WO2018093402A1 - Méthodes et préparations pour la détection de troubles neurodéveloppementaux - Google Patents

Méthodes et préparations pour la détection de troubles neurodéveloppementaux Download PDF

Info

Publication number
WO2018093402A1
WO2018093402A1 PCT/US2016/065669 US2016065669W WO2018093402A1 WO 2018093402 A1 WO2018093402 A1 WO 2018093402A1 US 2016065669 W US2016065669 W US 2016065669W WO 2018093402 A1 WO2018093402 A1 WO 2018093402A1
Authority
WO
WIPO (PCT)
Prior art keywords
son
polypeptide
level
nucleic acid
fully functional
Prior art date
Application number
PCT/US2016/065669
Other languages
English (en)
Inventor
Eun-Young Erin AHN
Jung-Hyun Kim
Ssang-Taek LIM
Original Assignee
University Of South Alabama
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University Of South Alabama filed Critical University Of South Alabama
Publication of WO2018093402A1 publication Critical patent/WO2018093402A1/fr

Links

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
    • G01N33/6896—Neurological disorders, e.g. Alzheimer's disease
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/50—Determining the risk of developing a disease

Definitions

  • Embodiments of the present invention relate to the diagnosis of neurodevelopmental disorders. Some embodiments relate to methods and kits for the diagnosis of neurodevelopmental disorders, including intellectual disability and developmental delay.
  • Some embodiments of the methods and compositions provided herein include a method for the diagnosis of a neurodevelopmental disorder, a likelihood of developing a neurodevelopmental disorder, or a likelihood of having a child having a neurodevelopmental disorder in a test subject comprising: determining the presence of a mutation in a SON gene in a sample from a subject.
  • the mutation reduces the activity of a polypeptide encoded by a SON gene.
  • the mutation is selected from a point mutation, an insertion and a deletion.
  • the mutation is a loss-of-function mutation.
  • the mutation is located at a position in exon 3 of the human SON gene or at position that corresponds to exon 3 of a human SON gene.
  • the mutation is a de novo mutation in the test subject.
  • the SON gene is a human SON gene.
  • the mutation is one or more of the following mutations in a human SON gene or that corresponds to one or more of the following mutations in a human SON gene: c.5549_5550del, c.1881 1882del, c.5753_5756del, c.3852_3856del, c.5753_5756del, c.4999_5013del; 5031_5032insAA, c.6002_6003insCC, c.4358_4359del, c.4640del, c.6087del, c.3597_3598dupGC, c.4151_4174del24, c.2365del, C.33340T, c.268del, c.4055del, c.4549dup, c.5753_5756del, and c.5753_5756del.
  • the mutation in a nucleic acid results in and corresponds to one or more changes in a human SON polypeptide selected from: p.(Argl 850Ilefs*3), p.(Val629Alafs*56), p.(Val l 91 8Glufs*87), p.(Metl 28411efs*2), p.(Val l 918Glufs*87), p.([Aspl 667_Asn l 671 del; Aspl 678Lysfs*9]), p.(Arg2002Glnfs*5), p.(Thrl453Serfs* l l), p.(Hisl547Leufs*76), p.(Ser2029Argfs*22), p.(Pro l200Argfs* 17), p.(Leu l384_Vall391del), p.(Ser789Ala
  • the mutation results in a decrease in the level of a SON polypeptide or a nucleic acid encoding the SON polypeptide in a cell of the test subject.
  • Some embodiments of the methods and compositions provided herein include a method for the diagnosis of a neurodevelopmental disorder in a test subject comprising: determining the level of a fully functional SON polypeptide or a nucleic acid encoding the fully functional SON polypeptide in a sample from the test subject.
  • Some embodiments also include comparing the level of the fully functional SON polypeptide or the nucleic acid encoding the fully functional SON polypeptide in a sample from the test subject with the level of a fully functional SON polypeptide or a nucleic acid encoding the fully functional SON polypeptide in a subject not having a neurodevelopmental disorder.
  • a decrease in the level the fully functional SON polypeptide or the nucleic acid encoding the fully functional SON polypeptide in a sample from the test subject is indicative of the test subject having a neurodevelopmental disorder a likelihood of developing a neurodevelopmental disorder, or a likelihood of having a child having a neurodevelopmental disorder.
  • the decrease is at least 50%.
  • the decrease is at least 60%.
  • the decrease is at least 70%.
  • the level of the fully functional SON polypeptide or the nucleic acid encoding the fully functional SON polypeptide in a sample from the test subject is determined by hybridizing a primer or hybridization probe to a nucleic acid in the sample.
  • the primer or hybridization probe is selected from an oligonucleotide having a sequence selected from the group consisting of SEQ ID NO.s: 01 -06.
  • the level of the fully functional SON polypeptide or the nucleic acid encoding the fully functional SON polypeptide in a sample from the test subject is determined with an antibody or antigen-binding fragment thereof that specifically binds to a fully functional polypeptide encoded by the SON gene.
  • the antibody or antigen-binding fragment thereof is attached to a solid support.
  • Some embodiments also include determining the level of one or more additional polypeptides or one or more additional nucleic acids encoding the one or more additional polypeptides in a sample from the test subject, wherein the polypeptide is encoded by a gene selected from a gene listed in TABLE 4A, TABLE 4B and TABLE 5.
  • Some embodiments also include determining the level of one or more additional polypeptides or one or more additional nucleic acids encoding the one or more additional polypeptides in a sample from the test subject, wherein the one or more additional polypeptides is encoded by a gene selected from the group consisting of TUBG l , FLNA, PN P, WD 62, PSMD3, HDAC6, PC 2, PF L, IDH2, ACY1 and ADA.
  • Some embodiments also include comparing the level of the one or more additional polypeptides or one or more additional nucleic acids encoding the one or more additional polypeptides in a sample from the test subject with the level of one or more additional polypeptides or one or more nucleic acids encoding the one or more additional polypeptides in a sample from a subject not having a neurodevelopmental disorder.
  • the level of the one or more additional polypeptides or the one or more additional nucleic acids encoding the one or more additional polypeptides in a sample from the test subject is decreased.
  • the decrease is at least 50%.
  • the decrease is at least 60%.
  • the decrease is at least 70%.
  • Some embodiments also include determining the level of a TUBA 1 A polypeptide or a nucleic acid encoding the TUBA 1 A polypeptide in a sample from the test subject.
  • Some embodiments also include comparing the level of the TUBA 1 A polypeptide or a nucleic acid encoding the TUBA 1 A polypeptide in a sample from the test subject with the level of a TUBA1A polypeptide or a nucleic acid encoding the TUBA1A polypeptide in a subject not having a neurodevelopmental disorder.
  • the level of the TUBA1A polypeptide or a nucleic acid encoding the TUBA 1 A polypeptide in a sample from the test subject is increased.
  • the increase is at least 10%.
  • the increase is at least 20%.
  • the increase is at least 30%.
  • the level of the TUBA1A polypeptide or a nucleic acid encoding the TUBA1A polypeptide in a sample from the test subject is determined by hybridizing a primer or a hybridization probe to a nucleic acid in the sample.
  • the primer or hybridization probe is selected from an oligonucleotide having a sequence selected from the group consisting of SEQ ID NO.s: 07-30.
  • the neurodevelopmental disorder comprises an intellectual disability and/or a developmental disorder.
  • the neurodevelopmental disorder comprises mild to moderate facial dysmorphisms selected from facial asymmetry, midface retraction, low set ears, down-slanting palpebral fissures, deep-set eyes, horizontal eyebrows, broad/depressed nasal bridge, and short philtrum.
  • the neurodevelopmental disorder comprises abnormal gyration pattern selected from polymicrogyria, simplified gyria and periventricular nodular heterotopia; ventriculomegaly; Arnold-Chiari malformation; arachnoid cyst; hypoplasia of the corpus callosum; hypoplasia of the cerebellar hemispheres; and loss of periventricular white matter.
  • the neurodevelopmental disorder comprises one or more abnormalities selected from brain malformation selected from ventricular enlargement, corpus callosum abnormality, cortex malformation, a white matter abnormality, and a cerebellum abnormality; a neurological feature selected from seizures and hypotoniz; a musculoskeletal abnormality selected from hypermobility, scoliosis/kyphosis, hemivertebrae, and contractures; an ocular abnormality selected from strabismus, (suspicion) cortical visual impairment (CVI), hypermetropia; a heart defect; a gastrointestinal malformation; an urogenital malformation selected from horseshoe kidney; facial dysmorphism; short statute; and craniosynostosis.
  • brain malformation selected from ventricular enlargement, corpus callosum abnormality, cortex malformation, a white matter abnormality, and a cerebellum abnormality
  • a neurological feature selected from seizures and hypotoniz
  • a musculoskeletal abnormality selected from hypermobility, s
  • Some embodiments also include obtaining a sample from the test subject.
  • the sample comprises fetal tissue, and/or maternal tissue.
  • the sample comprises fetal blood, maternal blood, and amniotic fluid.
  • the test subject is selected from a fetus, a neonate, a child, an adolescent, and an adult.
  • test subject is human.
  • Some embodiments of the methods and compositions provided herein include a method of detecting a reduction in the level or an absence of a nucleic acid encoding a fully functional SON polypeptide or a reduction in the level or the absence of a fully functional SON polypeptide in a test subject comprising: contacting a nucleic acid or polypeptide sample from the test subject with an agent which indicates a reduction in the level or an absence of a nucleic acid encoding a fully functional SON polypeptide or a reduction in the level or the absence of a fully functional SON polypeptide in the test subject; and determining the level or the absence of a nucleic acid encoding a fully functional SON polypeptide or the level or the absence of a fully functional SON polypeptide in the test subject.
  • Some embodiments also include comparing the level or the absence of a nucleic acid encoding a fully functional SON polypeptide or the level or the absence of a fully functional SON polypeptide in the test subject with the level or the absence of a nucleic acid encoding a fully functional SON polypeptide or the level or the absence of a fully functional SON polypeptide in a subject not having a neurodevelopmental disorder.
  • a decrease in the level or the absence of a nucleic acid encoding a fully functional SON polypeptide or in the level or the absence of a fully functional SON polypeptide in the test subject is indicative of the test subject having a neurodevelopmental disorder, a likelihood of developing a neurodevelopmental disorder, or a likelihood of having a child having a neurodevelopmental disorder.
  • the decrease is at least 50%.
  • the decrease is at least 60%.
  • the decrease is at least 70%.
  • the level or the absence of a nucleic acid encoding a fully functional SON polypeptide or the level or the absence of a fully functional SON polypeptide in the test subject is determined by hybridizing a primer or hybridization probe to a nucleic acid in the sample.
  • the primer or hybridization probe is selected from an oligonucleotide having a sequence selected from the group consisting of SEQ ID NO.s: 01 -06.
  • the level or the absence of a nucleic acid encoding a fully functional SON polypeptide or the level or the absence of a fully functional SON polypeptide in the test subject is determined with an antibody or antigen-binding fragment thereof that specifically binds to a polypeptide encoded by the SON gene.
  • the antibody or antigen-binding fragment thereof is attached to a solid support.
  • Some embodiments also include determining the level of one or more additional polypeptides or one or more additional nucleic acids encoding the one or more additional polypeptide in a sample from the test subject, wherein the one or more additional polypeptides is encoded by a gene selected from a gene listed in TABLE 4A, TABLE 4B and TABLE 5.
  • Some embodiments also include determining the level of one or more additional polypeptides or one or more additional nucleic acids encoding the one or more additional polypeptides in a sample from the test subject, wherein the one or more additional polypeptides is encoded by a gene selected from the group consisting of TUBG l , FLNA, PN P, WD 62, PSMD3, HDAC6, PC 2, PF L, IDH2, ACY1 and ADA.
  • Some embodiments also include comparing the level of the one or more additional polypeptides or one or more additional nucleic acids encoding the one or more additional polypeptides in a sample from the test subject with the level of one or more additional polypeptides or one or more nucleic acids encoding the one or more additional polypeptides in a subject not having a neurodevelopmental disorder.
  • the level of the one or more additional polypeptides or one or more additional nucleic acids encoding the one more additional polypeptides in a sample from the test subject is decreased.
  • the decrease is at least 50%.
  • the decrease is at least 60%.
  • the decrease is at least 70%.
  • Some embodiments also include determining the level of a TUBA 1 A polypeptide or a nucleic acid encoding the TUBA 1 A polypeptide in a sample from the test subject.
  • Some embodiments also include comparing the level of the TUBA 1 A polypeptide or a nucleic acid encoding the TUBA 1 A polypeptide in a sample from the test subject with the level of a TUBA 1 A polypeptide or a nucleic acid encoding the TUBA 1 A polypeptide in a subject not having a neurodevelopmental disorder.
  • the level of the TUBA1A polypeptide or a nucleic acid encoding the TUBA1A polypeptide in a sample from the test subject is increased.
  • the increase is at least 10%.
  • the increase is at least 20%.
  • the increase is at least 30%.
  • the level of the TUBA 1 A polypeptide or a nucleic acid encoding the TUBA 1 A polypeptide in a sample from the test subject is determined by hybridizing a primer or a hybridization probe to a nucleic acid in the sample.
  • the primer or hybridization probe is selected from an oligonucleotide having a sequence selected from the group consisting of SEQ ID NO.s: 07-30.
  • the neurodevelopmental disorder comprises an intellectual disability and/or a developmental disorder.
  • the neurodevelopmental disorder comprises mild to moderate facial dysmorphisms selected from facial asymmetry, midface retraction, low set ears, down-slanting palpebral fissures, deep-set eyes, horizontal eyebrows, broad/depressed nasal bridge, and short philtrum.
  • the neurodevelopmental disorder comprises abnormal gyration pattern selected from polymicrogyria, simplified gyria and periventricular nodular heterotopia; ventriculomegaly; Arnold-Chiari malformation; arachnoid cyst; hypoplasia of the corpus callosum; hypoplasia of the cerebellar hemispheres; and loss of periventricular white matter.
  • the neurodevelopmental disorder comprises one or more abnormalities selected from brain malformation selected from ventricular enlargement, corpus callosum abnormality, cortex malformation, a white matter abnormality, and a cerebellum abnormality; a neurological feature selected from seizures and hypotoniz; a musculoskeletal abnormality selected from hypermobility, scoliosis/kyphosis, hem i vertebrae, and contractures; an ocular abnormality selected from strabismus, (suspicion) cortical visual impairment (CVI), hypermetropia; a heart defect; a gastrointestinal malformation; an urogenital malformation selected from horseshoe kidney; facial dysmorphism; short statute; and craniosynostosis.
  • brain malformation selected from ventricular enlargement, corpus callosum abnormality, cortex malformation, a white matter abnormality, and a cerebellum abnormality
  • a neurological feature selected from seizures and hypotoniz
  • a musculoskeletal abnormality selected from hypermobility, s
  • Some embodiments also include obtaining a sample from the test subject.
  • the sample comprises fetal tissue, and/or maternal tissue.
  • the sample comprises fetal blood, maternal blood, and amniotic fluid.
  • the test subject is selected from a fetus, a neonate, a child, an adolescent, and an adult. [0084] In some embodiments, the test subject is human.
  • kits comprising an agent for determining the presence, absence or level of a fully functional SON polypeptide or a nucleic acid encoding a fully functional SON polypeptide.
  • the agent specifically binds to a fully functional SON polypeptide or a nucleic acid encoding a fully functional SON polypeptide
  • the agent is selected from a primer, a hybridization probe, and an antibody or antigen-binding fragment thereof.
  • the SON polypeptide is a human SON polypeptide.
  • the fully functional SON polypeptide is encoded by a nucleic acid comprising SEQ ID NO:61 .
  • the fully functional SON polypeptide comprises SEQ ID NO:62.
  • the agent is attached to a solid support.
  • Some embodiments also include an agent for determining the presence, absence or level of a polypeptide encoded by a SON gene having a mutation therein.
  • kits comprising: an agent for determining the level of a fully functional SON transcript, or an alternatively-spliced SON transcript.
  • the agent is selected from a primer, a hybridization probe, and an antibody or antigen-binding fragment thereof.
  • the fully functional SON transcript is encoded by a nucleic acid comprising SEQ ID NO:61.
  • the alternatively-spliced SON transcript is encoded by a SON gene having a mutation therein.
  • kits comprising: an agent for determining the presence, absence or level of a polypeptide encoded by a SON gene having a mutation therein.
  • the agent is selected from a primer, a hybridization probe, and an antibody or antigen-binding fragment thereof.
  • the mutation reduces the activity of a polypeptide encoded by a SON gene.
  • the mutation is selected from a point mutation, an insertion and a deletion.
  • the mutation is a loss-of-function mutation.
  • the mutation is located at a position in exon 3 of the human SON gene or at position that corresponds to exon 3 of a human SON gene.
  • the SON gene is a human SON gene.
  • the mutation is one or more of the following mutations in a human SON gene or that corresponds to one or more of the following mutations in a human SON gene: c.5549_5550del, c.1881 1882del, c.5753_5756del, c.3852_3856del, c.5753_5756del, c.4999_5013del; 5031_5032insAA, c.6002_6003insCC, c.4358_4359del, c.4640del, c.6087del, c.3597_3598dupGC, c.4151_4174del24, c.2365del, C.33340T, c.268del, c.4055del, c.4549dup, c.5753_5756del, and c.5753_5756del.
  • the mutation in a nucleic acid results in and corresponds to one or more changes in a human SON polypeptide selected from: p.(Argl 850Ilefs*3), p.(Val629Alafs*56), p.(Val l 91 8Glufs*87), p.(Metl 28411efs*2), p.(Val l 918Glufs*87), p.([Aspl 667_Asn l 671 del; Aspl 678Lysfs*9]), p.(Arg2002Glnfs*5), p.(Thrl 453Serfs* l l ), p.(Hisl 547Leufs*76), p.(Ser2029Argfs*22), p.(Pro l 200Argfs* 17), p.(Leul 384_Val 1391 del), p.(Ser789Alafs
  • the agent is a primer or a hybridization probe.
  • the primer or hybridization probe is selected from an oligonucleotide having a sequence selected from the group consisting of SEQ ID NO.s: 01 -06.
  • Some embodiments also include an additional agent that specifically binds to one or more additional polypeptides or one or more additional nucleic acids encoding the one or more polypeptide in a sample from the test sample, wherein the one or more additional polypeptides is encoded by a gene selected from a gene listed in TABLE 4A, TABLE 4B and TABLE 5.
  • Some embodiments also include an additional agent that specifically binds to the one or more additional polypeptides or one or more additional nucleic acid encoding the one or more additional polypeptides in a sample from the test sample, wherein the one or more additional polypeptides is encoded by a gene selected from a gene selected from the group consisting of TUBG1 , FLNA, PNKP, WDR62, PSMD3, HDAC6, PCK2, PFKL, IDH2, ACY1 and ADA.
  • Some embodiments also include an additional agent that specifically binds to TUBA1A polypeptide or a nucleic acid encoding the TUBA1A polypeptide in a sample from the test subject.
  • the agent is a primer or a hybridization probe.
  • the primer or a hybridization probe is selected from an oligonucleotide having a sequence selected from the group consisting of SEQ ID NO.s: 07-30.
  • the agent is attached to a solid support.
  • FIG. 1A depicts family pedigrees of individuals carrying mutation in SON.
  • FIG. I B depicts photos of individuals with SON mutations.
  • FIG. 1 C depicts MRI images of the brain of Individual- 1 .
  • FIG. I D depicts MRI images of the brain of Individual-2.
  • FIG. I E depicts MRI images of the brain of Individual-7.
  • FIG. IF depicts photos showing small feet and short toes of Individual-2 at age 9 years, Individual-4 at age 19 years, and Individual-19 at age 10 years (from left to right).
  • FIG. 1G depicts photos showing low set ears in Individual-2, Individual-4, Individual-10 and Individual- 13 (from left to right); midface retraction and short phi ltrum are noticeable in Individual-4 and Individual-13.
  • FIG. 2A depicts a schematic representation of the SON gene and the SON protein showing the position of the mutations identified from the 20 affected individuals with color-coded arrowheads. The locations of the PCR primer sets are indicated by black arrows.
  • FIG. 2B depicts real-time qPCR with three different pairs of the primers that showed overall downregulation of SON mRNA in the affected individuals compared to parents/unrelated normal individual. Error bars represent mean ⁇ S.D. *P ⁇ 0.001 .
  • FIG. 2C depicts Western blots for SON-N antibody (left panel) and the cocktail of SON WU antibodies (right panel).
  • FIG. 2D depicts sequence chromatograms and predicted amino acid sequences of two families with SON heterozygous mutations: Individual-1 , top panel; and Individual-2, bottom panel.
  • FIG. 3A depicts graphs for percentages of embryos with phenotype are shown in the bar graphs, and number of embryos examined is listed next to the bars.
  • FIG. 3B depicts representative images of phenotype observed 72 hours after MO injection. Red arrow, bent spine/tail; white arrow, eye defects; yellow arrow, brain edema.
  • FIG. 3C depicts an alignment of human (SEQ ID NO:62) and zebrafish (SEQ ID NO:77) SON proteins.
  • FIG. 4A depicts graphs showing downregulation of multiple genes associated with the pathophysiology of ID/DD and metabolic disorders in the affected individuals compared to parents and unrelated healthy individuals.
  • the level of TUBA 1 A mRNA was shown a negative control (unaffected transcript). Error bars represent mean ⁇ S.D. *P ⁇ 0.001.
  • FIG. 4B depicts intron retention and exon skipping of genes involved in ID/DD, when mutated, (left panel) and genes involved in metabolic disorders, when mutated (right panel) in the individuals with SON mutations. Locations of the primers used for PCR are marked by gray arrows above the exons. Analysis of TUBA 1 A pre-mRNA, as a negative control, demonstrated that splicing of this transcript is not impaired in the affected individuals. *, intron-retained products; #, exon-skipped products.
  • FIG. 4C depicts a schematic representation of the zebrafish son gene and son protein.
  • Top schematic representation of the zebrafish son gene (Gene ID: LOC565999, GenBank accession number: XM 689264).
  • the zebrafish son contains 13 exons (gray boxes) and several introns (bold lines). Red bar indicates target sequence (intron9-exon 10 junction) of morpholino.
  • Bottom Structural feature of the zebrafish son protein (GenBank accession number: XP 694356). Similar to human SON, zebrafish son has the RS domain (Ser/Arg- rich domain) and two RNA-binding motifs (G-Patch and DSRM).
  • FIG. 5 depicts representative images of phenotype observed 24 hours and 48 hours after MO injection.
  • Zebrafish injected with son morpholino (MO, 6.25ng) showed bent spine/tail (indicated by red arrow), head/eye defect, no head or small head (white arrow) and brain edema (yellow arrow).
  • FIG. 6 depicts SON knockdown effect on intron retention and exon skipping of SON target genes in HeLa cells.
  • RT-PCR was performed to detect splicing defects of selected SON target genes in control or SON siRNA-transfected HeLa cells.
  • Increased intron retention of nine SON target genes (TUBG 1 , FLNA, PN P, WDR62, PSMD3, PCK.2, IDH2, PFK.L and ACY1 ) and exon skipping of two SON target genes (HDAC6 and ADA) were detected in SON siRNA-transfected HeLa cells using specific primer sets (indicated by gray arrows above the exons).
  • TUBA1A splicing was analyzed as a negative control that does not require SON for correct splicing.
  • Embodiments of the methods and compositions provided herein relate to an ID syndrome caused by mutations in the SON gene, including de novo heterozygous loss- of-function mutations in a SON gene.
  • the syndrome is characterized by ID/DD, malformations of the cerebral cortex, epilepsy, vision problems, musculoskeletal abnormalities and congenital malformations. Son knockdown in zebrafish resulted in severe malformation of the spine, brain and eyes.
  • RNA from affected individuals revealed that genes critical for neuronal migration/cortex organization (TUBG 1 , FLNA, PNKP, WDR62, PSMD3, and HDAC6) and metabolism (PCK.2, PFKL, IDH2, ACY 1 and ADA) were significantly downregulated due to accumulation of mis-spliced transcripts resulting from erroneous SON-mediated RNA splicing.
  • the data highlight SON as a master regulator governing neurodevelopment, and demonstrated the importance of SON-mediated RNA splicing in human development.
  • Some embodiments of the methods and compositions provided herein include methods for the diagnosis of a neurodevelopmental disorder a likelihood of developing a neurodevelopmental disorder, or a likelihood of having a child having a neurodevelopmental disorder in a test subject.
  • the neurodevelopmental disorder can include an intellectual disability and/or a developmental disorder.
  • the neurodevelopmental disorder can include mild to moderate facial dysmorphisms selected from facial asymmetry, midface retraction, low set ears, down-slanting palpebral fissures, deep-set eyes, horizontal eyebrows, broad/depressed nasal bridge, and/or short philtrum.
  • the neurodevelopmental disorder can include abnormal gyration pattern selected from polymicrogyria, simplified gyria and periventricular nodular heterotopia; ventriculomegaly; Arnold-Chiari malformation; arachnoid cyst; hypoplasia of the corpus callosum; hypoplasia of the cerebellar hemispheres; and/or loss of periventricular white matter.
  • abnormal gyration pattern selected from polymicrogyria, simplified gyria and periventricular nodular heterotopia; ventriculomegaly; Arnold-Chiari malformation; arachnoid cyst; hypoplasia of the corpus callosum; hypoplasia of the cerebellar hemispheres; and/or loss of periventricular white matter.
  • the neurodevelopmental disorder can include one or more abnormalities selected from brain malformation selected from ventricular enlargement, corpus callosum abnormality, cortex malformation, a white matter abnormality, and/or a cerebellum abnormality; a neurological feature selected from seizures and/or hypotoniz; a musculoskeletal abnormality selected from hypermobility, scoliosis/kyphosis, hemivertebrae, and/or contractures; an ocular abnormality selected from strabismus, (suspicion) cortical visual impairment (CVI), and/or hypermetropia; a heart defect; a gastrointestinal malformation; an urogenital malformation selected from horseshoe kidney; facial dysmorphism; short statute; and/or craniosynostosis.
  • brain malformation selected from ventricular enlargement, corpus callosum abnormality, cortex malformation, a white matter abnormality, and/or a cerebellum abnormality
  • a neurological feature selected from seizures and/or hypotoniz
  • a method for the diagnosis of a neurodevelopmental disorder, a likelihood of developing a neurodevelopmental disorder, or a likelihood of having a child having a neurodevelopmental disorder in a test subject can include determining the presence or absence of a mutation in a SON gene indicative of the disorder.
  • the mutation can include a loss-of-function mutation or a mutation which reduces the activity of a polypeptide encoded by a SON gene.
  • the mutation may be one or more point mutations, insertions or deletions.
  • the mutation can result in reduced activity of a polypeptide encoded by a SON gene in a subject, reduced levels of a nucleic acid encoding a SON polypeptide in a subject, and/or reduced levels of a SON polypeptide in a subject.
  • the reduction is at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, and 90%, or any range between any two of the foregoing numbers, compared to the activity of a polypeptide encoded by the SON gene, level of a nucleic acid encoding a SON polypeptide, and/or level of a SON polypeptide in a subject not having a neurodevelopmental disorder.
  • a method for the diagnosis of a neurodevelopmental disorder in a test subject can include determining a reduction in the level or an absence of a nucleic acid encoding a fully functional SON polypeptide or a reduction in the level or the absence of a fully functional SON polypeptide in the test subject.
  • the reduction is at least about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, and 95%, or any range between any two of the foregoing numbers, compared to in the level of a nucleic acid encoding a fully functional SON polypeptide or the level of a fully functional SON polypeptide in a subject not having a neurodevelopmental disorder.
  • the mutation is located at a position in exon 3 of a human SON gene or at position that corresponds to exon 3 of a human SON gene (GenBank Accession NM_138927.2; SEQ ID NO:61 ).
  • the mutation in a nucleic acid encoding a SON polypeptide can include a mutation that is one or more of the following mutations in a human SON gene or that corresponds to one or more of the following mutations in a human SON gene (GenBank Accession NM_138927.2; SEQ ID NO:61): c.5549_5550del, c.
  • the mutation can include a mutation in a nucleic acid that results in and corresponds to more or changes in a human SON polypeptide (NP_620305.2; SEQ ID NO:62), such as p.(Argl 850Ilefs*3), p.(Val629Alafs*56), p.(Vall918Glufs*87), p.(Metl28411efs*2), p.(Vall918Glufs*87), p.([Asp l667_Asnl671del; Aspl678Lysfs*9]), p.(Arg2002Glnfs*5), p.(Thrl453Serfs* l 1), p.(Hisl 547Leufs*76), p.(Ser2029Argfs*22), p.(Prol200Argfs* 17), p.(Leu !384_Vall391del),
  • Some embodiments of the methods for the diagnosis of a neurodevelopmental disorder, a likelihood of developing a neurodevelopmental disorder, or a likelihood of having a child having a neurodevelopmental disorder in a test subject can include determining the level of one or more additional polypeptides or one or more additional nucleic acids encoding the one or more additional polypeptides in a test subject.
  • the additional polypeptide is encoded by a gene selected from a gene listed in TABLE 4A, TABLE 4B and TABLE 5.
  • the one or more additional polypeptides or the one or more additional nucleic acids encoding the one or more additional polypeptides is selected from a polypeptide encoded by one or more of the following genes: TUBG1, FLNA, PNKP, WDR62, PSMD3, HDAC6, PCK2, PFKL, IDH2, ACY1 and ADA.
  • the methods may comprise detecting the presence or determining the level of one or more mis-spliced R As, one or more RNAs having one or more introns retained, or one or more RNAs in which one or more exons have been skipped or the presence or level of one or more polypeptides encoded by such one or more RNAs in an individual having one or more mutations, insertions or deletions in a SON gene.
  • the one or more mis-spliced RNAs, one or more RNAs having one or more introns retained, one or more RNAs in which one or more exons have been skipped or the one or more polypeptide encoded by such one or more RNAs may be one or more RNAs encoded by a gene selected from TUBG1, FLNA, PNKP, WDR62, PSMD3, HDAC6, PCK2, PFKL, IDH2, ACY1 and ADA or a gene listed in TABLE 4A, TABLE 4B and TABLE 5.
  • a reduction in the level of the one or more additional polypeptides or the one or more additional nucleic acids encoding the one or more additional polypeptides in a test subject compared to the level of the one or more additional polypeptides or the one or more additional nucleic acids encoding the one or more additional polypeptides in a subject not having a neurodevelopmental disorder is indicative of a neurodevelopmental disorder, a likelihood of developing a neurodevelopmental disorder, or a likelihood of having a child having a neurodevelopmental disorder in a test subject.
  • the reduction is at least about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, and 95%, or any range between any two of the foregoing numbers.
  • Some embodiments of the methods for the diagnosis of a neurodevelopmental disorder in a test subject can include determining the level of a TUBAIA polypeptide or a nucleic acid encoding the TUBAIA polypeptide in a test subject. In some embodiments, an increase in the level of a TUBAIA polypeptide or a nucleic acid encoding the TUBAIA polypeptide in a test subject compared to the level of a TUBAIA polypeptide or a nucleic acid encoding the TUBAIA polypeptide in a subject not having a neurodevelopmental disorder is indicative of a neurodevelopmental disorder in a test subject. In some embodiments, the increase is at least about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 100%, and 200%, or any range between any two of the foregoing numbers.
  • Methods to determine the presence or absence of a mutation in a nucleic acid such as a SON gene or a nucleic acid encoded by a SON gene are well known in the art.
  • Methods to determine the level of a nucleic acid such as a gene including: SON, TUBG1, FLNA, PNKP, WDR62, PSMD3, HDAC6, PCK2, PFKL, IDH2, ACYl , ADA, TUBA I A and a gene listed in TABLE 4A, TABLE 4B and TABLE 5 or a nucleic acid encoded by one of the foregoing genes are also well known in the art.
  • Examples of the foregoing methods include sequencing a nucleic acid, and hybridizing a hybridization probe or primer with a nucleic acid.
  • Methods of sequencing can include for example, Sanger sequencing, sequencing by synthesis, such as pyrosequencing, and sequencing by ligation.
  • Methods can include PCR, quantative methods of PCR, such as real time PCR, and Northern blot analysis. Techniques for both PCR based assays and hybridization assays are well known in the art (See e.g. , Mullis et ah, Cold Spring Harbor Symp. Quant. Biol., 51 :263, 1987; Erlich ed., PCR Technology, Stockton Press, NY, 1989).
  • the nucleic acid is the SON gene or a nucleic acid encoded by a SON gene.
  • the hybridization probe or primer can include an oligonucleotide comprising any one of SEQ ID NOs:01-06.
  • the nucleic acid encoded is a gene such as SON, TUBG1, FLNA, PNKP, WDR62, PSMD3, HDAC6, PCK2, PFKL, IDH2, ACYl , ADA, TUBAIA ora gene listed in TABLE 4A, TABLE 4B or TABLE 5 or a nucleic acid encoded by one of the foregoing genes.
  • the hybridization probe or primer can include an oligonucleotide comprising any one of SEQ ID NOs:07-30.
  • Methods to determine the level of a polypeptide such as a polypeptide encoded by a gene including: SON, TUBG 1 , FLNA, PN P, WD 62, PSMD3, HDAC6, PCK2, PFKL, IDH2, ACY1, ADA, TUBA 1 A or a gene listed in TABLE 4A, TABLE 4B or TABLE 5 are well known in the art.
  • Methods to determine the presence or absence of a mutant polypeptide, such as a polypeptide encoded by a non-wild-type SON gene are well known in the art. Examples of the foregoing methods include contacting the polypeptide with an agent that that specifically binds to the polypeptide.
  • the agent comprises an antibody or antigen-binding fragment thereof. In some embodiments, the agent specifically binds to an epitope of a polypeptide encoded by a SON gene that corresponds to an epitope having an amino acid sequence comprising any one of SEQ ID NOs:63-66.
  • the agent can be immobilized on a solid support.
  • solid supports include a test well of a microtiter plate, a membrane, such as nitrocellulose membrane, a particle, such as a bead, comprising glass, fiberglass, latex, or a plastic material, such as polystyrene or polyvinylchloride.
  • the solid support can include a magnetic particle.
  • the agent can be immobilized on the solid support by a noncovalent association, such as adsorption, and/or a covalent attachment which can include a direct linkage between the agent and functional groups on the solid support, or may be a linkage by way of a cross-linking agent.
  • Some embodiments include obtaining a sample from a test subject.
  • the sample can include a tissue, a cell, a cell-line, and/or a fluid.
  • the sample comprises fetal tissue, and/or parental tissue, such as maternal tissue or paternal tissue.
  • the sample can include fetal blood, maternal blood, and amniotic fluid.
  • the test subject can include a blastocyst, a fetus, a neonate, a child, an adolescent, and an adult.
  • the test subject is mammalian, such as human.
  • kits can include an agent for determining the presence or absence of a fully functional polypeptide encoded by a SON gene.
  • the agent is a primer, a hybridization probe or an antibody or antigen binding fragment thereof.
  • the primer or hybridization probe can be used to determine the presence or absence of a mutation in a SON gene or a nucleic acid encoded by a SON gene.
  • the mutation is a loss-of-function mutation.
  • the mutation may be one or more point mutations, insertions or deletions.
  • the mutation in a nucleic acid encoding a SON polypeptide can include a mutation that is one or more of the following mutations in a human SON gene or that that corresponds to one or more of the following mutations in a human SON gene (GenBank Accession NMJ 38927.2; SEQ ID NO:61 ): c.5549_5550del, c.1 881 1882del, c.5753_5756del, c.3852_3856del, c.5753_5756del, c.4999_5013del; 5031_5032insAA, c.6002_6003insCC, c.4358_4359del, c.4640del, c.6087del, c.3597_3598dupGC, c.4151_4174del24, c.2365del, C.33340T, c.268del, c.4055del,
  • the mutation can include a mutation in a nucleic acid that results in and corresponds to one or more or changes in a human SON polypeptide (NP_620305.2; SEQ ID NO:62), such as p.(Argl 850Ilefs*3), p.(Val629Alafs*56), p.(Val l 918Glufs*87), p.(Metl 28411efs*2), p.(Val l 918Glufs*87), p.([Aspl 667_Asn l 671 del; Asp l678Lysfs*9]), p.(Arg2002Glnfs*5), p.(Thrl453Serfs* l 1), p.(Hisl 547Leufs*76), p.(Ser2029Argfs*22), p.(Prol200Argfs* 17), p.(Leu l384_Vall39
  • primers and hybridization probes for determining the presence or absence of a mutation in a SON gene can include primers and hybridization probes that hybridize to a nucleic acid having a sequence encoding any one of the foregoing mutations.
  • the primers and hybridization probes can hybridize to the nucleic acid at a position in the nucleic acids that corresponds to the location of the mutation, or at position in the nucleic acid that is adjacent to the mutation.
  • the antibody or antigen binding fragment thereof, primer or hybridization probe can be used to determine the level of a polypeptide or the level of a nucleic acid encoding the polypeptide.
  • the polypeptide or the nucleic acid is encoded by a gene including: SON, TUBG 1 , FLNA, PN P, WDR62, PSMD3, HDAC6, PC 2, PF L, IDH2, ACY1 , ADA, TUBA 1 A or a gene listed in TABLE 4A, TABLE 4B or TABLE 5.
  • the antibody or antigen binding fragment thereof, primer or hybridization probe can be used to detect the presence or determine the level of one or more mis-spliced RNAs, one or more RNAs having one or more introns retained, or one or more RNAs in which one or more exons have been skipped or the presence or level of one or more polypeptides encoded by such one or more RNAs in an individual having one or more mutations, insertions or deletions in a SON gene.
  • the one or more mis-spliced RNAs, one or more RNAs having one or more introns retained, one or more RNAs in which one or more exons have been skipped or the one or more polypeptide encoded by such one or more RNAs may be one or more RNAs encoded by a gene selected from TUBG1, FLNA, PNKP, WDR62, PSMD3, HDAC6, PCK2, PFKL, IDH2, ACY1 and ADA or a gene listed in TABLE 4A, TABLE 4B and TABLE 5.
  • the primers or hybridization probe comprise an oligonucleotide which can hybridize to the nucleic acid.
  • the primer or hybridization probe can include an oligonucleotide comprising any one of SEQ ID NOs:01 - 30.
  • the kit comprises an antibody or antigen-binding fragment thereof that specifically binds to the polypeptide.
  • the antibody or antigen- binding fragment thereof specifically binds to an epitope of a polypeptide encoded by a SON gene that corresponds to an epitope having an amino acid sequence comprising any one of SEQ ID NOs:63-66.
  • the primer, hybridization probe, antibody or antigen-binding fragment thereof is attached to a solid support.
  • FIG. IB depicts photos of individuals with SON mutations: top row from left to right: photos of Individual-2 (at age 5 years), Individual-4 (age 19 years), Individual-5 (age 2 years), Individual-6 (age 6 years), Individual-8 (age 34 years), Individual-10 (age 6 years); bottom row from left to right: photos of Individual-1 1 (age 21 years), Individual-13 (14 years), Individual-15 (age 15 months), Individual- 16 (age 5 years), Individual-1 8 (age 6 years), Individual-19 (age 10 years).
  • Shared facial dysmorphisms include facial asymmetry, midface retraction, low set ears, down slanting palpebral fissures, deep-set eyes,horizontal eyebrows, broad/depressed nasal bridge and short philtrum.
  • Clinical examination showed mild to moderate facial dysmorphisms in all affected individuals, including facial asymmetry, neurodevelopmental disorders, such as midface retraction, low set ears, down-slanting palpebral fissures, deep-set eyes, horizontal eyebrows, broad/depressed nasal bridge, and short philtrum (FIG. I B, FIG. I F, FIG. 1 G).
  • brain MRI revealed significant abnormalities in 17 of 19 individuals, including abnormal gyration patterns (polymicrogyria, simplified gyria and periventricular nodular heterotopia), ventriculomegaly, Arnold-Chiari malformation, arachnoid cyst, hypoplasia of the corpus callosum, hypoplasia of the cerebellar hemispheres and loss of periventricular white matter (FIG. 1C, ID and IE).
  • abnormal gyration patterns polymicrogyria, simplified gyria and periventricular nodular heterotopia
  • ventriculomegaly ventriculomegaly
  • Arnold-Chiari malformation arachnoid cyst
  • hypoplasia of the corpus callosum hypoplasia of the cerebellar hemispheres
  • loss of periventricular white matter FIG. 1C, ID and IE.
  • FIG. 1C depicts axial T2 -weighted fast spin-echo (FSE) magnetic resonance imaging (MRI) of the brain of Individual-1 at age 3 years.
  • FSE fast spin-echo
  • MRI magnetic resonance imaging
  • Three panels of FIG. 1 C show ascending images (left to right panels) revealing that individual's insular cortex on the right is thickened and featureless, and there was less impressive areas of similar change noted in the posterior aspect of the left insular cortex, revealing bilateral perisylvian and parietal polymicrogyria (yellow arrowhead).
  • FIG. ID depicts sagital Tl- weighted and axial T2-weighted MRI images of the brain of Individual-2. The two images at the left in FIG.
  • FIG. I D (age 1 day, gestational age 34+6 weeks) revealed enlarged lateral ventricles, cavum septum pellucidum, hypoplastic cerebellar hemisphere, broad cistern magna, small fourth ventricle and thin corpus callosum.
  • the cortex showed a simplified gyration pattern and the perisylvian and frontotemporal areas are suspect for polymicrogyria (yellow arrowheads).
  • the two panels at the right in FIG. I D (age 2 years) show the fissure Sylvie with abnormal cortical border, Arnold Chiari malformation and hydrocephalus.
  • IE depicts frontal T2- weighted, sagittal Tl-weighted, axial T2-weighted and sagittal Tl-weighted MRI images of the brain of Individual-7 (II- 1 in Family-7) at the age of 2 months.
  • the cortex showed deep sulci and perisylvian areas suspect for polymicrogyria (yellow arrowheads).
  • Discrete heterotopic nodules have been observed (orange arrowheads).
  • a thin corpus callosum, small fourth ventricle, enlarged frontal horns of the lateral ventricles and cavum septum pellucidum are present.
  • SON GenBank Accession NMJ 38927.2; SEQ ID NO:61
  • SON is composed of 12 exons (FIG. 2A) and encodes a protein (NP 620305.2; SEQ ID NO:62) containing a serine/arginine-rich domain (RS domain) and two RNA-binding motifs (G-patch and double- stranded RNA binding motif, DSRM) (FIG. 2A).
  • RS domain serine/arginine-rich domain
  • DSRM RNA-binding motifs
  • FIG. 2D top panel Parents- 1 (wild type) "AGGGCAAGAAAGAGATCATCTAAG” (SEQ ID NO:69), with a predicted amino acid sequence "RARKRSSK” (SEQ IS NO:70); Individual- 1 "AGGGCAAGAAAGATCTAAGTC” (SEQ ID NO:71 ), with a predicted amino acid sequence "RAR II” (SEQ ID NO:72).
  • FIG. 2D lower panel Parents-2 (wild type) "GCAACAGGGGTGCTGGAATCCTAT” (SEQ ID NO:73), with a predicted amino acid sequence "ATGVLESY” (SEQ IS NO:74); Individual-2
  • FIG. 2D depicts sequence chromatograms and predicted amino acid sequences of SON heterozygous mutations for the family of Individual- 1 (top panel), and the family of and Individual-2 (bottom panel). Heterozygous nucleotide deletion was detected at C.5549 5550 (Individual- 1 ; top panel) and c.1 881 1882 (Individual-2; bottom panel) position of SON transcript (NM_138927.2).
  • C.5549 5550 Individual- 1 ; top panel
  • c.1 881 1882 Individual-2; bottom panel
  • mutated (or deleted) sites are indicated in the chromatograms by red arrows with the predicted amino acids (right panels) corresponding to each codon are represented, and for each sequence, the first mutated amino acid sequence is marked by gray arrow, and mutated amino acids are depicted in red.
  • the cocktail of WU SON antibodies was a mixture of three different SON antibodies (WU09 [ 1 : 100], WU14 [1 :2,000], and WU21 [1 :200]).
  • the epitopes of WU SON antibodies were as follows; MDSQMLATSS (SEQ ID NO:64) for WU09, CEESESKTKSH (SEQ ID NO:65) for WU14, and SMMSAYERS (SEQ ID NO:66) for WU21.
  • SON-N antibody FIG. 2C, left panel
  • the cocktail of SON WU antibodies FIG. 2C, right panel
  • the bands indicated by the black arrow represent full-length SON in FIG. 2C.
  • Other bands were also detected, which may represent potential isoforms. Besides these common bands present in both normal and affected individual samples, no other specific bands were detected in the affected individual sample.
  • SON is a nuclear speckle protein with dual abilities to bind to DNA and NA, and its cellular functions include regulation of RNA splicing and gene transcription, as well as proper cell cycle and embryonic stem cell maintenance. 13 ' 22"25 To identify molecular mechanisms underlying the clinical features of individuals with SON haploinsufficiency, the global expression patterns upon SON knockdown in cellular systems was examined. Microarray-based RNA expression profiling as well as RNA-seq data sets generated upon
  • TABLE 4A lists significantly downregulated genes in all three studies on SON knockdown implicated of human disease based on the clinical genomic database of the National Human Genome Research Institute.
  • TABLE 4B lists significantly downregulated genes in all three studies upon SON knockdown with no prior implication in human disease.
  • TABLE 5 lists selected SON target genes that are directly implicated in ID / DD and metabolism.
  • NADP+ mitochondrial
  • PFKL phosphofructokinase
  • SON functions as a splicing co-factor that promotes correct and efficient RNA splicing of weak splice sites and alternative splice sites by facilitating spliceosome recruitment to the elongating RNA polymerase II complex.
  • 13 Prominent features observed upon SON knockdown in HeLa cells and human embryonic stem cells include intron retention and exon skipping, which has been shown at gene level for TUBG 1 , HDAC6 and ADA.
  • RNA splicing of these 1 1 genes is also impaired in our individuals with SON haploinsufficiency was investigated.
  • the pre-mRNA sequences of the remaining eight genes were analyzed to predict weak splice sites that may be potential targets of SON-mediated RNA splicing.
  • TABLE 6 lists a splice site score analysis of intron-retained genes by SON knockdown (5' splice site score / 3' splice site score) and the primer sequences (bold, underlined) used for RT-PCR to detect splicing defects.
  • Target PCR product size gene Target sequence Splice site (bp)
  • the 5' splice site threshold score is 6.7 and the 3' splice site threshold score is 6.632. *, scores lower than threshold. Dual, splice sites that can be recognized as both 5' and 3' splice sites
  • RT-PCR using DNase-treated R A samples isolated from Trio-1, Trio-3, Individual-5 and an unrelated healthy donor using primers designed to detect intron retention and exon skipping was performed (TABLE 6 and TABLE 7).
  • TABLE 7 lists sequence information of exon-skipped genes (5' splice site score / 3' splice site score) and the primer sequences (bold, underlined) used for RT-PCR to detect splicing defects.
  • Whole-exome sequencing identifies recessive WDR62 mutations in severe brain malformations. Nature 467, 207-210.
  • Microcephaly disease gene Wdr62 regulates mitotic progression of embryonic neural stem cells and brain size. Nat. Commun. 5, 3885.
  • WDR62 is associated with the spindle pole and is mutated in human microcephaly. Nat. Genet. 42, 1010- 1014.
  • Jalview Version 2 a multiple sequence alignment editor and analysis workbench. Bioinformatics 25, 1 189-1 191 .

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biomedical Technology (AREA)
  • Immunology (AREA)
  • Analytical Chemistry (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Genetics & Genomics (AREA)
  • Pathology (AREA)
  • Urology & Nephrology (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • Hematology (AREA)
  • General Health & Medical Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Neurology (AREA)
  • Neurosurgery (AREA)
  • Cell Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Food Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

Les modes de réalisation de la présente invention se rapportent au diagnostic de troubles neurodéveloppementaux. Certains modes de réalisation concernent des méthodes et des kits pour le diagnostic de troubles neurodéveloppementaux, dont le handicap intellectuel et le retard de développement.
PCT/US2016/065669 2016-11-16 2016-12-08 Méthodes et préparations pour la détection de troubles neurodéveloppementaux WO2018093402A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201662423089P 2016-11-16 2016-11-16
US62/423,089 2016-11-16

Publications (1)

Publication Number Publication Date
WO2018093402A1 true WO2018093402A1 (fr) 2018-05-24

Family

ID=62146760

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2016/065669 WO2018093402A1 (fr) 2016-11-16 2016-12-08 Méthodes et préparations pour la détection de troubles neurodéveloppementaux

Country Status (1)

Country Link
WO (1) WO2018093402A1 (fr)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109295218A (zh) * 2018-12-11 2019-02-01 南京医科大学 环状RNA标志物hsa_circ_0001788及其应用
CN114015767A (zh) * 2021-11-18 2022-02-08 南京市儿童医院 一种鉴别颅缝早闭的血清circRNA标志物及其应用

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006121952A2 (fr) * 2005-05-05 2006-11-16 The Regents Of The University Of California Biomarqueurs de diagnostic de troubles neurologiques du developpement
WO2016069792A1 (fr) * 2014-10-30 2016-05-06 California Institute Of Technology Compositions et procédés comprenant des bactéries pour améliorer le comportement des troubles neurodéveloppementaux

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006121952A2 (fr) * 2005-05-05 2006-11-16 The Regents Of The University Of California Biomarqueurs de diagnostic de troubles neurologiques du developpement
WO2016069792A1 (fr) * 2014-10-30 2016-05-06 California Institute Of Technology Compositions et procédés comprenant des bactéries pour améliorer le comportement des troubles neurodéveloppementaux

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
KIM ET AL.: "De novo mutations in SON disrupt RNA splicing of genes essential for brain development and metabolism, causing an intellectual-disability syndrome", AMERICAN JOURNAL OF HUMAN GENETICS, vol. 99, 1 September 2016 (2016-09-01), pages 711 - 719, XP029711815 *
TAKENOUCHI ET AL.: "Establishing SON in 21q22.11 as a cause a new syndromic form of intellectual disability: possible contribution to Braddock-Carey syndrome phenotype", AMERICAN JOURNAL OF MEDICAL GENETICS, vol. 170, 3 June 2016 (2016-06-03), pages 2587 - 2590, XP055502756 *
TOKITA ET AL.: "De novo truncating variants in SON cause intellectual disability, congenital malformations, and failure to thrive", AMERICAN JOURNAL OF HUMAN GENETICS, vol. 99, 1 September 2016 (2016-09-01), pages 720 - 727, XP029711776 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109295218A (zh) * 2018-12-11 2019-02-01 南京医科大学 环状RNA标志物hsa_circ_0001788及其应用
CN109295218B (zh) * 2018-12-11 2020-05-19 南京医科大学 环状RNA标志物hsa_circ_0001788及其应用
CN114015767A (zh) * 2021-11-18 2022-02-08 南京市儿童医院 一种鉴别颅缝早闭的血清circRNA标志物及其应用

Similar Documents

Publication Publication Date Title
Burmeister et al. Psychiatric genetics: progress amid controversy
Zech et al. Recessive mutations in the α3 (VI) collagen gene COL6A3 cause early-onset isolated dystonia
Chaouch et al. Mutations in the mitochondrial citrate carrier SLC25A1 are associated with impaired neuromuscular transmission
Hawi et al. DNA variation in the SNAP25 gene confers risk to ADHD and is associated with reduced expression in prefrontal cortex
Kahrizi et al. Next generation sequencing in a family with autosomal recessive Kahrizi syndrome (OMIM 612713) reveals a homozygous frameshift mutation in SRD5A3
Mackay et al. Exome sequencing identifies a missense variant in EFEMP1 co-segregating in a family with autosomal dominant primary open-angle glaucoma
Walters et al. The genetics of schizophrenia
Liao et al. SPG35 contributes to the second common subtype of AR‐HSP in China: frequency analysis and functional characterization of FA2H gene mutations
Paracchini et al. Genetics of human handedness and laterality
WO2018093402A1 (fr) Méthodes et préparations pour la détection de troubles neurodéveloppementaux
JP6378529B2 (ja) 遺伝性疾患の検出方法
Greenberg et al. The state of the art in the genetic analysis of the epilepsies
Gill Developmental psychopathology: The role of structural variation in the genome
Gurling et al. The genetics of schizophrenia
Arnold et al. Genetics of childhood and adolescent anxiety
JP2007503210A (ja) ヒト自閉症感受性遺伝子およびその使用
US20170067109A1 (en) Assays for Detecting WDR62 Mutations
WO2014131468A1 (fr) Mutations de depdc5 de diagnostic de maladies épileptiques
Wang et al. Association analysis of genetic variant of rs13331 in PSD95 gene with autism spectrum disorders: a case-control study in a Chinese population
KR20220072459A (ko) 알츠하이머병 발병 위험도 예측을 위한 단일염기다형성 마커 및 이의 용도
Gogos Schizophrenia susceptibility genes: in search of a molecular logic and novel drug targets for a devastating disorder
KR102110883B1 (ko) 정신 질환 진단용 kmt2c 다형성 마커
US20150031569A1 (en) Mutations of the GPR179 Gene in Congenital Stationary Night Blindness
Arnold GENETICS OF OCD
Sheerin The Use of Next Generation Sequencing Technologies to Dissect the Aetiologies of Parkinson’s disease and Dystonia

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16921767

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 16921767

Country of ref document: EP

Kind code of ref document: A1