WO2018105858A1 - Linking peptide for biomolecule binding - Google Patents

Abstract

The present invention relates to a linking peptide for biomolecule binding, and provides a linking peptide for binding a biomolecule to a terminal thereof by using a part of a PspA protein, which is a surface protein of Streptococcus pneumoniae, thereby being usable in the preparation of a fusion protein. According to the present invention, the activity of antibodies linked to both terminals of the linking peptide is enhanced when a fusion protein is prepared, thereby enabling the same to be effectively used as a linking peptide for biomolecules.

Description

Linked Peptides for Biomolecule Binding

The present invention relates to a linking peptide for biomolecule binding, and more particularly, to a linking peptide that can be used for the production of a fusion protein by binding a biomolecule to a terminal using a portion of the PspA protein, which is a surface protein of pneumococci.

Vaccine adjuvant flagellin is a component of bacterial flagella and is a ligand of Toll-like receptor (TLR) 5 of the innate immune system. For this reason, efforts have been made to use flagellin as an adjuvant. FlaB is a major constituent of the sepsis Vibrio vulnificus flagellin. The inventors have investigated the role of FlaB as a mucosal immune vaccine adjuvant.

Unlike other lipid or sugar based adjuvants, FlaB consists of proteins. For this reason, it is easy to prepare a fusion protein of antigen and FlaB using a gene cloning and recombinant protein expression system. The inventors have demonstrated that the FlaB-PspA fusion protein based vaccines show higher mucosal and protective immunity than the FlaB and PspA mixture vaccines.

However, when the expression of the recombinant protein is not easy, such as Pneumococcal surface protein A (PspA) (e.g., the hydrophilicity is extremely low, when the recombinant protein is expressed, most of them are separated into inclusion body fractions or when the recombinant fusion protein is purified. When recombinant protein expression is difficult due to poor stability due to low protein stability), obtaining a recombinant FlaB-antigen fusion protein is extremely difficult or has a low yield.

The detailed mechanisms are not yet known, but hypotheses have been suggested that they may be due to the inherent properties of specific proteins mentioned above, or because they are easily degraded due to structural vulnerability after expression of recombinant proteins.

The present inventors made diligent research efforts to develop linking peptides for biomolecule binding for use in the preparation of fusion proteins. As a result, when the connecting peptide was prepared using a part of the PspA protein, which is a surface protein of Streptococcus pneumoniae, it was confirmed that the activity of the biomolecules bound thereto was enhanced.

It is therefore an object of the present invention to provide a linking peptide for biomolecule binding derived from PspA protein.

One aspect of the invention relates to a linking peptide for binding a biomolecule comprising the amino acid sequence of SEQ ID NO: 4, 10 or 28.

The same or different biomolecules may be respectively bonded to both ends of the biomolecule binding coupling peptide.

The biomolecule may be a protein, and may be, for example, an antigen, an antibody, an enzyme, a substrate, a ligand, and / or a receptor, but is not limited thereto.

Another aspect of the invention relates to a nucleic acid sequence encoding a peptide comprising the amino acid sequence of SEQ ID NO: 4, 10 or 28.

The nucleic acid sequence may include a nucleotide sequence of SEQ ID NO: 3, 9 or 27, for example, may be a nucleic acid sequence consisting of the nucleotide sequence of SEQ ID NO: 3, 9 or 27.

The nucleic acid sequence may include a base sequence having substantial identity to the nucleotide sequence of SEQ ID NO: 3, 9 or 27, for example, substantially identical to the nucleic acid sequence consisting of the nucleotide sequence of SEQ ID NO: 3, 9 or 27 It may be a nucleic acid sequence having.

The substantial identity aligns each nucleotide sequence with any other nucleotide sequence as closely as possible and analyzes the sequence so that the any other nucleotide sequence is at least 70%, at least 90%, or 98% with each nucleotide sequence. It means having the above sequence homology.

The nucleic acid sequence may be part of a Pneumococcal surface protein A (PspA) gene.

The PspA may be derived from an N-terminal site forming an α-helix structure in the PspA protein, which is a surface protein of Streptococcus pneumoniae.

One aspect of the invention relates to a recombinant vector comprising a nucleic acid sequence encoding a peptide comprising the amino acid sequence of SEQ ID NO: 4, 10 or 28.

The recombinant vector may further include a nucleic acid sequence encoding a target biomolecule operably linked to the N-terminus and / or C-terminus of the nucleic acid sequence encoding the peptide.

The term "vector" means a means for expressing a gene of interest in a host cell. For example, viral vectors such as plasmid vectors, cosmid vectors and bacteriophage vectors, adenovirus vectors, retrovirus vectors, and adeno-associated virus vectors are included. Vectors that can be used as the recombinant vector are plasmids often used in the art (eg, pSC101, pGV1106, pACYC177, ColE1, pKT230, pME290, pBR322, pUC8 / 9, pUC6, pBD9, pHC79, pIJ61, pLAFR1, pHV14). , pGEX series, pET series and pUC19, etc.), phages (eg, λgt4λB, λ-Charon, λΔz1 and M13, etc.) or viruses (eg, SV40, etc.) can be produced by, but not limited to Do not.

The recombinant vector can typically be constructed as a vector for cloning or a vector for expression. The expression vector may be a conventional one used in the art to express foreign proteins in plants, animals or microorganisms. The recombinant vector may be constructed through various methods known in the art.

The recombinant vector may be constructed using prokaryotic or eukaryotic cells as hosts. For example, when the vector used is an expression vector and the prokaryotic cell is a host, a strong promoter capable of promoting transcription (for example, a pL ^λ promoter, a CMV promoter, a trp promoter, a lac promoter, a tac promoter, T7 promoters, etc.), ribosome binding sites for initiation of translation, and transcription / detox termination sequences. In the case of eukaryotic cells as hosts, replication origins that operate in eukaryotic cells included in the vector include f1 origin, SV40 origin, pMB1 origin, adeno origin, AAV origin and BBV origin. It is not limited. In addition, promoters derived from the genome of mammalian cells (eg, metallothionine promoters) or promoters derived from mammalian viruses (eg, adenovirus late promoters, vaccinia virus 7.5K promoters, SV40 promoters, Cytomegalovirus promoter and tk promoter of HSV) can be used and generally have a polyadenylation sequence as a transcription termination sequence.

One aspect of the invention relates to a host cell transformed with a recombinant vector comprising a nucleic acid sequence encoding a peptide comprising the amino acid sequence of SEQ ID NO: 4, 10 or 28.

In one embodiment of the present invention, a transformant may be made by inserting a recombinant vector into a host cell, and the transformant may be obtained by introducing the recombinant vector into an appropriate host cell.

The host cell may be any host cell known in the art as a cell capable of continuously cloning or expressing the expression vector while being stable.

Host cells used in the present invention may include E. coli, yeast, animal cells, plant cells, insect cells and the like, prokaryotic cells, for example, E. coli JM109, E. coli BL21, E. coli RR1, E. coli LE392, E. coli B, E. coli X 1776, E. coli W3110, Bacillus subtilis, Bacillus genus strains, such as Bacillus thuringiensis, and Salmonella typhimurium, Serratia marsonsons and Enterobacteria and strains such as various Pseudomonas species, and when transforming eukaryotic cells as host cells, yeast (Saccharomyce cerevisiae), insect cells, plant cells and animal cells, such as Sp2 / 0, CHO (Chinese) hamster ovary) K1, CHO DG44, PER.C6, W138, BHK, COS7, 293, HepG2, Huh7, 3T3, RIN, MDCK cell line, etc. may be used, but is not limited thereto.

The transport (introduction) of the polynucleotide or the recombinant vector including the same into a host cell may employ a transport method well known in the art. For example, when the host cell is a prokaryotic cell, a CaCl ₂ method or an electroporation method may be used. When the host cell is a eukaryotic cell, a micro-injection method, calcium phosphate precipitation method, electroporation method, Liposome-mediated transfection and gene bombardment may be used, but is not limited thereto.

The method of selecting the transformed host cell can be easily carried out according to methods well known in the art using a phenotype expressed by a selection label. For example, when the selection marker is a specific antibiotic resistance gene, the transformant can be easily selected by culturing the transformant in a medium containing the antibiotic.

The present invention relates to a linking peptide for biomolecule binding derived from a PspA protein. When the fusion protein is prepared using the linking peptide of the present invention, the mucosal immunity or the protective immune activity caused by the antigen linked to the linking peptide are not used. Since it is enhanced in case it is not, it can be effectively used as a linking peptide of the biomolecule.

1A is a schematic diagram showing a vector for preparing a FlaB-linker-FomA fusion protein according to an embodiment of the present invention.

Figure 1b is a schematic diagram showing the manufacturing process of the FlaB-linker-FomA fusion protein according to an embodiment of the present invention.

2 is SDS electrophoresis and western blotting results for identifying FlaB-Linker-FomA and FomA-Linker-FlaB fusion proteins according to an embodiment of the present invention.

Figure 3 is a graph comparing the bioactivity of the FlaB-Linker-FomA fusion protein according to an embodiment of the present invention.

4 is SDS electrophoresis and western blotting results for identifying FlaB-linker-Hgp44 and Hgp44-linker-FlaB fusion proteins according to an embodiment of the present invention.

Figure 5a is a graph comparing the bioactivity of the FlaB-linker-Hgp44 fusion protein according to an embodiment of the present invention.

Figure 5b is a graph comparing the bioactivity of the Hgp44-linker-FlaB fusion protein according to an embodiment of the present invention.

Figure 6a is a graph comparing the antigen specific IgG antibody titers in the serum of the FlaB-linker-Hgp44 fusion protein vaccine according to an embodiment of the present invention.

Figure 6b is a graph comparing the antigen specific IgA antibody titers in serum of the FlaB-linker-Hgp44 fusion protein vaccine according to an embodiment of the present invention.

Figure 7 is a graph comparing the antigen-specific secretory IgA antibody titers in the saliva of the FlaB-linker-Hgp44 fusion protein vaccine according to an embodiment of the present invention.

It relates to a linking peptide for biomolecule binding comprising the amino acid sequence of SEQ ID NO: 4, 10 or 28.

Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are only for illustrating the present invention, it will be apparent to those skilled in the art that the scope of the present invention is not to be construed as being limited by these examples.

Example 1 Linked Peptide Selection

1-1. Preparation of 12mer Amino Acid Linked Peptides

In order to form stable three-dimensional structure of the fusion protein, the N-terminal part that forms α-helix structure in PspA protein (SEQ ID NO: 2), which is a surface protein of Streptococcus pneumoniae, was selected. Nucleotide positions 5 ′ 1 to 36 of the PspA gene (SEQ ID NO: 1) were selected to prepare a 12mer amino acid linking peptide consisting of 12 amino acids (SEQ ID NO: 3).

In order to obtain a nucleic acid fragment of FlaB-12mer linking peptide additionally comprising FlaB, which is a major component of flagellin, a subunit protein of sepsis Vibrio vulnificus flagellum, the 12mer amino acid linking peptide, a plasmid for expressing recombinant FlaB-PspA protein Phosphorus pCMM8208 (Korean Patent No. 10-1130884) was used as a template, and the FlaB-12mer linker (hereinafter, FlaB 12 C-term linker) fragments were amplified using PCR primers represented by SEQ ID NOs: 5 and 6. It was also amplified using PCR primers represented by SEQ ID NO: 7 and SEQ ID NO: 8 (FlaB 3 'primer) to obtain 12mer linker-FlaB (hereinafter FlaB 12 N-term linker) fragments (Table 1, Figure 1A). .

SEQ ID NO:	designation		order
5	5 'primer for FlaB C-term linker nucleotide amplification (FlaB 5' primer) (underline: restriction enzyme NdeI recognition site)	gaattc atggcagtgaatgta aatacaa
6	3 'primer for FlaB 12 mer C-term linker nucleotide amplification	ggccgccgtctttctcagctttagactgactggctacgggagagtcgac
7	5 'primer for FlaB 12 mer N-term linker nucleotide amplification		tcgactctcccgtagccagtcagtctaaagctgagaaagacggc
8	3 'primer for amplifying FlaB N-term linker nucleotides (underlined: restriction enzyme PstI recognition site)	ctgcag ttagcctagtagacttagcgc
11	3 'primer for FlaB 24 mer C-term linker nucleotide amplification		ggccgcctttcgcattcttagcatctttcttcgctgcatcatagtctttctcagctttagactgactggctacgggagag
12	5 'primer for FlaB 24 mer N-term linker nucleotide amplification	tcgactctcccgtagccagtcagtctaaagctgagaaagactatgatgcagcgaagaaagatgctaagaatgcgaaaggc
13	3 'primer for FlaB 36 mer C-term linker nucleotide amplification (underlined: restriction enzyme NotI recognition site)	atagttta gcggccgccatca tctaaagccttttgagcatcttc
14	5 'primer for FlaB 36 mer N-term linker nucleotide amplification (underline: restriction enzyme SalI recognition site)	acgc gtcgac tctcccgtagc cagtcagtctaaag

Escherichia coli pTYB12 plasmid treated with the above-mentioned FlaB 12 C-term linker PCR amplified nucleic acid fragment and NdeI and NotI for easy expression in coli ) (Korea Patent No. 10-1130884, IMPACT (Intein Mediated Purification with an Affinity Chitin) -binding Tag) expression vector, AmpR, New England Biolab, Inc.), respectively, was subjected to agarose electrophoresis to obtain respective nucleic acid fragments. The pTYB12 plasmid is an N-terminal fusion expression vector in which an intein tag: Apr was fused to the N terminus of a target protein. The two nucleic acid fragments obtained were treated by ligation to ligase (pCMM11201).

Likewise, the FlaB 12 N-term linker PCR amplified nucleic acid fragments and pTYB12 plasmids treated with SalI and PstI restriction enzymes were agarose electrophoresed to obtain respective nucleic acid fragments. The two nucleic acid fragments obtained were linked by treating ligase (pCMM11202).

1-2. Preparation of 24mer Amino Acid Linked Peptides

In the same manner as in Example 1-1, in order to prepare a 24mer amino acid linking peptide, 5 '1 to 72 nucleotide sites of the pspA gene were selected (SEQ ID NO: 9).

To obtain nucleic acid fragments of FlaB-24mer linking peptides, FlaB-24mer linker (hereinafter FlaB 24 C-term linker) fragments were amplified using PCR primers represented by SEQ ID NOs: 5 and 11. It was also amplified using PCR primers represented by SEQ ID NO: 12 and SEQ ID NO: 8 to obtain a 24mer linker-FlaB (hereinafter FlaB 24 N-term linker) fragment (Table 1).

To facilitate expression in E. coli, the plasmid pCMM11203, FlaB 12 N-term linker was replaced with FlaB 24 N by replacing the FlaB 12 C-term linker with the FlaB 24 C-term linker. A plasmid pCMM11204 linked by replacement with a -term linker was prepared.

1-3. Preparation of 36mer Amino Acid Linked Peptides

In the same manner as in Example 1-1, in order to prepare a 36mer amino acid linking peptide, 5 '1 to 108 nucleotide sites of the pspA gene were selected (SEQ ID NO: 27).

In order to obtain nucleic acid fragments of the FlaB-36mer linking peptide, the FlaB-36mer linker (hereinafter referred to as FlaB 36 C-term linker) fragments were amplified using PCR primers represented by SEQ ID NOs: 5 and 13. It was also amplified using PCR primers represented by SEQ ID NO: 14 and SEQ ID NO: 8 to obtain a 36mer linker-FlaB (hereinafter FlaB 36 N-term linker) fragment (Table 1).

To facilitate expression in E. coli, the plasmid pCMM11205, FlaB 12 N-term linker was replaced with FlaB 36 N by replacing the FlaB 12 C-term linker with the FlaB 36 C-term linker. The plasmid pCMM11206 linked by replacement with a -term linker was prepared.

Example 2 Preparation of FlaB-Linker-FomA Fusion Proteins

2-1. Preparation of FlaB-12mer Linker-FomA Fusion Proteins

In order to obtain nucleic acid fragments of FomA antigen for fusion protein, fomA amplified fragments were obtained through PCR reaction using genomic DNA of Fusobacterium nucleatum strain of SEQ ID NO: 15 as a template. The primer pairs used are the primers represented by SEQ ID NOs: 16 and 17 (Table 2).

SEQ ID NO:	designation	order
16	5 'primer for fomA amplification	catatgatggcagtgaatgtaaatac
17	3 'primer for fomA amplification	gcggccgcgaaacgtcactttcataccgg

To prepare the FlaB-12mer linker-FomA fusion protein, the pCMM11201 plasmid was restriction-treated with NotI and the respective nucleic acid fragments were obtained using the PCR amplification fragments and agarose gel electrophoresis and gel recovery. The two kinds of nucleic acid fragments obtained were treated by ligase to carry out ligation. The obtained recombinant plasmid was named pCMM11207.

The plasmid pCMM11207 was introduced through transformation into E. coli ER2566 (New England Biolabs, Inc.) for cloning the expression strain of the FlaB-12mer linker-FomA fusion protein. The cloned strain was plated on LB plate medium containing ampicillin, and the surviving strain was selected as a cloned strain. PCR was performed using primer pairs represented by SEQ ID NOs: 5 and 17 to determine whether the selected strain had a plasmid encoding FlaB-12mer linker-FomA. Agarose gel electrophoresis confirmed that the PCR product had a size of 2 Kb, and the clone identified as having was named CMM11201.

To express the FlaB-12mer linker-FomA recombinant fusion protein, 0.5 mM 5-bromo-indole-3-chloro-isopropyl-β-D-galactopyranoside (IPTG) was added to E. coli to induce expression. It was. FlaB-12mer linker-FomA fusion of SEQ ID NO: 18 from an intein fusion protein using a chitin bead column and 1,4-dithiothreitol (1,4-DTT) according to the manufacturer's (New England Biolabs Inc.) instructions Proteins were obtained (FIG. 1B). Endotoxins contained in the isolated proteins were removed using AffinityPak ™ Detoxi Gel ™ Endotoxin Removing gel (Pierece).

2-2. Preparation of FlaB-24mer Linker-FomA Fusion Proteins

A fomA amplified piece was obtained according to Example 2-1. In addition, pCMM11203 plasmid was digested with NotI to prepare FlaB-24mer linker-FomA fusion protein, and each nucleic acid fragment was obtained by PCR amplification fragments and agarose gel electrophoresis and gel recovery. . The two kinds of nucleic acid fragments obtained were treated by ligase to carry out ligation. The obtained recombinant plasmid was named pCMM11208.

The plasmid pCMM11208 was introduced into E. coli ER2566 via transformation for cloning the expression strain of the FlaB-24mer linker-FomA fusion protein. Cloning was confirmed in the same manner as in Example 2-1, and the clone identified as having a 2 Kb size PCR product was named CMM11202.

For expression of the FlaB-24mer linker-FomA recombinant fusion protein, FlaB-24mer linker-FomA fusion proteins of SEQ ID NO: 19 were obtained for CMM11202 Escherichia coli in the same manner as in Example 2-1.

2-3. Preparation of FlaB-36mer Linker-FomA Fusion Proteins

A fomA amplified piece was obtained according to Example 2-1. In addition, to prepare the FlaB-36mer linker-FomA fusion protein, the pCMM11205 plasmid was restriction-treated with NotI, and the respective nucleic acid fragments were obtained using the PCR amplification fragments and agarose gel electrophoresis and gel recovery. . The two kinds of nucleic acid fragments obtained were treated by ligase to carry out ligation. The obtained recombinant plasmid was named pCMM11209.

The plasmid pCMM11209 was introduced via transformation into E. coli ER2566 for cloning the expression strain of FlaB-36mer linker-FomA fusion protein. Cloning was confirmed in the same manner as in Example 2-1, and the clone identified as having a 2 Kb size PCR product was named CMM11203.

For expression of FlaB-36mer linker-FomA recombinant fusion protein, FlaB-36mer linker-FomA fusion proteins of SEQ ID NO: 20 were obtained for CMM11203 Escherichia coli in the same manner as in Example 2-1.

Example 3 Preparation of FlaB-Linker-Hgp44 Fusion Proteins

3-1. Preparation of FlaB-12mer Linker-Hgp44 Fusion Proteins

To obtain nucleic acid fragments of the Hgp44 antigen for the fusion protein, hgp44 amplified fragments were obtained by PCR using genomic DNA of the Porphyromonas gingivalis strain represented by SEQ ID NO: 21 as a template. Primer pairs used are shown in SEQ ID NO: 22 and SEQ ID NO: 23 (Table 3).

SEQ ID NO:	designation	order
22	5 'primer for amplifying hgp44	catatgagcggtaggccgaaattgtg
23	3 'primer for hgp44 amplification	gtcgactcttttgccgttagctttgatctcc

To prepare the FlaB-12mer linker-Hgp44 fusion protein, the pCMM11201 plasmid was restriction-treated with NotI and the respective nucleic acid fragments were obtained using the PCR amplification fragments and agarose gel electrophoresis and gel recovery. The two kinds of nucleic acid fragments obtained were treated by ligase to carry out ligation. The obtained recombinant plasmid was named pCMM11210.

The plasmid pCMM11210 was introduced via transformation into E. coli ER2566 for cloning the expression strain of the FlaB-12mer linker-Hgp44 fusion protein. The cloned strains were plated on LB plate medium containing ampicillin, and the surviving strains were selected as cloned strains. PCR was performed using primer pairs represented by SEQ ID NOs: 5 and 23 to confirm that the selected strain had a plasmid encoding FlaB-12mer linker-Hgp44. Agarose gel electrophoresis confirmed that the PCR product had a size of 2 Kb, and the clone identified as having was named CMM11204.

For expression of FlaB-12mer linker-Hgp44 recombinant fusion protein, FlaB-12mer linker-Hgp44 fusion proteins of SEQ ID NO: 24 were obtained in the same manner as in Example 2-1 for CMM11204 E. coli.

3-2. Preparation of FlaB-24mer Linker-Hgp44 Fusion Proteins

The Hgp44 amplified fragment was obtained according to Example 3-1. In addition, pCMM11203 plasmid was restriction-treated with NotI to prepare FlaB-24mer linker-Hgp44 fusion protein, and each nucleic acid fragment was obtained by PCR amplification fragments and agarose gel electrophoresis and gel recovery. . Linkage was performed by treating the obtained two kinds of nucleic acid fragments with ligase, and the obtained recombinant plasmid was named pCMM11211.

PCMM11211 was transfected into E. coli ER2566 for cloning the expression strain of the FlaB-24mer linker-Hgp44 fusion protein. Cloning was confirmed in the same manner as in Example 3-1, and the clone identified as having a 2 Kb size PCR product was named CMM11205.

For expression of FlaB-24mer linker-Hgp44 recombinant fusion protein, FlaB-24mer linker-Hgp44 fusion proteins of SEQ ID NO: 25 were obtained in the same manner as in Example 2-1 for CMM11205 E. coli.

3-3. Preparation of FlaB-36mer Linker-Hgp44 Fusion Proteins

The Hgp44 amplified fragment was obtained according to Example 3-1. In addition, to prepare the FlaB-36mer linker-Hgp44 fusion protein, pCMM11205 plasmid was restriction enzyme-treated with NotI, and each nucleic acid fragment was obtained using the PCR amplification fragment and the agarose gel electrophoresis and gel recovery method. . Linkage was performed by treating the obtained two kinds of nucleic acid fragments with ligase, and the obtained recombinant plasmid was named pCMM11212.

PCMM11212 was introduced into E. coli ER2566 for cloning the expression strain of the FlaB-36 mer linker-Hgp44 fusion protein. Cloning was confirmed in the same manner as in Example 3-1, and the clone identified as having a 2 Kb size PCR product was named CMM11206.

For expression of the FlaB-36mer linker-Hgp44 recombinant fusion protein, the FlaB-36mer linker-Hgp44 fusion proteins of SEQ ID NO: 26 were obtained for CMM11206 Escherichia coli in the same manner as in Example 2-1.

Example 4 Preparation of FomA-Linker-FlaB Fusion Proteins

4-1. Preparation of FomA-12mer Linker-FlaB Fusion Proteins

A fomA amplified piece was obtained according to Example 2-1. In addition, pCMM11202 plasmid was restriction-treated with SalI for the preparation of FomA-12mer linker-FlaB fusion protein, and the respective nucleic acid fragments were obtained by PCR amplification fragments and agarose gel electrophoresis and gel recovery. . Linkage was performed by treating the two kinds of nucleic acid fragments obtained by ligase, and the obtained recombinant plasmid was named pCMM11216.

For cloning the expression strain of FomA-12mer linker-FlaB fusion protein, the plasmid pCMM11216 was introduced into E. coli ER2566 via transformation. The cloned strains were plated on LB plate medium containing ampicillin, and the surviving strains were selected as cloned strains. In order to confirm that the selected strain has a plasmid encoding FomA-12mer linker-FlaB, PCR was performed using primer pairs represented by SEQ ID NOs: 8 and 16. Agarose gel electrophoresis confirmed that the PCR product had a size of 2 Kb, and the clone identified as having was named CMM11210.

For expression of FomA-12mer linker-FlaB recombinant fusion protein, FomA-12mer linker-FlaB fusion proteins of SEQ ID NO: 29 were obtained in the same manner as in Example 2-1 for CMM11210 Escherichia coli.

4-2. Preparation of FomA-24mer Linker-FlaB Fusion Proteins

A fomA amplified piece was obtained according to Example 2-1. In addition, for the preparation of FomA-24mer linker-FlaB fusion protein, the pCMM11204 plasmid was restriction enzyme-treated with SalI, and each nucleic acid fragment was obtained using the PCR amplification fragment and the agarose gel electrophoresis and gel recovery method. Linkage was performed by treating ligase with the obtained two kinds of nucleic acid fragments, and the obtained recombinant plasmid was named pCMM11217.

The plasmid pCMM11217 was introduced via transformation into E. coli ER2566 for cloning the expression strain of FomA-24mer linker-FlaB fusion protein. The cloned strains were plated on LB plate medium containing ampicillin, and the surviving strains were selected as cloned strains. PCR was performed using primer pairs represented by SEQ ID NOs: 8 and 16 to confirm that the selected strain had a plasmid encoding FomA-24mer linker-FlaB. Agarose gel electrophoresis confirmed that the PCR product had a size of 2Kb, and the clone identified as having was named CMM11211.

For expression of FomA-24mer linker-FlaB recombinant fusion protein, FomA-24mer linker-FlaB fusion proteins of SEQ ID NO: 30 were obtained for CMM11211 Escherichia coli in the same manner as in Example 2-1.

4-3. Preparation of FomA-36mer Linker-FlaB Fusion Proteins

A fomA amplified piece was obtained according to Example 2-1. In addition, pCMM11206 plasmid was restriction-treated with SalI for the preparation of FomA-36mer linker-FlaB fusion protein, and each nucleic acid fragment was obtained by PCR amplification fragments and agarose gel electrophoresis and gel recovery. The two kinds of nucleic acid fragments obtained were treated by ligase to carry out ligation. The obtained recombinant plasmid was named pCMM11218.

The plasmid pCMM11218 was introduced via transformation into E. coli ER2566 for cloning the expression strain of FomA-36mer linker-FlaB fusion protein. The cloned strains were plated on LB plate medium containing ampicillin, and the surviving strains were selected as cloned strains. PCR was performed using primer pairs represented by SEQ ID NOs: 8 and 16 to confirm that the selected strain had a plasmid encoding FomA-36mer linker-FlaB. Agarose gel electrophoresis confirmed that the PCR product had a size of 2 Kb, and the clone identified as having was named CMM11212.

For expression of FomA-36mer linker-FlaB recombinant fusion protein, FomA-36mer linker-FlaB fusion proteins of SEQ ID NO: 31 were obtained for CMM11212 Escherichia coli in the same manner as in Example 2-1.

Example 5 Preparation of Hgp44-Linker-FlaB Fusion Proteins

5-1. Preparation of Hgp44-12mer Linker-FlaB Fusion Proteins

The Hgp44 amplified fragment was obtained according to Example 3-1. In addition, to prepare the Hgp44-12mer linker-FlaB fusion protein, the pCMM11202 plasmid was restriction enzyme-treated with SalI, and the respective nucleic acid fragments were obtained using the PCR amplification fragments and agarose gel electrophoresis and gel recovery. The two kinds of nucleic acid fragments obtained were treated by ligase to carry out ligation. The obtained recombinant plasmid was named pCMM11219.

The plasmid pCMM11219 was introduced via transformation into E. coli ER2566 for cloning the expression strain of Hgp44-12mer linker-FlaB fusion protein. The cloned strains were plated on LB plate medium containing ampicillin, and the surviving strains were selected as cloned strains. PCR was performed using primer pairs represented by SEQ ID NOs: 8 and 22 to confirm that the selected strain had a plasmid encoding FomA-12mer linker-FlaB. Agarose gel electrophoresis confirmed that the PCR product had a size of 2 Kb, and the clone identified as having was named CMM11213.

For expression of the Hgp44-12mer linker-FlaB recombinant fusion protein, the Hgp44-12mer linker-FlaB fusion proteins of SEQ ID NO: 32 were obtained in the same manner as in Example 2-1 for CMM11213 Escherichia coli.

5-2. Preparation of Hgp44-24mer Linker-FlaB Fusion Proteins

The Hgp44 amplified fragment was obtained according to Example 3-1. In addition, to prepare the Hgp44-24mer linker-FlaB fusion protein, the pCMM11204 plasmid was restriction-treated with SalI, and each nucleic acid fragment was obtained by using the PCR amplification fragment and the agarose gel electrophoresis and gel recovery method. Linkage was performed by treating the obtained two kinds of nucleic acid fragments with ligase, and the obtained recombinant plasmid was named pCMM11220.

The plasmid pCMM11220 was introduced via transformation into E. coli ER2566 for cloning the expression strain of the Hgp44-24mer linker-FlaB fusion protein. The cloned strains were plated on LB plate medium containing ampicillin, and the surviving strains were selected as cloned strains. PCR was performed using primer pairs represented by SEQ ID NOs: 8 and 22 to confirm that the selected strain had a plasmid encoding Hgp44-24mer linker-FlaB. Agarose gel electrophoresis confirmed that the PCR product had a size of 2 Kb, and the clone identified as having was named CMM11214.

For expression of the Hgp44-24mer linker-FlaB recombinant fusion protein, Hgp44-24mer linker-FlaB fusion proteins of SEQ ID NO: 33 were obtained in the same manner as in Example 2-1 for CMM11214 Escherichia coli.

5-3. Preparation of Hgp44-36mer Linker-FlaB Fusion Proteins

The Hgp44 amplified fragment was obtained according to Example 3-1. In addition, to prepare the Hgp44-36mer linker-FlaB fusion protein, the pCMM11206 plasmid was restriction enzyme-treated with SalI, and the respective nucleic acid fragments were obtained using the PCR amplification fragments and agarose gel electrophoresis and gel recovery. Linkage was performed by treating the obtained two kinds of nucleic acid fragments with ligase, and the obtained recombinant plasmid was named pCMM11221.

The plasmid pCMM11221 was transfected into E. coli ER2566 for cloning the expression strain of the Hgp44-36mer linker-FlaB fusion protein. The cloned strains were plated on LB plate medium containing ampicillin, and the surviving strains were selected as cloned strains. PCR was performed using primer pairs represented by SEQ ID NOs: 8 and 22 to confirm that the selected strain had a plasmid encoding Hgp44-36mer linker-FlaB. Agarose gel electrophoresis confirmed that the PCR product had a size of 2 Kb, and the clone identified as having was named CMM11215.

For expression of the Hgp44-36mer linker-FlaB recombinant fusion protein, the Hgp44-36mer linker-FlaB fusion proteins of SEQ ID NO: 34 were obtained in the same manner as in Example 2-1 for CMM11215 Escherichia coli.

Test Example 1 Comparison of FlaB-Linker-FomA Fusion Proteins

1-1. Comparison of Stability and Yield of FlaB-Linker-FomA Fusion Proteins

Western blotting of the FlaB-linker-FomA fusion protein using anti-FlaB serum showed a much lower degradation pattern for FomA-36mer linker-FlaB fusion protein compared to FlaB alone. This means that the fusion protein has higher stability than FlaB alone (FIG. 2).

Protein recovery in 1 L culture of FlaB-Linker-FomA fusion protein is shown in Table 4 below. In the case of FomA alone expression, 0.6 mg was recovered in 1 L culture, whereas the yield increased by 2 to 3 times from 1.12 to 1.81 mg according to the insertion of the linking peptide.

FomA	Yield (mg / L)
FlaB-FomA	0.6
FlaB-12-FomA	1.82
FlaB-24-FomA	1.12
FlaB-36-FomA	1.2

Test Example 1-2. Comparison of Bioactivity of FlaB-Linker-FomA Fusion Proteins

In order to check whether the FlaB-Linker-FomA fusion protein has a stimulating ability against TLR5, which is the action point of flagellin, incubate overnight by injecting 293-T cells into a well plate incubator by 1 × 10 ⁵ cells. NF-κ-Luc plasmid (Effectene, QIAGEN) was obtained from Professor Kim Jung-mok of the Department of Microbiology, Hanyang University Medical College, p3xFlag-hTLR-5 plasmid cloned with TLR-5 gene derived from sepsis vibrio (US Obtained from Steven B. Mizel of Wake Forest University School of Medicine, Department of Microbiology and Immunology) and β-galactosidase expression control plasmid (Clontech) simultaneously introduced into cells.

After 24 hours of further incubation, 100% or 250 ng of FlaB-Linker-FomA fusion protein was replaced with fresh medium and separated by IMPACT-CN system (NEB) for a certain period of time. Berthold) was used to determine the degree of transcription of NF-κB, and the results are shown in FIG. 3.

As can be seen in Figure 3, the FlaB-Linker-FomA fusion protein showed a similar or twice as high TLR5 stimulation capacity as the same dose treated FlaB. This suggests that the FlaB-Linker-FomA fusion protein has similar or higher bioactivity than FlaB alone.

Test Example 2 Comparison of FlaB-Linker-Hgp44 Fusion Proteins

2-1. Comparison of Stability and Yield of FlaB-Linker-Hgp44 Fusion Proteins

Western blotting of the FlaB-linker-Hgp44 fusion protein with anti-FlaB serum showed a much lower proteolytic pattern for the Hgp44-36mer linker-FlaB fusion protein compared to FlaB alone. This suggests that the fusion protein has higher stability than FlaB alone (FIG. 4).

Protein recovery in 1 L culture of FlaB-Linker-Hgp44 fusion protein is shown in Table 5 below. In the case of Hgp44 alone expression, 0.633 mg was recovered in 1 L culture, whereas when fusion protein containing FlaB was expressed, 2 mg of FlaB-Hgp44 and 1 mg of Hgp44-FlaB showed 1.5 to 3 fold improvement. .

In addition, the yield of FlaB-linker-Hgp44 increased 3 to 4 times from 2 to 2.5 mg with the insertion of the linking peptide, and the yield was 1.5 to 2 mg from 2.5 to 3, even for Hgp44-linker-FlaB. The yield of the pear was improved.

Hgp44	Yield (mg / L)
Hgp44	0.633
FlaB-Hgp44	2
FlaB-12-Hgp44	2
FlaB-24-Hgp44	2.5
FlaB-36-Hgp44	2.5
Hgp44-FlaB	One
Hgp44-FlaB	2
Hgp44-FlaB	1.5
Hgp44-FlaB	1.5

2-2. Comparison of Bioactivity of FlaB-Linker-Hgp44 Fusion Proteins

TLR5 stimulation ability was measured in the same manner as in Test Example 2-1. FlaB-linker-Hgp44 and Hgp44-linker-FlaB fusion protein showed twice as high TLR5 stimulating activity as the single FlaB treated with 100 and 250 ng of the same dose (Fig. 5). The Y axis was expressed as the relative increase in expression with the value of the control group as 1. This suggests that FlaB-Linker-Hgp44 and Hgp44-Linker-FlaB fusion proteins have similar or higher bioactivity than FlaB alone.

2-3. Comparison of Antibody Titers for FlaB-Linker-Hgp44 Fusion Protein-based Vaccines

FlaB-linker-Hgp44 fusion protein-based vaccines according to the present invention were immunized three, five and six times at weekly intervals into the nasal cavity of 6-week-old female Balb / c mice (Oriental Bio, Korea) and obtained serum to obtain FlaB- The formation of linker-Hgp44 fusion protein specific antibodies was compared.

When administered with FlaB-Linker-Hgp44 fusion protein based vaccine, there was a statistically significantly higher titer of IgG and IgA in antigen (Hgp44) specific serum compared to Hgp44 based vaccine (FIG. 6) and secretion of secretory IgA in antigen specific saliva. The titer rise was shown (FIG. 7). This indicates that FlaB-Linker-Hgp44 fusion protein based vaccines have higher potency than vaccines that do not contain linking peptides.

As mentioned above, specific portions of the present disclosure have been described in detail, and it is apparent to those skilled in the art that such specific techniques are merely preferred embodiments, and thus the scope of the present disclosure is not limited thereto. something to do. Thus, the substantial scope of the present invention will be defined by the appended claims and their equivalents.

The present invention relates to a linking peptide for biomolecule binding, and more particularly, to a linking peptide that can be used for the production of a fusion protein by binding a biomolecule to a terminal using a portion of the PspA protein, which is a surface protein of pneumococci.

Claims (10)

1. A linking peptide for binding a biomolecule comprising the amino acid sequence of SEQ ID NO: 4, 10 or 28.
2. According to claim 1, wherein the biomolecule binding linking peptide is a biomolecule binding linking peptide is bonded to the same or different biomolecules at both ends.
3. According to claim 1, wherein the biomolecule is a protein, binding peptide for biomolecule binding.
4. A nucleic acid sequence encoding a peptide comprising the amino acid sequence of SEQ ID NO: 4, 10 or 28.
5. The nucleic acid sequence of claim 4, wherein the nucleic acid sequence comprises the nucleotide sequence of SEQ ID NO: 3, 9 or 27. 6.
6. The nucleic acid sequence of claim 4, wherein the nucleic acid sequence is part of a Pneumococcal surface protein A (PspA) gene.
7. The nucleic acid sequence of claim 6, wherein the PspA is derived from Streptococcus pneumoniae.
8. A recombinant vector comprising a nucleic acid sequence encoding a peptide comprising the amino acid sequence of SEQ ID NO: 4, 10 or 28.
9. The recombinant vector of claim 8, wherein the nucleic acid sequence further comprises a nucleic acid sequence encoding a target biomolecule operably linked to the N-terminus and / or C-terminus.
10. A host cell transformed with a recombinant vector comprising a nucleic acid sequence encoding a peptide comprising the amino acid sequence of SEQ ID NO: 4, 10 or 28.

Images