WO2018110814A1 - SS18-SSX 융합 유전자 특이적 siRNA 및 이를 포함하는 암 예방 또는 치료용 약학적 조성물 - Google Patents

SS18-SSX 융합 유전자 특이적 siRNA 및 이를 포함하는 암 예방 또는 치료용 약학적 조성물 Download PDF

Info

Publication number
WO2018110814A1
WO2018110814A1 PCT/KR2017/010991 KR2017010991W WO2018110814A1 WO 2018110814 A1 WO2018110814 A1 WO 2018110814A1 KR 2017010991 W KR2017010991 W KR 2017010991W WO 2018110814 A1 WO2018110814 A1 WO 2018110814A1
Authority
WO
WIPO (PCT)
Prior art keywords
sirna
seq
fusion gene
ssx
nucleic acid
Prior art date
Application number
PCT/KR2017/010991
Other languages
English (en)
French (fr)
Inventor
최윤라
신영기
이미숙
Original Assignee
사회복지법인 삼성생명공익재단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 사회복지법인 삼성생명공익재단 filed Critical 사회복지법인 삼성생명공익재단
Publication of WO2018110814A1 publication Critical patent/WO2018110814A1/ko

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering N.A.

Definitions

  • the present invention relates to siRNA that specifically binds to the SS18-SSX fusion gene, and a pharmaceutical composition for preventing or treating cancer comprising the same.
  • RNA interfering RNA interfering
  • aptamers aptamers
  • ribozymes antisense oligonucleotides
  • Gene therapy refers to medicines that directly insert functional genes and DNA fragments, RNA interfering (RNAi), aptamers, ribozymes, antisense oligonucleotides, and the like into cells to treat diseases.
  • RISC RNA-induced silencing complex
  • RISC RNA-induced silencing complex
  • RNAi technology is estimated to be worth $ 4 billion annually.
  • more than 20 clinical trial phases related to RNAi therapeutics are all in the early phases of Phase 1 and Phase 2, siRNA therapeutics are under development.
  • Patent expiration is a factor in the mid / long-term growth of the pharmaceutical industry, along with the recent decline in R & D productivity of large pharmaceutical companies.
  • the clinical success rate in the pipeline including preclinical is only about 0.25%, and the clinical success rate is expected to be lowered in the future due to the stricter clinical approval criteria and the regulation of transparency and information disclosure.
  • the rate of clinical failures in phases 2 and 3 which have the greatest impact on cost and productivity, is steeply rising.
  • GIA data the market for gene therapy products is expected to reach USD 790 million in 2017, as the demand for new and effective treatment methods in the anticancer drug market grows.
  • the biggest growth driver in the gene therapy market is anticancer drugs, and as the demand for more effective and fewer side effects increases, gene therapy is expected to replace some of the traditional radiotherapy and compound therapies. Is being developed as an anticancer drug.
  • Antisense drugs are being developed as the next generation gene therapy products.
  • Antisense RNAi (siRNA) drugs are expected to form a market of 12 trillion won by 2020.
  • synovial sarcoma accounts for about 10% of malignant soft tissue tumors and is known to occur before the 20s and 30s. The pathophysiology and prognostic factors are not well known, and chemotherapy or radiation therapy is useful in addition to surgical resection. It is an unestablished tumor. Cytogenetic studies have shown that the SS18 (also known as SYT) gene on chromosome 18 and SSX1 on X chromosome due to t (x; 18) (p11; q11) chromosomal translocation in synovial sarcoma patients It has been found that the SSX family member 2 (SSX2) gene is fused and combined into a new SS18-SSX1 or SS18-SSX2 gene.
  • SYT SS18 gene on chromosome 18 and SSX1 on X chromosome due to t (x; 18) (p11; q11) chromosomal translocation in synovial sarcoma patients
  • the fusion gene thus produced is generally observed in about 90% or more of synovial sarcoma patients, and the function of the SS18-SSX fusion gene is not known precisely, but the SS18-SSX fusion gene causes the synovial sarcoma in mesenchymal stem cells. It is known to be.
  • siRNA therapeutics targeting intractable cancer-specific fusion genes it is possible to develop therapeutics for various diseases with relatively short development period and low cost due to the characteristics of gene-based therapeutics. It is very large, and research investment is being made competitively in developed countries. Therefore, there is an increasing demand for the development of personalized medicine and the development of fusion gene specific siRNA therapeutics for increasing survival of patients with intractable cancer.
  • the present inventors conducted a study on siRNAs that specifically act on the SS18-SSX fusion gene, and confirmed that the siRNA specific to the SS18-SSX fusion gene was designed and the siRNA was effective in preventing or treating cancer. By this, the present invention was completed.
  • siRNA small interfering RNA
  • Another object of the present invention is to provide a pharmaceutical composition for preventing or treating cancer, comprising a siRNA comprising a sense sequence represented by SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3 and an antisense sequence thereof To provide.
  • siRNA complex comprising a siRNA comprising a sense sequence represented by SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3 and an antisense sequence thereof and a nucleic acid carrier.
  • the present invention provides a small interfering RNA (siRNA) comprising a sense sequence represented by SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3 and its antisense sequence.
  • siRNA small interfering RNA
  • the present invention also provides a pharmaceutical composition for preventing or treating cancer, comprising an siRNA comprising a sense sequence represented by SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3, and an antisense sequence thereof. .
  • the present invention also provides an siRNA complex comprising a siRNA comprising a sense sequence represented by SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3 and an antisense sequence thereof and a nucleic acid carrier.
  • SS18-SSX fusion gene-specific siRNA of the present invention has a high specificity for the SS18-SSX fusion gene and has an excellent effect of inhibiting the expression of the fusion gene in an individual having the SS18-SSX fusion gene, proliferation of cancer cells Because of its inhibitory effect, it can be usefully used for the prevention or treatment of cancer.
  • 1 is a diagram showing the results confirmed by RT-PCR and Sanger sequencing specifically generated in 259T patients.
  • Figure 2 is a diagram showing the results of comparing the breakpoints of the SS18-SSX2 fusion gene confirmed in 259T patients and SS18-SSX1 fusion gene identified in HS-SY-II cell line.
  • FIG. 3 is a diagram showing the results of confirming the change in SS18-SSX fusion gene expression by qRT-PCR after transfecting 16 designed siRNAs into the synovial sarcoma cell line (HS-SY-II).
  • Figure 4 shows the changes in SS18-SSX fusion gene expression after transfection of three selected siRNAs (siRNA 3, siRNA 6, siRNA 11) into the synovial sarcoma cell line (HS-SY-II) and Ewing's sarcoma cell line (A673).
  • siRNA 3, siRNA 6, siRNA 11 selected siRNAs
  • H-SY-II synovial sarcoma cell line
  • A673 Ewing's sarcoma cell line
  • siRNA 3 siRNA 6, siRNA 11
  • HSA-SY-II synovial sarcoma cell line
  • the present invention provides a small interfering RNA (siRNA) comprising a sense sequence represented by SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3 and an antisense sequence thereof.
  • siRNA small interfering RNA
  • antisense sequence is a generic term for RNA having a base sequence complementary to the nucleic acid sequence of the sense strand.
  • the antisense sequence of the sequence represented by SEQ ID NO: 1 is CTTCTTGGGCATGATCTGG
  • the antisense sequence of the sequence represented by SEQ ID NO: 2 is CTTGGGCATGATCTGGTCA
  • the antisense sequence of the sequence represented by SEQ ID NO: 3 is GCATGATCTGGTCATATCC.
  • the siRNA may include or consist of a sense sequence represented by SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3, and an antisense sequence complementary to the sense sequence. It may be in the form.
  • the siRNA can specifically inhibit the nBAF chromatin remodeling complex subunit (SS18) -SSX family member (SSX) fusion gene to inhibit cancer cell proliferation by inhibiting the expression of the fusion gene in individuals with the SS18-SSX fusion gene. have.
  • SS18 nBAF chromatin remodeling complex subunit
  • SSX family member
  • fusion gene refers to a gene in which two genes are reconstituted into one gene and perform a new function.
  • the term “fusion gene” is generated while the portions of chromosomes differ greatly depending on the formation mechanism. When a part of the same chromosome is generated by a position shift, the genes in the same or different chromosomes are classified into cases in which the two transcripts are generated by fusion.
  • Gene fused in the present invention is preferably SS18 gene and SSX gene, may be referred to as “SS18-SSX” or “SS18-SSX fusion gene", the SSX gene may comprise SSX1 or SSX2.
  • RNA small interfering RNA
  • Dicer enzyme specific for mRNA having a complementary sequence Can be used to inhibit the expression of the protein and mRNA.
  • the siRNA of the present invention binds to a fusion gene in which the SS18 gene and the SSX gene are fused, specificity for the SS18-SSX fusion gene is high. Therefore, the RNA interference efficiency is increased by specifically binding to the breakpoint in which the SS18 gene and the SSX gene are fused to target siRNA, and thus, the expression of the fusion gene mRNA or protein thereof is excellent in the individual having the SS18-SSX fusion gene. There is this.
  • the siRNA of the present invention is a concept including both the ribonucleic acid sequence itself or the form of a recombinant vector (expression vector) expressing the same.
  • the expression vector may be a viral vector selected from the group consisting of plasmid or adeno-associated virus, retrovirus, vaccinia virus, oncolytic adenovirus, and the like.
  • SS18-SSX fusion gene expression inhibition effect by the treatment of the siRNA is confirmed by measuring the change of mRNA or protein level by quantitative PCR (qPCR), RT-PCR, bDNA (branched DNA) assay, Western blot, ELISA, etc. Can be.
  • siRNA may have a ribonucleic acid unit structure present in nature without modification, or may be chemically modified. Chemical modification of these siRNAs is intended to enhance stability in vivo, impart nucleic acid enzyme resistance, and reduce nonspecific immune responses.
  • RNAi capacity does not affect RNAi capacity, but enhances resistance to nucleases, increases intracellular uptake, improves cell targeting, increases stability, decreases interferon activity, immune response and sense
  • Various properties of the siRNA can be improved over unmodified siRNA, including reduced off-target effects such as).
  • the method for chemical modification of such siRNA is not particularly limited, and those skilled in the art can synthesize and modify the siRNA in a desired manner using methods known in the art.
  • the —OH group at the 2 ′ carbon position of the sugar structure in the nucleotide may be —CH 3 (methyl), —OCH 3 (methoxy), —NH 2, —F (fluorine), —O-2-methoxyethyl —O-propyl To -O-2-methylthioethyl, -O-3-aminopropyl, -O-3-dimethylaminopropyl, -ON-methylacetamido or -O-dimethylamidooxyethyl By deformation; Modification in which oxygen in a sugar structure in nucleotides is replaced with sulfur; Or one or more modifications selected from modifications of nucleotide bonds to phosphorothioate or boranophosphate, methyl phosphonate bonds, and may be used in combination,
  • Nuclease nucleic acid of the nuclease through the method of replacing the phosphodiester bonds of the siRNA sense and antisense strands with phosphorothioate or boranophosphate bonds during the chemical modification It can increase the resistance to decomposition.
  • the 3'-terminal phosphodiester bonds of both siRNA sense and antisense strands can be changed to phosphorothioate bonds.
  • Ethylene bridge nucleic acid (ENA), peptide nucleic acid (PNA), locked nucleic acid (LNA), or UNA (unlocked) at the 5 'end, 3' end, or both ends of the siRNA sense or antisense strand during the chemical modification.
  • Nuclear acid may be used to increase siRNA stability and reduce immune response and nonspecific inhibitory effects without affecting RNAi capacity.
  • the minimum modification is made so as not to stabilize the siRNA double-stranded structure and reduce gene expression inhibitory activity.
  • the present invention also provides a pharmaceutical composition for preventing or treating cancer, comprising a sense sequence represented by SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3, and an antisense sequence thereof.
  • the siRNA inhibits the proliferation of cancer cells, it is characterized in that it exhibits a cancer prevention or treatment effect.
  • the cancer is characterized in that the expression of the SS18-SSX fusion gene, siRNA of the present invention can suppress the expression of the fusion gene in an individual showing the SS18-SSX fusion gene.
  • the cancer may be SS18-SSX fusion gene positive cancer.
  • compositions of the present invention may include, without limitation, SS18-SSX fusion gene positive cancers, preferably synovial sarcomas.
  • composition of the present invention may further comprise a nucleic acid carrier.
  • the present invention also provides a method of treating cancer, comprising treating a subject with a composition comprising a sense sequence represented by SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3, and an antisense sequence thereof. do.
  • the subject means all organism-derived subjects, and may preferably be an animal including a human.
  • the animal is a biological group corresponding to a plant, and mainly eats organic matter as nutrients, and means that digestion, excretion, and respiratory organs are differentiated, and preferably, vertebrates, more preferably mammals.
  • the mammal may be human, primate, rodent, or the like.
  • the present invention also provides an siRNA complex comprising a siRNA comprising a sense sequence represented by SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3 and an antisense sequence thereof and a nucleic acid carrier.
  • nucleic acid delivery system is to increase the delivery efficiency to the body, as well as excellent stability in the body has the advantage of a simple manufacturing process as a drug.
  • the nucleic acid carriers may include, but are not limited to, viral vectors, non-viral vectors, liposomes, cationic polymers, micelles, emulsions, solid lipid nanoparticles, and the like.
  • Viral vectors have the advantages of high delivery efficiency and long duration, retroviral vectors, adenovirus vectors, vaccinia virus vectors, adeno-associated viral vectors, and cancer cells. Soluble viral vectors and the like.
  • Nonviral vectors may include plasmids.
  • various formulations may be used, such as liposomes, cationic polymers, micelles, emulsions, solid lipid nanoparticles, and the like.
  • Cationic polymers for nucleic acid delivery include natural polymers such as chitosan, atelocollagen, cationic polypeptide, poly (L-lysin), linear or branched polyethylene imine (PEI), and cyclodextrin series. Synthetic polymers such as cyclodextrin-based polycation and dendrimer may be included.
  • siRNA When siRNA is included in the composition in the form of a complex with a nucleic acid carrier as described above, the siRNA is efficiently promoted to the target cell, and delivered to the target cell even at a relatively low concentration, thereby controlling high target gene expression. Can be represented. In addition, there is an advantage that can prevent the delivery of non-specific siRNA to other organs and cells other than the target.
  • compositions of the present invention may be mammals, preferably humans, monkeys, rodents (mouses, rats), and especially have a disease or condition associated with the expression of the SS18-SSX fusion gene, or SS18-SSX All may have a fusion gene and require inhibition of expression of the SS18-SSX fusion gene, such as a mammal, such as a human.
  • the concentration of siRNA, or use or treatment concentration, in the composition is: 0.001 to 1000 nM, preferably 0.01 to 100 nM, more preferably 0.1 to 10 nM, but is not limited thereto.
  • composition of the present invention may also include a chemically modified form of the siRNA represented by SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3, and additionally binds specifically to the SS18-SSX fusion gene other than the siRNA of the present invention.
  • siRNA may be additionally included in the composition of the present invention.
  • composition of the present invention may be prepared by including at least one pharmaceutically acceptable carrier in addition to the above-mentioned effective ingredient.
  • Pharmaceutically acceptable carriers must be compatible with the active ingredients of the present invention and include saline solution, sterile water, Ringer's solution, buffered saline solution, dextrose solution, maltodextrin solution, glycerol, ethanol and one or more of these ingredients. It can mix and use, and if needed, other conventional additives, such as antioxidant, buffer, and bacteriostatic agent, can be added.
  • diluents, dispersants, surfactants, binders and lubricants may be additionally added to formulate injectable formulations such as aqueous solutions, suspensions, emulsions and the like.
  • injectable formulations such as aqueous solutions, suspensions, emulsions and the like.
  • it may be preferably formulated according to each disease or component by a suitable method in the art or using a method disclosed in Remington's pharmaceutical Science, Mack Publishing Company, Easton PA.
  • composition of the present invention can be determined by a person of ordinary skill in the art based on the symptoms and severity of the disease of a typical patient. It may also be formulated in various forms, such as powders, tablets, capsules, solutions, injections, ointments, syrups, and the like, and may also be provided in unit-dose or multi-dose containers, such as sealed ampoules and bottles.
  • composition of the present invention can be administered orally or parenterally.
  • Routes of administration of the compositions according to the invention are not limited to, for example, oral, intravenous, intramuscular, intraarterial, intramedullary, intradural, intracardiac, transdermal, subcutaneous, intraperitoneal, intestinal, sublingual Or topical administration is possible.
  • the dosage of the composition according to the present invention may vary in the range depending on the weight, age, sex, health condition, diet, time of administration, method, excretion rate or severity of the disease, etc. of the patient, and is easily available to those skilled in the art. Can decide.
  • the compositions of the present invention can be formulated into suitable formulations using known techniques for clinical administration.
  • the siRNA of the present invention can be introduced into cells in vivo or ex vivo for the treatment of cancer.
  • the introduction of siRNA of the present invention inhibits the expression of the SS18-SSX fusion gene and inhibits the differentiation of cancer cells in cancer patients with the target SS18-SSX fusion gene, thereby killing the cancer cells and ultimately treating cancer. It becomes possible.
  • the anticancer effect can be maximized by simultaneously blocking several pathways in cancer.
  • SiRNA that specifically binds to the SS18-SSX fusion gene provided by the present invention not only inhibits the mRNA expression of the SS18-SSX fusion gene in individuals with the SS18-SSX fusion gene, but also significantly inhibits the expression of the protein. .
  • FIG. 1 the results of RT-PCR and Sanger sequencing performed on samples obtained from patients to search for fusion genes specifically occurring in LC13-259T patients are shown in FIG. 1.
  • Patient LC13-259T was diagnosed with lung cancer after percutaneous needle aspiration and biopsy (PCNA) and underwent video-assisted thoracoscopic surgery (VATS) RULobectomy surgery.
  • PCNA percutaneous needle aspiration and biopsy
  • VATS video-assisted thoracoscopic surgery
  • a 4 cm endobronchial mass was found in the upper right lobe of the patient. Refers to a patient identified as synovial sarcoma as a result of RT-PCR.
  • SYT-SSX1, SYT-SSX2, and beta-globin genes were identified in samples from patients with LC13-259T (lanes 1-3), and HS-SYII synovial sarcoma cell line (lane 5) and positive control (lane 5).
  • the SYT-SSX1 gene was identified in the A673 Ewing's sarcoma cell line. As shown in FIG. 1, it was confirmed that LC13-259T patients had synovial sarcoma with SS18-SSX2 fusion gene translocated at SYT exon 10 and SSX2 exon 6.
  • the fusion gene specifically occurring in the synovial sarcoma cell line HS-SY-II was identified, and the result confirmed that the SS18-SSX1 fusion gene occurred.
  • siRNA targeting SS18-SSX in the present invention can target both SS18-SSX1 and SS18-SSX2.
  • siRNAs that specifically act on the SS18-SSX breakpoint identified in Example 1.2
  • 16 siRNAs were prepared and screened as shown in Table 1 below.
  • siRNAs designed to screen siRNAs specific for the SS18-SSX fusion gene in the siRNAs of Table 1 was analyzed. Specifically, after transfection with siRNA into the synovial sarcoma cell line (HS-SY-II) having the SS18-SSX1 fusion gene using lipofectamine, it is confirmed whether the fusion gene is inhibited and the result is shown in FIG. 3. Shown in
  • siRNA of the present invention specifically acts on the SS18-SSX fusion gene.
  • siRNA 3, siRNA 6, siRNA 11 three siRNAs (siRNA 3, siRNA 6, siRNA 11) using lipofectamine in the HS-SY-II cell line having the SS18-SSX1 fusion gene were used.
  • the results of confirming the proliferation change of cells after transfection by WST are shown in FIG. 5.
  • siRNA 3 (# 3), siRNA 6 (# 6), and siRNA 11 (# 11) induce proliferation inhibition of the synovial sarcoma cell line.
  • the SS18-SSX specific siRNA of the present invention has an effect of inhibiting cancer cell proliferation by specifically acting on SS18-SSX present in cancer cells, it can be usefully used for the prevention or treatment of cancer.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • General Engineering & Computer Science (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Epidemiology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

본 발명은 SS18-SSX 융합 유전자에 특이적으로 결합하는 siRNA, 및 이를 포함하는 암 예방 또는 치료용 조성물에 관한 것이다. 본 발명의 SS18-SSX 융합 유전자 특이적 siRNA는 SS18-SSX 융합 유전자에 대한 특이성이 높고 이에 결합하여 SS18-SSX 융합 유전자를 갖는 개체에서 융합 유전자의 발현을 억제하는 우수한 효과가 있으며, 암 세포의 증식억제 작용을 나타내므로 암의 예방 또는 치료에 유용하게 사용할 수 있다.

Description

SS18-SSX 융합 유전자 특이적 siRNA 및 이를 포함하는 암 예방 또는 치료용 약학적 조성물
본 발명은 SS18-SSX 융합 유전자에 특이적으로 결합하는 siRNA, 및 이를 포함하는 암 예방 또는 치료용 약학적 조성물에 관한 것이다.
유전자치료제(Gene therapy)는 질환을 치료하기 위해 직접적으로 기능 유전자 및 DNA 단편, RNA 간섭(RNA interfering, RNAi), 앱타머, 리보자임, 안티센스 올리고뉴클레오티드 등을 세포로 삽입하는 의약품을 지칭한다. RNA 간섭 기술 중 하나인 siRNA(small interfering RNA)는 21-25nt 크기의 작은 RNA 조각으로, 일반적으로 세포 내에서 RISC(RNA-induced silencing complex)와 복합체를 형성하여 상보적인 서열을 갖는 mRNA에 특이적으로 결합하여 타겟 mRNA를 절단시킨 후 단백질 발현을 억제하는 것으로 알려져 있다. 기존에 약이 존재하지 않았던 질병에 대해 유전자 염기 서열에 특이적인 siRNA를 제조함으로써 병인성 단백질 생성을 원천적으로 억제하여 생체 내에 존재하는 생화학적 기작을 통한 안전하고 효과적인 siRNA 신약 제조가 가능하다.
2017년까지, RNAi 기술에 대한 세계시장은 연간 40억 달러의 가치가 있을 것으로 추정되고, 현재 RNAi 치료제와 관련된 20개 이상의 임상시험 단계는 모두 임상 1, 2 상의 초기 단계에 있으며 전임상 중에서도 여러 가지의 siRNA 치료제가 개발 중인 실정이다. 현재 제약 산업은 특허만료와 R&D 생산성 위기라는 두 가지 과제에 직면하였는데, 특허만료는 최근 대두되고 있는 대형 제약사들의 R&D 생산성 하락 문제와 함께 제약 산업의 중장기적 성장 저해 요소이다. 미국에서 전임상을 포함한 파이프라인에서 임상이 성공할 확률이 대략 0.25%에 불과한 상황이고 임상승인 기준마저 엄격해지고 절차의 투명성, 정보공개 확대 등의 규제로 임상 성공률은 향후 더욱 낮아질 것으로 예상된다. 임상 단계별로 살펴보면 비용과 생산성에 가장 큰 영향을 미치는 2상과 3상의 임상 실패율이 가장 가파르게 올라가고 있는 추세이다.
GIA 자료에 따르면 항암치료제 시장에서 새롭고 효과적인 치료방법에 대한 요구가 커지면서 유전자치료제 시장은 2017년 7억 9천만달러 규모에 이를 것으로 전망된다. 유전자치료제 시장의 가장 큰 성장요인은 항암제이며, 보다 효과적이고 부작용이 적은 약물에 대한 요구가 커지면서 유전자치료제가 전통적인 방사선치료와 화합물 치료를 일부 대체할 것으로 기대되고, 실제로 임상 진행 중인 유전자치료제 중 40%가 항암제로 개발중이다. 차세대 유전자치료제로 개발되고 있는 분야는 안티센스 약물(antisense drugs)로, 안티센스 RNAi(siRNA) 의약품은 2020년까지 12조원 규모의 시장을 형성할 것으로 예상된다.
한편, 활막육종은 악성 연부조직 종양의 약 10%를 차지하고 20-30대 이전에 호발하는 종양으로 아직 그 병태생리와 예후 인자가 잘 알려져 있지 않으며 수술적 절제 외에 항암 화학 요법이나 방사선 치료의 효용성이 확립되지 않은 종양이다. 세포유전학 연구 결과, 활막육종 환자에서 t(x;18)(p11;q11)염색체 위치 이동(chromosomal translocation)으로 18번 염색체의 SS18(SYT로도 알려짐) 유전자와 X 염색체의 SSX1(SSX family member 1), SSX2(SSX family member 2) 유전자가 융합되어 새로운 SS18-SSX1 또는 SS18-SSX2 유전자로 조합되는 것이 밝혀졌다. 이와 같이 생성된 융합 유전자는 일반적으로 활막육종 환자의 약 90% 이상에서 관찰되고, SS18-SSX 융합 유전자의 기능은 정확하게 밝혀지지 않으나 중간엽 줄기세포에서 SS18-SSX 융합 유전자가 활막육종을 유발하는 인자인 것으로 알려져 있다.
현재까지 siRNA를 이용하여 SS18-SSX 융합 유전자를 억제하기 위한 시도는 있었으나 대부분 18번 염색체의 SYT 유전자를 억제시키는 siRNA를 사용하였기 때문에, 현재까지의 시도는 SYT 유전자 억제에 의한 부작용을 고려하지 않은 시도였다. 이처럼 현재까지 융합 유전자를 표적하는 난치암 치료를 위한 siRNA 치료제 개발은 전임상 및 임상단계에서 경쟁 물질이 없으며, 바이오 시밀러 또는 제네릭 약물 또한 개발되거나 시판되고 있지 않다. 특히, siRNA를 기반으로 하는 새로운 치료제의 시장이 더욱 확대되고 있으나, 난치암에서 융합 유전자를 표적으로 하는 약물 개발은 전무한 상태이다.
난치암 특이적 융합 유전자를 표적으로 하는 siRNA 치료제의 경우, 유전자 기반 치료제의 특성상 상대적으로 짧은 개발 기간과 적은 비용으로 다양한 질병을 대상으로 치료제 개발이 가능하여 개발 기술의 과학적 의미와 함께 산업적 활용 가치가 매우 크며 이에 선진국을 중심으로 경쟁적으로 연구 투자가 이루어지고 있다. 따라서, 개인 맞춤의학구축 및 난치암 환자의 생존율 증가를 위한 융합 유전자 특이적 siRNA 치료제 개발에 대한 요구가 증가하고 있다.
이에 본 발명자들은 SS18-SSX 융합 유전자에 특이적으로 작용하는 siRNA에 대한 연구를 수행한 결과, SS18-SSX 융합 유전자에 특이적인 siRNA를 설계하고 상기 siRNA가 암의 예방 또는 치료에 효과가 있음을 확인함으로써 본 발명을 완성하였다.
본 발명의 목적은 서열번호 1, 서열번호 2 또는 서열번호 3으로 표시되는 센스(sense) 서열 및 이의 안티센스(antisense) 서열을 포함하는, siRNA(small interfering RNA)를 제공하는 것이다.
본 발명의 또다른 목적은 서열번호 1, 서열번호 2 또는 서열번호 3으로 표시되는 센스(sense) 서열 및 이의 안티센스(antisense) 서열을 포함하는 siRNA를 포함하는, 암 예방 또는 치료용 약학적 조성물을 제공하는 것이다.
본 발명의 또다른 목적은 서열번호 1, 서열번호 2 또는 서열번호 3으로 표시되는 센스(sense) 서열 및 이의 안티센스(antisense) 서열을 포함하는 siRNA 및 핵산 전달체를 포함하는, siRNA 복합체를 제공하는 것이다.
상기 목적을 달성하기 위하여, 본 발명은 서열번호 1, 서열번호 2 또는 서열번호 3으로 표시되는 센스(sense) 서열 및 이의 안티센스(antisense) 서열을 포함하는, siRNA(small interfering RNA)를 제공한다.
또한, 본 발명은 서열번호 1, 서열번호 2 또는 서열번호 3으로 표시되는 센스(sense) 서열 및 이의 안티센스(antisense) 서열을 포함하는 siRNA를 포함하는, 암 예방 또는 치료용 약학적 조성물을 제공한다.
또한, 본 발명은 서열번호 1, 서열번호 2 또는 서열번호 3으로 표시되는 센스(sense) 서열 및 이의 안티센스(antisense) 서열을 포함하는 siRNA 및 핵산 전달체를 포함하는, siRNA 복합체를 제공한다.
본 발명의 SS18-SSX 융합 유전자 특이적 siRNA는 SS18-SSX 융합 유전자에 대한 특이성이 높고 이에 결합하여 SS18-SSX 융합 유전자를 갖는 개체에서 융합 유전자의 발현을 억제하는 우수한 효과가 있으며, 암 세포의 증식억제 작용을 나타내므로 암의 예방 또는 치료에 유용하게 사용할 수 있다.
도 1은 259T 환자에서 특이적으로 발생하는 융합 유전자를 RT-PCR 및 Sanger 시퀀싱을 통해 확인한 결과를 나타낸 도이다.
도 2는 259T 환자에서 확인한 SS18-SSX2 융합 유전자와 HS-SY-II 세포주에서 확인한 SS18-SSX1 융합 유전자의 브레이크포인트를 비교한 결과를 나타낸 도이다.
도 3은 설계된 16종의 siRNA를 활막육종 세포주(HS-SY-II)에 형질감염시킨 후 SS18-SSX 융합 유전자 발현의 변화를 qRT-PCR로 확인한 결과를 나타낸 도이다.
도 4는 선별된 3종의 siRNA(siRNA 3, siRNA 6, siRNA 11)를 활막육종 세포주(HS-SY-II)와 유잉육종 세포주(A673)에 형질감염시킨 후 SS18-SSX 융합 유전자 발현의 변화를 qRT-PCR 및 웨스턴 블롯으로 확인한 결과를 나타낸 도이다.
도 5는 3 종의 siRNA(siRNA 3, siRNA 6, siRNA 11)를 활막육종 세포주(HS-SY-II)에 형질감염시킨 후 세포성장억제변화를 WST로 확인한 결과를 나타낸 도이다.
이하, 본 발명에 대해 상세히 설명한다.
본 발명은 서열번호 1, 서열번호 2 또는 서열번호 3으로 표시되는 센스(sense) 서열 및 이의 안티센스(antisense) 서열을 포함하는, siRNA(small interfering RNA)를 제공한다.
상기 용어 “안티센스 서열”은 센스 가닥의 핵산 서열에 대하여 상보적인 염기 서열을 갖는 RNA의 총칭이다. 본 발명에서 서열번호 1로 표시되는 서열의 안티센스 서열은 CTTCTTGGGCATGATCTGG이고, 서열번호 2로 표시되는 서열의 안티센스 서열은 CTTGGGCATGATCTGGTCA이고, 서열번호 3으로 표시되는 서열의 안티센스 서열은 GCATGATCTGGTCATATCC이다.
상기 siRNA는 서열번호 1, 서열번호 2 또는 서열번호 3으로 표시되는 센스(sense) 서열 및 센스 서열에 상보적인 안티센스(antisense) 서열을 포함하거나 이로 이루어질 수 있는 센스 서열과 안티센스 서열은 듀플렉스(duplex) 형태일 수 있다.
상기 siRNA는 SS18(nBAF chromatin remodeling complex subunit)-SSX(SSX family member) 융합 유전자에 특이적으로 결합하여 SS18-SSX 융합 유전자를 갖는 개체에서 상기 융합 유전자의 발현을 억제함으로써 암세포의 증식을 억제할 수 있다.
본 발명에서, 용어 "융합 유전자(fusion gene)"는 두 개의 유전자가 한 개의 유전자로 재구성되어 새로운 기능을 수행하는 유전자를 지칭하는 용어로, 형성기작에 따라 크게 서로 다른 염색체 일부분이 위치 이동하면서 생성되는 경우, 같은 염색체 내에서 일부가 위치 이동을 하여 생성되는 경우, 동일하거나 서로 다른 염색체 내의 유전자가 각각 전사체를 만들고 이 두 개의 전사체가 융합하여 생성되는 경우로 분류된다. 본 발명에서 융합되는 유전자는 바람직하게는 SS18 유전자와 SSX 유전자이며, “SS18-SSX” 또는 “SS18-SSX 융합 유전자”로 지칭될 수 있고, 상기 SSX 유전자는 SSX1 또는 SSX2를 포함할 수 있다.
본 발명에서, 용어 “siRNA(small interfering RNA)"는 이중가닥 RNA가 다이서(Dicer) 효소에 의해 절단되어 생성되는 18~23 뉴클레오티드 크기의 작은 RNA 조각으로, 상보적인 서열을 갖는 mRNA에 특이적으로 결합하여 당해 단백질, mRNA의 발현을 억제하는 데 사용할 수 있다.
본 발명의 siRNA는 SS18 유전자와 SSX 유전자가 융합된 융합 유전자에 결합하므로 SS18-SSX 융합 유전자에 대한 특이성이 높다. 따라서 siRNA의 표적인 SS18 유전자와 SSX 유전자가 융합된 브레이크 포인트에 특이적으로 결합하여 RNA 간섭 효율성이 증가되므로, SS18-SSX 융합 유전자를 갖는 개체의 융합 유전자 mRNA 또는 이의 단백질의 발현 억제 효율이 우수한 특징이 있다.
본 발명의 siRNA는 리보핵산 서열 자체, 또는 이를 발현하는 재조합 벡터 (발현 벡터) 형태를 모두 포함하는 개념이다. 또한, 상기 발현 벡터는 플라즈미드 또는 아데노-부속 바이러스(adeno-associated virus), 레트로바이러스, 백시니아 바이러스, 암세포 용해성 바이러스(oncolytic adenovirus) 등으로 이루어진 군에서 선택되는 바이러스 벡터일 수 있다.
상기 siRNA의 처리에 의한 SS18-SSX 융합 유전자 발현 억제 효과는 정량 PCR(qPCR), RT-PCR, bDNA (branched DNA) assay, 웨스턴 블롯, ELISA 등의 방법으로 mRNA 또는 단백질 수준의 변화를 측정하여 확인할 수 있다.
본 발명에서, siRNA는 변형되지 않고 자연에 존재하는 리보핵산 단위구조를 가지고 있는 것이거나, 화학적으로 변형된 것일 수 있다. 이러한 siRNA의 화학적 변형은 생체 내 안정성 향상, 핵산 분해효소 저항성 부여 및 비 특이적 면역반응 감소를 위한 것이다.
상기 화학적 변형을 통해, RNAi 능력에는 영향을 미치지 않고, 뉴클레아제(nuclease)에 대한 저항성 증진, 세포내 흡수(uptake) 증가, 세포 표적화 향상, 안정성 증가, 인터페론 활성 감소, 면역 반응 및 센스(sense) 효과와 같은 타겟 이외의(off-target) 효과 감소 등을 포함하는 siRNA의 다양한 특성을 변형되지 않은 siRNA 보다 향상시킬 수 있다.
이러한 siRNA의 화학적 변형 방법은 특별히 제한되지 않으며, 본 발명이 속하는 기술 분야의 통상의 지식을 가진 당업자라면 당해 기술 분야에 공지된 방법을 이용하여 원하는 방식대로 상기 siRNA를 합성하고 변형시킬 수 있다. 예컨대 뉴클레오티드 내 당 구조의 2´ 탄소 위치에서 -OH기가 -CH3(메틸), -OCH3(methoxy), -NH2, -F(불소), -O-2-메톡시에틸 -O-프로필(propyl), -O-2-메틸티오에틸(methylthioethyl), -O-3-아미노프로필, -O-3-디메틸아미노프로필, -O-N-메틸아세트아미도 또는 -O-디메틸아미도옥시에틸로의 치환에 의한 변형; 뉴클레오티드 내 당(sugar) 구조 내의 산소가 황으로 치환된 변형; 또는 뉴클레오티드결합의 포스포로티오에이트(phosphorothioate) 또는 보라노포스페이트(boranophosphate), 메틸 포스포네이트(methyl phosphonate) 결합으로의 변형에서 선택된 하나 이상의 변형이 조합되어 사용될 수 있으며, PNA(peptide nucleic acid), LNA(locked nucleic acid) 또는 UNA(unlocked nucleic acid) 형태로의 변형도 사용이 가능하고, siRNA의 5'- 또는 3'- 말단에 콜레스테롤, 비오틴, 세포 투과성 펩타이드(cell penetrating peptide)와 같은 리간드(ligand)를 붙이는 것도 가능하다.
상기 화학적 변형 중 siRNA 센스(sense) 및 안티센스(antisense) 가닥의 포스포디에스테르 결합을 포스포로티오에이트(phosphorothioate) 또는 보라노포스페이트(boranophosphate) 결합으로 치환하는 방법을 통해 뉴클레아제(nuclease)의 핵산 분해에 대한 저항성을 높일 수 있다. 예컨대, siRNA 센스(sense)와 안티센스(antisense) 양쪽 가닥의 3'-말단 포스포디에스테르 결합을 포스포로티오에이트 결합으로 변경할 수 있다.
상기 화학적 변형 중 siRNA 센스(sense) 또는 안티센스 가닥의 5' 말단, 3' 말단, 또는 양 말단에 ENA(Ethylene bridge nucleic acid), PNA(peptide nucleic acid), LNA(locked nucleic acid) 또는 UNA(unlocked nucleic acid)를 도입하는 방법이 있을 통해 RNAi 능력에 영향을 미치지 않고 siRNA 안정성을 증가시키고 면역 반응 및 비특이적 억제 효과를 줄일 수 있다.
상기 화학적 변형 외에도 다양한 화학적 변형을 가할 수 있으며, 이러한 화학적 변형은 어느 한 가지 형태의 변형만 이루어질 수도 있고, 여러 가지 화학적 변형이 함께 이루어질 수도 있다.
다만 상기 변형에 있어서, siRNA 이중 가닥구조를 안정화시키는 동시에 유전자 발현 저해활성을 감소시키지 않도록, 바람직하게는 최소한의 변형이 이루어지도록 하는 것이 좋다.
또한, 본 발명은 서열번호 1, 서열번호 2 또는 서열번호 3으로 표시되는 센스(sense) 서열 및 이의 안티센스(antisense) 서열을 포함하는, 암 예방 또는 치료용 약학적 조성물을 제공한다.
상기 siRNA는 암세포의 증식을 억제하므로, 암 예방 또는 치료 효과를 나타내는 것을 특징으로 한다.
상기 암은 SS18-SSX 융합 유전자를 발현하는 것을 특징으로 하며, 본 발명의 siRNA는 SS18-SSX 융합 유전자를 나타내는 개체에서 상기 융합 유전자의 발현을 억제할 수 있다.
상기 암은 SS18-SSX 융합 유전자 양성 암일 수 있다.
본 발명의 조성물이 적용될 수 있는 암은 SS18-SSX 융합 유전자 양성 암을 제한 없이 포함할 수 있으며, 바람직하게는 활막육종일 수 있다.
본 발명의 조성물은 핵산 전달체를 더 포함할 수 있다.
또한, 본 발명은 서열번호 1, 서열번호 2 또는 서열번호 3으로 표시되는 센스(sense) 서열 및 이의 안티센스(antisense) 서열을 포함하는 조성물을 개체에 처리하는 단계를 포함하는, 암 치료방법을 제공한다.
상기 개체는 모든 생물-유래 개체를 의미하며, 바람직하게는 인간을 포함한 동물일 수 있다. 상기 동물은 식물에 대응하는 생물군으로 주로 유기물을 영양분으로 섭취하며, 소화나 배설 및 호흡기관이 분화되어 있는 것을 말하고, 바람직하게는 척추동물, 더욱 바람직하게는 포유류일 수 있다. 구체적으로는 상기 포유류는 인간, 영장류, 설치류 등일 수 있다.
또한, 본 발명은 서열번호 1, 서열번호 2 또는 서열번호 3으로 표시되는 센스(sense) 서열과 이의 안티센스(antisense) 서열을 포함하는 siRNA 및 핵산 전달체를 포함하는, siRNA 복합체를 제공한다.
본 발명에서, 용어 “핵산 전달체(nucleic acid delivery system)”는 체내로의 전달효율을 높이기 위한 것으로, 체내에서의 안정성이 우수할 뿐 아니라 약물로서의 제조 공정이 간단하다는 장점이 있다.
상기 핵산 전달체는, 이에 제한되는 것은 아니나, 바이러스성 벡터, 비바이러스성 벡터, 리포좀, 양이온성 고분자, 미셀(micelle), 에멀젼, 지질 나노입자(solid lipid nanoparticles) 등을 포함할 수 있다. 바이러스성 벡터는 전달 효율이 높고 지속 시간이 긴 이점이 있고, 레트로바이러스 벡터(retroviral vector), 아데노바이러스 벡터(adenoviral vector), 백시니아바이러스 벡터, 아데노 부속 바이러스 벡터(adeno-associated viral vector), 암세포 용해성 바이러스 벡터 등이 포함된다. 비바이러스 벡터(nonviral vector)는 플라즈미드를 포함할 수 있다. 그 외에도 리포좀, 양이온성 고분자, 미셀(micelle), 에멀젼, 지질 나노입자(solid lipid nanoparticles) 등의 다양한 제형이 사용될 수 있다. 핵산 전달을 위한 양이온성 고분자에는 키토산, 아텔로콜라겐(atelocollagen), 양이온성 폴리펩타이드(cationic polypeptide) 등과 같은 천연고분자와 poly(L-lysin), 선형 또는 분지형 PEI(polyethylene imine), 사이클로덱스트린계열 다가양이온(cyclodextrin-based polycation), 덴드리머(dendrimer) 등과 같은 합성고분자가 포함될 수 있다.
siRNA가 상기와 같은 핵산 전달체와의 복합체 형태로 조성물에 포함되는 경우, siRNA를 효율적으로 타겟 세포로 전달을 촉진하여, 비교적 낮은 농도의 투여량으로도 타겟 세포로 전달되어 높은 타겟 유전자 발현 조절 기능을 나타낼 수 있다. 또한 타겟 이외의 타 장기 및 세포로의 비 특이적인 siRNA의 전달을 방지할 수 있다는 장점이 있다.
본 발명의 조성물의 투여 대상 환자는 포유 동물, 바람직하게는 사람, 원숭이, 설치류 (마우스, 래트)일 수 있으며, 특히 SS18-SSX 융합 유전자의 발현과 관련되는 질병이나 증상을 가지거나, SS18-SSX 융합 유전자를 가지며 SS18-SSX 융합 유전자의 발현 억제를 필요로 하는 모두 포유 동물, 예컨대, 사람일 수 있다.
SS18-SSX 융합 유전자를 발현하는 개체에서 SS18-SSX 융합 유전자의 발현 억제에 유효한 효과를 얻으면서 면역 반응 등의 바람직하지 않은 부반응을 최소화하기 위하여, 조성물 내의 siRNA의 농도, 또는 사용 또는 처리 농도는, 0.001 내지 1000nM, 바람직하게는 0.01 내지 100nM, 더욱 바람직하게는 0.1 내지 10nM로 할 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 조성물은 서열번호 1, 서열번호 2 또는 서열번호 3으로 표시되는 siRNA는 화학적으로 변형된 형태 또한 포함할 수 있으며, 추가적으로 본 발명의 siRNA 이외의 SS18-SSX 융합 유전자에 특이적으로 결합하는 siRNA가 본 발명의 조성물에 추가적으로 포함될 수 있다. 상기와 같이 본 발명의 서열번호 1, 서열번호 2 또는 서열번호 3으로 표시되는 siRNA 이외에 SS18-SSX 융합 유전자에 특이적으로 결합하는 siRNA를 모두 포함하는 암 예방 또는 치료용 약학적 조성물을 이용할 경우, 병용 요법(combination therapy)과 같이 상승적인 효과를 거둘 수 있다.
본 발명의 조성물은 상기의 유효성분 이외에 추가로 약제학적으로 허용 가능한 담체를 1종 이상 포함하여 제조할 수 있다. 약제학적으로 허용 가능한 담체는 본 발명의 유효성분과 양립 가능하여야 하며, 식염수, 멸균수, 링거액, 완충 식염수, 덱스트로즈 용액, 말토덱스트린 용액, 글리세롤, 에탄올 및 이들 성분 중 한 성분 또는 둘 이상의 성분을 혼합하여 사용할 수 있고, 필요에 따라 항산화제, 완충액, 정균제 등 다른 통상의 첨가제를 첨가할 수 있다. 또한 희석제, 분산제, 계면활성제, 결합제 및 윤활제를 부가적으로 첨가하여 수용액, 현탁액, 유탁액 등과 같은 주사용 제형으로 제제화 할 수 있다. 더 나아가 당 분야의 적정한 방법으로 또는 레밍톤 약학 과학(Remington's pharmaceutical Science, Mack Publishing company, Easton PA)에 개시되어 있는 방법을 이용하여 각 질병에 따라 또는 성분에 따라 바람직하게 제제화 할 수 있다.
본 발명의 조성물에 포함되는 유효성분 등의 함량 및 투여방법은 통상의 환자의 증후와 질병의 심각도에 기초하여 본 기술분야의 통상의 전문가가 결정할 수 있다. 또한 산제, 정제, 캡슐제, 액제, 주사제, 연고제, 시럽제 등의 다양한 형태로 제제화 할 수 있으며 단위-투여량 또는 다-투여량 용기, 예를 들면 밀봉된 앰플 및 병 등으로 제공될 수도 있다.
본 발명의 조성물은 경구 또는 비경구 투여가 가능하다. 본 발명에 따른 조성물의 투여경로는 이들로 한정되는 것은 아니지만, 예를 들면, 구강, 정맥 내, 근육 내, 동맥 내, 골수 내, 경막 내, 심장 내, 경피, 피하, 복강 내, 장관, 설하 또는 국소 투여가 가능하다. 본 발명에 따른 조성물의 투여량은 환자의 체중, 연령, 성별, 건강상태, 식이, 투여시간, 방법, 배설율 또는 질병의 중증도 등에 따라 그 범위가 다양하며, 본 기술분야의 통상의 전문가가 용이하게 결정할 수 있다. 또한, 임상 투여를 위해 공지의 기술을 이용하여 본 발명의 조성물을 적합한 제형으로 제제화할 수 있다.
본 발명의 siRNA는 암의 치료를 위해 in vivo 또는 ex vivo 상에서 세포 내로 도입될 수 있다. 본 발명의 siRNA를 세포 내에 도입하게 되면 표적인 SS18-SSX 융합 유전자를 갖는 암 환자에서 SS18-SSX 융합 유전자의 발현을 억제하고 암세포의 분화가 억제되어 암세포가 사멸하고, 궁극적으로는 암의 치료가 가능하게 된다.
이와 같이, 본 발명의 siRNA와 함께 화학요법을 병용하여 화학요법제에 대한 민감도를 높임으로써 치료효과를 극대화하고 부작용을 감소시킬 수 있을 뿐 아니라, 각종 성장인자 (예컨대 VEGF, EGF, PDGF 등), 성장 인자 수용체 및 하위 신호전달 단백질, 바이러스성 종양유발인자, 항암제 내성 유전자의 발현을 저해하는 siRNA와 병용하여 암의 여러 경로를 동시에 차단함으로 항암효과를 극대화 할 수 있다.
본 발명이 제공하는 SS18-SSX 융합 유전자에 특이적으로 결합하는 siRNA는 SS18-SSX 융합 유전자를 갖는 개체에서 SS18-SSX 융합 유전자의 mRNA 발현을 저해시킬 뿐만 아니라, 해당 단백질의 발현을 현저하게 저해시킨다.
본 명세서에서 달리 정의되지 않은 용어들은 본 발명이 속하는 기술분야에서 통상적으로 사용되는 의미를 갖는 것이다.
이하, 본 발명을 실시예에 의해 상세히 설명한다. 단, 하기 실시예는 본 발명을 예시하는 것일 뿐 본 발명의 내용이 하기 실시예에 한정되는 것은 아니다.
실시예 1: SS18-SSX 융합 유전자의 브레이크 포인트(breakpoint) 확인 및 SS18-SSX 융합 유전자 특이적 siRNA의 설계
1.1 활막육종 환자에서 특이적으로 발생하는 융합 유전자 확인
먼저 LC13-259T 환자에서 특이적으로 발생하는 융합 유전자를 탐색하기 위하여 환자로부터 얻은 시료에서 수행한 RT-PCR 및 Sanger 시퀀싱 결과를 도 1에 나타내었다. LC13-259T 환자는 PCNA(percutaneous needle aspiration and biopsy, 경피적침생검술)시행 후 폐암 진단을 받고 VATS(Video-assisted thoracoscopic surgery) RULobectomy 수술을 시행한 환자로, 환자 오른쪽 upper lobe에서 4 cm endobronchial mass가 발견되었으며 RT-PCR 시행 결과 활막 육종으로 판명된 환자를 지칭한다.
LC13-259T 환자로부터 얻은 시료에서 SYT-SSX1, SYT-SSX2, beta-globin 유전자를 확인하였고(레인 1-3), 양성 대조군(레인 4)인 HS-SYII 활막육종 세포주와 음성 대조군(레인 5)인 A673 유잉 육종 세포주에서 SYT-SSX1 유전자를 확인하였다. 도 1에 나타낸 바와 같이, LC13-259T 환자가 SYT 엑손 10과 SSX2 엑손 6에서 위치 이동(translocation)된 SS18-SSX2 융합 유전자를 갖는 활막육종을 갖는 것을 확인하였다.
1.2 활막육종에서 특이적으로 발생하는 융합 유전자 확인 및 브레이크 포인트(break point) 확인
활막육종 세포주인 HS-SY-II에서 특이적으로 발생하는 융합 유전자를 확인하였으며, 확인 결과 SS18-SSX1 융합 유전자가 발생함을 확인하였다.
상기 실시예 1.1에서 확인한 SS18-SSX2 융합유전자와 HS-SY-II 세포주에서 확인한 SS18-SSX1 융합 유전자의 브레이크 포인트를 비교한 결과를 도 2에 나타내었다.
도 2에 나타낸 바와 같이, 259T 환자의 시료에서 확인한 SS18-SSX2 융합 유전자의 브레이크 포인트와 활막육종 세포주 HS-SY-II에서 확인한 SS18-SSX1 융합 유전자의 브레이크 포인트가 CTTATGGATATGACCAGATCATGCCCAAGA로 일치함을 확인하였다.
따라서, 본 발명에서 SS18-SSX을 타겟으로 하는 siRNA가 SS18-SSX1과 SS18-SSX2 모두를 타겟으로 할 수 있음을 확인하였다.
1.3 SS18-SSX 특이적 siRNA의 설계 및 스크리닝
상기 실시예 1.2에서 확인한 SS18-SSX 브레이크 포인트에 특이적으로 작용하는 siRNA를 디자인하기 위해서, 하기 표 1에 나타낸 바와 같은 16종의 siRNA를 제작하고 스크리닝을 수행하였다.
Figure PCTKR2017010991-appb-T000001
상기 표 1의 siRNA 중 SS18-SSX 융합 유전자에 특이적인 siRNA를 스크리닝하기 위해서 설계된 16종의 siRNA의 in vitro 기능을 분석하였다. 구체적으로, 리포펙타민(lipofectamine)을 이용해서 SS18-SSX1 융합 유전자를 가진 활막육종 세포주(HS-SY-II)에 siRNA로 형질감염시킨 후 융합 유전자가 억제되는지 여부를 확인하고 그 결과를 도 3에 나타내었다.
도 3에 나타낸 바와 같이, 3종의 siRNA로 형질감염시킨 HS-SY-II 세포주에서 융합 유전자의 발현이 70% 이상 감소된 것을 확인하였고, 상기 3종의 siRNA(siRNA 3, siRNA 6, siRNA 11)를 선택하여 추가적인 스크리닝을 수행하였다.
SS18-SSX 융합 유전자를 갖지 않는 유잉육종(Ewing sarcoma) 세포주 A673에 선택된 3종의 siRNA들을 형질감염시킨 후 siRNA에 의한 융합 유전자 억제 효과를 상기와 같이 측정하였다. 측정 결과를 도 4에 나타내었다.
도 4에 나타낸 바와 같이, HS-SY-II 세포주에서는 siRNA에 의해 융합 유전자의 발현이 감소되었으나, 융합 유전자를 갖지 않는 유잉육종 세포주(A673)에서 3종의 siRNA가 SS18 및 SSX 유전자의 발현에 영향을 주지 않음을 확인하였다. 따라서 본 발명의 siRNA는 SS18-SSX 융합 유전자에 특이적으로 작용함을 확인하였다.
실시예 2: SS18-SSX 특이적 siRNA의 세포증식억제 효과 확인
본 발명의 siRNA의 in vitro 기능을 분석하기 위하여 SS18-SSX1 융합 유전자를 갖는HS-SY-II 세포주에 리포펙타민(lipofectamine)을 이용해서 3종의 siRNA(siRNA 3, siRNA 6, siRNA 11)들을 형질감염시킨 후 세포의 증식 변화를 WST로 확인한 결과를 도 5에 나타내었다.
도 5에 나타낸 바와 같이, siRNA 3(#3), siRNA 6(#6), siRNA 11(#11)이 활막육종 세포주의 증식 억제를 유발하는 것을 확인하였다.
따라서 본 발명의 SS18-SSX 특이적 siRNA는 암세포에 존재하는 SS18-SSX에 특이적으로 작용하여 암세포 증식을 억제시키는 효과가 있으므로, 암의 예방 또는 치료에 유용하게 사용할 수 있다.
비록 본 발명이 상기에 언급된 바람직한 실시예로서 설명되었으나, 발명의 요지와 범위로부터 벗어남이 없이 다양한 수정이나 변형을 하는 것이 가능하다. 또한 첨부된 청구 범위는 본 발명의 요지에 속하는 이러한 수정이나 변형을 포함한다.

Claims (10)

  1. 서열번호 1, 서열번호 2 또는 서열번호 3으로 표시되는 센스(sense) 서열 및 이의 안티센스(antisense) 서열을 포함하는, siRNA(small interfering RNA).
  2. 제1항에 있어서, 상기 siRNA는 SS18(nBAF chromatin remodeling complex subunit)-SSX(SSX family member) 융합 유전자에 특이적으로 결합하는 것인, siRNA.
  3. 제1항에 있어서, 상기 siRNA가 화학적으로 변형된 것인, siRNA.
  4. 제3항에 있어서, 상기 화학적 변형은 뉴클레오티드 내 당 구조의 2´ 탄소 위치에서 -OH기가 -CH3, -OCH3, -NH2, -F, -O-2-메톡시에틸 -O-프로필(propyl), -O-2-메틸티오에틸(methylthioethyl), -O-3-아미노프로필, -O-3-디메틸아미노프로필, -O-N-메틸아세트아미도 또는 -O-디메틸아미도옥시에틸로의 치환에 의한 변형; 뉴클레오티드 내 당(sugar) 구조 내의 산소가 황으로 치환된 변형; 뉴클레오티드결합의 포스포로티오에이트(phosphorothioate) 또는 보라노포스페이트(boranophosphate), 메틸포스포네이트(methyl phosphonate) 결합으로의 변형; PNA(peptide nucleic acid), LNA(locked nucleic acid) 또는 UNA(unlocked nucleic acid) 형태로의 변형;으로 구성된 군으로부터 선택된 1종 이상인, siRNA.
  5. 서열번호 1, 서열번호 2 또는 서열번호 3으로 표시되는 센스(sense) 서열 및 이의 안티센스(antisense) 서열을 포함하는, 암 예방 또는 치료용 약학적 조성물.
  6. 제5항에 있어서, 상기 암은 SS18-SSX 융합 유전자 양성 암인, 암 예방 또는 치료용 약학적 조성물.
  7. 제5항에 있어서, 상기 암은 활막육종인, 암 예방 또는 치료용 약학적 조성물.
  8. 제5항에 있어서, 핵산 전달체를 더 포함하는, 암 예방 또는 치료용 약학적 조성물.
  9. 서열번호 1, 서열번호 2 또는 서열번호 3으로 표시되는 센스(sense) 서열과 이의 안티센스(antisense) 서열을 포함하는 siRNA 및 핵산 전달체를 포함하는, siRNA 복합체.
  10. 제9항에 있어서, 상기 핵산 전달체는 바이러스성 벡터, 비바이러스성 벡터, 리포좀, 양이온성 고분자, 미셀(micelle), 에멀젼 및 지질 나노입자(solid lipid nanoparticles)로 구성된 군에서 선택되는 것인, siRNA 복합체.
PCT/KR2017/010991 2016-12-14 2017-09-29 SS18-SSX 융합 유전자 특이적 siRNA 및 이를 포함하는 암 예방 또는 치료용 약학적 조성물 WO2018110814A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2016-0170303 2016-12-14
KR1020160170303A KR101913693B1 (ko) 2016-12-14 2016-12-14 SS18-SSX 융합 유전자 특이적 siRNA 및 이를 포함하는 암 예방 또는 치료용 약학적 조성물

Publications (1)

Publication Number Publication Date
WO2018110814A1 true WO2018110814A1 (ko) 2018-06-21

Family

ID=62558845

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2017/010991 WO2018110814A1 (ko) 2016-12-14 2017-09-29 SS18-SSX 융합 유전자 특이적 siRNA 및 이를 포함하는 암 예방 또는 치료용 약학적 조성물

Country Status (2)

Country Link
KR (1) KR101913693B1 (ko)
WO (1) WO2018110814A1 (ko)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN116284315A (zh) * 2022-12-13 2023-06-23 中山大学附属第七医院(深圳) 一种ssx多肽及其用于治疗滑膜肉瘤的应用

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102424454B1 (ko) 2019-02-26 2022-07-22 서울대학교산학협력단 Tut4/7 발현 조절인자를 포함하는 암 예방 또는 치료용 약학적 조성물

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20120042645A (ko) * 2010-10-22 2012-05-03 성균관대학교산학협력단 Rna 간섭을 유도하는 핵산 분자 및 그 용도
KR101252799B1 (ko) * 2009-12-31 2013-04-09 주식회사 삼양바이오팜 c-Met의 발현을 저해하는 siRNA 및 이를 포함하는 항암 조성물
US20130281513A1 (en) * 2010-12-30 2013-10-24 Samyang Biopharmaceuticals Corporation siRNA FOR INHIBITION OF Hif1alpha EXPRESSION AND ANTICANCER COMPOSITION CONTAINING THE SAME
US20160346293A1 (en) * 2014-10-16 2016-12-01 Epizyme, Inc. Method for treating cancer

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7803370B2 (en) 2002-08-30 2010-09-28 Oncotherapy Science, Inc. Method for treating synovial sarcoma
US20110082185A1 (en) 2007-09-17 2011-04-07 Ludwig Institute For Cancer Research Ltd. Cancer-testis gene silencing agents and uses thereof
US9410943B2 (en) 2013-03-14 2016-08-09 The Board Of Trustees Of The Leland Stanford Junior University Methods, compositions and screens for therapeutics for the treatment of synovial sarcoma
WO2015058125A1 (en) 2013-10-18 2015-04-23 Epizyme, Inc. Method of treating cancer

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101252799B1 (ko) * 2009-12-31 2013-04-09 주식회사 삼양바이오팜 c-Met의 발현을 저해하는 siRNA 및 이를 포함하는 항암 조성물
KR20120042645A (ko) * 2010-10-22 2012-05-03 성균관대학교산학협력단 Rna 간섭을 유도하는 핵산 분자 및 그 용도
US20130281513A1 (en) * 2010-12-30 2013-10-24 Samyang Biopharmaceuticals Corporation siRNA FOR INHIBITION OF Hif1alpha EXPRESSION AND ANTICANCER COMPOSITION CONTAINING THE SAME
US20160346293A1 (en) * 2014-10-16 2016-12-01 Epizyme, Inc. Method for treating cancer

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
LUBIENIECKA, J. M. ET AL.: "Histone Deacetylase Inhibitors Reverse SS18-SSX-mediated Polycomb Silencing of the Tumor Suppressor Early Growth Response I in Synovial Sarcoma", CANCER RESEARCH, vol. 68, no. 11, June 2008 (2008-06-01), pages 4303 - 4310, XP055516290 *
MINAMI, Y. ET AL.: "SS18-SSX-regulated miR-17 Promotes Tumor Growth of Synovial Sarcoma by Inhibiting p2 1WAF1/CIP1", CANCER SCIENCE, vol. 105, no. 9, 2014, pages 1152 - 1159, XP055516289 *
TAMAKI, S. ET AL.: "SS18-SSX, the Oncogenic Fusion Protein in Synovial Sarcoma, Is a Cellular Context-Dependent Epigenetic Modifier", PLOS ONE, vol. 10, no. 11, 2015, pages 1 - 20, XP055516287 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN116284315A (zh) * 2022-12-13 2023-06-23 中山大学附属第七医院(深圳) 一种ssx多肽及其用于治疗滑膜肉瘤的应用
CN116284315B (zh) * 2022-12-13 2023-09-22 中山大学附属第七医院(深圳) 一种ssx多肽及其用于治疗滑膜肉瘤的应用

Also Published As

Publication number Publication date
KR101913693B9 (ko) 2018-10-31
KR20180068524A (ko) 2018-06-22
KR101913693B1 (ko) 2018-10-31

Similar Documents

Publication Publication Date Title
Huang et al. Chlorogenic acid effectively treats cancers through induction of cancer cell differentiation
Zhang et al. MiR-221 and miR-222 target PUMA to induce cell survival in glioblastoma
Chen et al. Targeting MIAT reduces apoptosis of cardiomyocytes after ischemia/reperfusion injury
JP2004519458A (ja) 標的遺伝子の発現阻害方法
WO2008025073A1 (en) Method of modulation of expression of epidermal growth factor receptor (egfr) involving mirna
WO2018110814A1 (ko) SS18-SSX 융합 유전자 특이적 siRNA 및 이를 포함하는 암 예방 또는 치료용 약학적 조성물
EP2644199B1 (en) Methods for detecting and modulating the sensitivity of tumour cells to anti-mitotic agents
TWI812591B (zh) 細胞死亡誘導劑、細胞增殖抑制劑及起因於細胞之增殖異常之疾病之治療用醫藥組合物
US9493772B2 (en) Method for reducing expression of downregulated in renal cell carcinoma in malignant gliomas
AU2015229033A1 (en) Asymmetric interfering RNA compositions that silence K-Ras and methods of uses thereof
US8921333B2 (en) Therapeutic agent for tumor
CN101348512B (zh) 一种抗肿瘤的腺病毒制剂
KR102120659B1 (ko) 난소과립막세포암 또는 자궁내막암의 진단 및 치료를 위한 마이크로rna-1236의 용도
WO2018224668A1 (en) Long non-coding rna in cancer
CN109337907B (zh) 一种用于抑制TCF12基因的siRNA分子
WO2013023361A1 (zh) 人zfx基因的用途及其相关药物
US9567583B2 (en) Method for treating glioma using Tarbp2 expression inhibitor
WO2010050328A1 (ja) 腫瘍の転移抑制剤
KR102269988B1 (ko) BRD4-NUTM1 특이적 siRNA를 포함하는 암 예방 또는 치료용 조성물
WO2022111637A1 (zh) 结合yb-1蛋白的核酸分子
KR101888104B1 (ko) MET 엑손 14 스키핑 특이적 siRNA 및 이를 포함하는 암 예방 또는 치료용 약학적 조성물
CN113774137B (zh) 检测生物标志物表达的试剂在制备鉴定白血病耐药和/或不良预后的试剂盒中的应用
US9045752B2 (en) NKX3-1 saRNA and KLF4 saRNA and uses thereof
CN113134010B (zh) 一种靶向雌激素受体α的微小RNA及其抗肿瘤用途
WO2022131667A1 (ko) Oligodendrocyte transcription factor 2 억제제를 유효성분으로 포함하는 흑색종 치료 효과 증진용 약학적 조성물

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17881064

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 17881064

Country of ref document: EP

Kind code of ref document: A1