WO2016192669A1

WO2016192669A1 - Method and medicine for losing weight and reducing blood glucose and blood lipid via mir-96, and use thereof

Info

Publication number: WO2016192669A1
Application number: PCT/CN2016/084710
Authority: WO
Inventors: 彭长庚; 温婷
Original assignee: 昆山彭济凯丰生物科技有限公司
Priority date: 2015-06-05
Filing date: 2016-06-03
Publication date: 2016-12-08
Also published as: CN106267207A

Abstract

Provided is a use in preventing and/or treating, by inhibiting a miR-96 function, hyperlipidemia, fatty liver, obesity, diabetes and symptoms similar to the symptoms of the above diseases. Also provided is a method for inhibiting the miR-96 function, comprising enabling a miR-96 inhibitor such as an antisense oligonucleotide to contact a target cell expressing miR-96. Also provided are an inhibitor inhibiting the miR-96 function, pharmaceutical composition and kit comprising the inhibitor, and use thereof in preventing and/or treating hyperlipidemia, fatty liver, obesity, diabetes and symptoms similar to the symptoms of the above diseases.

Description

Method and medicine for reducing weight, lowering blood sugar and lowering blood fat by miR-96 and application thereof

Technical field

The present invention relates to the field of biomedicine, and in particular to the prevention and/or treatment of hyperlipemia, fatty liver, obesity, diabetes, and diseases thereof by inhibiting the function of miR-96, a marker of hyperlipemia, fatty liver, obesity or diabetes. A symptom-like symptom, a method of inhibiting the function of miR-96, a miR-96-based inhibitor, a pharmaceutical composition and kit, and their use in inhibiting the function of miR-96, particularly It is an application in the prevention and/or treatment of hyperlipemia, fatty liver, obesity and/or diabetes and symptoms similar to those of these diseases.

Background technique

Excessive energy intake is the most fundamental cause of hyperlipidemia, fatty liver and obesity, and obesity is recognized as a cause of type 2 diabetes. Previous studies have shown that the brain (the hypothalamus is particularly important) - the central axis of the gastrointestinal tract plays an important regulatory role in appetite, feeding and digestion and absorption, as well as blood glucose concentration and fat metabolism [1], so the gene expression in the hypothalamus-gastrointestinal is very variable. May be the most fundamental cause of obesity. Excessive energy intake will first cause fatty liver, which in turn changes the expression of genes in the liver, causing abnormalities in lipid metabolism and causing cardiovascular disease. In addition, studies have shown that the brain-gastrointestinal-hepatic central axis plays an important regulatory role in blood glucose metabolism [2], indicating that the brain-gastrointestinal-hepatic central axis may be a new target organ system for the treatment of obesity and diabetes [3].

There is increasing evidence that microRNAs (miRNAs) play an important role in the regulation of energy metabolism [4]. MicroRNAs are a class of non-coding RNA molecules (www.mirbase.org) that are 16-25 nt in length and are capable of recognizing and silencing RNA expression and/or protein expression of a target gene by complementary pairing with a target gene. After the mature microRNA is loaded onto the RNA-induced silencing complex (RISC), it is combined with the complementary sequence in the 3'-UTR of the target gene mRNA by base pairing, thereby triggering the degradation of the mRNA and/or inhibiting its protein. translation. The nucleotides from the second to the eighth position of the 5' end of the microRNA are called "core sequences". The complementary pairing of these seven nucleotides with the target gene is the key to recognition of the target gene. The higher the degree of pairing, the binding and The greater the likelihood and ability to regulate a target gene. Simultaneous pairing of sequences other than the "core sequence" of the microRNA with the target gene also enhances its ability to bind and regulate the target gene. It is precisely because microRNAs recognize and regulate the expression of target genes through incomplete pairing that a microRNA can simultaneously regulate multiple target genes to different degrees in one cell.

Therefore, the development of microRNA-based drugs that control energy metabolism is a trend.

Summary of the invention

It is an object of the present invention to develop microRNA-based drugs that control energy metabolism.

In order to achieve the above object, in one aspect, the present invention provides a function of inhibiting hyperlipemia, fatty liver, obesity or diabetes, miR-96, in preventing and/or treating hyperlipemia, fatty liver, obesity, diabetes, and diseases thereof. The application of symptoms similar to symptoms.

In a second aspect, the present invention provides a method of inhibiting the function of a marker miR-96 of hyperlipemia, fatty liver, obesity or diabetes, wherein the method comprises: targeting a miR-96 inhibitor to a target expressing miR-96 Cell contact.

In a third aspect, the present invention provides a miR-96 inhibitor, wherein the miR-96 inhibitor is an antisense oligonucleotide comprising antisense DNA and antisense RNA, the antisense oligonucleotide Complementary to miR-96 and having a length of 8-23 nucleotides; or the miR-96 inhibitor is a small interfering RNA of the miR-96 precursor.

In a fourth aspect, the present invention also provides a pharmaceutical composition, wherein the pharmaceutical composition comprises a miR-96 inhibitor as described above and a pharmaceutically acceptable carrier.

In a fifth aspect, the present invention also provides a kit, wherein the kit comprises a miR-96 inhibitor as described above, optionally, the kit further comprising a pharmaceutically acceptable carrier.

In a sixth aspect, the present invention provides a method as described above, a miR-96 inhibitor as described above, a pharmaceutical composition as described above and/or a kit as described above, in inhibiting the function of miR-96 Applications; especially in the prevention and/or treatment of hyperlipidemia, fatty liver, obesity, diabetes, and symptoms similar to those of these diseases.

In a seventh aspect, the present invention provides the use of a miR-96 inhibitor as described above, a pharmaceutical composition as described above, for the preparation of a medicament for inhibiting the function of miR-96; in particular for preparation for prevention and / or the use of drugs for the treatment of hyperlipidemia, fatty liver, obesity, diabetes and symptoms similar to those of these diseases.

The present invention can fully inhibit the function of miR-96 by contacting a miR-96 inhibitor with a target cell expressing miR-96 (including inhibiting the binding of miR-96 to its target gene or reducing the expression level of miR-96, thereby inhibiting The function of miR-96), when used for individual administration, can effectively prevent and/or treat diseases caused by an increase in the amount of miR-96, for example, hyperlipemia, fatty liver, obesity, diabetes or with these diseases. Symptoms with similar symptoms. Compared with the traditional single hypoglycemic or single hypolipidemic or single weight loss drugs, the present invention provides a comprehensive treatment for appetite, glycolipid metabolism and adipocyte differentiation, and thus has powerful effects and small side effects.

Other features and advantages of the invention will be described in detail in the detailed description which follows.

DRAWINGS

The drawings are intended to provide a further understanding of the invention, and are intended to be a In the drawing:

Figure 1 shows the expression levels of miR-96 in the hypothalamus, stomach and liver of 12-month-old mice relative to 2 month old mice.

Figure 2A is a linear plot of miR-96 ASO dose versus its inhibitory effect on miR-96.

Figure 2B is a comparison of the functional effects of miR-96 ASO, randomized control nucleotides, miR-96 mismatched ASO at the cellular level to inhibit miR-96.

Figure 3A is a graph comparing the changes in body weight over time in mice injected with miR-96 ASO and PBS, respectively.

Figure 3B is a graph comparing the rate of weight gain over time in mice injected with miR-96 ASO and PBS, respectively.

Figure 3C is a graph comparing blood glucose concentrations of mice injected with two and a half months of miR-96 ASO and PBS, respectively.

Figure 4A is a graph comparing the weight of liver, epididymal fat and stomach of mice injected with miR-96 ASO and PBS for three months, respectively.

Figure 4B is a graph comparing the weight of epididymal fat and stomach to body weight of miR-96 ASO and PBS injected for three months, respectively.

Figure 4C is a graph comparing the weight to body weight ratio of liver and kidney for miR-96 ASO and PBS injected for three months, respectively.

Figure 4D is a graph comparing the levels of total cholesterol, triglyceride, high density lipoprotein and low density lipoprotein in the serum of mice injected with miR-96 ASO and PBS for three months, respectively.

Figure 5 is a graph comparing the effect of miR-96 siRNA and random control RNA on miR-96 expression.

Figure 6 is a graph showing the comparison of fasting blood glucose in mice administered by oral gavage for 14 weeks of thio-miR-96 ASO, physiological saline, and thio-modified random nucleotides.

7A-C are comparative graphs of mouse body weight growth rate, liver weight, and liver coefficient, respectively, for 14 weeks of oral administration of thio-miR-96 ASO, physiological saline, and thio-modified random nucleotides.

Figures 8A-D are cholesterol, triglyceride, high-density lipoprotein, and low-density in the blood of mice administered orally by intragastric administration for 14 weeks of thio-miR-96 ASO, saline, and thio-modified random nucleotides. A comparison of the concentrations of lipoproteins.

Figure 9 is a graph showing the effect of oral administration of thio-miR-96 ASO, physiological saline, and thio-modified random nucleotides on the formation of fatty liver in mice by oral gavage for 14 weeks.

detailed description

Specific embodiments of the present invention will be described in detail below. It is to be understood that the specific embodiments described herein are merely illustrative and not restrictive.

Unless otherwise stated, the technical terms used herein have the same meaning as the terms commonly understood by those skilled in the art.

The inventors of the present invention found in the course of the study that the miR-96 in the hypothalamic-gastric axis of the dominant appetite was significantly up-regulated in the 12-month-old mouse compared to the 2 month old mouse, and The expression in the liver is also significantly upregulated. Based on the above findings, the inventors used the TargetScanHuman (www.targetscan.org) algorithm to predict the target gene of miR-96 that is conserved in vertebrates, and then compared with the KEGG pathway, many target genes of miR-96 are enriched in sugar. , lipids, and signaling pathways regulating glycoprotein metabolism, as well as in the insulin signaling pathway, the diabetic signaling pathway, and the adipocytokine pathway (Table 1). Another 20 miR-96 target genes are located in the MAPK signaling pathway, 9 miR-96 target genes are located in the Wnt signaling pathway and 3 target genes are located in the Hedgehog signaling pathway (Table 1); these three signaling pathways are known to be inhibitory Adipocyte differentiation and proliferation [5]. In addition, six miR-96 targets were involved in the appetite-adjusting Jak-STAT signaling pathway (Table 1).

Table 1

Based on the above studies, the inventors of the present invention found that miR-96 can be used as a marker for hyperlipemia, fatty liver, obesity or diabetes, and subsequently demonstrated that hyperlipemia and fatty liver can be prevented and/or treated by inhibiting the function of miR-96. , obesity, diabetes, and symptoms similar to those of these diseases.

Accordingly, the present invention provides the use of the marker miR-96, which inhibits hyperlipemia, fatty liver, obesity or diabetes, for the prevention and/or treatment of the following diseases and/or symptoms: hyperlipemia, fatty liver, obesity, diabetes, and Symptoms similar to the symptoms of these diseases, a miR-96 inhibitor, a method of inhibiting the function of miR-96 by the miR-96 inhibitor, and pharmaceutical compositions and kits including the miR-96 inhibitor, and They are used in the prevention and/or treatment of hyperlipidemia, fatty liver, obesity, diabetes and symptoms similar to those of these diseases.

method

The present invention provides a method of inhibiting the function of the marker miR-96 of hyperlipemia, fatty liver, obesity or diabetes, wherein the method comprises: contacting a miR-96 inhibitor with a target cell expressing miR-96.

In a preferred aspect, miR-96 has SEQ ID No: 1 (NUUGGCACUAGCACAUUUUUGCU) The nucleotide sequence shown.

According to the present invention, the "inhibition of the function of miR-96" refers to the degree of down-regulation of miR-96 expression of its target gene in a target cell expressing miR-96 of the same species which is not treated by the method of the present invention, In the target cells expressing miR-96 treated by the present invention, the degree of down-regulation of miR-96 expression of its target gene by at least 0.5 fold is reduced by at least a factor of 0.5, such as Figures 2A and 2B.

The present invention provides a method of inhibiting miR-96 function in a target cell expressing miR-96 in vivo or in vitro. The term "inhibiting the function of miR-96" means that the expression level of a target gene regulated by miR-96 is increased by directly or indirectly acting on miR-96 with an agent. Methods include, but are not limited to, the following:

1) Small molecule compounds

MiR-96 inhibitors include, but are not limited to, naturally occurring or synthetic small molecule compounds that act directly on miR-96 to increase the expression of a target gene regulated by miR-96, usually molecular weight. An organic compound greater than 50 and less than 2500 Daltons. Such candidate compounds possess functional groups that interact with proteins, particularly hydrogen bonds, and typically comprise at least one amine, carbonyl, hydroxyl or carboxyl group. These small molecule miR-96 inhibitors can be found by suitable screening methods or other methods.

2) Antisense oligonucleotide

The antisense oligonucleotide is capable of inhibiting the function of the target miR-96 by direct binding to the target miR-96, including antisense RNA and antisense DNA. Preferably, the antisense oligonucleotide is complementary to miR-96, has a length of 8-23 nucleotides, and has a sequence complementary to nucleotides 2-8 of miR-96.

As described in the Background section, it is well known that microRNAs can recognize and silence the expression and/or translation of a target gene by complementary pairing with a target gene. Similarly, miR-96 can also bind to a partially complementary core. The nucleotide sequence competitively inhibits its own function, thereby upregulating the expression of the target gene of miR-96. Thus, in the present invention, the term "complementary" includes not only complete complementarity but also partial complementarity.

Thus, the antisense oligonucleotide has the following nucleotide sequence:

a) the nucleotide sequence shown in SEQ ID No: 4 (AGCAAAAATGTGCTAGTGCCAAA);

b) A nucleotide sequence which is deleted, substituted or added with one or several nucleotides and which is complementary to miR-96 in the nucleotide sequence shown by SEQ ID No: 4.

When in the case of incomplete complementation, that is, when the antisense oligonucleotide is deleted, substituted or added by one or several nucleotides in the nucleotide sequence shown in SEQ ID No: In the case of the obtained nucleotide sequence, the antisense oligonucleotide preferably has at least 60%, 65%, 70% with miR-96 in the region of the complementary nucleotide. 75%, 80%, 85%, 90% or 95% complement each other. More preferably, the antisense oligonucleotide has a mismatch of up to 3 nucleotides in the region of nucleotides 2-8 of miR-96.

As described above, in the case where the antisense oligonucleotide is not completely complementary to miR-96, it is further preferred that there are at most 10, 9 in length compared to SEQ ID No: 4. A difference of 8, 7, 6, 5, 3, 2 or 1 nucleotides.

In a preferred aspect, the antisense oligonucleotide that is not fully complementary to miR-96 has the nucleotide sequence set forth in SEQ ID No: 5 (TAGTGAATTCTGCTAGTGCCATA).

In addition, the present invention also encompasses some conventional modifications of the antisense oligonucleotide to improve the stability and activity of the antisense oligonucleotide, all of which are within the scope of the invention. For example, the stability of antisense oligonucleotides is enhanced by conventional 5'-O-1-thiotriphosphate modifications or locked nucleic acids or 2'-O-methyl modifications. In a preferred aspect of the invention, 1-5 bases at both ends of the nucleotide sequence set forth in SEQ ID No: 4 may be modified with a thiotriphosphate. In a specific embodiment of the invention, the two phosphate esters at both ends of the nucleotide acid sequence set forth in SEQ ID No: 4 are thiolated (eg, A _S G _S CAAAAATGTGCTAGTGCCA _S A _S A).

It is to be noted in the present invention that fully or incompletely complementary RNA having the above characteristics is also within the scope of the present invention. In view of the stability in cells, it is preferred in the present invention that the antisense oligonucleotide is DNA.

Since the antisense oligonucleotide is capable of being complementary (fully complementary or partially complementary) to miR-96, when the antisense oligonucleotide is contacted with a target cell expressing miR-96 in vivo or in vitro, The antisense oligonucleotide is capable of complementary pairing with miR-96 and inhibits the binding of miR-96 to its target gene (ie, inhibits the activity of miR-96), thereby breaking the silence of miR-96 on its target gene. .

According to the invention, the method comprises introducing an effective amount of an antisense oligonucleotide complementary to miR-96 into a target cell expressing miR-96. Wherein, the "effective amount" varies depending on the target cell expressing miR-96, and exhibits a certain dose effect, as shown in FIG. 2A of the present invention, according to conventional experimental means by those skilled in the art. And the intended purpose achieved can readily determine the effective dose for target cells expressing miR-96.

When the contact is in vivo contact, the antisense oligonucleotide of the present invention can be administered to an individual by conventional methods of nucleic acid administration. For example, administration of the antisense oligonucleotide can be carried out using the following method: the antisense oligonucleotide can be administered by a method of viral infection, microinjection, or vesicle fusion, or can also be passed A method of jet injection is used for muscle administration of the antisense oligonucleotide. Alternatively, the antisense oligonucleotide may be applied to gold particles and then transdermally administered by a known method such as a particle bombardment apparatus or a "gene gun". These are all technical means conventional in the art, and the present invention will not be repeated here.

Furthermore, the antisense oligonucleotide can also be introduced into a target cell expressing miR-96 by an expression vector. Such expression vectors have a restriction site located adjacent to the promoter sequence to facilitate insertion of the antisense oligonucleotide. Wherein, the transcription cassette located in the expression vector may include a transcription initiation region, a target gene or a fragment thereof, and a transcription termination region. The vector can be, for example, but not limited to, a plasmid, a virus, etc., and can be selected by a person skilled in the art according to actual conditions.

Furthermore, the antisense oligonucleotides can also be introduced into target cells expressing miR-96 by means of respiratory spray administration, for example by preparation into a spray formulation.

In addition, the antisense oligonucleotide may also be introduced into a target cell expressing miR-96 by oral administration, for example, by preparation into an oral preparation, or by the antisense The oligonucleotide is administered orally in a manner that is mixed with the food.

An individual as described above may be any mammalian cell, including but not limited to: ungulates, eg, cows, goats, pigs, sheep, etc.; rodents, eg, hamsters, mice, rats, rabbits; primates For example, monkeys, baboons, humans, etc.

When the contact is in vitro contact, the antisense oligonucleotide or a vector containing the antisense oligonucleotide (for example, a drug containing the antisense oligonucleotide) can be directly added to The substrate in which the target cell expressing miR-96 is cultured is contacted, and the target cell expressing miR-96 into which the antisense oligonucleotide is introduced is cultured under conventional cell culture conditions.

3) RNAi reagent

In a representative embodiment, the RNAi agent targets a precursor molecule of miR-96 (pre-microRNA, as shown in SEQ ID No: 2, UGGCCGAUUUUGGCACUAGCACAUUUUUGCUUGUGUCUCUCCGCUCUGAGCAAUCAUGUGCAGUGCCAAUAUGGGAAA), modulating miR-96 by a mechanism of RNA interference The expression, that is, indirectly inhibits the function of miR-96.

It is well known in the art that RNA interference (RNAi) is a phenomenon in which homologous mRNA is efficiently and specifically degraded by double-stranded RNA (dsRNA). Since RNAi technology can specifically knock out or turn off the expression of specific genes, this technology has been widely used to explore the field of gene function and treatment of infectious diseases and malignant tumors. In particular, the present application, by using interfering RNA of the precursor molecule of miR-96, causes gene silencing of the precursor molecule of miR-96, thereby reducing the level of the precursor molecule of miR-96, thereby reducing The level of mature miR-96 converted from the precursor molecule of miR-96, ie, inhibits miR-96 The function of this increases the expression level of the miR-96 target gene.

The RNAi agent can be a small RNA molecule, usually a single-stranded deoxyoligonucleotide (shRNA) that theoretically forms a small hairpin structure, typically no more than 100 nucleotides in length, typically No more than 75 nucleotides; or a 15-30 bp double-stranded deoxyoligonucleotide (siRNA), most typically 20-23 bp, as described in Example 5 of the present invention (eg SEQ) The antisense strand represented by ID No: 7 and the sense strand as shown in SEQ ID No: 8.

In some applications, the RNAi agent can also be a template DNA encoding shRNA or siRNA. These template DNA may be present in a vector, such as a plasmid vector or a viral vector; or may be absent from the vector, but a template DNA encoding shRNA or siRNA plus a common promoter sequence fragment that controls its transcription.

Wherein, the contact of the RNAi agent with the target cell expressing miR-96 may also be in vivo contact or in vitro contact. The method of administering the RNAi agent can be carried out with reference to the description of the antisense oligonucleotide as described above, and the present invention will not be described in detail herein in order to avoid unnecessary repetition.

miR-96 inhibitor

The present invention also provides a miR-96 inhibitor, the specific type of which is as described above, and the present invention will not be described in detail herein in order to avoid unnecessary duplication.

Pharmaceutical composition

The present invention also provides a pharmaceutical composition comprising the miR-96 inhibitor as described above and a pharmaceutically acceptable carrier.

In the composition of the present invention, the content of the miR-96 inhibitor as described above as an active ingredient may vary within a wide range, and may be, for example, 0.01 to 99%, preferably 1 to 70%. More preferably, it may be 5-30%.

According to the present invention, the pharmaceutical composition can be prepared into various dosage forms conventional in the art, and the present invention is not particularly limited thereto, and for example, it can be formulated into a solid, semi-solid, liquid or gaseous form, for example, a tablet. , capsules, elixirs, suspensions, syrups, powders, granules, ointments, suppositories, injections, inhalants, aerosols, and the like, which are not enumerated herein.

Therefore, various forms of administration may be carried out depending on the pharmaceutical dosage form, such as, but not limited to, oral administration, buccal administration, rectal administration, parenteral administration, intraperitoneal administration, and respiratory administration. , intradermal administration, percutaneous administration medicine.

Wherein, the pharmaceutically acceptable carrier can be selected differently depending on the dosage form, which are well known to those skilled in the art. For example, without limitation, the pharmaceutically acceptable carrier can be starch, gum, lactose, glucose, sucrose, microcrystalline cellulose, kaolin, mannitol, dibasic calcium phosphate, sodium chloride, alginic acid, and the like.

In addition, conventional additives such as solubilizers, isotonic agents, suspending agents, emulsifying agents, stabilizers and preservatives may also be added.

Additionally, the pharmaceutically acceptable carrier may further comprise a targeting agent capable of enhancing targeting of the antisense oligonucleotide to a particular organ or tissue or cell, such as a targeting peptide, and may also These include transmembrane agents that are capable of carrying the antisense oligonucleotides more readily into target cells expressing miR-96, such as transmembrane peptides, liposomes, microvesicles, and membrane lipoproteins.

According to the present invention, a flavoring agent such as peppermint, wintergreen oil or the like may be added to the pharmaceutical composition. In addition, coloring agents may also be added to the pharmaceutical composition to impart a certain degree of attractiveness to the prepared dosage form or to distinguish it from other products.

According to the present invention, the antisense oligonucleotide can also be combined with other conventional drugs capable of similar effects to prepare a combination pharmaceutical composition. For example, it can be combined with insulin to prepare a drug for effective treatment of diabetes.

Kit

The invention provides a kit, wherein the kit comprises an antisense oligonucleotide as described above, optionally, the kit further comprises an additional reagent, for example, pharmaceutically acceptable as described above Accepted carriers, flavoring and/or coloring agents, solubilizing agents, isotonic agents, suspending agents, emulsifying agents, stabilizers, preservatives, targeting agents or transmembrane agents.

According to the present invention, the additional reagent may be present in the kit in combination with the antisense oligonucleotide, or may be stored separately in the kit and mixed again when used.

The kit of the present invention may further include an instruction manual, and the form of the specification is not particularly limited, and may be, for example, a printed paper form, a CD form, or a web address. Get access to it via the internet.

application

The present invention provides the prevention of the function of miR-96, a marker for inhibiting hyperlipemia, fatty liver, obesity or diabetes. And/or for the treatment of at least one of the following diseases and/or conditions.

The diseases and/or symptoms include: hyperlipidemia, fatty liver, obesity, diabetes, and symptoms similar to those of these diseases.

In particular, the use comprises the preparation of a medicament and/or food for the prevention and/or treatment of any of the above diseases and/or symptoms. Wherein the food product comprises a health care product.

The invention also provides the use of a miR-96 inhibitor as described above, a pharmaceutical composition as described above, a kit as above and/or a method as described above for inhibiting the function of miR-96.

Further preferably, the use comprises preventing and/or treating any of the above diseases and/or symptoms.

Further, the present invention provides the use of the miR-96 inhibitor as described above, the pharmaceutical composition as described above, in the preparation of a medicament for reducing the amount of miR-96.

Preferably, the medicament comprises a medicament and/or a food for preventing and/or treating any of the above diseases and/or symptoms. Wherein the food product comprises a health care product.

According to the invention, the treatment refers to an improvement or complete disappearance of a subject's symptoms associated with a disease or condition caused by miR-96, wherein a broad sense of improvement refers to a reduction of at least one parameter. Specific to the present application, for example, it may be a reduction in body weight, a decrease in blood fat and/or blood sugar, an improvement in fatty liver, and the like.

The individual to be treated can be any individual, preferably a mammal, afflicted with the symptoms described above.

The administration form and composition of the drug can be referred to the above description, and the present invention will not be described in detail herein.

The invention will be described in detail below by way of examples. In the following embodiments,

miR-96 overexpression vector

The miR-96 gene (GGTACAAAGACCTCCTCTGCTCCTTCCCCAGAGGGCCTGTTCCAGTACCATCTGC TTGGCCGATTTTGGCACTAGCACATTTTGGCTTGTGTCTCTCCGCTGTGAGCAATCAT GTGTAGTGCCAATATGGGAAAAGCGGGCTGCTGC GGCCACGTTCACCTCCCCCGGCATCC ) shown in SEQ ID No: 3 was cloned into the pCAG-GFP vector to obtain the overexpression plasmid pCAG-miR-96-GFP of the miR-96 gene. Among them, the synthesis and cloning of the miR-96 gene shown by SEQ ID No: 3 was carried out by Kingsray.

miR-96 sensor vector (miR-96 sensor vector)

The miR-96 receptor vector is a fire luciferase gene 3 cloned into the pGL3-SV40 vector by binding a confirmed miR-96 binding and regulatory target sequence (AAAGAAACCATCAAGTTGTGCCAAA) as shown in SEQ ID No:11. 'The downstream xbaI site was obtained, so that the expression of fire luciferase in the miR-96 receptor vector was regulated by miR-96.

Example 1

This example is used to illustrate the difference in miR-96 expression in 2 month old and 12 month old mice.

(1) Extraction and reverse transcription of total RNA

Wild type C57/Bl6 male mice, 2 months old and 12 months old, were sacrificed after cervical dislocation, 500 μl of blood was taken, and the entire hypothalamus and half stomach were dissected, and 200 mg of liver, muscle and epididymis were taken. Adipose tissue. Add 1 ml of Trizol reagent (invitrogen) to the blood and mix. Add 200 μl of Trizol reagent to the hypothalamus, stomach, liver, muscle and adipose tissue, then cut the hypothalamus, stomach, liver, muscle and adipose tissue with scissors, and then grind these tissues into pieces with an electric homogenizer. Then, the total RNA in one tissue was extracted according to the instructions of Trizol. The RNA was solubilized with nuclease-free water, and then the ratio of 260 to 280 of the RNA was determined using a Nanodrop 2000 instrument, and samples with a ratio greater than 1.8 were continued for subsequent experiments. After the concentration of RNA was determined by Qubit, the integrity of the RNA was detected using a bioanalyzer, and the RNA integrity index RIN was greater than 0.9. Among them, in order to ensure that each tissue or organ can perform subsequent experiments, multiple replicates can be set for total RNA extraction.

1 μg of total RNA was taken from each sample, and 10-40 nt of short RNA in total RNA was isolated using a flashPAGE sieving apparatus (Ambion), and then a microRNA cDNA library was prepared by reverse transcription using an Illumina kit, and then in a second The expression level of microRNA in the sample was determined on a generation sequencer. The results showed that the expression of miR-96 in the hypothalamus, stomach and liver of the 12-month-old mice was higher than that in the 2-month-old mice, indicating that the expression level of miR-96 increased with age in the hypothalamus. Increased in the stomach and liver, positively correlated with weight gain and obesity.

(2) Quantitative PCR to detect the expression of miR-96

To confirm that the expression level of miR-96 in the hypothalamus, stomach and liver increased with age, the expression level of miR-96 was detected by quantitative PCR. Take [mu] g of total RNA from each sample, miRNA & mRNA RT-PCR kit (Pengekiphen, Kunshan) trans micro RNA and mRNA transcribed cDNA with a Catch All ^TM. The primers used for detection were: miR-96 forward primer (5'-TTTGGCACTAGCACATTTTTGCT-3') as shown in SEQ ID No: 12; U6 forward primer as shown in SEQ ID No: 13 (5'-CGCAAGGATGACACGCAAATTCG) -3'); The reverse primer is a universal primer provided for the kit. The instrument to be tested was Bio-Rad's iQ5 system and the reagent was TaKaRa's SYBR Green Mix. Three replicate wells were simultaneously detected for each sample, and U6 was used as an internal reference to calculate the expression level of miR-96 in each sample by the 2- ^ΔΔct method. The expression level of miR-96 in each organ of 2 month old mice was then set to 1, and the relative expression level of miR-96 in 12-month-old mice was calculated. The results are shown in Fig. 1.

As shown in Figure 1, the expression level of miR-96 in the hypothalamic-gastric central axis of the appetite was significantly up-regulated in 12-month-old mice, and the expression of miR-96 in the liver was also significantly up-regulated. Quantitative PCR confirmed that the expression levels of miR-96 in the hypothalamus, stomach and liver of the 12-month-old mice were 1.5, 1.7 and 2.4 times higher than those in the 2-month-old mice, respectively. It can be shown that the upregulation of miR-96 is associated with obesity and fatty liver formation. Among them, in Fig. 1, **P<0.01, *p<0.05.

Example 2

This example is to illustrate the in vitro regulation of antisense oligonucleotides on miR-96

Human embryonic kidney cells HEK-293T were cultured in DMEM medium containing 10% fetal bovine serum. The cell culture incubator was constantly maintained at 37 ° C and 5% CO ₂ . HEK-293T cells were seeded in a 24-well cell culture plate at a seeding rate of 100,000 cells per well at a culture volume of 500 μl. The following day, the settings of Table 2 below were co-transfected into KEK-293 cells using liposome 2000 (Invitrogen) according to the instructions, and expression from the miR-96 receptor vector was measured 36 hours later using a dual luciferase analyzer (Promega). The luciferase activity. Three replicate wells were set each time and the experiment was repeated three times.

Among them, the transfer amount of miR-96 receptor vector in each group was 500 ng for miR-96 receptor vector, 20 ng for pCAG-GFP blank vector, 500 ng for miR-96 overexpression vector, and 50 μM for oligonucleotide. The solution. Further, when the transferred oligonucleotide was miR-96 ASO, 0.5 μl and 1 μl of a 50 μM oligonucleotide solution were respectively added, and the final concentrations were 0.0417 μM and 0.0833 μM, respectively, after being added to the cell culture solution. To determine the activity of luciferase, and to use it as the ordinate, the concentration of miR-96 ASO is plotted on the abscissa. The results are shown in Figure 2.

As can be seen from Figure 2, miR-96 ASO inhibits the function of miR-96.

As can be seen from Fig. 2A, the miR-96 receptor vector, miR-96 overexpression vector and different concentrations of miR-96 ASO were co-transfected, and the luciferase activity assay showed that miR-96 ASO could inhibit the function of miR-96. And there is a dose effect.

As can be seen from Figure 2B, overexpression of miR-96 inhibits the expression of miR-96 receptor vector (left 1 column and left 2 column); miR-96 ASO and miR-96 mismatch ASO can inhibit miR-96 function ( Left 3 column and left 5 column), miR-96 The inhibitory effect of ASO was better than that of miR-96 mismatched ASO, while the random control nucleotide did not inhibit the function of miR-96 (left 4 column), Data = mean ± SEM; N = 3; *** P < 0.001, **P < 0.01. Furthermore, overexpression of miR-96 in HEK293 cells inhibited the expression level of the reporter luciferase in the miR-9 receptor vector to 47% of the control level, while co-transforming the final concentration of 0.0833 μM of miR-96 ASO The expression of the reporter gene luciferase in the miR-96 receptor vector was restored to 76% of the control level, that is, miR-96 ASO was able to inhibit 54% of miR-96 function.

Table 2

Example 3

This example is to illustrate the role of miR-96 antisense oligonucleotides in regulating miR-96 target genes and their subsequent effects on energy metabolism in vivo.

Eight wild-type C57/Bl6 male mice (Beijing Weitonglihua Experimental Animal Technology Co., Ltd.) with 12-week-old body weight difference of less than 10% were randomly divided into two groups, after feeding for two weeks (feeding 20% high) Fat feed), the experimental group was injected with 3.5 OD/100 μl of miR-96 ASO (dissolved in PBS) in the tail vein, and the control group was injected with 100 μl of solvent PBS. Inject every three days in the first week and then every two weeks. Weigh the body weight of the mice every week, and change the body weight The rate of growth and weight gain are shown in Figures 3A and 3B, respectively.

Fasting blood glucose was measured in mice two and a half months after the start of the injection. At 9 o'clock in the morning, take the mouse's feed away, after 6 hours of starvation, cut a drop of blood, then measure the blood sugar concentration with Roche's excellent blood glucose meter (model ACCU-CHEK Performa) and excellent Jinrui blood glucose test strip, see Figure 3C.

Three months after the start of the injection, the mice were anesthetized, blood was taken from the right atrium, and the weight of the epididymal fat, stomach, liver, and kidney was dissected and weighed. The results are shown in Figure 4A, and the relative body weight ratio is shown in Figure 4B. Figure 4C. Serum was taken after centrifugation at 5000 rpm for 15 minutes, and serum total cholesterol (CHOL), triglyceride (TG), high density lipoprotein (HDL) and low density lipoprotein (LDL) were measured using a fully automated biochemical analyzer (Hitachi 7180). The content is shown in Figure 4D.

As can be seen from Figure 3, intravenous injection of miR-96 antisense oligonucleotide (miR-96 ASO) reduced the body weight (A) and body weight growth rate (B) compared to the control group. It can reduce hyperglycemia (C) induced by high-fat foods, and the reduction rate is 19%. Data = mean ± SD; N = 4; * P < 0.05.

As can be seen from Figure 4, intravenous injection of miR-96 ASO reduced liver and epididymal fat and stomach weight (Fig. 4A) and epididymal fat and stomach weight to body weight ratio (Fig. 4B); miR -96 ASO has a tendency to reduce liver specific gravity but has no effect on kidney weight (Fig. 4C). miR-96 ASO also reduces triglyceride levels in the blood and increases the concentration of high-density lipoprotein. However, it has no effect on total cholesterol and low density lipoprotein (Fig. 4D). Data = mean ± SD; N = 4; * P < 0.05; ** P < 0.01.

The total RNA of the hypothalamus and stomach of the control and miR-96 ASO-injected mice was extracted according to the method of Example 1, and sequenced and analyzed by the second generation: the miR-96 ASO injection group was up-regulated compared with the control group. Many genes in the MAPK signaling pathway, Wnt signaling pathway, and Hedgehog signaling pathway that inhibit adipocyte differentiation and proliferation, and increase many genes in the insulin signaling pathway and diabetes signaling pathway, as well as in the Jak-STAT signaling pathway regulating appetite Many genes; additionally regulate some of the genes in the signaling pathways regulated by sugar, lipid, and glycolipid metabolism (Table 3).

table 3

In summary, inhibition of miR-96 function can reduce weight gain. The best way to treat severe obesity and diabetes is to perform gastric bypass surgery, which means that the gastrointestinal tract is an important target organ for the treatment of obesity and diabetes. The application demonstrates that inhibition of miR-96 function reduces the weight of stomach and abdominal fat and their ratio to body weight, thus demonstrating that miR-96 is an important target for the treatment of obesity.

Inhibition of miR-96 function can reduce hyperglycemia, thus demonstrating that miR-96 is an important target for the treatment of diabetes.

High levels of triglycerides are known to cause cardiovascular disease, and the concentration of high-density lipoprotein and the risk of cardiovascular disease are Negative correlation. These data indicate that inhibition of miR-96 function can both reduce hyperlipidemia and increase high-density lipoprotein to reduce the risk of cardiovascular disease caused by hyperlipidemia. In addition, as described above, the inhibition of miR-96 function can be reduced. The increase in liver weight induced by high-fat foods suggests that miR-96 is an important target for the treatment of hyperlipidemia and fatty liver.

Moreover, the molecular experiments of the present invention demonstrate that miR-96 regulates many genes in the appetite, energy metabolism, fat metabolism and adipocyte differentiation signaling pathways in vivo, which clarifies that miR-96 antisense nucleotides can lower blood fat and lower blood lipids. The molecular mechanism of blood sugar and inhibition of body weight and accumulation of abdominal fat.

Example 4

This example is used to demonstrate the in vitro regulation of small interfering RNA (siRNA) on miR-96

Human embryonic kidney cells HEK-293T were cultured in DMEM medium containing 10% fetal bovine serum. The cell culture incubator was kept at 37 ° C and 5% CO ₂ at a constant volume of 500 μl. The next day, miR-96 siRNA (antisense strand SEQ ID No: 7: 5'CUCAGAGCGGAGAGACACAAG'3, sense strand SEQ ID No: 8: 5'CUUGUGUCUCUCCGCUCUGAG'3, Shanghai Ji with liposome 2000 (Invitrogen) according to the instructions Ma synthesis, wherein the structure has dTdT at the 3' end of SEQ ID No: 7 and SEQ ID No: 8) and a random control RNA (antisense strand SEQ ID No: 9: 5'CGUGACACGUUCGGAGAA'3; sense strand SEQ ID No: 10:5'UUCUCCGAACGUGUCACGU'3, Shanghai Gemma synthesis in which the structure of dTdT is present at the 3' end of SEQ ID No: 9 and SEQ ID No: 10, respectively, and transfected into KEK-293, respectively. After 36 hours, the cells were lysed with Trizol and total RNA was extracted, and then the expression amount of miR-96 was detected using the same quantitative PCR kit and primers as in Example 1. Three replicate wells were set each time and the experiment was repeated three times. The results are shown in Figure 5, ***P < 0.01.

The results showed that miR-96 siRNA could down-regulate the expression of miR-96 by 70%, and thus the amount of miR-96 bound to the target gene of miR-96 was also down-regulated by 70%, thereby increasing the expression level of the target gene. . It can be seen that the function of miR-96 can also be successfully inhibited by RNA interference with the miR-96 precursor.

Example 5

This example is intended to illustrate the antisense oligonucleotide of thio-modified miR-96 orally (thio-miR-96 ASO: A _S G _S CAAAAATGTGCTAGTGCCA _S A _S A, modified site: labeled with "s" Substituting an oxygen atom in the phosphate in the base of the subscript with sulfur can reduce the weight gain, liver weight, blood lipids, blood sugar and fatty liver formation induced by high fat diet.

30 8-10 week old SPF grade C57BL/6 mice (Beijing Weitong Lihua Experimental Animal Co., Ltd.), randomly selected from them Ten were selected and fed normal feed (Beijing Keao Xieli Feed Co., Ltd.), and the remaining 20 were fed 60% kal high fat feed (Beijing Huakang Biotechnology Co., Ltd.). After two weeks of feeding, the mice were weighed once a week. Two weeks later, the mouse body weight growth rate was calculated. Four of the 20 high-fat diet-fed mice had the slowest weight gain or 4 of which were deviated from the population. The remaining 16 rats were divided into 2 groups according to their weight growth rate and body weight, with 8 rats in each group.

After grouping, the first two weeks, oral oral administration twice a week (Tuesday and Friday); from the third week, oral oral administration once a week (Tuesday) for 12 consecutive weeks. A total of 14 weeks of administration. The normal feed control group and the high-fat diet control group were intragastrically administered with normal saline; the negative control group was intragastrically administered with 16 mg/kg of thio-modified random nucleotide (SEQ ID No: 14: A _S A _S TCGACATATCAACGAACGAA _S C _S The modification site: one of the phosphates in the base labeled with the "s" subscript is replaced by sulfur), and the PJ150021 group is administered orally with 16 mg/kg of thio-miR-96 ASO.

(1) Effect of thio-miR-96 ASO on blood glucose

After 14 weeks of administration, the fasting blood glucose of the mice was measured. Before taking blood, the animals were fasted overnight, and the tail tip was taken for blood.

The UltraEasy ^{TM is} designed to measure the blood glucose meter and supporting test strips. High-fat diet significantly induced an increase in blood glucose. Compared with the negative control group, the PJ150021 gavage group significantly reduced hyperglycemia induced by high-fat diet, as shown in Figure 6. Data = mean ± SD; ** P < 0.01, *** P < 0.001.

(2) Effect of thio-miR-96 ASO on body weight growth rate and liver weight

Before the animals were euthanized, the animals were weighed and recorded after fasting, and the organs were weighed. The PJ150021 gavage group significantly reduced the high body weight growth rate induced by high fat diet, as shown in Figure 7A. Compared with the negative control group, PJ150021 can reduce liver weight and liver coefficient, as shown in Figure 7B-C. Data = mean ± SD; * P < 0.05, ** P < 0.01, *** P < 0.001.

(3) Effect of thio-miR-96 ASO on blood cholesterol, triglyceride, high-density lipoprotein and low-density lipoprotein

Approximately 0.2-0.3 mL of blood was taken from the abdominal aorta for detection of blood biochemical indicators of TBA-120FR automatic biochemical analyzer, and total cholesterol (CHOL), triglyceride (TG), high density lipoprotein (HDL), and low were detected. Density lipoprotein (LDL). High-fat diet can significantly increase the concentration of cholesterol, triglycerides, high-density lipoprotein and low-density lipoprotein in the blood. Compared with the negative control group, the PJ150021 gavage group significantly reduced the concentration of cholesterol, triglyceride, high-density lipoprotein and low-density lipoprotein induced by high-fat diet, as shown in Figures 8A-D. Data = mean ± SD; * P < 0.05, ** P < 0.01, *** P < 0.001.

(4) Effect of thio-miR-96 ASO on fatty liver formation

Part of the liver of the mice was fixed with 10% neutral buffered formalin solution, embedded in paraffin, sectioned, HE stained, and photographed with a 20X microscope. High fat diet can induce fatty liver formation in mice. Compared with the negative control group, PJ150021 The gavage group can effectively prevent the formation of fatty liver induced by high fat diet, as shown in Figure 9.

to sum up

The present invention can sufficiently inhibit miR-96 in a target cell expressing miR-96 by contacting a miR-96 inhibitor (including an antisense oligonucleotide and an interfering RNA) with a target cell expressing miR-96 in vivo or in vitro. Function (antisense oligonucleotide inhibits the binding of miR-96 to its target gene, interfering RNA can reduce the expression of miR-96, thereby inhibiting the function of miR-96), and can be effective when used for individual administration. The disease caused by an increase in the amount of miR-96 is prevented and/or treated, for example, hyperlipidemia, fatty liver, obesity, and/or diabetes. Compared with the traditional single hypoglycemic or single hypolipidemic or single weight loss drugs, the present invention provides a comprehensive treatment for appetite, glycolipid metabolism and adipocyte differentiation, and thus has powerful effects and small side effects. It provides a new direction for the treatment of diseases such as obesity, diabetes, fatty liver and hyperlipidemia, and thus has extremely high social and economic benefits.

The preferred embodiments of the present invention have been described in detail above, but the present invention is not limited to the specific details of the above embodiments, and various simple modifications can be made to the technical solutions of the present invention within the scope of the technical idea of the present invention. These simple variants All fall within the scope of protection of the present invention.

It should be further noted that the specific technical features described in the above specific embodiments may be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, the present invention will not be further described in various possible combinations.

In addition, any combination of various embodiments of the invention may be made as long as it does not deviate from the idea of the invention, and it should be regarded as the disclosure of the invention.

references

1. Buhmann, H., C. W. le Roux, and M. Bueter, The gut-brain axis in obesity. Best Pract Res Clin Gastroenterol, 2014. 28(4): p. 559-71.

2. Wang, P.Y., et al., Upper intestinal lipids trigger a gut-brain-liver axis to regulate glucose production. Nature, 2008. 452 (7190): p. 1012-6.

3.Beraza, N. and C. Trautwein, The gut-brain-liver axis: a new option to treat obesity and diabetes? Hepatology, 2008.48(3): p.1011-3.

4. Schneeberger, M., et al., Hypothalamic miRNAs: emerging roles in energy balance control. Front Neurosci, 2015. 9: p.

5. Yan Dapeng, Zhan Lixing. Research progress in adipocyte differentiation and its regulation. Chinese Journal of Cell Biology 2010, 32(5): 690-695.

Claims

The use of the marker miR-96, a marker of hyperlipemia, fatty liver, obesity or diabetes, for the prevention and/or treatment of hyperlipemia, fatty liver, obesity, diabetes and symptoms similar to those of these diseases, especially in the preparation Use in medicines and/or foods for preventing and/or treating hyperlipemia, fatty liver, obesity, diabetes, and symptoms similar to the symptoms of these diseases.
The use according to claim 1, wherein miR-96 has the nucleotide sequence shown in SEQ ID No: 1.
A method for inhibiting the function of miR-96, a marker of hyperlipemia, fatty liver, obesity or diabetes, characterized in that the method comprises: targeting a miR-96 inhibitor with a target cell expressing miR-96 expressing miR-96 contact.
The method according to claim 3, wherein the miR-96 inhibitor is an antisense oligonucleotide comprising antisense DNA and antisense RNA, the antisense oligonucleotide being complementary to miR-96, and a sequence having a length of 8-23 nucleotides and having a nucleotide complementary to nucleotides 2-8 of miR-96;

Preferably, the antisense oligonucleotide has the following nucleotide sequence:

a) the nucleotide sequence shown in SEQ ID No: 4;

b) a nucleotide sequence which is deleted, substituted or added with one or several nucleotides and is complementary to miR-96 in the nucleotide sequence shown in SEQ ID No: 4; preferably, in SEQ ID No: 4 a nucleotide sequence of the indicated nucleotide sequence which is deleted, substituted or added with one or several nucleotides and which is at least 60% complementary to miR-96; more preferably, with position 2-8 of miR-96 A nucleotide sequence having at most 3 nucleotides mismatched nucleotides; most preferably, the nucleotide sequence shown in SEQ ID No: 5.
The method of claim 4, wherein the miR-96 inhibitor is a modified antisense oligonucleotide;

Preferably, the modification comprises: at least one of a 5'-O-1-thiotriphosphate modification, a locked nucleic acid, and a 2'-O-methyl modification;

More preferably, the miR-96 inhibitor is the nucleotide sequence shown in SEQ ID No: 4, and the nucleotide sequence shown by SEQ ID No: 4 has 1-5 bases at both ends thereof. 5'-O-1-thiotriphosphate modification.
The method according to claim 3, wherein the miR-96 inhibitor is a small interfering RNA of a miR-96 precursor;

Preferably, the miR-96 precursor has the sequence set forth in SEQ ID No: 2;

Preferably, the small interfering RNA of the miR-96 precursor is 15-30 bp in length;

Preferably, the small interfering RNA of the miR-96 precursor has an antisense strand as set forth in SEQ ID No: 7 and a sense strand as set forth in SEQ ID No: 8.
A miR-96 inhibitor, characterized in that the miR-96 inhibitor is the antisense oligonucleotide of claim 4 or 5 and/or the miR-96 precursor of claim 6. Interfering with RNA.
A pharmaceutical composition comprising the miR-96 inhibitor of claim 7 and a pharmaceutically acceptable carrier.
A kit, comprising the miR-96 inhibitor of claim 7, optionally further comprising a pharmaceutically acceptable carrier.
The method according to any one of claims 3 to 6, the miR-96 inhibitor according to claim 7, the pharmaceutical composition according to claim 8 and/or the kit according to claim 9 inhibiting miR- Application in the function of 96; in particular in the prevention and/or treatment of hyperlipemia, fatty liver, obesity, diabetes and symptoms similar to those of these diseases.
Use of the miR-96 inhibitor according to claim 7 or the pharmaceutical composition according to claim 8 for the preparation of a medicament for inhibiting the function of miR-96; in particular for the preparation of a medicament for preventing and/or treating hyperlipemia The use of drugs for fatty liver, obesity, diabetes, and symptoms similar to the symptoms of these diseases.