WO2024035185A1 - Platform for preparing nucleic acid vaccine - Google Patents

Abstract

The present invention relates to a platform for preparing a nucleic acid vaccine and, specifically, to a nucleic acid molecule comprising a polynucleotide encoding a signal peptide, a polynucleotide encoding a Th cell epitope, a polynucleotide encoding a membrane protein and/or a polynucleotide encoding an antigenic protein. In addition, the present invention relates to a vaccine composition for preventing or treating viral infections, containing the nucleic acid molecule. The platform for preparing an mRNA vaccine, according to the present invention, enables rapid preparation of an mRNA vaccine for a new mutant virus. In addition, a nucleic acid molecule prepared by the platform has excellent intracellular antigen protein expression and extracellular secretion of an antigen protein, and allows an individual to acquire immunity to a virus, and thus can be effectively used for preventing and treating viral infections.

Description

Platform for nucleic acid vaccine manufacturing

The present invention relates to a platform for manufacturing nucleic acid vaccines, specifically comprising a polynucleotide encoding a signal peptide, a polynucleotide encoding a Th cell epitope, a polynucleotide encoding a membrane protein, and/or a polynucleotide encoding an antigen protein. , relates to nucleic acid molecules. Additionally, the present invention relates to a vaccine composition for preventing or treating viral infections containing the above nucleic acid molecules.

Currently, vaccines are being developed and manufactured in a variety of ways, and specific types include attenuated vaccine, which injects the pathogen in an attenuated state, and a vaccine made by inactivating the causative agent (toxin) that causes the disease, not the pathogen itself. Toxoid vaccine, subunit vaccine made by separately extracting only the part corresponding to the epitope recognized as an antigen, and recombinant vaccine made by separately producing only the epitope using genetic information. there is.

Among the above-mentioned vaccines, recombinant vaccines have the advantage of high safety because they do not contain any components other than the epitope. In particular, nucleic acid vaccines made of mRNA are fast to produce, low cost, and support cell-mediated immunity and body fluids. There are many advantages in being able to induce an immune response, both for human immunity. In addition, the composition of the vaccine can be designed in various ways, such as selecting and using only specific epitopes that induce an immune response among the various components of the antigen, so it is possible to quickly respond to infections caused by new mutant viruses.

However, due to the nature of the mechanism of action of nucleic acid vaccines such as mRNA vaccines, the efficacy of the vaccine is determined by the ability to translate nucleic acid molecules into proteins and the ability to induce an immune response of the translated proteins. Therefore, there is a demand in the art for the development of materials that not only target various diseases but also have improved protein expression ability and corresponding immune response induction ability.

The present inventors established a nucleic acid vaccine manufacturing platform to develop a nucleic acid vaccine that can rapidly respond to infections caused by new mutant viruses. In addition, the present invention was completed by confirming that the nucleic acid molecule produced through the above platform has excellent protein expression ability and can induce a high level of an individual's immune response to the virus.

Each description and embodiment disclosed in the present invention can also be applied to each other description and embodiment. That is, all combinations of the various elements disclosed in the present invention fall within the scope of the present invention. Additionally, the scope of the present invention cannot be considered limited by the specific description described below.

Additionally, terms that are not specifically defined in this specification should be understood to have meanings commonly used in the technical field to which the present invention pertains. Additionally, unless specifically defined by context, the singular includes the plural, and the plural includes the singular.

One aspect of the invention is a polynucleotide encoding a signal peptide; A polynucleotide encoding a Th cell epitope; and at least one of a polynucleotide encoding a membrane protein or a polynucleotide encoding an antigenic protein.

In one embodiment of the invention, the nucleic acid molecule includes a polynucleotide encoding a signal peptide, a polynucleotide encoding a Th cell epitope, and a polynucleotide encoding a membrane protein; or comprising a polynucleotide encoding a signal peptide, a polynucleotide encoding a Th cell epitope, and a polynucleotide encoding an antigenic protein; Alternatively, it may include a polynucleotide encoding a signal peptide, a polynucleotide encoding a Th cell epitope, a polynucleotide encoding a membrane protein, and a polynucleotide encoding an antigen protein.

As used herein, the term “signal peptide” refers to a peptide present at the N-terminus of a protein at the beginning of protein synthesis, and includes a signal sequence, targeting signal, and localization signal. , localization sequence, leader sequence, or leader peptide. The signal peptide according to the present invention can play a role in increasing protein expression or secretion of nucleic acid molecules. At this time, in this specification, 'protein expression' or 'protein expression rate' may be used interchangeably with the same meaning as 'protein translation', 'protein translation rate', 'antigen expression', and 'antigen expression rate'.

Specifically, the signal peptide is IgE (Immunoglobulin E), albumin, interferon gamma (IFN-γ), factor IX (F IX), and mucin-like protein 1 (MLP1). It may be derived from one or more selected from the group consisting of, but is not limited thereto.

The signal peptide is represented by SEQ ID NO: 1, derived from IgE, SEQ ID NO: 5, derived from albumin, SEQ ID NO: 9, derived from IFN-γ, SEQ ID NO: 13, derived from factor IX, and SEQ ID NO: 17, derived from MLP1. It may be represented by one or more amino acid sequences selected from the group consisting of peptides, but is not limited thereto.

The polynucleotide encoding the signal peptide may be represented by one or more base sequences selected from the group consisting of SEQ ID NOs: 58 to 72, but is not limited thereto.

The polynucleotide encoding the signal peptide may be transcribed from one or more base sequences selected from the group consisting of SEQ ID NOs: 2 to 4, 6 to 8, 10 to 12, 14 to 16, and 18 to 20, but is limited thereto. no.

As used herein, the term "Th cell epitope" refers to a peptide that is recognized by Th cells and induces an immune response by Th cells, and the "Th cell (T helper cell)" refers to CD4+ cells, CD4+ T cells. It refers to immune cells, also called helper T lymphocytes, helper T cells, etc. The Th cell epitope according to the present invention can play a role in increasing the ability to produce neutralizing antibodies by inducing an immune response by Th cells, specifically, IFN-γ, TNF-α, IL-2, IL-10, IL- 4. Secretes various cytokines such as IL-5, IL-6, IL-9, IL-10, and IL-13, resulting in antibody production in B cells, activation of cytotoxic T cells, and activation of memory T cells. , it can carry out immune responses such as promoting antibacterial activity of phagocytes, including macrophages.

Specifically, the Th cell epitope may be a peptide derived from one or more selected from the group consisting of tetanus toxoid (Tetanus toxoid), diphtheria toxoid (DTH toxoid), and pertussis toxoid (Purtussis toxoid). The toxoid refers to a substance that has been removed from its toxicity but still has immunogenicity that induces an immune response, and 'Tetanus toxoid' is tetanose, a neurotoxin produced by Clostridium tetani , a tetanus bacterium. Derived from tetanospasmin, 'DTH Toxoid' is derived from an exotoxin produced by Corynebacterium diphtheria , and 'Pertussis toxoid' is from Border, a pertussis bacteria. It may be derived from peptidoglycan fragments produced by Bordetella pertussis . In addition, the Th cell epitope is an epitope composed of a peptide sequence that is presented by MHC Class II of antigen-presenting cells such as macrophages or dendritic cells and is detected by the T cell receptor of Th cells to transmit a stimulating signal. may include.

The Th cell epitope may further include a linker peptide or cleavage sequence. A specific example of the linker peptide may be a GS linker, and the GS linker may include 4 to less than 35 amino acids consisting of glycine (Gly; G) and serine (Ser; S), but is not limited thereto. . Specific examples of the cleavage sequence may be a furin cleavage site or a self cleave site, but are not limited thereto.

The Th cell epitope may be represented by one or more amino acid sequences selected from the group consisting of SEQ ID NOs: 21, 23, 25, 27, 29, 31, and 34, but is not limited thereto.

The polynucleotide encoding the Th cell epitope may be represented by one or more base sequences selected from the group consisting of SEQ ID NOs: 73 to 81, but is not limited thereto.

The polynucleotide encoding the Th cell epitope may be transcribed from one or more base sequences selected from the group consisting of SEQ ID NOs: 22, 24, 26, 28, 30, 32, 33, 35, and 36, but is not limited thereto.

The polynucleotide encoding the Th cell epitope may be located at the 5'-end or 3'-end of the polynucleotide encoding the membrane protein and/or the polynucleotide encoding the antigen protein in the nucleic acid molecule according to the invention. . Preferably, the polynucleotide encoding the Th cell epitope may be located within the nucleic acid molecule at the 5'-end of the polynucleotide encoding the membrane protein and/or the polynucleotide encoding the antigen protein.

Additionally, the Th cell epitope may be located at the N-terminus or C-terminus of the membrane protein and/or antigen protein when the nucleic acid molecule according to the present invention is translated into a protein. Preferably, the Th cell epitope may be located at the N-terminus of the membrane protein and/or antigen protein when the nucleic acid molecule is translated into protein.

It is believed that the Th cell epitope can increase the immunogenicity of the nucleic acid molecule according to the present invention. The immunogenicity of the nucleic acid molecule is further increased when the polynucleotide encoding the Th cell epitope is located at the 5'-end of the polynucleotide encoding the membrane protein and/or the polynucleotide encoding the antigen protein within the nucleic acid molecule. was observed, which means that the nucleic acid molecule can further increase the desired vaccine activity.

As used herein, the term “membrane protein” refers to the structural protein that makes up the outer envelope of the coronavirus. The membrane protein according to the present invention can play a role in inducing an immune response, such as improving the function of CD4+ Th cells. Specifically, the membrane protein may be derived from a non-mutated prototype coronavirus or a mutated variant coronavirus, but is not limited thereto.

The membrane protein may be represented by the amino acid sequence of SEQ ID NO: 37, but is not limited thereto.

The polynucleotide encoding the membrane protein may be represented by one or more base sequences selected from the group consisting of SEQ ID NOs: 82 to 86, but is not limited thereto.

The polynucleotide encoding the membrane protein may be transcribed from one or more base sequences selected from the group consisting of SEQ ID NOs: 38 to 42, but is not limited thereto.

As used herein, the term “antigen protein” refers to a protein that induces an immune response such as production of specific antibodies and secretion of cytokines.

Specifically, the antigen may be derived from a coronavirus. Specific examples of the coronavirus include alphacoronavirus genus (α-CoV, alphaCoV, alphacoronavirus), betacoronavirus genus (β-CoV, betaCoV, betacoronavirus), gammacoronavirus genus (γ-CoV, gammaCoV, gammacoronavirus), or It may belong to the deltacoronavirus genus (δ-CoV, deltaCoV, deltacoronavirus), and more specifically, HCoV-229E, HCoV-NL63, Bat-SARS-like (SL)-ZC45, Bat-SL ZXC21, SARS-CoV, It may be MERS-CoV, HCoV-OC43, HKU-1, MHV-A59, SARS-CoV-1 or SARS-CoV-2, preferably SARS-CoV-1 or SARS-CoV-2, but is limited thereto. It doesn't work.

More specifically, the antigen may be a spike protein derived from a coronavirus, but is not limited thereto. The spike protein may be derived from a non-mutated (prototype) coronavirus or a mutated coronavirus, but is not limited thereto.

The spike protein can play a role in inducing an immune response in the body and generating neutralizing antibodies.

The spike protein may be represented by one or more amino acid sequences selected from the group consisting of SEQ ID NOs: 43, 48, and 53, but is not limited thereto.

The polynucleotide encoding the spike protein may be represented by one or more selected from the group consisting of SEQ ID NOs: 87 to 98, but is not limited thereto.

The polynucleotide encoding the spike protein may be transcribed from one or more base sequences selected from the group consisting of SEQ ID NOs: 44 to 47, 49 to 52, and 54 to 57, but is not limited thereto.

As used herein, the term “nucleic acid molecule” refers to nucleotides or polynucleotides and comprehensively includes DNA and RNA. Nucleotides, which are the basic structural units in the nucleic acid molecule, include not only natural nucleotides but also analogues in which sugar or base sites have been modified. Examples of the modified analog may be pseudouridine, N1-methyl pseudouridine, or a combination thereof, but is not limited thereto. The sequence of a nucleic acid molecule of the invention may vary, including the addition, deletion, non-conservative substitution, or modification of one or more nucleotides.

In addition, all sequences used in the present invention, including base sequences and amino acid sequences, are interpreted to include sequences showing substantial identity with the sequences listed in the sequence list, considering mutations with biologically equivalent activity. . The term 'substantial identity' means that when the sequence of the present invention and any other sequence are aligned to the maximum extent possible and the aligned sequence is analyzed using an algorithm commonly used in the art, the minimum 60% homology, more specifically 70% homology, even more specifically 80% homology, most specifically 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97% , refers to a sequence showing 98% or 99% homology. In addition, “t” written in the sequence list attached as an electronic file means thymine in the DNA base sequence and uracil in the RNA base sequence.

Therefore, sequences having high homology to the sequences represented by SEQ ID NOs. 1 to 98 of the present invention, for example, having a homology of 70% or more, specifically 80% or more, more specifically 90% or more. Sequences should also be construed as falling within the scope of the present invention.

The nucleic acid molecule may include a polynucleotide encoding a signal peptide according to the present invention, a polynucleotide encoding a Th cell epitope, a polynucleotide encoding a membrane protein, and/or a polynucleotide encoding an antigen protein in the following structure. It can be: 5'-[polynucleotide encoding a signal peptide]-[polynucleotide encoding a Th cell epitope]-[polynucleotide encoding a membrane protein]-3'; 5'-[polynucleotide encoding a signal peptide]-[polynucleotide encoding a membrane protein]-[polynucleotide encoding a Th cell epitope]-3'; 5'-[polynucleotide encoding signal peptide]-[polynucleotide encoding Th cell epitope]-[polynucleotide encoding antigenic protein]-3'; 5'-[polynucleotide encoding signal peptide]-[polynucleotide encoding antigenic protein]-[polynucleotide encoding Th cell epitope]-3'; 5'-[polynucleotide encoding a signal peptide]-[polynucleotide encoding a Th cell epitope]-[polynucleotide encoding a membrane protein]-[polynucleotide encoding an antigenic protein]-3'; 5'-[polynucleotide encoding a signal peptide]-[polynucleotide encoding a Th cell epitope]-[polynucleotide encoding an antigenic protein]-[polynucleotide encoding a membrane protein]-3'; 5'-[polynucleotide encoding a signal peptide]-[polynucleotide encoding a membrane protein]-[polynucleotide encoding an antigenic protein]-[polynucleotide encoding a Th cell epitope]-3'; or 5'-[polynucleotide encoding a signal peptide]-[polynucleotide encoding an antigenic protein]-[polynucleotide encoding a membrane protein]-[polynucleotide encoding a Th cell epitope]-3'.

At this time, the polynucleotide encoding the signal peptide, the polynucleotide encoding the Th cell epitope, the polynucleotide encoding the membrane protein, and/or the polynucleotide encoding the antigen protein are not limited to the above-described order, and in the present invention There are no restrictions on the order as long as the initiating role can be performed.

In addition, the polynucleotide encoding the signal peptide, the polynucleotide encoding the Th cell epitope, the polynucleotide encoding the membrane protein, and/or the polynucleotide encoding the antigen protein may be included in the nucleic acid molecule singular or plural, There is no limit to their number as long as the expression rate of the protein is not reduced.

In addition, the nucleic acid molecule may be a general nucleic acid for expression as a protein, in addition to a polynucleotide encoding a signal peptide, a polynucleotide encoding a Th cell epitope, a polynucleotide encoding a membrane protein, and/or a polynucleotide encoding an antigen protein. Sequence, specific examples, 5'-CAP, 5'-UTR, Kozak sequence, start codon, stop codon, 3'-UTR and/or multiple adenosines including 7-methylguanosine It may include a 3'-Poly A tail, etc.

Another aspect of the present invention provides a vaccine composition for preventing or treating viral infections, comprising the nucleic acid molecule.

In the vaccine composition according to the present invention, each term is as described above unless specifically mentioned.

The vaccine composition according to the present invention can exhibit a preventive or therapeutic effect against both infections caused by non-mutated viruses and infections caused by mutated viruses.

As used herein, the term “viral infection” refers to a disease that occurs as a result of a virus proliferating in organs or tissues of the human body.

Specifically, the viral infection may be a coronavirus infection. Specific examples of the coronavirus infection include Severe Acute Respiratory Syndrome (SARS), Middle East Respiratory Syndrome (MERS), and Coronavirus disease-2019 (COVID-19). It may be one or more selected from the group, but is not limited thereto, as long as it is a disease caused by a coronavirus infection.

As used herein, the term “prevention” refers to any action that suppresses or delays viral infection by administering the vaccine composition according to the present invention.

As used herein, the term “treatment” refers to any action in which symptoms of a viral infection are improved or completely cured by administration of the vaccine composition according to the present invention.

As used herein, the term "vaccine" is a biological agent containing an antigen that provides immunity to an individual, and is an immunogen or antigenic substance that creates immunity in the organism of an individual by injecting or orally administering it to the individual to prevent infection. means. The vaccine may be an RNA vaccine, and specifically may be an mRNA vaccine. The term “mRNA vaccine” refers to a vaccine that induces an immune response by artificially replicating some of the genes of an antigen and then administering it. These mRNA vaccines have various advantages over existing protein vaccines. First, since they can be synthesized using only the genetic information of the target antigen, there is no need to directly handle dangerous pathogens, and they are administered because they use only some of the genes required to induce toxicity. Even if it does, there is no risk of significant toxicity, and due to its simplicity consisting only of mRNA, it has various advantages such as the ability to quickly develop vaccines against suddenly occurring infectious diseases or various mutations.

Specifically, the vaccine composition for preventing or treating viral infections according to the present invention can be used for preventing or treating coronavirus infections, and may have immunity against coronaviruses. Specific examples of the coronavirus may include the alphacoronavirus genus , betacoronavirus genus, gammacoronavirus genus, or deltacoronavirus genus, and more specific examples include HCoV-229E, HCoV-NL63, Bat-SARS-like (SL)- It may be ZC45, Bat-SL ZXC21, SARS-CoV, MERS-CoV, HCoV-OC43, HKU-1, MHV-A59, SARS-CoV-1 or SARS-CoV-2, and more specifically SARS-CoV-1 Or it may be SARS-CoV-2, but is not limited thereto.

In addition, the nucleic acid molecule included in the vaccine composition may be supported or linked to a carrier, and the carrier may be one or more selected from the group consisting of liposome-based carriers, lipid-based carriers, polymer-based carriers, and lipid-polymer hybrid nanoparticles. However, it is not limited to this. Specific examples of the carrier include liposome, phytosome, ethosome, lipid nanoparticle, lipid-like nanoparticle, lipid emulsion, liposome-based or lipid-based delivery vehicles such as lipoplexes and lipid micelles; Polymer-based carriers such as polymersome, polymeric nanoparticle, dendrimer, nanosphere, polyplex, and polymeric micelle; Alternatively, it may be a lipid-polymer hybrid nanoparticle such as a lipid-polymer hybrid nanoparticle, cationic nanoemulsion, anionic nanoemulsion, or lipopolyplex. , but is not limited to this.

The vaccine composition of the present invention may include a pharmaceutically acceptable carrier. The term 'pharmaceutically acceptable carrier' includes any and all solvents, dispersion media, coating agents, adjuvants, stabilizers, excipients, diluents, preservatives, antibacterial and antifungal agents, isotonic agents, adsorption delay agents, etc. Specific examples of the carrier include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, maltitol, starch, glycerin, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, Examples include, but are not limited to, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil.

In addition, the vaccine composition of the present invention can be formulated and used in the form of oral dosage forms such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, etc., and sterile injectable solutions according to conventional methods. When formulating, it can be prepared using diluents or excipients such as commonly used fillers, extenders, binders, wetting agents, disintegrants, and surfactants.

The vaccine composition may be administered to an individual in various forms. The “administration” may be performed by subcutaneous administration, intramuscular administration, intradermal administration, intraperitoneal administration, intravenous administration, intranasal administration, transdermal administration, parenteral administration, and oral administration, but is not limited thereto.

The vaccine composition may include one or more adjuvants to improve or strengthen the immune response. Suitable auxiliaries include synthetic analogs of double-stranded RNA (dsRNA), oligonucleotides of the unmethylated cytidine-guanidine type, peptides, aluminum hydroxide, aluminum phosphate, aluminum oxide and mineral or vegetable oils such as Marcol 52, and Compositions consisting of one or more emulsifiers or surface active substances such as lysolcecithin, polyvalent cations, and polyanions are included.

Another aspect of the present invention provides a method of generating an immune response against a viral infection in an individual, comprising administering the vaccine composition to an individual in need thereof.

In the method according to the present invention, each term is as described above unless specifically mentioned.

As used herein, the term “individual” includes all individuals that are likely to be infected with a virus or are infected, and may include humans, any non-human animals, fish, or plants, etc., without limitation. The non-human animal may be a vertebrate, such as a primate, dog, cow, horse, pig, rodent, such as mouse, rat, hamster, guinea pig, etc. In this specification, “individual” may be used interchangeably with “subject” or “patient.”

As used herein, the term “immune response” refers to the activation of a subject's immune system in response to the introduction of an antigen. At this time, the immune response may be in the form of cell-mediated immunity, humoral immunity, or both.

In the method for generating an immune response, the vaccine composition of the present invention may include an effective amount of the active ingredient, that is, the nucleic acid molecule according to the present invention, together with a pharmaceutically acceptable carrier and adjuvant. The term “effective amount” refers to an amount sufficient to induce a specific immune response against a viral infection in the subject to which the vaccine composition is administered. The effective amount can be easily determined by a person skilled in the art, for example, through routine experiments in animals.

Another aspect of the present invention provides a method for preventing or treating a viral infection in an individual, comprising administering the vaccine composition to an individual in need thereof.

In the method according to the present invention, each term is as described above unless specifically mentioned.

The platform for manufacturing mRNA vaccines according to the present invention allows rapid manufacturing of mRNA vaccines against new mutant viruses. In addition, nucleic acid molecules manufactured through the above platform have excellent expression rates of antigen proteins within cells and the ability to secrete antigen proteins outside the cells, and enable individuals to acquire immunity to viruses, making them useful for the prevention and treatment of viral infections. It can be.

Figure 1 is a schematic diagram showing the structure of various nucleic acid molecules, including a polynucleotide encoding a membrane protein (in the figure, denoted as 'membrane protein'). Each polynucleotide is base optimized with a wild-type codon (WT), a human codon (Hu), a yeast codon (Yeast; Y), a human and yeast codon (Y+Hu), or a yeast and wild-type codon (Y+WT). Includes sequence. The nucleic acid molecule includes a T7 promoter (T7), 5'-UTR, 3'-UTR and Poly A.

Figure 2 shows polynucleotides encoding signal peptides derived from IgE, ALB, IFN-γ, F IX (Factor IX) or MLP-1 (in the figure, 'IgE', 'ALB', 'IFN-γ', and 'F', respectively) IX' or 'MLP1') and a polynucleotide encoding a membrane protein (in the drawing, denoted as 'membrane protein') is a schematic diagram showing the structure of various nucleic acid molecules. Each polynucleotide contains a base sequence optimized with wild-type codon (WT), human codon (Hu), yeast codon (Yeast; Y), or human and yeast codon (Y+Hu). The nucleic acid molecule includes a T7 promoter (T7), 5'-UTR, 3'-UTR and Poly A.

Figure 3A shows a polynucleotide encoding a signal peptide derived from IgE, ALB, IFN-γ, F IX or MLP-1 (in the figure, 'IgE', 'ALB', 'IFN-γ', 'F IX' or ', respectively). denoted as 'MLP1'), a polynucleotide encoding a Th cell epitope (TTTh) cluster (in the drawing, denoted as 'TTTh') and/or a polynucleotide encoding a membrane protein (in the drawing, denoted as 'membrane protein') It is a schematic diagram showing the structure of various nucleic acid molecules, including: The polynucleotide encoding the TTTh cluster is located at the 3'-end of the polynucleotide encoding the membrane protein. Each polynucleotide contains a base sequence optimized with a wild-type codon (WT), a human codon (Hu), a yeast codon (Yeast; Y), or a human and yeast codon (Y+Hu). The nucleic acid molecule includes a T7 promoter (T7), 5'-UTR, 3'-UTR and Poly A.

Figure 3b shows a polynucleotide encoding a signal peptide derived from IgE, ALB, IFN-γ, F IX or MLP-1 (in the figure, 'IgE', 'ALB', 'IFN-γ', 'F IX' or ', respectively). denoted as 'MLP1'), a polynucleotide encoding a Th cell epitope (TTTh) cluster (in the drawing, denoted as 'TTTh') and/or a polynucleotide encoding a membrane protein (in the drawing, denoted as 'membrane protein') It is a schematic diagram showing the structure of various nucleic acid molecules, including: The polynucleotide encoding the TTTh cluster is located at the 5'-end of the polynucleotide encoding the membrane protein. Each polynucleotide contains a base sequence optimized with a wild-type codon (WT), a human codon (Hu), a yeast codon (Yeast; Y), or a human and yeast codon (Y+Hu). The nucleic acid molecule includes a T7 promoter (T7), 5'-UTR, 3'-UTR and Poly A.

Figure 4A shows a polynucleotide encoding a signal peptide derived from IgE, ALB, IFN-γ, F IX or MLP-1 (in the figure, 'IgE', 'ALB', 'IFN-γ', 'F IX' or ', respectively). denoted as 'MLP1'), a polynucleotide encoding a Th cell epitope (TTTh) cluster (in the drawing, denoted as 'TTTh') and/or a polynucleotide encoding a membrane protein (in the drawing, denoted as 'membrane protein') It is a schematic diagram showing the structure of various nucleic acid molecules, including: The polynucleotide encoding the TTTh cluster is located at the 3'-end of the polynucleotide encoding the membrane protein. Each polynucleotide contains a base sequence optimized with a wild-type codon (WT), a human codon (Hu), a yeast codon (Yeast; Y), or a human and yeast codon (Y+Hu). The nucleic acid molecule includes a T7 promoter (T7), 5'-UTR, 3'-UTR and Poly A.

Figure 4b shows a polynucleotide encoding a signal peptide derived from IgE, ALB, IFN-γ, F IX or MLP-1 (in the figure, 'IgE', 'ALB', 'IFN-γ', 'F IX' or ', respectively). denoted as 'MLP1'), a polynucleotide encoding a Th cell epitope (TTTh) cluster (in the drawing, denoted as 'TTTh') and a polynucleotide encoding a membrane protein (in the drawing, denoted as 'membrane protein'). It is a schematic diagram showing the structure of various nucleic acid molecules, including. The polynucleotide encoding the TTTh cluster is located at the 5'-end of the polynucleotide encoding the membrane protein. Each polynucleotide contains a base sequence optimized with a wild-type codon (WT), a human codon (Hu), a yeast codon (Yeast; Y), or a human and yeast codon (Y+Hu). The nucleic acid molecule includes a T7 promoter (T7), 5'-UTR, 3'-UTR and Poly A.

Figure 5 shows a polynucleotide encoding a signal peptide derived from IgE, ALB, IFN-γ, F IX or MLP-1 (in the figure, 'IgE', 'ALB', 'IFN-γ', 'F IX' or ', respectively) (denoted as MLP1'), and/or a polynucleotide encoding a spike protein from an unmutated Prototype virus or a spike protein from a mutated Delta or Omicron virus ( In the drawing, it is a schematic diagram showing the structure of various nucleic acid molecules, including (indicated as 'spike protein'). Each polynucleotide contains a base sequence optimized with a wild-type codon (WT), a human codon (Hu), a yeast codon (Yeast; Y), or a human and yeast codon (Y+Hu). The nucleic acid molecule includes a T7 promoter (T7), 5'-UTR, 3'-UTR and Poly A.

FIG. 6A is an image showing the expression level of a membrane protein (contained in cell lysate, 24 kDa) expressed by the nucleic acid molecule shown in FIG. 1. '(-)' is a negative control and shows the expression level of membrane protein expressed in cells that do not contain nucleic acid molecules, and '(+)' is a positive control and shows the expression level of membrane protein expressed by nucleic acid molecule #9 (shown in Figure 2). It shows the expression level of the expressed membrane protein. The values shown in the figure refer to the expression rate relative to the positive control group.

FIG. 6B is an image showing the expression level of a membrane protein (contained in cell lysate, 24 kDa) expressed by nucleic acid molecules (#8 to #22) shown in FIG. 2. '(-)' is a negative control and shows the expression level of membrane protein expressed in cells that do not contain nucleic acid molecules. The values shown in the figure refer to the relative expression rate of nucleic acid molecule #9 as a positive control.

FIG. 7A is an image showing the expression level of a membrane protein (contained in cell lysate, 24 kDa) expressed by nucleic acid molecules (#24 to #38) shown in FIG. 3A. '(-)' is a negative control and shows the expression level of membrane protein expressed in cells that do not contain nucleic acid molecules, and '(+)' is a positive control and shows the expression level of membrane protein expressed by nucleic acid molecule #9 (shown in Figure 2). It shows the expression level of the expressed membrane protein. The values shown in the figure refer to the expression rate relative to the positive control group.

FIG. 7b is an image showing the expression level of a membrane protein (contained in cell lysate, 24 kDa) expressed by nucleic acid molecules (#40 to #54) shown in FIG. 3b. '(-)' is a negative control and shows the expression level of membrane protein expressed in cells that do not contain nucleic acid molecules, and '(+)' is a positive control and shows the expression level of membrane protein expressed by nucleic acid molecule #9 (shown in Figure 2). It shows the expression level of the expressed membrane protein. The values shown in the figure refer to the expression rate relative to the positive control group.

FIG. 8A is an image showing the expression level of a membrane protein (contained in cell lysate, 24 kDa) expressed by nucleic acid molecules (#55 to #70) shown in FIG. 4A. '(-)' is a negative control and shows the expression level of membrane protein expressed in cells that do not contain nucleic acid molecules, and '(+)' is a positive control and shows the expression level of membrane protein expressed by nucleic acid molecule #9 (shown in Figure 2). It shows the expression level of the expressed membrane protein. The values shown in the figure refer to the expression rate relative to the positive control group.

Figure 8b is an image showing the expression level of membrane protein (contained in cell lysate, 24 kDa) expressed by nucleic acid molecules (#71 to #85) shown in Figure 4b. '(-)' is a negative control and shows the expression level of membrane protein expressed in cells that do not contain nucleic acid molecules, and '(+)' is a positive control and shows the expression level of membrane protein expressed by nucleic acid molecule #9 (shown in Figure 2). It shows the expression level of the expressed membrane protein. The values shown in the figure refer to the expression rate relative to the positive control group.

FIG. 9A is an image showing the expression level of spike protein expressed by nucleic acid molecules (#86 to #92) shown in FIG. 5. The spike protein is detected in the form of S1 protein (110kDa) in cell culture media, and in the form of total protein (190kDa) or S1 protein (110kDa) in cell lysate. '(-)' is a negative control and shows the expression level of spike protein expressed in cells that do not contain nucleic acid molecules.

FIG. 9B is an image showing the expression level of spike protein expressed by the nucleic acid molecules (#93 to #94-(2)) shown in FIG. 5. The spike protein is detected in the form of S1 protein (110kDa) in cell culture media, and in the form of total protein (190kDa) or S1 protein (110kDa) in cell lysate. '(-)' is a negative control and shows the expression level of spike protein expressed in cells that do not contain nucleic acid molecules.

FIG. 9C is an image showing the expression level of spike protein expressed by nucleic acid molecules (#95 to #101) shown in FIG. 5. The spike protein is detected in the form of S1 protein (110kDa) in cell culture media, and in the form of total protein (190kDa) or S1 protein (110kDa) in cell lysate. '(-)' is a negative control and shows the expression level of spike protein expressed in cells that do not contain nucleic acid molecules.

Figure 10 is a graph showing the immunogenicity of nucleic acid molecules according to the present invention, showing the IFN-γ secreting T cells produced in the spleen cells of mice administered each nucleic acid molecule. The IFN-γ secreting T cells were expressed as SFU (Spot Forming unit)/2.5x10 ⁵ units.

The present invention will be explained in more detail based on the following examples, but this is not intended to limit the scope of the present invention. In addition, those skilled in the art will be able to make various changes and modifications to the present invention without impairing the spirit of the present invention.

Example 1. Construction of a nucleic acid molecule platform for vaccines

In order to develop a vaccine that can quickly respond to infections caused by new mutant viruses, a vaccine platform was established. Specifically, the platform includes a polynucleotide encoding a signal peptide (SP) and a polynucleotide encoding a Th cell epitope (T helper cell epitope), and encoding a membrane protein, which is an antigen protein with a low mutation rate. It was constructed to contain polynucleotides. In addition, it was constructed to include a polynucleotide encoding a spike protein as another antigen protein, and the spike protein derived from various mutant strains was used.

The base and amino acid sequences of the peptides, proteins, etc. were obtained from GenBank, and the wild-type sequence obtained from GenBank was optimized with human and/or yeast codons to prepare nucleic acid molecules with improved antigen protein expression efficiency. . Codon optimization involves optimizing protein-coding genes by changing them to preferred codons so that they can be expressed well in each individual. GC content, repeated base sequences, transcription efficiency, expression level, protein folding, and mRNA secondary structure. It is carried out by considering a number of factors such as: Since the correlation between the above factors has various effects on the codon optimization results, it is very difficult to produce an mRNA sequence that can express the desired level of expression in many cases.

In addition, the protein expression level, etc. was predicted by calculating the GC content of the nucleic acid molecule and the free energy of the mRNA secondary structure. As the free energy of the mRNA secondary structure increases, the stability of the structure decreases and the structure easily collapses. As recognition efficiency by ribosomes increases, protein expression rate can be increased.

At this time, the polynucleotide encoding the SP, Th cell epitope, membrane protein, or antigen protein was designed as a nucleic acid molecule by constructing it as follows: 5'-[polynucleotide encoding SP]-[encoding Th cell epitope polynucleotide encoding a membrane protein]-[polynucleotide encoding a membrane protein]-3'; 5'-[polynucleotide encoding SP]-[polynucleotide encoding membrane protein]-[polynucleotide encoding Th cell epitope]-3'; 5'-[polynucleotide encoding SP]-[polynucleotide encoding Th cell epitope]-[polynucleotide encoding antigenic protein]-3'; 5'-[polynucleotide encoding SP]-[polynucleotide encoding antigenic protein]-[polynucleotide encoding Th cell epitope]-3'; 5'-[polynucleotide encoding SP]-[polynucleotide encoding Th cell epitope]-[polynucleotide encoding membrane protein]-[polynucleotide encoding antigen protein]-3'; 5'-[polynucleotide encoding SP]-[polynucleotide encoding Th cell epitope]-[polynucleotide encoding antigenic protein]-[polynucleotide encoding membrane protein]-3'; 5'-[polynucleotide encoding SP]-[polynucleotide encoding membrane protein]-[polynucleotide encoding antigen protein]-[polynucleotide encoding Th cell epitope]-3'; or 5'-[polynucleotide encoding SP]-[polynucleotide encoding antigenic protein]-[polynucleotide encoding membrane protein]-[polynucleotide encoding Th cell epitope]-3'.

Example 1-1. Construction of polynucleotides encoding signal peptides

In order to prepare a nucleic acid molecule for a vaccine with an excellent protein expression rate, a polynucleotide encoding a signal peptide (SP) was first produced.

Specifically, human-derived IgE (Immunoglobulin E), albumin, interferon gamma (IFN-γ), factor IX (F IX), mucin-like protein 1 (MLP1), etc. Signal peptides derived from five different proteins were obtained. The nucleic acid sequences of these signal peptides were mutated in various ways, and among them, nucleic acid sequences with excellent expression rates of antigen proteins were selected. The results are shown in Table 1 below. For example, the nucleic acid sequence of SEQ ID NO: 3 is a codon-optimized form of an IgE-derived signal peptide for humans.

Example 1-2. Construction of polynucleotides encoding Th cell epitopes

In order to prepare a nucleic acid molecule for a vaccine with increased immunogenicity and thus the ability to induce an immune response, a polynucleotide encoding a Th cell epitope was prepared.

Specifically, the Th cell epitope derived from tetanus toxoid (Tetanus Toxoid Th cell epitope, TTTh) was used as an example. Additionally, the TTTh fragment was used in the form of a cluster by connecting it with a furin cleavage signal (CS) or a glycine-serine (GS) linker. The Th cell epitope cluster containing the linker was designed as follows and located at the N-terminus or C-terminus of the ORF: 5'-[CS]-[TTTh1]-[CS]-[TTTh2]-3 '; or 5'-[GS linker]-[TTTh3]-[GS linker]-[TTTh4]-[GS linker]-[TTTh5]-3'. Afterwards, codon optimization was performed by the method according to Example 1-1, and the nucleic acid sequences for which codon optimization was performed are summarized in Tables 2 to 4 below. For example, the nucleic acid sequence of SEQ ID NO: 36 is a codon-optimized form of the TTTh cluster for humans.

Example 1-3. Construction of polynucleotides encoding membrane proteins

In order to develop a vaccine platform that can be used to prevent viral infections, the membrane protein (M), a well-conserved gene when compared between various variants of coronavirus, was used.

Specifically, codon optimization was performed on the membrane gene of SARS-CoV-2 by the method according to Example 1-1 above, and the nucleic acid sequence on which codon optimization was performed is shown below. For example, the nucleic acid sequence of SEQ ID NO: 39 is a codon-optimized form of the membrane protein antigen of SARS-CoV-2 for humans, and the nucleic acid sequence of SEQ ID NO: 40 is a codon-optimized form of the membrane protein antigen of SARS-CoV-2 for yeast. It is in a codon-optimized form, and the nucleic acid sequences of SEQ ID NOs: 41 and 42 have both the codon-optimized form of the membrane protein antigen of SARS-CoV-2 for humans and the codon-optimized form for yeast.

(1) SARS-CoV-2 membrane protein wild type amino acid sequence (SEQ ID NO: 37):

MADSNGTITVEELKKLLEQWNLVIGFLFLTWICLLQFAYANRNRFLYIIKLIFLWLLWPVTLACFVLAAVYRINWITGGIAIAMACLVGLMWLSYFIASFRLFARTRSMWSFNPETNILLNVPLHGTILTRPLLESELVIGAVILRGHLRIAGHHLGRCDIKDLPKEITVATSRTLSYYKLGASQRVAGDSGFAAYSRYRIGNYKLNTDHSSSSDNIALLVQ

(2-1) SARS-CoV-2 membrane protein wild type nucleic acid sequence (SEQ ID NO: 38):

ATGGCAGATTCCAACGGTACTATTACCGTTGAAGAGCTTAAAAAGCTCCTTGAAACAATGGAACCTAGTAATAGGTTTCCTATTCCTTACATGGATTTGTCTTCTACAATTTGCCTATGCCAACAGGAATAGGTTTTGTATATAATTAAGTTAATTTTCCTCTGGCTGTTATGGCCAGTAACTTTAGCTTGTTTTGTGCTTGCTGCTGTTTACAGAATAAATTGGATCACCGGTGGAATTGCTATCGCAATGGCTTGTC TTGTAGGCTTGATGTGGCTCAGCTACTTCATTGCTTCTTTCAGACTGTTTGCGCGTACGCGTTCCATGTGGTCATTCAATCCAGAAACTAACATTCTTCTCAACGTGCCACTCCATGGCACTATTCTGACCAGACCGCTTCTAGAAAGTGAACTCGTAATCGGAGCTGTGATCCTTCGTGGACATCTTCGTATTGCTGGACACCATCTAGGACGCTGTGACATCAAGGACCTGCCTAAAGAAATCACTGTTGCTACATCACGAACGCTT TCTTATTACAAATTGGGAGCTTCGCAGCGTGTAGCAGGTGACTCAGGTTTTGCTGCATACAGTCGCTACAGGATTGGCAACTATAAATTAAACACAGACCATTCCAGTAGCAGTGACAATATTGCTTTGCTTGTACAGTAA

(2-2) SARS-CoV-2 membrane protein wild type nucleic acid sequence (SEQ ID NO: 82):

AUGGCAGAUUCCAACGGUACUAUUACCGUUGAAGAGCUUAAAAAGCUCCUUGAACAAUGGAACCUAGUAAUAGGUUUCCUAUUCCUUACAUGGAUUUUGUCUUCUACAAUUUGCCUAUGCCAACAGGAAUAGGUUUUUGUAUAUAAUUAAGUUAAUUUUCCUCUGGCUGUUAUGGCCAGUAACUUUAGCUUGUUUUGUGCUUGCUGCUGUUUACAGAAUAAAUUGGAUCA CCGGUGGAAUUGCUAUCGCAAUGGCUUGUCUUGUAGGCUUGAUGUGGCUCAGCUACUUCAUUGCUUCUUUCAGACUGUUUGCGCGUACGCGUUCCAUGUGGGUCAUUCAAUCCAGAAACUAACAUCUUCUUCUCAACGUGCCACUCCAUGGCACUAUUCUGACCAGACCGCUUCUAGAAAGUGAACUCGUAAUCGGAGCUGUGAUCCUUCGUGGACAUCUUCGUAUUGCUGGACACCAUCUAGG ACGCUGUGACAUCAAGGACCUGCCUAAAGAAAUCACUGUUGCUACAUCACGAACGCUUUCUUAUUACAAAUUGGGAGCUUCGCAGCGUGUAGCAGGUGACUCAGGUUUUGCUGCAUACAGUCGCUACAGGAUUGGCAACUAUAAAUUAAACACAGACCAUUCCAGUAGCAGUGACAAUAUUGCUUUGCUUGUACAGUAA

(3-1) SARS-CoV-2 membrane protein human codon optimized nucleic acid sequence (SEQ ID NO: 39):

ATGGCTGATAGCAACGGCACCATCACAGTCGAGGAACTGAAAAAGCTGCTGGAACAGTGGAACCTGGTGATTGGATTCCTGTTCCTGACCTGGATCTGCCTGCTCCAGTTCGCCTACGCCAACCGGAACAGATTCCTGTACATCATCAAGCTGATCTTCCTGTGGCTGCTGTGGCCTGTGACCCTGGCCTGCTTCGTGCTGGCTGCTGTGTACAGAATCAACTGGATCACCGGAGGCATCGCCATCGCCATGGCCTGTC TGGTGGGCCTGATGTGGCTGAGCTACTTCATCGCCTCTTTTAGACTGTTTGCCAGAACCCGGAGCATGTGGTCCTTCAACCCCGAGACAAACATCCTGCTGAATGTGCCCCTGCACGGCACAATCCTGACAAGACCTCTGCTTGAGAGCGAGCTGGTGATCGGCGCCGTGATCCTGAGGGGCCATCTGCGGATTGCCGGACACCACCTGGGCAGATGCGACATCAAGGACCTGCCTAAGGAAATCACCGTGGCTACAAGCC GCACCCTGTCCTACTACAAACTCGGCGCCAGCCAAAGAGTGGCCGGCGACAGCGGCTTCGCCGCCTATAGCAGATACCGGATCGGCAACTACAAGCTGAACACCGACCACTCTAGCAGCTCTGATAATATCGCCCTGCTGGTTCAGTGA

(3-2) SARS-CoV-2 membrane protein human codon optimized nucleic acid sequence (SEQ ID NO: 83):

AUGGCUGAUAGCAACGGCACCAUCACAGUCGAGGAACUGAAAAAGCUGCUGGAACAGUGGAACCUGGUGAUUGGAUUCCUGUUCCUGACCUGGAUCUGCCUGCUCCAGUUCGCCUACGCCAACCGGAACAGAUUCCUGUACAUCAUCAAGCUGAUCUUCCUGUGGCUGCUGUGGCCUGUGACCCUGGCCUGCUUCGUGCUGGCUGCUGUGUACAGAAUCAACUGGAUCACCGGAGGCAUCGCCAUCGCCA UGGCCUGUCUGGUGGGCCUGAUGUGGCUGAGCUACUUCAUCGCCUCUUUUAGACUGUUUGCCAGAACCCGGAGCAUGUGGUCCUUCAACCCCGAGACAAACAUCCUGCUGAAUGUGCCCCUGCACGGCACAAUCCUGACAAGACCUCUGCUUGAGAGCGAGCUGGUGAUCGGCGCCGUGAUCCUGAGGGGCCAUCUGCGGAUUGCCGGACACCACCUGGGCAGAUGCGACAUCAAGGACCUGCCUGG AAAUCACCGUGGCUACAAGCCGCACCCUGUCCUACUACAAACUCGGCGCCAGCCAAAGAGUGGCCGGCGACAGCGGCUUCGCCGCCUAUAGCAGAUACCGGAUCGGCAACUACAAGCUGAACACCGACCACUCUAGCAGCUCUGAUAAUAUCGCCCUGCUGGUUCAGUGA

(4-1) SARS-CoV-2 membrane protein yeast codon optimized nucleic acid sequence (SEQ ID NO: 40):

ATGGCTGATTCCAACGGTACCATCACCGTTGAAGAATTGAAGAAGTTGCTGGAACAATGGAACTTGGTCATTGGTTTTTTATTCTTGACTTGGATCTGTTTGTTGCAATTCGCTTACGCTAACAGAAACCGTTTCCTCTACATTATCAAGTTGATCTTCCTATGGTTATTGTGGCCAGTCACTTTGGCTTGTTTCGTTTTGGCCGCAGTTTACAGAATCAACTGGATTACAGGTGGTATTGCTATTGCTATGGCCTGT TTGGTTGGTTTGATGTGGTTGTCTTACTTCATCGCTTCCTTCAGATTATTTGCTAGAACCAGATCCATGTGGTCTTTCAACCCAGAAACCAACATCTTGTTGAATGTTCCATTGCACGGTACTATCTTAACCAGACCTTTATTGGAATCTGAATTAGTTATCGGTGCTGTCATTTTGCGTGGTCACTTGAGAATTGCTGGTCATCACTTGGGTAGATGCGATATCAAGGATTTGCCAAAGGAAATCACTGTTGCTACCAGCAGA ACTTTGTCCTACTACAAGTTGGGCGCTTCTCAAAGAGTCGCCGGTGACTCTGGTTTCGCCGCCTATTCAAGATACCGTATTGGTAACTACAAATTGAACACTGACCACTCTTCTTCCTCTGACAACATTGCTTTGTTGGTCCAATGA

(4-2) SARS-CoV-2 membrane protein yeast codon optimized nucleic acid sequence (SEQ ID NO: 84):

AUGGCUGAUUCCAACGGUACCACCGUUGAAGAAUUGAAGAAGUUGCUGGAACAAUGGAACUUGGUCAUUGGUUUUUUAUUCUUGACUUGGAUCUGUUUGUUGCAAUUCGCUUACGCUAACAGAAACCGUUUCCUCUACAUUAUCAAGUUGAUCUUCCUAUGGUUAUUGUGGCCAGUCACUUUGGCUUGUUUCGUUUUGGCCGCAGUUUACAGAAUCAACUGG AUUACAGGUGGUAUUGCUAUUGCUAUGGCCUGUUUGGUUGGUUUGAUGUGGUUGUCUUACUUCAUCGCUUCCUUCAGAUUAUUUGCUAGAACCAGAUCCAUGUGGUCUUUCAACCCAGAAACCAACAUCUUGUUGAAUGUUCCAUUGCACGGUACUAUCUUAACCAGACCUUUAUUGGAAUCUGAAUUAGUUAUCGGUGCUGUCAUUUUGCGUGGUCACUUGAGAAUUGCUGG UCAUCACUUGGGUAGAUGCGAUAUCAAGGAUUUGCCAAAGGAAAUCACUGUUGCUACCAGCAGAACUUUGUCCUACUACAAGUUGGGCGCUUCUCAAAGAGUCGCCGGUGACUCUGGUUUCGCCGCCUAUUCAAGAUACCGUAUUGGUAACUACAAAUUGAACACUGACCACUCUUCUUCCUCUGACAACAUUGCUUUGUUGGUCCAAUGA

(5-1) SARS-CoV-2 membrane protein yeast codon (250 nt) and human codon (419 nt) optimized nucleic acid sequence (SEQ ID NO: 41):

ATGGCTGATTCCAACGGTACCATCACCGTTGAAGAATTGAAGAAGTTGCTGGAACAATGGAACTTGGTCATTGGTTTTTTATTCTTGACTTGGATCTGTTTGTTGCAATTCGCTTACGCTAACAGAAACCGTTTCCTCTACATTATCAAGTTGATCTTCCTATGGTTATTGTGGCCAGTCACTTTGGCTTGTTTCGTTTTGGCCGCAGTTTACAGAATCAACTGGATTACAGGTGGTATTGCTATTGCTATGGCCTGT CTGGTGGGCCTGATGTGGCTGAGCTACTTCATCGCCTCTTTTAGACTGTTTGCCAGAACCCGGAGCATGTGGTCCTTCAACCCCGAGACAAACATCCTGCTGAATGTGCCCCTGCACGGCACAATCCTGACAAGACCTCTGCTTGAGAGCGAGCTGGTGATCGGCGCCGTGATCCTGAGGGGCCATCTGCGGATTGCCGGACACCACCTGGGCAGATGCGACATCAAGGACCTGCCTAAGGAAATCACCGTGGCTACAAG CCGCACCCTGTCCTACTACAAACTCGGCGCCAGCCAAAGAGTGGCCGGCGACAGCGGCTTCGCCGCCTATAGCAGATACCGGATCGGCAACTACAAGCTGAACACCGACCACTCTAGCAGCTCTGATAATATCGCCCTGCTGGTTCAGTGA

(5-2) SARS-CoV-2 membrane protein yeast codon (250 nt) and human codon (419 nt) optimized nucleic acid sequence (SEQ ID NO. 85):

AUGGCUGAUUCCAACGGUACCACCGUUGAAGAAUUGAAGAAGUUGCUGGAACAAUGGAACUUGGUCAUUGGUUUUUUAUUCUUGACUUGGAUCUGUUUGUUGCAAUUCGCUUACGCUAACAGAAACCGUUUCCUCUACAUUAUCAAGUUGAUCUUCCUAUGGUUAUUGUGGCCAGUCACUUUGGCUUGUUUCGUUUUGGCCGCAGUUUACAGAAUCAACUGG AUUACAGGUGGUAUUGCUAUUGCUAUGGCCUGUCUGGUGGGCCUGAUGUGGCUGAGCUACUUCAUCGCCUCUUUUAGACUGUUUGCCAGAACCCGGAGCAUGUGGUCCUUCAACCCCGAGACAAACAUCCUGCUGAAUGUGCCCCUGCACGGCACAAUCCUGACAAGACCUCUGCUUGAGAGCGAGCUGGUGAUCGGCGCCGUGAUCCUGAGGGGCCAUCUGCGGAUUGCCGGACACCACCUGGGCA GAUGCGACAUCAAGGACCUGCCUAAGGAAAUCACCGUGGCUACAAGCCGCACCCUGUCCUACUACAAACUCGGCGCCAGCCAAAGAGUGGCCGGCGACAGCGGCUUCGCCGCCUAUAGCAGAUACCGGAUCGGCAACUACAAGCUGAACACCGACCACUCUAGCAGCUCUGAUAAUAUCGCCCUGCUGGUUCAGUGA

(6-1) SARS-CoV-2 membrane protein yeast codon (100 nt) and human codon (569 nt) optimized nucleic acid sequence (SEQ ID NO: 42):

ATGGCTGATTCCAACGGTACCATCACCGTTGAAGAATTGAAGAAGTTGCTGGAACAATGGAACTTGGTCATTGGTTTTTTATTCTTGACTTGGATCTGTTTGCTCCAGTTCGCCTACGCCAACCGGAACAGATTCCTGTACATCATCAAGCTGATCTTCCTGTGGCTGCTGTGGCCTGTGACCCTGGCCTGCTTCGTGCTGGCTGCTGTGTACAGAATCAACTGGATCACCGGAGGCATCGCCATCGCCATGGCCTGTCTG GTGGGCCTGATGTGGCTGAGCTACTTCATCGCCTCTTTTAGACTGTTTGCCAGAACCCGGAGCATGTGGTCCTTCAACCCCGAGACAAACATCCTGCTGAATGTGCCCCTGCACGGCACAATCCTGACAAGACCTCTGCTTGAGAGCGAGCTGGTGATCGGCGCCGTGATCCTGAGGGGCCATCTGCGGATTGCCGGACACCACCTGGGCAGATGCGACATCAAGGACCTGCCTAAGGAAATCACCGTGGCTACAAGCCGCGC ACCCTGTCCTACTACAAACTCGGCGCCAGCCAAAGAGTGGCCGGCGACAGCGGCTTCGCCGCCTATAGCAGATACCGGATCGGCAACTACAAGCTGAACACCGACCACTCTAGCAGCTCTGATAATATCGCCCTGCTGGTTCAGTGA

(6-2) SARS-CoV-2 membrane protein yeast codon (100 nt) and human codon (569 nt) optimized nucleic acid sequence (SEQ ID NO. 86):

AUGGCUGAUUCCAACGGUACCAUCACCGUUGAAGAAUUGAAGAAGUUGCUGGAACAAUGGAACUUGGUCAUUGGUUUUUUAUUCUUGACUUGGAUCUGUUUGCUCCAGUUCGCCUACGCCAACCGGAACAGAUUCCUGUACAUCAUCAAGCUGAUCUUCCUGUGGCUGCUGUGGCCUGUGACCCUGGCCUGCUUCGUGCUGGCUGCUGUGUACAGAAUCAACUGGAUCACCGGAGGC AUCGCCAUCGCCAUGGCCUGUCUGGUGGGCCUGAUGUGGCUGAGCUACUUCAUCGCCUCUUUUAGACUGUUUGCCAGAACCCGGAGCAUGUGGUCCUUCAACCCCGAGACAAACAUCCUGCUGAAUGUGCCCCUGCACGGCACAAUCCUGACAAGACCUCUGCUUGAGAGCGAGCUGGUGAUCGGCGCCGUGAUCCUGAGGGGCCAUCUGCGGAUUGCCGGACACCACCUGGGCAGAUGCGACAUCAAGG ACCUGCCUAAGGAAAUCACCGUGGCUACAAGCCGCACCCUGUCCUACUACAAACUCGGCGCCAGCCAAAGAGUGGCCGGCGACAGCGGCUUCGCCGCCUAUAGCAGAUACCGGAUCGGCAACUACAAGCUGAACACCGACCACUCUAGCAGCUCUGAUAAUAUCGCCCUGCUGGUUCAGUGA

Example 1-4. Construction of polynucleotide encoding spike protein

In order to develop a vaccine platform that can be used to prevent viral infections, the coronavirus spike protein (Spike protein, S) is known to play a central role in infection and pathogenicity, such as host cell receptor recognition, cell membrane fusion, and neutralizing antibody induction. ) was used as the antigen protein. Additionally, the spike proteins derived from various mutant strains were used.

Example 1-4-1. Spike protein of prototype virus

Codon optimization was performed on the spike gene of the SARS-CoV-2 prototype virus by the method according to Example 1-1 above, and the nucleic acid sequence on which codon optimization was performed is shown below. Meanwhile, the specific base sequence of the gene encoding the spike protein of the prototype virus was confirmed through information known in NCBI GenBank (Accession: NC_045512, etc.). For example, the nucleic acid sequence of SEQ ID NO: 45 is a codon-optimized form of the spike protein antigen of the SARS-CoV-2 prototype virus for humans, and the nucleic acid sequence of SEQ ID NO: 46 is the spike protein antigen of the SARS-CoV-2 prototype virus. The protein antigen is codon-optimized for yeast, and the nucleic acid sequence of SEQ ID NO: 47 has both the spike protein antigen of the SARS-CoV-2 prototype virus codon-optimized for humans and the codon-optimized form for yeast. .

(1) SARS-CoV-2 prototype virus spike protein wild type amino acid sequence: SEQ ID NO: 43

(2-1) SARS-CoV-2 prototype virus spike protein wild type nucleic acid sequence: SEQ ID NO: 44

(2-2) SARS-CoV-2 prototype virus spike protein wild type nucleic acid sequence: SEQ ID NO: 87

(3-1) SARS-CoV-2 prototype virus spike protein human codon optimized nucleic acid sequence: SEQ ID NO: 45

(3-2) SARS-CoV-2 prototype virus spike protein human codon optimized nucleic acid sequence: SEQ ID NO: 88

(4-1) SARS-CoV-2 prototype virus spike protein yeast codon optimized nucleic acid sequence: SEQ ID NO: 46

(4-2) SARS-CoV-2 prototype virus spike protein yeast codon optimized nucleic acid sequence: SEQ ID NO: 89

(5-1) SARS-CoV-2 prototype virus spike protein yeast codon (250 nt) and human codon (3572 nt) optimized nucleic acid sequence: SEQ ID NO: 47

(5-2) SARS-CoV-2 prototype virus spike protein yeast codon (250 nt) and human codon (3572 nt) optimized nucleic acid sequence: SEQ ID NO: 90

Example 1-4-2. Spike protein of delta variant virus

Codon optimization was performed on the spike gene of the SARS-CoV-2 delta (B.1.617.2) variant virus by the method according to Example 1-1 above, and the nucleic acid sequence for which codon optimization was performed is as follows. indicated. Meanwhile, the specific base sequence of the gene encoding the spike protein of the delta mutant virus was confirmed through information known in NCBI GenBank (Accession: OX014251.1, OX012481.1, etc.). For example, the nucleic acid sequence of SEQ ID NO: 50 is a codon-optimized form of the spike protein antigen of the SARS-CoV-2 delta mutant virus for humans, and the nucleic acid sequence of SEQ ID NO: 51 is the spike protein antigen of the SARS-CoV-2 delta mutant virus. The protein antigen is codon-optimized for yeast, and the nucleic acid sequence of SEQ ID NO: 52 is a form that has both the spike protein antigen of the SARS-CoV-2 delta mutant virus codon-optimized for humans and codon-optimized for yeast. .

(1) SARS-CoV-2 delta mutant virus spike protein wild type amino acid sequence: SEQ ID NO: 48

(2-1) SARS-CoV-2 delta mutant virus spike protein wild type nucleic acid sequence: SEQ ID NO: 49

(2-2) SARS-CoV-2 delta mutant virus spike protein wild type nucleic acid sequence: SEQ ID NO: 91

(3-1) SARS-CoV-2 delta mutant virus spike protein human codon optimized nucleic acid sequence: SEQ ID NO: 50

(3-2) SARS-CoV-2 delta mutant virus spike protein human codon optimized nucleic acid sequence: SEQ ID NO: 92

(4-1) SARS-CoV-2 delta mutant virus spike protein yeast codon optimized nucleic acid sequence: SEQ ID NO: 51

(4-2) SARS-CoV-2 delta mutant virus spike protein yeast codon optimized nucleic acid sequence: SEQ ID NO: 93

(5-1) SARS-CoV-2 delta mutant virus spike protein yeast codon (500 nt) and human codon (3316 nt) optimized nucleic acid sequence: SEQ ID NO: 52

(5-2) SARS-CoV-2 delta mutant virus spike protein yeast codon (500 nt) and human codon (3316 nt) optimized nucleic acid sequence: SEQ ID NO: 94

Example 1-4-3. Spike protein of omicron variant virus

Codon optimization was performed on the spike gene of the SARS-CoV-2 Omicron (B.1.1.529) variant virus by the method according to Example 1-1 above, and the nucleic acid sequence on which codon optimization was performed is as follows. shown in Meanwhile, the specific base sequence of the gene encoding the spike protein of the omicron mutant virus was confirmed through information known in NCBI GenBank (Accession: OW996240.1, etc.). For example, the nucleic acid sequence of SEQ ID NO: 55 is a codon-optimized form of the spike protein antigen of the SARS-CoV-2 omicron mutant virus for humans, and the nucleic acid sequence of SEQ ID NO: 56 is a codon-optimized form of the spike protein antigen of the SARS-CoV-2 omicron mutant virus. The spike protein antigen is codon-optimized for yeast, and the nucleic acid sequence of SEQ ID NO: 57 is a codon-optimized form of the spike protein antigen of the SARS-CoV-2 omicron mutant virus, both for humans and codon-optimized for yeast. It has a form.

(1) SARS-CoV-2 omicron mutant virus spike protein wild type amino acid sequence: SEQ ID NO: 53

(2-1) SARS-CoV-2 omicron mutant virus spike protein wild type nucleic acid sequence: SEQ ID NO: 54

(2-2) SARS-CoV-2 omicron mutant virus spike protein wild type nucleic acid sequence: SEQ ID NO: 95

(3-1) SARS-CoV-2 omicron mutant virus spike protein human codon optimized nucleic acid sequence: SEQ ID NO: 55

(3-2) SARS-CoV-2 omicron mutant virus spike protein human codon optimized nucleic acid sequence: SEQ ID NO: 96

(4-1) SARS-CoV-2 omicron mutant virus spike protein yeast codon optimized nucleic acid sequence: SEQ ID NO: 56

(4-2) SARS-CoV-2 omicron mutant virus spike protein yeast codon optimized nucleic acid sequence: SEQ ID NO: 97

(5-1) SARS-CoV-2 omicron mutant virus spike protein yeast codon (1430nt) and human codon (2283nt) optimized nucleic acid sequence: SEQ ID NO: 57

(5-2) SARS-CoV-2 omicron mutant virus spike protein yeast codon (1430nt) and human codon (2283nt) optimized nucleic acid sequence: SEQ ID NO: 98

Examples 1-5. Construction of fusion nucleic acid molecules

Example 1-5-1. Fusion of a polynucleotide encoding a signal peptide, a polynucleotide encoding a Th cell epitope, and a polynucleotide encoding a membrane protein.

A nucleic acid molecule fused with a polynucleotide encoding a signal peptide, a polynucleotide encoding a Th cell epitope (including a GS linker), and a polynucleotide encoding a membrane protein obtained through Examples 1-1 to 1-3. Manufactured.

Specifically, the nucleic acid molecule was constructed to include a T7 promoter, 5'-UTR, a polynucleotide encoding each codon-optimized signal peptide, a polynucleotide encoding a codon-optimized membrane protein, 3'-UTR, and Poly A; Its schematic diagram is shown in Figures 1 to 4b.

Thereafter, in order to synthesize the nucleic acid molecule into mRNA, 10 ), 5% DMSO (Sigma Aldrich catalog #472301-500ML), 10 mg/L SARS-CoV-2 membrane protein DNA transcription template, 800 U/mL recombinant RNase inhibitory protein (Takara catalog #2316A), 2 U/mL yeast Inorganic pyrophosphatase (Thermo Scientific catalog #EF0221) and 2500 U/mL T7 RNA polymerase (DyneBio catalog #dy1670) were mixed, and the transcription reaction mixture was incubated at 37°C for 2 hours. The synthesis of mRNA was confirmed by electrophoresis using a 1% agarose gel supplemented with Lonza GelStarTM Nucleic Acid gel Stain (Catalog #5 0535). Meanwhile, the synthesized mRNA was purified by AKTA (Cytiva, AKTA avant) using an Oligo(dT) column (bioseparation, catalog #311.1219-2) and used in subsequent in vitro or in vivo experiments.

Example 1-5-2. Fusion of a polynucleotide encoding a signal peptide, a polynucleotide encoding a Th cell epitope, and a polynucleotide encoding a spike protein.

Nucleic acid molecules were prepared by fusing the polynucleotide encoding the signal peptide, the polynucleotide encoding the Th cell epitope, and the polynucleotide encoding the spike protein obtained through Examples 1-1 to 1-4.

Specifically, the nucleic acid molecule was constructed to include a T7 promoter, 5'-UTR, a polynucleotide encoding each codon-optimized signal peptide, a polynucleotide encoding a codon-optimized spike protein, 3'-UTR, and Poly A; Its schematic diagram is shown in Figure 5. The subsequent mRNA synthesis process was carried out in the same manner as in Example 1-5-1.

Example 2. Effect of nucleic acid molecules for vaccines

Example 2-1. protein expression level

In order to confirm the efficacy of the nucleic acid molecule prepared in Example 1, the expression rate of membrane protein or antigen protein was analyzed in vitro. It is generally known that if a drug exhibits high expression characteristics in vitro, it exhibits high immunogenicity in vivo, thereby increasing the efficacy of the vaccine.

Specifically, HEK-293T (ATCC, catalog number CRL-1586) cells were cultured in DMEM medium containing 10% FBS and 1% Pen/Strep, and the above procedure was performed on HEK-293T cells at 4 × 10 ⁵ cells/well. The nucleic acid molecule prepared according to Example 1 was transfected at a concentration of about 0.1 or 0.05 g/L. At this time, the nucleic acid molecule was used as a carrier in the form of mRNA-LNP supported on lipid nanoparticles (LNP). After transfection was completed, the intracellular protein expression of the nucleic acid molecule and the resulting protein secretion level out of the cell were analyzed through Western blot according to a method known in the art. Western blot uses SARS-CoV-2 membrane or spike polyclonal antibody as the primary antibody against the lysate of the transfected cells, and HRP-conjugated secondary antibody (goat anti-rabbit IgG) as the secondary antibody. It was performed using .

As a result, as can be seen in Figures 6A to 8B, the nucleic acid molecule containing the polynucleotide encoding each signal peptide, the polynucleotide encoding the membrane protein, and the polynucleotide encoding the Th cell epitope are polynucleotides encoding the Th cell epitope. There was a difference in the expression rate of membrane protein depending on the position of the nucleotide (5'-end or 3'-end). That is, if the polynucleotide encoding the Th cell epitope is located at the 5'-end of the polynucleotide encoding the membrane protein, the polynucleotide encoding the Th cell epitope is located at the 3'-end of the polynucleotide encoding the membrane protein. The expression rate of membrane protein increased more than in the case where it was located.

Meanwhile, as can be seen in FIGS. 9A to 9C, in the case of nucleic acid molecules containing polynucleotides encoding each signal peptide, the expression rates of spike proteins were all excellent. That is, a polynucleotide encoding a spike protein (FIGS. 9b and 9c) derived from a virus that does not mutate (prototype virus) or mutates (delta or omicron mutant virus), including a polynucleotide encoding each signal peptide. All nucleic acid molecules containing nucleotides had excellent spike protein expression rates, and each spike protein was detected in the form of total protein or S1 protein in cell culture or cell lysate.

The above results indicate that nucleic acid molecules comprising a polynucleotide encoding a codon-optimized signal peptide, a polynucleotide encoding a Th cell epitope, a polynucleotide encoding a membrane protein, and/or a polynucleotide encoding an antigen protein are membrane proteins, respectively. And/or the expression rate of the antigen protein is excellent, and the nucleic acid molecule has the effect of increasing the protein expression rate of the polynucleotide encoding the antigen protein derived from different mutant viruses, so rapid production of mRNA vaccines against various mutant viruses. This suggests that it can be usefully used.

Example 2-2. Immunogenicity

In order to confirm the efficacy of the nucleic acid molecule prepared in Example 1, the immunogenicity of the nucleic acid molecule was confirmed. Immunogenicity refers to the ability of an antigen to cause an immune response in the body. To analyze immunogenicity, in this example, it was confirmed whether the nucleic acid molecule produces T cells that secrete IFN-γ in the body. IFN-γ is an important component responsible for the innate antiviral response and is mainly produced by NK cells, innate lymphocyte type 1 (ILC1), and T helper cell type 1 (Th1). If the production of IFN-γ by these immune cells is not achieved, viral replication increases in vivo.

Specifically, each nucleic acid molecule prepared in Example 1 was formulated into LNP (mRNA-LNP), and administered to Balb/c female mice twice at 2-week intervals. Splenocytes from mice were isolated one week after the last boosting (two vaccinations). The groups of mice administered different nucleic acid molecules are summarized in Table 5 below.

The number of IFN-γ-secreting T cells was measured by the ELISPOT method. To perform ELISPOT, the splenocytes were seeded in plates at a density of 2.5 x 10 ⁵ /well. At this time, each well of the plate is coated with an antibody that detects mouse IFN-γ. After spleen cells were inoculated, they were stimulated by treatment with antigen (spleen cell stimulating material, such as membrane protein peptide, spike-membrane protein peptide, or Th cell epitope peptide) for 48 hours. The amount of IFN-γ secretion increases in proportion to the number of T cells reacting to each antigen, which appears in the form of spots by the antibodies coated in each well of the plate. The number of spots was calculated to analyze the amount of IFN-γ secreting T cells produced by the nucleic acid molecule, that is, the cellular immunogenicity of the nucleic acid molecule.

As a result, as can be seen in Figure 10, Group 3 (administered nucleic acid molecules that do not contain polynucleotides encoding Th cell epitopes); and Group 5 (a nucleic acid molecule in which a polynucleotide encoding a Th cell epitope is located at the 3'-end of a polynucleotide encoding a membrane protein is administered), compared to Group 5 (a polynucleotide encoding a Th cell epitope is administered at the 3'-end of a polynucleotide encoding a membrane protein). (administered with a nucleic acid molecule positioned at the 5'-end of a polynucleotide encoding the protein), the number of T cells secreting IFN-γ against the membrane protein increased.

Additionally, compared to group 2 (which was administered a nucleic acid molecule containing only a polynucleotide encoding the spike protein), group 7 (which contained polynucleotides encoding a spike protein, a membrane protein and a Th cell epitope, respectively) secretion of IFN-γ in response to membrane proteins, spike-membrane fusion proteins, and Th peptides (administered with a nucleic acid molecule comprising a polynucleotide encoding a spike and at the 5'-end of a polynucleotide encoding a membrane). The number of T cells increased.

That is, a nucleic acid molecule containing a polynucleotide encoding a Th cell epitope at the 5'-end of a polynucleotide encoding a membrane protein showed increased cellular immunogenicity compared to a polynucleotide containing this at the 3'-end. .

The above results show that nucleic acid molecules comprising a polynucleotide encoding a codon-optimized signal peptide, a polynucleotide encoding a Th cell epitope, a polynucleotide encoding a membrane protein, and/or a polynucleotide encoding an antigen protein, respectively, are immunogenic. Because it exhibits these increased characteristics, it suggests that it can be useful as an mRNA vaccine against various mutant viruses.

Claims (23)

1. A polynucleotide encoding a signal peptide; A polynucleotide encoding a Th cell epitope; and one or more of a polynucleotide encoding a membrane protein or a polynucleotide encoding an antigenic protein.
2. According to paragraph 1,

   The signal peptide is selected from one or more of the group consisting of IgE (Immunoglobulin E), albumin, interferon gamma (IFN-γ), factor IX, and mucin-like protein 1. A nucleic acid molecule from which it is derived.
3. According to paragraph 1,

   A nucleic acid molecule wherein the polynucleotide encoding the signal peptide is represented by one or more selected from the group consisting of SEQ ID NOs: 58 to 72.
4. According to paragraph 1,

   The polynucleotide encoding the signal peptide is a nucleic acid molecule transcribed from one or more selected from the group consisting of SEQ ID NOs: 2 to 4, 6 to 8, 10 to 12, 14 to 16, and 18 to 20.
5. According to paragraph 1,

   A nucleic acid molecule wherein the Th cell epitope is derived from one or more selected from the group consisting of tetanus toxoid, diphtheria toxoid (DTH toxoid), and pertussis toxoid.
6. According to paragraph 1,

   A nucleic acid molecule, wherein the polynucleotide encoding the Th cell epitope is located at the 5'-end of a polynucleotide encoding a membrane protein or a polynucleotide encoding an antigen protein within the nucleic acid molecule.
7. According to paragraph 1,

   A nucleic acid molecule wherein the Th cell epitope includes a linker peptide.
8. According to paragraph 1,

   The polynucleotide encoding the Th cell epitope is a nucleic acid molecule represented by one or more selected from the group consisting of SEQ ID NOs: 73 to 81.
9. According to paragraph 1,

   The polynucleotide encoding the Th cell epitope is a nucleic acid molecule transcribed from one or more selected from the group consisting of SEQ ID NOs: 22, 24, 26, 28, 30, 32, 33, 35, and 36.
10. According to paragraph 1,

    A nucleic acid molecule, wherein the membrane protein is derived from a coronavirus.
11. According to clause 10,

    The coronavirus is a nucleic acid molecule that is not mutated (prototype pathogen) or mutated (variant).
12. According to paragraph 1,

    A nucleic acid molecule wherein the polynucleotide encoding the membrane protein is represented by one or more selected from the group consisting of SEQ ID NOs: 82 to 86.
13. According to paragraph 1,

    A nucleic acid molecule wherein the polynucleotide encoding the membrane protein is transcribed from one or more selected from the group consisting of SEQ ID NOs: 38 to 42.
14. According to paragraph 1,

    The antigen protein is a nucleic acid molecule that is a spike protein derived from a coronavirus.
15. According to clause 14,

    The coronavirus is a nucleic acid molecule that is either unmutated (prototype) or mutated (variant).
16. According to clause 14,

    A nucleic acid molecule wherein the polynucleotide encoding the spike protein is represented by one or more selected from the group consisting of SEQ ID NOs: 87 to 98.
17. According to clause 14,

    The polynucleotide encoding the spike protein is a nucleic acid molecule transcribed from one or more selected from the group consisting of SEQ ID NOs: 44 to 47, 49 to 52, and 54 to 57.
18. A vaccine composition for preventing or treating viral infections, comprising the nucleic acid molecule of claim 1.
19. According to clause 18,

    A vaccine composition wherein the viral infection is a coronavirus infection.
20. According to clause 19,

    The coronavirus infection is selected from the group consisting of Severe Acute Respiratory Syndrome (SARS), Middle East Respiratory Syndrome (MERS), and Coronavirus disease-2019 (COVID-19). One or more vaccine compositions.
21. According to clause 18,

    A vaccine composition wherein the nucleic acid molecule is carried or linked to a delivery vehicle.
22. According to clause 21,

    The vaccine composition, wherein the carrier is one or more selected from the group consisting of liposome-based carriers, lipid-based carriers, polymer-based carriers, and lipid-polymer hybrid nanoparticles.
23. According to clause 21,

    The carrier includes liposome, phytosome, ethosome, lipid nanoparticle, lipid-like nanoparticle, lipid emulsion, lipoplex ( lipoplex, lipid micelle, polymersome, polymeric nanoparticle, dendrimer, nanosphere, polyplex, polymeric micelle, A vaccine composition, one or more selected from the group consisting of lipid-polymer hybrid nanoparticles, cationic nanoemulsions, anionic nanoemulsions and lipopolyplexes.

Images