of nephropathy and its complications, and the decrease in total protein and/or albumin content in the blood. The use of diseases and symptoms as well as insulin resistance also relates to the use of enhancing the function of miR-96 in enhancing lung function, and correspondingly to a method for enhancing the function of miR-96. In addition, the present invention also relates to detection. The amount of miR-96 expressed in the blood is used in predicting whether an individual has a risk of developing liver disease, kidney disease, and lung disease.

Background technique

MicroRNAs (miRNAs) are a class of non-coding RNA molecules (www.mirbase.org) that are 16-25 nt in length and can recognize and silence RNA expression and/or protein expression of target genes by complementary pairing with target genes. . After the mature microRNA is loaded onto the RNA-induced silencing complex (RISC), it is combined with the complementary sequence in the 3'-UTR of the target gene mRNA by base pairing, thereby triggering the degradation of the mRNA and/or inhibiting its protein. translation. The nucleotides from the second to the eighth position of the 5' end of the microRNA are called "core sequences". The complementary pairing of these seven nucleotides with the target gene is the key to recognition of the target gene. The higher the degree of pairing, the binding and The greater the likelihood and ability to regulate a target gene. Simultaneous pairing of sequences other than the "core sequence" of the microRNA with the target gene also enhances its ability to bind and regulate the target gene. It is precisely because microRNAs recognize and regulate the expression of target genes through incomplete pairing that a microRNA can simultaneously regulate multiple target genes to different degrees in one cell.

Studies by the inventors of the present invention have shown that microRNAs not only play an important role in development but also play an important regulatory role in adult tissues. Therefore, studying the changes of microRNAs in tissues is of great significance for the prevention and/or treatment of pathological changes and damage of tissues.

Summary of the invention

A preliminary study by the inventors of the present invention found that miR-96 is expressed in liver, kidney and muscle, and the expression level of miR-96 in these tissues is gradually increased with age, suggesting miR- An increase in expression of 96 may be associated with the loss of these tissues. However, there is no literature report that the function of miR-96 in these tissues and the elevation or decrease of miR-96 are associated with lesions in these tissues. The inventors have devised and completed a series of experiments in order to prove that the function of regulating miR-96 can protect and prevent, and even treat, the liver, kidney and muscles, and thus the present invention has been proposed.

Based on the above studies, it is an object of the present invention to provide a miR-96-based protection of liver, kidney, muscle and lung function and to prevent and/or treat diseases associated with a decrease in total protein and/or albumin content in the blood and Symptoms and methods and products for insulin resistance.

In order to achieve the above object, in one aspect, the present invention provides a method for inhibiting the function of miR-96 in protecting liver and muscle, and preventing and/or treating kidney disease and its complications, and relating to a decrease in total protein and/or albumin in blood. Use in diseases and symptoms as well as insulin resistance.

Preferably, protecting the liver comprises: promoting liver synthesis of albumin and creatinine, preventing and/or treating liver function damage, hepatitis or cirrhosis.

Preferably, protecting the muscle comprises: promoting muscle growth, preventing and/or treating muscle atrophy.

Preferably, the diseases and conditions associated with decreased levels of total protein and/or albumin in the blood include hypoproteinemia, edema, ascites, and decreased renal function.

Preferably, the kidney disease and its complications include: mesangial proliferative nephritis, diabetic nephropathy, edema caused by kidney disease or ascites, cerebral edema, brain damage, and elevated intracranial pressure caused by cerebral edema and brain damage.

In a second aspect, the invention also provides for enhancing the function of miR-96 for enhancing lung function.

Preferably, enhancing lung function comprises preventing and/or treating pulmonary function damage, pneumonia, emphysema or polyps.

In a third aspect, the invention also provides a method of enhancing the function of miR-96, wherein the method comprises: contacting a miR-96 enhancer with a target cell expressing miR-96.

In a fourth aspect, the invention also provides for the use of detecting the amount of miR-96 expressed in the blood in predicting whether the individual is at risk of developing liver disease, kidney disease and lung disease.

The present invention can fully inhibit the function of miR-96 by contacting a miR-96 inhibitor with a target cell expressing miR-96 (including inhibiting the binding of miR-96 to its target gene or reducing the expression level of miR-96, thereby inhibiting The function of miR-96), when used for individual administration, can effectively prevent and/or treat diseases caused by an increase in the amount of miR-96, for example, hypoproteinemia, liver function damage, muscle atrophy, insulin resistance And kidney disease. At the same time, by contacting the miR-96 enhancer with target cells expressing miR-96, the function of miR-96 can be fully enhanced (including enhancing the binding of miR-96 to its target gene or increasing the expression of miR-96, thereby enhancing The function of miR-96, when used for individual administration, can effectively enhance lung function, for example, prevention and/or treatment of lung function damage, pneumonia, emphysema or polyps. In addition, by detecting the amount of expression of miR-96 in the blood, it is also possible to predict whether the individual is at risk of suffering from liver disease, kidney disease and lung disease.

Other features and advantages of the invention will be described in detail in the detailed description which follows.

DRAWINGS

The drawings are intended to provide a further understanding of the invention, and are intended to be a In the drawing:

Figure 1A is a linear plot of miR-96ASO dose versus its inhibitory effect on miR-96.

Figure 1B is a comparison of the functional effects of miR-96ASO, randomized control nucleotides, miR-96 mismatched ASO at the cellular level to inhibit miR-96.

Figure 2A shows the relationship between the amount of total protein (TP) in the blood of the experimental group db/db mice treated with the thio-modified miR-96ASO PJ150021 and the model group db/db mice.

Figure 2B shows the relationship between the arsenic-treated miR-96ASO PJ150021 treated experimental group db/db mice and albumin db/db mice blood albumin (ALB).

Figure 3 shows the relationship between thio-modified miR-96ASO PJ150021 treated experimental group db/db mice and creatinine (CRE) in the blood of model group db/db mice.

Figure 4A shows the kidney weight of db/db model group mice, normal control mice, and thio-modified miR-96ASO PJ150021 treated experimental group db/db mice.

Figure 4B shows the renal mesenteric lesions of the model group db/db mice, the negative control group db/db mice, and the thio-modified miR-96ASO PJ150021 treated experimental group db/db mice.

Figure 5 shows the enhancement of insulin sensitivity of thio-modified miR-96ASO PJ150021 treated db/db mice.

Figure 6 shows a comparison of the effect of miR-96 siRNA and randomized control siRNA on miR-96 expression.

detailed description

Specific embodiments of the present invention will be described in detail below. It is to be understood that the specific embodiments described herein are merely illustrative and not restrictive.

The endpoints and any values of the ranges disclosed herein are not limited to the precise range or value, and such ranges or values should be understood to include values that are close to the ranges or values. For numerical ranges, the endpoint values of the various ranges, the endpoint values of the various ranges and the individual point values, and the individual point values can be combined with one another to yield one or more new ranges of values. The scope should be considered as specifically disclosed herein.

Unless otherwise stated, the technical terms used herein have the same meaning as the terms commonly understood by those skilled in the art.

In the previous study, the inventors of the present invention found that miR-96 can regulate appetite and body weight, and db/db leptin receptor knockout mice regulated by negative feedback of appetite are used as a model [1], and in-depth study of miR-96 In function, it was found that inhibition of miR-96 can increase the total protein in the blood and the only albumin synthesized by the liver, while low levels of total protein and albumin cause hypoproteinemia, which in turn causes edema and ascites. It is well known that replenishing albumin can treat edema, ascites, cirrhosis and protect kidney function [2-3]. Inhibition of miR-96 also increases the amount of creatinine in the blood, but the amount of albumin in the urine does not increase. This suggests that in the absence of deterioration of renal function and food, the increase in creatinine in the blood is the result of increased ability to synthesize creatinine in the body. Creatinine synthesis is mainly in the liver and kidney [4], thus indicating that inhibition of miR-96 function enhances the liver of db/db mice (eg, prevention and/or treatment of liver function damage, hepatitis or cirrhosis) and kidney The function. It is well known that creatinine mainly supplies muscle nutrition, can protect and promote muscle metabolism, and is often taken by athletes to enhance muscle strength [4-5]. In addition, the reduction of creatinine content is also related to convoluted atrophy, neurodegenerative diseases and muscular dystrophy. Related to diseases. The kidney weight of db/db mice was positively correlated with the degree of renal damage. The heavier the kidney, the more severe the damage was [6]. The weight gain of the kidney is partly caused by the proliferation of mesangial cells [6]. Inhibition of miR-96 function also significantly inhibited the increase in kidney weight in db/db mice, and HE staining revealed that inhibition of miR-96 function inhibited proliferation of mesangial cells. These data demonstrate that inhibition of miR-96 function protects kidney function, prevents and treats kidney disease, especially diabetic nephropathy and edema caused by kidney disease or ascites, cerebral edema, brain damage, and increased intracranial pressure caused by cerebral edema and brain damage On the one hand, it promotes and protects kidney function by promoting albumin synthesis. In addition, the inventors of the present invention have also found that inhibition of the function of miR-96 can also treat and/or prevent insulin resistance. On the other hand, the deterioration of tissue nephropathy is inhibited by inhibiting the proliferation of mesangial cells. Inhibition of miR-96 function reduces lung weight, suggesting that miR-96 functions to enhance lung function, while enhanced lung function can be used to prevent and/or treat lung function damage, pneumonia, emphysema or Multiple symptoms. miR-96 was detected from liver, muscle, lung and kidney of normal mice.

Based on the above studies, the inventors of the present invention found that miR-96 is expressed in muscle, liver, lung and kidney, and subsequently demonstrated that liver and muscle can be protected by inhibiting the function of miR-96, and that low blood protein is prevented and/or treated. Disease, hepatitis and cirrhosis, muscle atrophy, insulin resistance and kidney disease.

Specifically, as described above, inhibition of the function of miR-96 can increase the level of total protein in the blood and albumin synthesized by the liver (low levels of total protein and albumin cause hypoproteinemia, which in turn causes edema, ascites, and Reduced renal function; supplemental albumin can treat edema, ascites, cirrhosis, hepatitis, liver damage and protect kidney function), improve liver and kidney ability to synthesize creatinine (replenish muscle nutrition, protect muscles and promote muscle metabolism, prevention and prevention) / or treatment of convoluted atrophy, neurodegenerative diseases and muscular dystrophy), protect kidney function (inhibition of mesangial cells, prevention and treatment of kidney disease, especially diabetic nephropathy and edema caused by kidney disease or ascites, cerebral edema, brain Injury and increased intracranial pressure caused by cerebral edema and brain damage); while enhancing the function of miR-96 can enhance lung function (for prevention and/or treatment of lung function damage, pneumonia, emphysema or polyps).

Accordingly, the present invention provides for inhibiting the function of miR-96 in protecting the liver (promoting liver synthesis of albumin and creatinine, preventing and/or treating liver function damage, hepatitis or cirrhosis, preferably prevention and/or treatment associated with decreased creatinine content) Diseases or symptoms, such as convoluted atrophy, neurodegenerative diseases and muscular dystrophy) and muscle (promoting muscle growth, preventing and/or treating muscle atrophy), and preventing and/or treating kidney disease and its complications (mesenchymal hyperplasia) Nephritis, diabetic nephropathy, edema caused by kidney disease, ascites, cerebral edema, brain damage, and increased intracranial pressure caused by cerebral edema and brain damage), diseases associated with decreased total protein and/or albumin in the blood And the use of symptoms (hypoproteinemia, edema, ascites and decreased renal function) and insulin resistance.

According to the present invention, the function of miR-96 can be inhibited by administering a miR-96 inhibitor, for example, by oral or subcutaneous injection or intramuscular or intravenous administration.

In a preferred aspect, miR-96 has the nucleotide sequence set forth in SEQ ID No: 1 (UUUGGCACUAGCACAUUUUUGCU).

According to the present invention, the "inhibition of the function of miR-96" refers to the degree of down-regulation of miR-96 expression of its target gene in a target cell expressing miR-96 of the same species which is not treated by the method of the present invention, The degree of down-regulation of miR-96 expression of its target gene by miR-96 in a target cell treated by the present invention is reduced by at least a factor of 0.5, and can generally be reduced by at least a factor of 1, such as Figures 1A and 1B.

The present invention provides a method of inhibiting miR-96 function in a target cell expressing miR-96 in vivo or in vitro. The term "inhibiting the function of miR-96" means that the expression level of a target gene regulated by miR-96 is increased by directly or indirectly acting on miR-96 with an agent. Methods include, but are not limited to, the following:

1) Small molecule compounds

MiR-96 inhibitors include, but are not limited to, naturally occurring or synthetic small molecule compounds that act directly on miR-96 to increase the expression of a target gene regulated by miR-96, usually molecular weight. An organic compound greater than 50 and less than 2500 Daltons. Such candidate compounds possess functional groups that interact with proteins, particularly hydrogen bonds, and typically comprise at least one amine, carbonyl, hydroxyl or carboxyl group. These small molecule miR-96 inhibitors can be found by suitable screening methods or other methods.

2) Macromolecular organic compounds

For example, nucleotides and nucleotide analogs such as morpholino that bind to the miR-96 promoter and inhibit its promoter activity.

3) Antisense oligonucleotide

The antisense oligonucleotide can inhibit the function of the target miR-96 by direct binding to the target miR-96, and binds the antisense RNA and the antisense DNA. Preferably, the antisense oligonucleotide is complementary to miR-96, has a length of 8-30 nucleotides, and has a sequence complementary to nucleotides 2-8 of miR-96.

As described in the Background section, it is well known that microRNAs can recognize and silence the expression and/or translation of a target gene by complementary pairing with a target gene. Similarly, miR-96 can also bind to a partially complementary core. The nucleotide sequence competitively inhibits its own function, thereby upregulating the expression of the target gene of miR-96. Thus, in the present invention, the term "complementary" includes not only complete complementarity but also partial complementarity.

Thus, the antisense oligonucleotide has the following nucleotide sequence:

a) the nucleotide sequence shown in SEQ ID No: 4 (AGCAAAAATGTGCTAGTGCCAAA);

b) A nucleotide sequence which is deleted, substituted or added with one or several nucleotides and which is complementary to miR-96 in the nucleotide sequence shown by SEQ ID No: 4.

When in the case of incomplete complementation, that is, when the antisense oligonucleotide is deleted, substituted or added by one or several nucleotides in the nucleotide sequence shown in SEQ ID No: In the case of the obtained nucleotide sequence, the antisense oligonucleotide preferably has at least 60%, 65%, 70%, 75%, 80%, 85 with respect to miR-96 in the region of the complementary nucleotide. %, 90% or 95% complement each other. More preferably, the antisense oligonucleotide has a mismatch of up to 2 nucleotides in the nucleotide region 2-8 of miR-96.

As described above, in the case where the antisense oligonucleotide is not completely complementary to miR-96, it is further preferred that there are at most 10, 9 in length compared to SEQ ID No: 4. A difference of 8, 7, 6, 5, 3, 2 or 1 nucleotides.

In a preferred aspect, the antisense oligonucleotide that is not fully complementary to miR-96 has the nucleotide sequence set forth in SEQ ID No: 5 (TAGTGAATTCTGCTAGTGCCATA).

In addition, the present invention also encompasses some conventional modifications of the antisense oligonucleotide to improve the stability and activity of the antisense oligonucleotide, all of which are within the scope of the invention.

It is to be noted in the present invention that fully or incompletely complementary RNA having the above characteristics is also within the scope of the present invention. In view of the stability in cells, it is preferred in the present invention that the antisense oligonucleotide is DNA.

Since the antisense oligonucleotide is capable of being complementary (fully complementary or partially complementary) to miR-96, when the antisense oligonucleotide is contacted with a target cell expressing miR-96 in vivo or in vitro, The antisense oligonucleotide is capable of complementary pairing with miR-96 and inhibits the binding of miR-96 to its target gene (ie, inhibits the activity of miR-96), thereby breaking the silence of miR-96 on its target gene. .

According to the invention, the method comprises introducing an effective amount of an antisense oligonucleotide complementary to miR-96 into a target cell expressing miR-96. Wherein, the "effective amount" differs depending on the target cell expressing miR-96, and exhibits a certain dose effect, as shown in FIG. 1A of the present invention, according to conventional experimental means by those skilled in the art. And the intended purpose achieved can readily determine the effective dose for target cells expressing miR-96.

When the contact is in vivo contact, the antisense oligonucleotide of the present invention can be administered to an individual by conventional methods of nucleic acid administration. For example, administration of the antisense oligonucleotide can be carried out using the following method: the antisense oligonucleotide can be administered by a method of viral infection, microinjection, or vesicle fusion, or can also be passed A method of jet injection is used for muscle administration of the antisense oligonucleotide. Alternatively, the antisense oligonucleotide may be applied to gold particles and then transdermally administered by a known method such as a particle bombardment apparatus or a "gene gun". These are all technical means conventional in the art, and the present invention will not be repeated here.

Furthermore, the antisense oligonucleotide can also be introduced into a target cell expressing miR-96 by an expression vector. Such expression vectors have a restriction site located adjacent to the promoter sequence to facilitate insertion of the antisense oligonucleotide. Wherein, the transcription cassette located in the expression vector may include a transcription initiation region, a target gene or a fragment thereof, and a transcription termination region. The vector can be, for example, but not limited to, a plasmid, a virus, etc., and can be selected by a person skilled in the art according to actual conditions.

Furthermore, the antisense oligonucleotides can also be introduced into target cells expressing miR-96 by means of respiratory spray administration, for example by preparation into a spray formulation.

In addition, the antisense oligonucleotide may also be introduced into a target cell expressing miR-96 by oral administration, for example, by preparation into an oral preparation, or by the antisense The oligonucleotide is administered orally in a manner that is mixed with the food.

An individual as described above may be any mammalian cell, including but not limited to: ungulates, eg, cows, goats, pigs, sheep, etc.; rodents, eg, hamsters, mice, rats, rabbits; primates For example, monkeys, baboons, humans, etc.

When the contact is in vitro contact, the antisense oligonucleotide or a vector containing the antisense oligonucleotide (for example, a drug containing the antisense oligonucleotide) can be directly added to The substrate in which the target cell expressing miR-96 is cultured is contacted, and the target cell expressing miR-96 into which the antisense oligonucleotide is introduced is cultured under conventional cell culture conditions.

4) RNAi reagent

In a representative embodiment, the RNAi agent targets a precursor molecule of miR-96 (pre-microRNA, as shown in SEQ ID No: 2, UGGCCGAUUUUGGCACUAGCACAUUUUUGCUUGUGUCUCUCCGCUCUGAGCAA UCAUGUGCAGUGCCAAUAUGGGAAA), which modulates miR- via a mechanism of RNA interference Expression of 96, that is, indirectly inhibits the function of miR-96.

It is well known in the art that RNA interference (RNAi) is a phenomenon in which homologous mRNA is efficiently and specifically degraded by double-stranded RNA (dsRNA). Since RNAi technology can specifically knock out or turn off the expression of specific genes, this technology has been widely used to explore the field of gene function and treatment of infectious diseases and malignant tumors. In particular, the present application, by using interfering RNA of the precursor molecule of miR-96, causes gene silencing of the precursor molecule of miR-96, thereby reducing the level of the precursor molecule of miR-96, thereby reducing The level of mature miR-96 converted from the precursor molecule of miR-96, that is, inhibits the function of miR-96, thereby increasing the expression level of the miR-96 target gene.

The RNAi agent can be a small RNA molecule, usually a single-stranded deoxyoligonucleotide (shRNA) that theoretically forms a small hairpin structure, typically no more than 100 nucleotides in length, typically No more than 75 nucleotides; or a 15-30 bp double-stranded deoxyoligonucleotide (siRNA), most typically 20-23 bp, as described in Example 5 of the present invention (eg SEQ) The antisense strand represented by ID No: 7 and the sense strand as shown in SEQ ID No: 8.

In some applications, the RNAi agent can also be a template DNA encoding shRNA or siRNA. These template DNA may be present in a vector, such as a plasmid vector or a viral vector; or may be absent from the vector, but a template DNA encoding shRNA or siRNA plus a common promoter sequence fragment that controls its transcription.

Wherein, the contact of the RNAi agent with the target cell expressing miR-96 may also be in vivo contact or in vitro contact. The method of administering the RNAi agent can be carried out with reference to the description of the antisense oligonucleotide as described above, and the present invention will not be described in detail herein in order to avoid unnecessary repetition.

According to the present invention, the above miR-96 inhibitor can be administered in the form of a pharmaceutical composition comprising a miR-96 inhibitor as described above and a pharmaceutically acceptable carrier.

In the composition of the present invention, the content of the miR-96 inhibitor as described above as an active ingredient may vary within a wide range, and may be, for example, 0.000001 to 99%, preferably 1 to 70%. More preferably, it may be 5-30%.

According to the present invention, the pharmaceutical composition can be prepared into various dosage forms conventional in the art, and the present invention is not particularly limited thereto, and for example, it can be formulated into a solid, semi-solid, liquid or gaseous form, for example, a tablet. , capsules, elixirs, suspensions, syrups, powders, granules, ointments, suppositories, injections, inhalants, aerosols, and the like, which are not enumerated herein.

Therefore, various forms of administration may be carried out depending on the pharmaceutical dosage form, such as, but not limited to, oral administration, buccal administration, rectal administration, parenteral administration, intraperitoneal administration, and respiratory administration. , intradermal administration, transdermal administration.

Wherein, the pharmaceutically acceptable carrier can be selected differently depending on the dosage form, which are well known to those skilled in the art. For example, without limitation, the pharmaceutically acceptable carrier can be starch, gum, lactose, glucose, sucrose, microcrystalline cellulose, kaolin, mannitol, dibasic calcium phosphate, sodium chloride, alginic acid, and the like.

In addition, conventional additives such as solubilizers, isotonic agents, suspending agents, emulsifying agents, stabilizers and preservatives may also be added.

Additionally, the pharmaceutically acceptable carrier may further comprise a targeting agent capable of enhancing targeting of the antisense oligonucleotide to a particular organ or tissue or cell, such as a targeting peptide, and may also These include transmembrane agents that are capable of carrying the antisense oligonucleotides more readily into target cells expressing miR-96, such as transmembrane peptides, liposomes, microvesicles, and membrane lipoproteins.

According to the present invention, a flavoring agent such as peppermint, wintergreen oil or the like may be added to the pharmaceutical composition. In addition, coloring agents may also be added to the pharmaceutical composition to impart a certain degree of attractiveness to the prepared dosage form or to distinguish it from other products.

According to the present invention, the antisense oligonucleotide can also be combined with other conventional drugs capable of similar effects to prepare a combination pharmaceutical composition. For example, it can be prepared in combination with a drug for inhibiting insulin resistance as a drug for effectively treating diabetes.

In particular, said use of the invention comprises the preparation of a medicament and/or food for the prevention and/or treatment of any of the above diseases and/or symptoms. Wherein the food product comprises a health care product.

According to the invention, the treatment refers to an improvement or complete disappearance of a subject's symptoms associated with a disease or condition caused by miR-96, wherein a broad sense of improvement refers to a reduction of at least one parameter. Specific to the present application, for example, it is possible to synthesize albumin ability, kidney function and lung function, and improvement of muscle metabolism in the liver and the like.

The individual to be treated can be any individual, preferably a mammal, afflicted with the symptoms described above.

In a second aspect, the invention also provides for enhancing the function of miR-96 for enhancing lung function (prevention and/or treatment of lung function damage, pneumonia, emphysema or polyps).

According to the present invention, the miR-96 enhancer comprises synthetic mature miR-96 (see sequence 1), a precursor of miR-96, an agonist of miR-96 (agomir), and transcription that positively regulates miR-96 Horizontal small molecule compounds, proteins, and nucleic acids and analogs thereof.

The administration form, the administration form, and the administration target of the enhancer can be set in the form of an inhibitor as described above, and will not be described in detail herein.

At the same time, the present invention also provides for the use of detecting the expression level of miR-96 in blood in predicting whether an individual has a risk of suffering from liver disease, kidney disease and lung disease.

The invention will be described in detail below by way of examples. In the following embodiments,

miR-96 overexpression vector

The miR-96 gene (GGTACAAAGACCTCCTCTGCTCCTTCCCCAGAGGGCCTGTT CCAGTACCATCTG CTTGGCCGATTGTGGCACTAGCACATTTTGGCTTGTGTCTCTCCGCTGTGAGCAATC ATGTGTAGTGCCAATATGGGAAAAGCGGGCTGCTGC GGCCACGTTCACCTCCCCCGGCATCC) shown in SEQ ID No: 3 was cloned into the pCAG-GFP vector to obtain the overexpression plasmid pCAG-miR-96-GFP of the miR-96 gene. Among them, the synthesis and cloning of the miR-96 gene shown by SEQ ID No: 3 was carried out by Kingsray.

miR-96 sensor vector (miR-96sensor vector)

The miR-96 receptor vector is a fire luciferase gene 3 cloned into the pGL3-SV40 vector by binding a confirmed miR-96 binding and regulatory target sequence (AAAGAAACCATCAAGTTGTGCCAAA) as shown in SEQ ID No:11. 'The downstream xbaI site was obtained, so that the expression of fire luciferase in the miR-96 receptor vector was regulated by miR-96.

Example 1

This example is to illustrate the in vitro regulation of antisense oligonucleotides on miR-96

Human embryonic kidney cells HEK-293T were cultured in DMEM medium containing 10% fetal bovine serum. The cell culture incubator was constantly maintained at 37 ° C and 5% CO ₂ . HEK-293T cells were seeded in a 24-well cell culture plate at a seeding rate of 100,000 cells per well at a culture volume of 500 μl. The following day, the settings of Table 1 below were co-transfected into KEK-293 cells using liposome 2000 (Invitrogen) according to the instructions, and expression from the miR-96 receptor vector was measured 36 hours later using a dual luciferase analyzer (Promega). The luciferase activity. Three replicate wells were set each time and the experiment was repeated three times.

Among them, the transgenic amount of miR-96 receptor vector in each group was 500 ng for miR-96 receptor vector, 20 ng for pCAG-GFP blank vector, 500 ng for miR-96 overexpression vector, and 50 μM for oligonucleotide. The solution. Further, when the transferred oligonucleotide was miR-96ASO, 0.5 μl and 1 μl of a 50 μM oligonucleotide solution were respectively added, and the final concentrations were 0.0417 μM and 0.0833 μM, respectively, after being added to the cell culture solution. To measure the activity of luciferase, and take the ordinate as the ordinate and the concentration of miR-96ASO as the abscissa, draw a curve. The results are shown in Figure 1.

As can be seen from Figure 1, miR-96ASO inhibits the function of miR-96.

As can be seen from Figure 1A, the miR-96 receptor vector, miR-96 overexpression vector and different concentrations of miR-96ASO were co-transfected. The luciferase activity assay showed that miR-96ASO can inhibit the function of miR-96, and Dose effect.

As can be seen from Figure 1B, overexpression of miR-96 inhibits the expression of miR-96 receptor vector (left 1 column and left 2 column); miR-96ASO and miR-96 mismatch ASO can inhibit miR-96 function (left) 3 column and left 5 column), miR-96ASO has better inhibitory effect than miR-96 mismatched ASO, while randomized control nucleotides can not inhibit miR-96 function (left 4 column), Data = mean ± SEM ; N=3; ***P<0.001, **P<0.01. Moreover, overexpression of miR-96 in HEK293 cells inhibited the expression level of the reporter gene luciferase in the miR-9 receptor vector to 47% of the control group, while co-transforming the final concentration of 0.0833 μM of miR-96ASO, The expression of the reporter gene luciferase in the miR-96 receptor vector was restored to 76% of the control level, ie miR-96ASO was able to inhibit 54% of miR-96 function.

Table 1

Example 2

This example is intended to illustrate the antisense oligonucleotide of thio-modified miR-96 by oral gavage (thio-miR-96ASO: A _S G _S CAAAAATGTGCTAGTGCCA _S A _S A, modification site: the last two phosphoric acids at both ends One of the oxygen atoms in the ester is replaced by sulfur), which inhibits the increase in kidney weight and prevents kidney disease in db/db mice with leptin receptor knockout, enhances the ability of the liver to synthesize albumin, and enhances the ability of the liver and kidney to synthesize creatinine. And reduce the weight of the lungs.

Leptin binds to the leptin receptor and activates the downstream signaling pathway, which inhibits the appetite of the individual. The leptin receptor gene in db/db mice is mutated, so the leptin negative feedback in db/db mice impairs the appetite signaling pathway. Continuous feeding makes db/db mice gain weight, liver and kidney weight increase, and affect liver and kidney function, leading to diabetic nephropathy [1,6].

10 normal 8-10 week old SPF grade C57BL/6 mice (Beijing Weitong Lihua Experimental Animal Co., Ltd.) and 30 4-8 weeks of SPF grade db/db mice (Nanjing Institute of Biomedical Research) Eight weeks later, the two lightest C57BL/6 mice and six db/db mice were excluded. Eight C57BL/6 mice were used as normal mouse control groups, and 24 db/db mice were randomly divided into three groups according to body weight: model control group, negative control group and PJ150021 (thio-modified miR-96ASO) treatment group. The PJ150021 treatment group received 16 mg/kg of PJ150021 per day, and the negative control group received 16 mg/kg of negative control nucleic acid (SEQ ID No: 6) per day. The model control group received an equal volume of normal saline per day. After 5 weeks of drug treatment, glucose was administered after 12 hours of fasting, and then changes in blood glucose concentration (glucose tolerance test, OGTT) and insulin injection 12 hours after the abdomen were measured continuously, and then changes in blood glucose concentration were continuously measured (insulin tolerance test). , ITT), after the animal is euthanized, blood sampling biochemical indicators, including total protein, albumin and creatinine in the blood, dissecting organs and weighing, while HE staining of mouse mesangial cells for observation Its proliferation.

The results showed that PJ150021 significantly increased the total protein (Fig. 2A) and albumin content (Fig. 2B) and creatinine content in the blood of db/db mice (Fig. 3). PJ150021 significantly inhibited the increase in kidney weight in db/db mice (Fig. 4) and reduced proliferation of mesangial cells (Fig. 4B), reducing lung weight. The insulin resistance test results demonstrated that PJ150021 significantly enhanced the sensitivity of db/db mice to insulin (Figure 5).

Example 3

This example is used to demonstrate the in vitro regulation of small interfering RNA (siRNA) on miR-96

Human embryonic kidney cells HEK-293T were cultured in DMEM medium containing 10% fetal bovine serum. 37 [deg.] C incubator and maintained constant 5% CO _2, the culture volume of 500μl. The next day, miR-96 siRNA (antisense strand SEQ ID No: 7: 5'CUCAGAGCGGAGAGACACAAG'3, sense strand SEQ ID No: 8: 5'CUUGUGUCUCUCCGCUCUGAG'3, Shanghai Jima was prepared according to the instructions using liposome 2000 (Invitrogen). Synthesis, wherein the structure of dTdT at the 3' end of SEQ ID No: 7 and SEQ ID No: 8) and random control RNA (antisense strand SEQ ID No: 9: 5'CGUGACACGUUCGGAGAA'3; sense strand SEQ ID No: 10:5'UUCUCCGAACGUGUCACGU'3, Shanghai Gemma synthesis, in which the structure of dTdT is present at the 3' end of SEQ ID No: 9 and SEQ ID No: 10), respectively, transfected into KEK-293 into cells, 36 After the hour, the cells were lysed with Trizol and total RNA was extracted, and then the expression amount of miR-96 was detected using the same quantitative PCR kit and primer as in Example 1. Three replicate wells were set each time and the experiment was repeated three times. The results are shown in Figure 6, ***P < 0.01.

The results showed that miR-96 siRNA could down-regulate the expression of miR-96 by 70%, and thus the amount of miR-96 bound to the target gene of miR-96 was also down-regulated by 70%, thereby increasing the expression level of the target gene. It can be seen that the function of miR-96 can also be successfully inhibited by RNA interference with the miR-96 precursor.

to sum up

The present invention can sufficiently inhibit miR-96 in a target cell expressing miR-96 by contacting a miR-96 inhibitor (including an antisense oligonucleotide and an interfering RNA) with a target cell expressing miR-96 in vivo or in vitro. Function (antisense oligonucleotide inhibits the binding of miR-96 to its target gene, interfering RNA can reduce the expression of miR-96, thereby inhibiting the function of miR-96), and can be effective when used for individual administration. The disease caused by an increase in the amount of miR-96 is prevented and/or treated, for example, hypoproteinemia, edema, liver function damage, muscle atrophy, insulin resistance, and kidney disease. It provides a new direction for the treatment of diseases such as hypoproteinemia, edema, liver function damage, muscle atrophy, insulin resistance and kidney disease, and thus has extremely high social and economic benefits.

At the same time, according to the miR-96 inhibitor, which can reduce the weight of the lung, it can be inferred that the weight of the lung can be increased by using the miR-96 enhancer, thereby protecting the lung function.

The preferred embodiments of the present invention have been described in detail above, but the present invention is not limited to the specific details of the above embodiments, and various simple modifications can be made to the technical solutions of the present invention within the scope of the technical idea of the present invention. These simple variants All fall within the scope of protection of the present invention.

It should be further noted that the specific technical features described in the above specific embodiments may be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, the present invention will not be further described in various possible combinations.

In addition, any combination of various embodiments of the invention may be made as long as it does not deviate from the idea of the invention, and it should be regarded as the disclosure of the invention.

references

1.Chen, H., et al., Evidence that the diabetes gene encodes the leptin receptor: identification of a mutation in the leptin receptor gene in db/db mice. Cell, 1996. 84(3): p.491-5.

2. Vincent, J.L., D. De Backer, and C.J. Wiedermann, Fluid management in sepsis: The potential beneficial effects of albumin. J Crit Care, 2016.35: p.161-7.

3.Thevenot, T., et al., Effect of albumin in cirrhotic patients with infection other than spontaneous bacterial peritonitis. A randomized trial. J Hepatol, 2015. 62(4): p.822-30.

4. Barcelos, R.P., et al., Creatine and the Liver: Metabolism and Possible Interactions. Mini Rev Med Chem, 2016.16(1): p.12-8.

5. Brosnan, J.T. and M.E. Brosnan, Creatine: endogenous metabolite, dietary, and therapeutic supplement. Annu Rev Nutr, 2007.27: p.241-61.

6. Kim, J.E., et al., Celastrol, an NF-kappaB inhibitor, improved insulin resistance and attenuates renal injury in db/db mice. PLoS One, 2013.8(4): p.e62068.

Claims

Inhibition of the function of miR-96 in the protection of liver and muscle, as well as the prevention and/or treatment of kidney disease and its complications, diseases and symptoms associated with decreased levels of total protein and/or albumin in the blood, and insulin resistance, in particular Use in the preparation of products for protecting liver and muscle, as well as preventing and/or treating kidney disease and its complications, diseases and conditions associated with decreased levels of total protein and/or albumin in the blood, and insulin resistance.
The application according to claim 1, wherein

Protecting the liver includes: promoting liver synthesis of albumin and creatinine, preventing and/or treating liver damage, hepatitis or cirrhosis;

Preferably, protecting the liver comprises: preventing and/or treating a disease or symptom associated with a decrease in creatinine content, for example, a racemic atrophy, a neurodegenerative disease, and a muscular dystrophy;

Protecting muscles includes: promoting muscle growth, preventing and/or treating muscle atrophy;

Diseases and symptoms associated with decreased levels of total protein and/or albumin in the blood include hypoproteinemia, edema, ascites, and decreased renal function;

The kidney disease and its complications include: mesangial proliferative nephritis, diabetic nephropathy, edema caused by kidney disease or ascites, cerebral edema, brain damage, and increased intracranial pressure caused by cerebral edema and brain damage.
The use according to claim 1 or 2, wherein miR-96 has the nucleotide sequence shown in SEQ ID No: 1.
The use according to claim 1 or 2, wherein the method of inhibiting the function of miR-96 comprises contacting a miR-96 inhibitor with a target cell expressing miR-96 expressing miR-96.
The use according to claim 4, wherein the miR-96 inhibitor is an antisense oligonucleotide, which binds antisense DNA and antisense RNA, and the antisense oligonucleotide is complementary to miR-96, And having a length of 8-30 nucleotides and having a sequence complementary to nucleotides 2-8 of miR-96;

Preferably, the antisense oligonucleotide has the following nucleotide sequence:

a) the nucleotide sequence shown in SEQ ID No: 4;

b) a nucleotide sequence which is deleted, substituted or added with one or several nucleotides and is complementary to miR-96 in the nucleotide sequence shown in SEQ ID No: 4; preferably, in SEQ ID No: 4 a nucleotide sequence which is deleted, substituted or added with one or several nucleotides and which is at least 60% complementary to miR-96; more preferably, with position 2-8 of miR-96 A nucleotide sequence having at most 2 nucleotides mismatched nucleotides; most preferably, the nucleotide sequence shown in SEQ ID No: 5.
The use according to claim 4, wherein the miR-96 inhibitor is a small interfering RNA of a miR-96 precursor;

Preferably, the miR-96 precursor has the sequence set forth in SEQ ID No: 2;

Preferably, the small interfering RNA of the miR-96 precursor is 15-30 bp in length;

Preferably, the small interfering RNA of the miR-96 precursor has an antisense strand as set forth in SEQ ID No: 7 and a sense strand as set forth in SEQ ID No: 8.
Enhance the function of miR-96 in enhancing lung function, especially in the preparation of products for enhancing lung function.
The use according to claim 7, wherein enhancing lung function comprises preventing and/or treating pulmonary function damage, pneumonia, emphysema or polyposis.
A method for enhancing the function of miR-96, the method comprising: contacting a miR-96 enhancer with a target cell expressing miR-96;

Preferably, the miR-96 enhancer comprises synthetic mature miR-96, a precursor of miR-96, an agonist of miR-96, and a small molecule compound, protein and nucleic acid capable of positively regulating the transcriptional level of miR-96 And its analogues.
The amount of expression of miR-96 in the blood is tested for predicting whether the individual has a risk of developing liver disease, kidney disease and lung disease.