WO2018080396A2 - Compounds and methods to target a molecule to a specific cellular location - Google Patents

Compounds and methods to target a molecule to a specific cellular location Download PDF

Info

Publication number
WO2018080396A2
WO2018080396A2 PCT/SG2017/050533 SG2017050533W WO2018080396A2 WO 2018080396 A2 WO2018080396 A2 WO 2018080396A2 SG 2017050533 W SG2017050533 W SG 2017050533W WO 2018080396 A2 WO2018080396 A2 WO 2018080396A2
Authority
WO
WIPO (PCT)
Prior art keywords
cell
vire2
conjugate
peptide
cells
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/SG2017/050533
Other languages
French (fr)
Other versions
WO2018080396A3 (en
Inventor
Shenquan Pan
Xiaoyang Li
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
National University of Singapore
Original Assignee
National University of Singapore
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by National University of Singapore filed Critical National University of Singapore
Priority to CN201780065902.5A priority Critical patent/CN110036021B/en
Publication of WO2018080396A2 publication Critical patent/WO2018080396A2/en
Publication of WO2018080396A3 publication Critical patent/WO2018080396A3/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K19/00Hybrid peptides, i.e. peptides covalently bound to nucleic acids, or non-covalently bound protein-protein complexes

Definitions

  • This invention relates to a peptide comprising or consisting of (i) the amino acid sequence of SEQ ID NO: l or (ii) an amino acid sequence having at least 80% sequence identity to the amino acid sequence of SEQ ID NO: l over its entire length.
  • the present invention also relates to a conjugate, a host cell, a bio-imaging system, a method to visualize internalization, a method to internalize a drug into a cell and the conjugate of the invention for use as a medicament or research reagent.
  • A. tumefaciens causes crown gall tumors on various plants by transferring oncogenic T-DNA into plant cells (1-3). Under laboratory conditions, the bacterium can transfer T-DNA into other eukaryotic species, including yeast (4, 5), fungi (6), algae (7) and cultured human cells (8). It has been developed as a DNA-delivery vector that is widely used as the workhorse for genetic engineering of plants (9) and non-plant organisms (10).
  • A. tumfaciens delivers both T- DNA and bacterial virulence proteins into host cells via a bacterial type IV secretion system (T4SS) composed of VirB/VirD4 (11, 12).
  • T4SS bacterial type IV secretion system
  • Agrobacterium VirB/VirD4 T4SS is the archetype for the T4SS family that is widely used by bacteria to translocate DNA (13, 14) and protein macromolecules (75) to a diverse range of bacterial and eukaryotic cells (16).
  • the Agrobacterium T4SS apparatus is comprised of 12 bacterial virulence proteins, including VirB l-11 and VirD4, which form a multi-subunit membrane-spanning channel that delivers macromolecules into host cells (17).
  • Agrobacterium T4SS delivers at least five protein substrates into host cells; these include VirD2, VirD5, VirE2, VirE3 and VirF (18-20). There is evidence that these bacterial effectors depend upon their C- terminal positive charged signals for their export into host cells (19). Upon delivery, these effector proteins work cooperatively inside host cells and facilitate the transformation process. Host factors have been shown to interact with these effectors and are important for the successful transformation (21).
  • T-DNA is generated by VirD2 protein that functions as an endonuclease inside bacterial cells, as a single-stranded (ss) DNA molecule from the Ti plasmid (22-24).
  • VirD2 remains covalently associated with 5 ' end of the T-DNA and leads the way into host cells through T4SS (23).
  • T4SS T4SS -delivered VirE2, which is ssDNA-binding protein, to form the T-complex (25-27).
  • Both VirD2 and VirE2 contain functional nuclear localization signal (NLS) sequences that interact with host importin a proteins (28). They may work cooperatively for the nuclear import of T-complex inside host cells.
  • NLS nuclear localization signal
  • VirE2 As an abundant effector protein secreted into recipient cells, VirE2 is also crucial for a variety of other processes during the transformation. In vitro studies showed that VirE2 forms voltage-gated and ssDNA- specific channel on artificial membranes, suggesting that it might facilitate the entry of T-DNA into host cells (29). Since VirE2 binds to the T-strand inside host cytoplasm in a cooperative manner, it can protect T-DNA from nucleolytic degradation (30, 31). As the major component of T-complex, VirE2 trafficking would affect the fate of T-strand.
  • VirE2 has been shown to participate in nuclear targeting of T-DNA in two different ways. First, two separate NLS sequences have been identified in VirE2 molecule, which are involved in direct interaction with Arabidopsis importin a isoforms (28). Second, VirE2 could also interact with plant transcription factor VIP1 (32); this host protein undergoes MAPK3 mediated phosphorylation and nuclear translocation induced by Agrobacterium infection, which might result in the nuclear import of VirE2 and thus the T-strand (33, 34).
  • VIP1 can interact with host histones, and the interaction might be useful for the T-complex to target the host chromatin (34).
  • VirE2 could interact with another host protein VIP2, a putative transcriptional repressor localized to plant nucleus (35).
  • VIP2 a putative transcriptional repressor localized to plant nucleus
  • the requirement of VIP2 for stable transformation suggests that interaction between VirE2 and VIP2 might facilitate T-strand integration into host genome (35).
  • targeting a molecule or drug to a specific location inside a cell is important and challenging in the fields of drug development and life sciences. There exists a continuous need for techniques which are useful for the introduction of molecule or drug over the cytoplasmic membrane into a cell and to a specific desired location.
  • Figure 1 shows association of Agrobacterium-delivered VirE2 with host plasma membrane and endocytic vesicles.
  • A VirE2 detection at different time intervals inside N. benthamiana cells.
  • A. tumefaciens EHA105 vz ' r£2: :GFP11 was infiltrated into transgenic N. benthamiana (Nb308A) leaves expressing both GFPl-10 and DsRed. Projected Z-series of images were obtained at 32 h and 48 h post agroinfiltration.
  • B Accumulation of VirE2 at the cytoplasmic sides of tobacco cells contacting with A. tumefaciens cells. Wild type N.
  • benthamiana leaves were infiltrated with DsRed-labeled A. tumefaciens strain EHA105vz ' r£2:. G P77(pGFPl-10 and pVBA- RFP), which is also capable of delivering VirE2-GFPl l and the T-DNA expressing GFPl-10. Images were obtained at 2 d post agroinfiltration. (C) Accumulation of Agrobacterium-delivered VirE2 at the host plasma membrane. Wild type N. benthamiana leaves were infiltrated with evenly mixed A.
  • benthamiana leaves were infiltrated with A. tumefaciens strain EHA105vz ' r£2::G P77(pGFPl-10) and then stained with FM4-64. Images were obtained at 2 d post agroinfiltration. Scale bars, 10 ⁇ .
  • FIG. 2 shows accumulation of Agrobacterium at the intercellular space of infiltrated leaf epidermal cells.
  • A Projected Z-series of N. benthamiana (Nb308A) leaves infiltrated with GFP-labeled A. tumefaciens cells EHA105 (pVB-GFP). Images were obtained 2 d post agroinfiltration under confocal microscope with Olympus UAPO N 340 40 x N.A. 1.15 water immersion objective. White lines were added to the images to indicate borders between leaf epidermal cells.
  • B Projected Z-series of wild type N. benthamiana leaves infiltrated with evenly mixed GFP labeled A. tumefaciens cells EHA105 (pVB-GFP) and DsRed labeled A. tumefaciens cells EHA105 (pVB-RFP). Scale bars, 20 ⁇ .
  • Figure 3 shows co-movement of VirE2 with FM4-64 labeled endocytic vesicles in N. benthamiana epidermal cells. Wild type N. benthamiana leaves were infiltrated with A. tumefaciens cells EHA105vz ' r£2::G P77(pGFPl-10) followed by FM4-64 staining. Images were obtained 2 d post agroinfiltration. Scale bar, 20 ⁇ .
  • Figure 4 shows interference with host endocytosis impaired VirE2 trafficking and attenuated the virulence.
  • A Expression of a defective clathrin Hub impaired VirE2 departure from plasma membrane.
  • N. benthamiana (Nb308A) leaves were infiltrated with A. tumefaciens strain EHA105vz ' r£2::G P77(pXY01) or EHA105vzr£2::G P77(pXY01-Hub), which is capable of delivering VirE2-GFPl l and the T-DNA expressing Hub. Projected Z-series of images were obtained at 4 d post agroinfiltration. Scale bars, 20 ⁇ .
  • VirE2-GFPcomp signals remaining at host cell borders was measured in each image, n: the number of images measured.
  • C ESI treatment decreased nuclear accumulation of VirE2 in plant epidermal cells. N. benthamiana (Nb308A) leaves were infiltrated with EHA105vz ' r£2::G P77 alone or together with ES I. Boxed areas are enlarged to highlight the nucleus. Projected Z-series of images were obtained at 2 d post agroinfiltration. Scale bars, 20 ⁇ .
  • D The intensity of VirE2-GFP C om P signals was measured within each host nucleus, n: the number of nucleus measured.
  • FIG. 5 shows expression of Hub impaired FM4-64 uptake in N. benthamiana epidermal cells.
  • A Wild type N. benthamiana leaves were infiltrated with A. tumefaciens cells EHA105(pXY01) or EHA105(pXY01-Hub) followed by FM4-64 staining at 2 d or 4 d post agroinfiltration. Projected Z-series of images were obtained 5 h post staining under confocal microscope with Olympus UAPO N 340 40 x N.A. 1.15 water immersion objective. Scale bars, 20 ⁇ .
  • Figure 6 shows expression of dominant-negative clathrin Hub impaired VirE2 departure from plasma membrane in N. benthamiana epidermal cells.
  • A Wild type N. benthamiana leaves were infiltrated with A. tumefaciens cells EHA105vz ' r£2::G P77 (pXYOl).
  • B Wild type N. benthamiana leaves were infiltrated with A. tumefaciens cells EHA105vz ' r£2::G P77 (pXY01-Hub). Projected Z-series of images were shown. Scale bars, 20 ⁇ .
  • FIG. 7 shows ES I treatment affected early endosomes and VirE2 trafficking.
  • A ESI treatment caused aggregation of SYP61 -containing endosomes in N. benthamiana leaf epidermal cells. Wild type N. benthamiana leaves were infiltrated with A. tumefaciens cells EHA105(pXY01-SYP61-mC) alone or mixed with ES I (25 ⁇ ). In controls, transiently expressed SYP61-mCherry labeled the round-shaped early endosomes in N. benthamiana epidermal cells. ESI treatment induced the aggregation of SYP61 -containing endosomes (arrowed).
  • Figure 8 shows mutations at VirE2 endocytic motifs affected VirE2 internalization and impaired Agrobacterium-mediated transformation.
  • A Schematic locations of VirE2 putative endocytic motifs identified by the Eukaryotic Linear Motif resource for functional sites in proteins (www.ELM.eu.org). The invariant amino acids of endocytic motifs are labeled in red.
  • B Mutations at the dual endocytic motifs at VirE2 C-terminus affected VirE2 internalization into host cells. N. benthamiana (Nb308A) leaves were infiltrated with A.
  • tumefaciens EHA105vz ' r£2 :GFP11 or mutant strains containing the corresponding tyrosine substitutions with alanine. Projected Z-series of images were obtained at 2 d post agroinfiltration. Scale bars, 20 ⁇ .
  • C Percentage of VirE2 staying at the cell borders is represented as the intensity of VirE2-GFP CO mp associated with host cell borders divided by the total intensity in each image, n: the number of images measured.
  • D Mutations at the dual endocytic motifs at VirE2 C-terminus decreased transient transformation efficiency. Wild type N. benthamiana leaves were infiltrated with A.
  • E The intensity of transiently expressed mCherry was measured in each image, n: the number of images measured.
  • F Mutations at the dual endocytic motifs at VirE2 C-terminus decreased stable transformation efficiency. A. tumefaciens A348 and mutant strains were used for tumor formation assay.
  • G Quantification of the frequency of tumor formation. *p ⁇ 0.05, **p ⁇ 0.01 (unpaired Student's t test).
  • Figure 9 shows mutations at other putative VirE2 endocytic sorting motifs did not affect VirE2 internalization in host cells.
  • N. benthamiana (Nb308A) leaves were infiltrated with A. tumefaciens EHA105 vz ' r£2: :GFP11 or VirE2 mutants, in which the corresponding tyrosine residues or leucine residues were substituted with alanine.
  • Projected Z-series of images were obtained at 2 d post agroinfiltration. Scale bars, 20 ⁇ .
  • Figure 10 shows sequence alignment analysis of VirE2 from different types of Ti plasmids. Sequence alignment revealed that the dual tyrosine-based endocytic motifs at C-terminus were conserved on VirE2 proteins from different types of Ti plasmids.
  • Figure 11 shows endocytic motifs at VirE2 C-terminus interacted with plant AP2M and ap2m mutations attenuated tumorigenesis.
  • VirE2 C-terminal tail fused onto GST (GST-VirE2C) was used to conduct an in vitro pull-down assay with AP2M cargo binding domain fused onto MBP (MBP-AP2MC). The pull down (upper panel) and 20% of input (lower panels) factions were analyzed by western blot. Free MBP and MBP-AP2MC fusion protein are asterisked.
  • the present invention is thus directed to a peptide comprising or consisting of (i) the amino acid sequence of SEQ ID NO: l or (ii) an amino acid sequence having at least 80% sequence identity to the amino acid sequence of SEQ ID NO: 1 over its entire length.
  • said peptide is 10 to 200 amino acids in length.
  • the peptide of the invention consists of not more than 500 amino acids, not more than 450 amino acids, not more than 400 amino acids, not more than 350 amino acids, not more than 300 amino acids, not more than 250 amino acids, not more than 200 amino acids, not more than 150 amino acids, not more than 100 amino acids, not more than 80 amino acids, not more than 50 amino acids or not more than 30 amino.
  • the peptide is 10 to 100 amino in length, 15 to 130 amino acids in length, 20 to 170 amino acids in length or 30 to 210 amino acids in length.
  • the scope of the present invention also encompasses various embodiments wherein the amino acid sequence having at least 85%, at least 87%, at least 90%, at least 93%, at least 95%, at least 97% or at least 99% sequence identity to the amino acid sequence of SEQ ID NO: l over its entire length.
  • the present invention relates to a conjugate comprising a peptide of the invention, wherein said peptide further comprises at least one functional moiety.
  • said at least one functional moiety is conjugated to the N-terminus of said peptide.
  • said at least one functional moiety does not comprise the amino acid sequence set forth in SEQ ID NO:2 or a C-terminal fragment thereof.
  • the present invention relates to a conjugate of the invention with the proviso that said at least one functional moiety does not comprise the amino acid sequence set forth in SEQ ID NO: 3 or an N-terminal fragment thereof.
  • the functional moiety is a pharmaceutically or biologically active compound.
  • the scope of the present invention also encompasses various embodiments wherein the functional moiety further comprises or is the green fluorescent protein (GFP) or a fragment thereof.
  • GFP green fluorescent protein
  • said conjugate further comprises at least one moiety for translocation into a cell.
  • said moiety for translocation into a cell is the C-terminal sequence of VirE2.
  • said moiety for translocation into a cell comprises or consists of the sequence of R-X(7)-R-X-R-X-R-X-X, wherein X is any proteinogenic amino acid and R is arginine.
  • said moiety for translocation into a cell is a cell-penetrating peptide or agent.
  • the present invention relates to a vector comprising a nucleotide sequence encoding the peptide of the invention.
  • the present invention relates to a host cell comprising the vector of the invention.
  • the present invention relates to a bio-imaging system for visualization of internalization comprising (a) a conjugate of the invention which is conjugated to a first GFP fragment; and (b) a cell which expresses a second GFP fragment, wherein the first GFP fragment and the second GFP fragment can assemble to form a functional GFP.
  • the conjugate of (a) is conjugated to a peptide according to SEQ ID NO:5; and/or (b) the cell expresses a peptide according to SEQ ID NO:6.
  • the scope of the present invention also encompasses various embodiments wherein the cell is selected from the group consisting of a plant cell, yeast cell, fungi, algae or cultured mammalian cell.
  • the cell is a plant cell.
  • the cell expresses the clathrin-associated adaptor AP2 complex (AP2M).
  • A2M clathrin-associated adaptor AP2 complex
  • the present invention relates to a method to visualize internalization comprising: (a) providing the bio-imaging system of the invention; and (b) contacting the conjugate and the cell.
  • the present invention relates to a method to internalize a drug into a cell comprising: (a) providing the conjugate of the invention and a cell; and (b) contacting the conjugate and the cell.
  • the present invention relates to a conjugate of the invention for use as a medicament.
  • the present invention relates to the use of a conjugate of the invention as a research reagent.
  • At least one relates to one or more, in particular 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more.
  • Bacterial strains and plasmids used in this study are listed in Table 1.
  • A. tumefaciens strains were grown at 28 °C in LB (Luria-Bertani) medium. Media were supplemented with 100 ⁇ g ml "1 carbenicillin or 50 ⁇ g ml "1 kanamycin when necessary.
  • Arabidopsis thaliana (ecotype Columbia-0) wild type and mutant plants were used in root transformation assay.
  • Nicotiana benthamiana wild type and transgenic line Nb308A (expressing GFPl-10 and DsRed) were used in agro-infiltration assays (36).
  • the GFPl-10 coding sequence was amplified from pQH308A (36) with primers 5'- CT AGTCT AGAATGGTTTCGAAAGGCGAGGA-3' and 5'-
  • Agrobacterium-labeling constructs [00050] A primer set of 5 ' -ACGCGTCGACCTCGAGGGGGG-3 ' and 5'- ACGCGTCGACTCTCAGTAAAGCGCTGGCTG-3' was used to amplify the backbone from pCB301 (59); the PCR product was then digested with Sail and self-ligated to generate pXY301, which lacks the T-DNA right border sequence.
  • a virB promoter region was amplified from the plasmid pTiA6 with primers 5'- ACGCGTCGACATGGGTTTACAGACAGCGTAATCTC-3 ' and 5 ' -ACCTTATCTCCTTAGCTCGC AAC-3 ' and cloned into pXY301 to generate pVB.
  • the DsRed coding sequence was amplified with primers 5'- CGGGGTACCATGGCCTCCTCCGAGG ACG-3 ' and 5 ' -CGGGGTACCTTACAGGAACAGGTGGTGGCG-3 ' and cloned into pVB to generate pVB-RFP.
  • the GFP coding sequence was amplified with primers 5'- CGGGGTACCATGTCTAAAGGTGAAGAATTATTCACTG-3' and 5'-
  • the mCherry coding sequence was amplified with primers 5'- CCGCTCGAGATGGTGAGCAAGGGCGAGGA-3' and 5'-
  • CGGGGTACCTTACTTGTACAGCTCGTCCATGCCG-3' and cloned into a binary vector pQH121 to generate pQH121-mC, in which the mCherry was under the control of a CaMV 35S promoter.
  • the coding sequence of 295 amino acid C-terminal cargo-binding domain of Li2-subunit was amplified from A. thaliana cDNA with primers 5 ' -CGCGGATCCTCACC ATTTTCATCGAAGCCA-3 ' and 5 ' -CTAGTCTAGATCAGCATCTGATCTCGTAAGATCCC-3 ' ; the PCR fragment was cloned into vector pMAL-c2x (New England Biolabs) to generate pMBP-AP2MC.
  • telomere sequence of 76 amino acid C-terminal tail of VirE2 was amplified from pTibo542(EHA105) with primers 5 ' -CGCGG ATCC ATCGTCGCCG ATCGC AA- 3 ' and 5'- CCGCTCGAGTCAAAAGCTGTTGACGCTTTG-3 ' ; the PCR fragment was cloned into a vector pGEX-4T-l (GE Healthcare) to generate pGST-VirE2C.
  • Agrobacterium-delivered VirE2 was detected using a split-GFP system as described (36).
  • the VirE2-GFPl l fusion was expressed inside bacteria using the tagged A. tumefaciens strain EHA105virE2: :GFP11.
  • GFPl-10 was expressed in plant cells either using a transgenic line Nb308A or by transient expression using A. tumefaciens strains containing the binary plasmid pGFPl-10.
  • Plasma membranes or early endosomes were detected by transient expression with A. tumefaciens strains containing a binary plasmid pm-rb (37), which harbors T-DNA encoding a plasma membrane marker, or pXY01-SYP61-mC, which harbors T-DNA encoding the early endosome marker SYP61, respectively.
  • FM4-64 (Invitrogen) was infiltrated into the underside of N. benthamiana leaves at a concentration of 25 ⁇ in distilled water. Images were taken at 1 h post infiltration.
  • A. tumefaciens EHA105 or mutant strains containing pQH121-mC, which harbors T-DNA encoding the mCherry, were infiltrated into wild type N. benthamiana leaves in low concentration (OD6oo 0.005). Images were obtained at 2 d post agroinfiltration and used for intensity calculation.
  • A. thaliana wild type or mutant seeds (Col-0) were surface-sterilized using 15% bleach solution and incubated at 4 °C for 2 days. The seeds were then placed onto solidified l/2x MS medium (supplemented with 1% sucrose and 0.5 g L 1 MES, pH 5.8) and incubated under a photoperiod of 16 h light/8 h dark at 22 °C for 10- 12 days. Roots from individual seedlings were cut into 3-5 mm segments and mixed with 1 ml A. tumefaciens cells (A348 or mutant) at a concentration of 1 ⁇ 10 8 cells/ml and spread onto a solidified 1/2* MS plate. The plates were subsequently incubated at 22 °C for 36 h. The root segments were aligned onto l/2x MS medium plates containing 100 ⁇ g mL "1 cefotaxime and kept at 22 °C for 5-6 weeks.
  • A. thaliana roots from individual seedlings were cut into 3-5 mm segments and mixed with ES I or Tyrphostin A23 (Sigma) at a final concentration of 60 ⁇ or 50 uM respectively in H2O, the mixtures were then kept in dark for 3 h. As the control, the root fragments were treated with H2O alone. The root fragments were then mixed with A. tumefaciens for root transformation assay as described above.
  • IPTG Isopropyl beta-D-l-thiogalactopyranoside
  • Bacterial cells were harvested by centrifugation at 5000 g at 4 °C for 5 min and washed once with Pull-Down Lysis Buffer (50 mM Tris « HCl, 50 mM NaCl, pH 7.5). The cells were then resuspended in Pull-Down Lysis Buffer containing protease inhibitor cocktail (Nacalai Tesque) and were subjected for brief sonication (12 bursts of 20 sec with 40% power). Cell debris was removed by centrifugation at 12000 g at 4 °C for 15 min.
  • Pull-Down Lysis Buffer 50 mM Tris « HCl, 50 mM NaCl, pH 7.5. The cells were then resuspended in Pull-Down Lysis Buffer containing protease inhibitor cocktail (Nacalai Tesque) and were subjected for brief sonication (12 bursts of 20 sec with 40% power). Cell debris was removed by centrifugation at 12000
  • the supernatant of bait proteins (MBP or MBP tagged proteins) were incubated with 150 ⁇ of amylose resin (New England Biolabs) on a rotator at 4 °C for 3 h. The column was then washed 5 times with the Pull-Down Wash Buffer (50 mM Tris-HCl, 50 mM NaCl, 0.5% Triton X-100 pH 7.5).
  • the supernatant of prey proteins (GST-tagged proteins) were added to the column containing the immobilized MBP-tagged bait protein and incubated on a rotator at 4 °C for overnight. The column was then washed 5 times with the Pull-Down Wash Buffer and captured proteins were eluted with the Pull-Down Lysis Buffer containing 10 mM maltose.
  • MBP-tagged proteins were detected by immunoblotting with anti-MBP antibody (sc-809, Santa Cruz Biotechnology) and GST-tagged proteins were detected by immunoblotting with anti-GST antibody (sc-459, Santa Cruz Biotechnology).
  • a PerkinElmer Ultra View Vox Spinning Disk system with EM-CCD cameras was used for confocal microscopy.
  • Agroinfiltrated N. benthamiana leaves were observed at 2 d post agroinfiltration unless specified otherwise.
  • To observe leaf epidermis agroinfiltrated leaf tissues were detached from N. benthamiana plants and immersed in H2O on a glass slide with a coverslip. All images were processed by Volocity ® 3D Image Analysis Software 6.2.1. All images were obtained under confocal microscope with Olympus UPLSAPO 60 x N.A. 1.20 water immersion objective unless otherwise specified.
  • Fluorescence intensity was measured using ImageJ (http://rsbweb.nih.gov/ij/).
  • Km 1 pCB301 A mini binary vector; Km' (59) pCB301 derivative, with T-DNA right border sequence pXY301 This study deleted; Km' pVB pXY301 derivative, with a VirB promoter region; Km' This study pVB derivative, with DsRed coding sequence under the pVB-RFP This study control of VirB promoter; Km' pVB-RFP derivative, with kanamycin resistance
  • pVB-GFP This study control of VirB promoter; Km' pBim A binary vector; Km 1 (62) pQH121 pBI121 derivative, with gusA deleted; Km' This study pQH121 derivative, with mCherry coding sequence
  • VirE2C(Y494A) fusion protein Amp r pGST-VirE2C(Y488A pGEX-4T-l derivative, expressing MBP-
  • VirE2-GFPl 1 fusion was expressed in A. tumefaciens and GFPl- 10 was expressed in plant cells.
  • VirE2-GFP C om P fluorescence signals resulting from the complementation of VirE2-GFPl l and GFPl-10 were visualized (36).
  • VirE2 delivery into tobacco cells was observed at the early stage; a T-DNA free strain EHA105 was used to avoid any potential complication due to T-DNA trafficking.
  • A. tumefaciens EHA105 vz ' r£2: :GFP11 producing VirE2-GFPl l was infiltrated into transgenic N. benthamiana (Nb308A) leaves expressing both GFPl-10 and DsRed.
  • the VirE2 delivery into tobacco cells was examined under a confocol microscope at different time points. As shown in Fig. 1A, a small amount of VirE2 started to appear at tobacco cell borders at 32 hours after agroinfiltration (upper panel).
  • VirE2 As the time goes, more VirE2 was observed at the cell borders; the VirE2 signals became filamentous. Most of tobacco cells exhibited VirE2 accumulation in the nucleus at 48 hours after agroinfiltration (Fig. 1A lower panel). The data indicated that VirE2 first appeared at tobacco cell borders and then moved into the nucleus.
  • A. tumefaciens cells were constructed to express GFP under the control of the virB promoter and thus they became fluorescently labeled naturally during agro-infiltration.
  • GFP-labeled A. tumefaciens cells EHA105(pAT- GFP) were infiltrated into N. benthamiana leaves, it was observed that most of the bacterial cells lined up at the intercellular space of agro-infiltrated tobacco cells (Fig. 2A). Then GFP-labeled bacterial cells were evenly mixed with DsRed-labeled bacterial cells; the mixture was infiltrated into the N.
  • A. tumefaciens cells and VirE2 delivered into plant cells was determined. Wild type N. benthamiana leaves were infiltrated with DsRed-labeled A. tumefaciens strain EHA105vjV£2::G P77(pGFPl-10 and pVBA-RFP), which is also capable of delivering VirE2-GFPl l and the T- DNA expressing GFPl-10.
  • VirE2 accumulated at the cytoplasmic sides of tobacco cells that are in a close contact with A. tumefaciens cells (Fig. IB).
  • VirE2 was delivered into plant cells from both sides of the bacterial cells. This suggests that a single bacterium could deliver VirE2 into two neighboring host cells simultaneously.
  • a specific plant plasma membrane tracker was expressed inside plant cells by T-DNA delivered by the same bacterial cells delivering VirE2-GFPl l (37). It was found that Agrobacterium-dehvered VirE2 co-localized with the transiently expressed plasma membrane tracker (Fig. 1C), suggesting that VirE2 was associated with plant cytoplasmic membrane upon the delivery.
  • a fluorescent styryl dye FM4-64 was used to label the membranes and then monitor the dynamics (38). This dye is lipophilic; it can label membranes where it is applied, but it cannot penetrate the membranes by itself. This property would allow us to monitor the trafficking process of VirE2-bound membranes.
  • A. tumefaciens EHA105virE2::GFPll cells were infiltrated into N. benthamiana leaves to start the VirE2 delivery; 48 h later the FM4-64 dye was then infiltrated into the same areas. As shown in Fig.
  • VirE2 was co-localized with FM4-64-labeled plasma membranes (upper panel), in a manner similar to using plasma membrane tracker (Fig. 1C). Interestingly, VirE2 was also co- localized with FM4-64-labeled endocytic vesicles, which pinched off from the plasma membranes (Fig. ID lower panel).
  • ES I chemical inhibitor endosidinl
  • SYP61-mCherry was used to label the highly dynamic round-shaped early endosomes (44, 45); it was transiently expressed in N. benthamiana epidermal cells that were treated with ES I. It was found that ESI treatment caused abnormal aggregation of SYP61-mCherry marker (Fig. 7A), indicating aggregation of early endosomes in leaf epidermal cells.
  • ES I treatment caused abnormal VirE2 trafficking in host cytoplasm; VirE2 was accumulated inside the ESI -induced endosome aggregates (Fig. 7B). This indicated that ES I interfered with host endocytosis and restricted the VirE2 movement.
  • Example 5 Dual endocytic motifs at C-terminal tail of VirE2 are required for VirE2 trafficking
  • VirE2 was selected as a cargo for internalization.
  • selection of plasma membrane associated cargo proteins for internalization depends upon the recognition of endocytic signals at the cytosolic side of cargo proteins by a variety of host adaptors (47, 48).
  • host adaptors 47, 48.
  • VirE2 Upon delivery into host plant cells through T4SS, VirE2 might interact with one of host adaptor proteins at the plasma membrane.
  • Sequence analysis indicated that the VirE2 (accession no. AAZ50538) contained 5 putative endocytic sorting motifs (Fig. 8A).
  • Example 7 Endocytic motifs at VirE2 C-terminus interact with plant AP2M [00088]
  • the above results led us to hypothesize that the dual C-terminal tyrosine-based endocytic motifs of VirE2 might be recognized by a clathrin-associated sorting protein, since clathrin-mediated endocytosis process is facilitated by a group of host adaptors known as "clathrin-associated sorting proteins", which are responsible for endocytic signal recognition and cargo binding (47, 48).
  • the adaptor protein 2 (AP-2) complex recognizes the tyrosine-based endocytic signal and binds to it through the C-terminal domain of ⁇ -subunit (AP2M) (50).
  • Example 8 ap2m mutations attenuates tumorigenesis
  • Arabidopsis importin alpha isoform is preferentially involved in Agrobacterium-mediated plant transformation. Plant Cell 20, 2661 (2008).

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Biochemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biophysics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

This invention relates to a peptide comprising or consisting of (i) the amino acid sequence of SEQ ID NO:1 or (ii) an amino acid sequence having at least 80% sequence identity to the amino acid sequence of SEQ ID NO:1 over its entire length. The present invention also relates to a conjugate, a host cell, a bio-imaging system, a method to visualize internalization, a method to internalize a drug into a cell and the conjugate of the invention for use as a medicament or the use of the conjugate of the invention as a research agent.

Description

COMPOUNDS AND METHODS TO TARGET A MOLECULE TO A SPECIFIC CELLULAR LOCATION
FIELD OF THE INVENTION
[0001] This invention relates to a peptide comprising or consisting of (i) the amino acid sequence of SEQ ID NO: l or (ii) an amino acid sequence having at least 80% sequence identity to the amino acid sequence of SEQ ID NO: l over its entire length. The present invention also relates to a conjugate, a host cell, a bio-imaging system, a method to visualize internalization, a method to internalize a drug into a cell and the conjugate of the invention for use as a medicament or research reagent.
BACKGROUND OF THE INVENTION
[0002] A. tumefaciens causes crown gall tumors on various plants by transferring oncogenic T-DNA into plant cells (1-3). Under laboratory conditions, the bacterium can transfer T-DNA into other eukaryotic species, including yeast (4, 5), fungi (6), algae (7) and cultured human cells (8). It has been developed as a DNA-delivery vector that is widely used as the workhorse for genetic engineering of plants (9) and non-plant organisms (10).
[0003] During Agrobacterium-mediate transformation (AMT) process, A. tumfaciens delivers both T- DNA and bacterial virulence proteins into host cells via a bacterial type IV secretion system (T4SS) composed of VirB/VirD4 (11, 12). Agrobacterium VirB/VirD4 T4SS is the archetype for the T4SS family that is widely used by bacteria to translocate DNA (13, 14) and protein macromolecules (75) to a diverse range of bacterial and eukaryotic cells (16). The Agrobacterium T4SS apparatus is comprised of 12 bacterial virulence proteins, including VirB l-11 and VirD4, which form a multi-subunit membrane-spanning channel that delivers macromolecules into host cells (17).
[0004] Agrobacterium T4SS delivers at least five protein substrates into host cells; these include VirD2, VirD5, VirE2, VirE3 and VirF (18-20). There is evidence that these bacterial effectors depend upon their C- terminal positive charged signals for their export into host cells (19). Upon delivery, these effector proteins work cooperatively inside host cells and facilitate the transformation process. Host factors have been shown to interact with these effectors and are important for the successful transformation (21).
[0005] T-DNA is generated by VirD2 protein that functions as an endonuclease inside bacterial cells, as a single-stranded (ss) DNA molecule from the Ti plasmid (22-24). VirD2 remains covalently associated with 5 ' end of the T-DNA and leads the way into host cells through T4SS (23). Inside host cytoplasm, the naked T-DNA is then coated with T4SS -delivered VirE2, which is ssDNA-binding protein, to form the T-complex (25-27). Both VirD2 and VirE2 contain functional nuclear localization signal (NLS) sequences that interact with host importin a proteins (28). They may work cooperatively for the nuclear import of T-complex inside host cells.
[0006] As an abundant effector protein secreted into recipient cells, VirE2 is also crucial for a variety of other processes during the transformation. In vitro studies showed that VirE2 forms voltage-gated and ssDNA- specific channel on artificial membranes, suggesting that it might facilitate the entry of T-DNA into host cells (29). Since VirE2 binds to the T-strand inside host cytoplasm in a cooperative manner, it can protect T-DNA from nucleolytic degradation (30, 31). As the major component of T-complex, VirE2 trafficking would affect the fate of T-strand.
[0007] VirE2 has been shown to participate in nuclear targeting of T-DNA in two different ways. First, two separate NLS sequences have been identified in VirE2 molecule, which are involved in direct interaction with Arabidopsis importin a isoforms (28). Second, VirE2 could also interact with plant transcription factor VIP1 (32); this host protein undergoes MAPK3 mediated phosphorylation and nuclear translocation induced by Agrobacterium infection, which might result in the nuclear import of VirE2 and thus the T-strand (33, 34).
[0008] Inside host nucleus, VIP1 can interact with host histones, and the interaction might be useful for the T-complex to target the host chromatin (34). Moreover, VirE2 could interact with another host protein VIP2, a putative transcriptional repressor localized to plant nucleus (35). The requirement of VIP2 for stable transformation suggests that interaction between VirE2 and VIP2 might facilitate T-strand integration into host genome (35). [0009] Thus, targeting a molecule or drug to a specific location inside a cell is important and challenging in the fields of drug development and life sciences. There exists a continuous need for techniques which are useful for the introduction of molecule or drug over the cytoplasmic membrane into a cell and to a specific desired location.
BRIEF DESCRIPTION OF THE DRAWINGS
[00010] The invention will be better understood with reference to the detailed description when considered in conjunction with the non-limiting examples and the accompanying drawings.
[00011] Figure 1 shows association of Agrobacterium-delivered VirE2 with host plasma membrane and endocytic vesicles. (A) VirE2 detection at different time intervals inside N. benthamiana cells. A. tumefaciens EHA105 vz'r£2: :GFP11 was infiltrated into transgenic N. benthamiana (Nb308A) leaves expressing both GFPl-10 and DsRed. Projected Z-series of images were obtained at 32 h and 48 h post agroinfiltration. (B) Accumulation of VirE2 at the cytoplasmic sides of tobacco cells contacting with A. tumefaciens cells. Wild type N. benthamiana leaves were infiltrated with DsRed-labeled A. tumefaciens strain EHA105vz'r£2:. G P77(pGFPl-10 and pVBA- RFP), which is also capable of delivering VirE2-GFPl l and the T-DNA expressing GFPl-10. Images were obtained at 2 d post agroinfiltration. (C) Accumulation of Agrobacterium-delivered VirE2 at the host plasma membrane. Wild type N. benthamiana leaves were infiltrated with evenly mixed A. tumefaciens strains EHA105vzr£2::G P77(pGFPl-10), which is capable of delivering VirE2-GFPl l and the T-DNA expressing GFPl-10, and EHA105vzr£2.vG P77(pm-rb), which is capable of delivering VirE2-GFPl l and the T-DNA expressing a plasma membrane (PM) tracker. Images were obtained at 2 d post agroinfiltration. (D) Co- localization of Agrobacterium-delivered VirE2 with FM4-64-labeled plasma membrane (upper panel) or endocytic vesicles (lower panel) inside tobacco epidermal cells. Wild type N. benthamiana leaves were infiltrated with A. tumefaciens strain EHA105vz'r£2::G P77(pGFPl-10) and then stained with FM4-64. Images were obtained at 2 d post agroinfiltration. Scale bars, 10 μιη.
[00012] Figure 2 shows accumulation of Agrobacterium at the intercellular space of infiltrated leaf epidermal cells. (A) Projected Z-series of N. benthamiana (Nb308A) leaves infiltrated with GFP-labeled A. tumefaciens cells EHA105 (pVB-GFP). Images were obtained 2 d post agroinfiltration under confocal microscope with Olympus UAPO N 340 40x N.A. 1.15 water immersion objective. White lines were added to the images to indicate borders between leaf epidermal cells. (B) Projected Z-series of wild type N. benthamiana leaves infiltrated with evenly mixed GFP labeled A. tumefaciens cells EHA105 (pVB-GFP) and DsRed labeled A. tumefaciens cells EHA105 (pVB-RFP). Scale bars, 20 μπι.
[00013] Figure 3 shows co-movement of VirE2 with FM4-64 labeled endocytic vesicles in N. benthamiana epidermal cells. Wild type N. benthamiana leaves were infiltrated with A. tumefaciens cells EHA105vz'r£2::G P77(pGFPl-10) followed by FM4-64 staining. Images were obtained 2 d post agroinfiltration. Scale bar, 20 μιη.
[00014] Figure 4 shows interference with host endocytosis impaired VirE2 trafficking and attenuated the virulence. (A) Expression of a defective clathrin Hub impaired VirE2 departure from plasma membrane. N. benthamiana (Nb308A) leaves were infiltrated with A. tumefaciens strain EHA105vz'r£2::G P77(pXY01) or EHA105vzr£2::G P77(pXY01-Hub), which is capable of delivering VirE2-GFPl l and the T-DNA expressing Hub. Projected Z-series of images were obtained at 4 d post agroinfiltration. Scale bars, 20 μιη. (B) The intensity of VirE2-GFPcomp signals remaining at host cell borders was measured in each image, n: the number of images measured. (C) ESI treatment decreased nuclear accumulation of VirE2 in plant epidermal cells. N. benthamiana (Nb308A) leaves were infiltrated with EHA105vz'r£2::G P77 alone or together with ES I. Boxed areas are enlarged to highlight the nucleus. Projected Z-series of images were obtained at 2 d post agroinfiltration. Scale bars, 20 μιη. (D) The intensity of VirE2-GFPComP signals was measured within each host nucleus, n: the number of nucleus measured. (E) ES 1 or Tyrphostin A23 treatment attenuated tumorigenesis on Arabidopsis roots. Chemical- treated Arabidopsis roots were co-cultivated with Agrobacterium strain A348 for tumorigenesis. (F) Quantification of the frequency of tumor formation. **p < 0.01 (unpaired Student's t test).
[00015] Figure 5 shows expression of Hub impaired FM4-64 uptake in N. benthamiana epidermal cells. (A) Wild type N. benthamiana leaves were infiltrated with A. tumefaciens cells EHA105(pXY01) or EHA105(pXY01-Hub) followed by FM4-64 staining at 2 d or 4 d post agroinfiltration. Projected Z-series of images were obtained 5 h post staining under confocal microscope with Olympus UAPO N 340 40x N.A. 1.15 water immersion objective. Scale bars, 20 μιη. (B) Quantification of FM4-64 uptake. Number of endocytic vesicles stained by FM4-64 was calculated in each image (n=20). **p < 0.01 (unpaired Student's t test).
[00016] Figure 6 shows expression of dominant-negative clathrin Hub impaired VirE2 departure from plasma membrane in N. benthamiana epidermal cells. (A) Wild type N. benthamiana leaves were infiltrated with A. tumefaciens cells EHA105vz'r£2::G P77 (pXYOl). (B) Wild type N. benthamiana leaves were infiltrated with A. tumefaciens cells EHA105vz'r£2::G P77 (pXY01-Hub). Projected Z-series of images were shown. Scale bars, 20 μιη.
[00017] Figure 7 shows ES I treatment affected early endosomes and VirE2 trafficking. (A) ESI treatment caused aggregation of SYP61 -containing endosomes in N. benthamiana leaf epidermal cells. Wild type N. benthamiana leaves were infiltrated with A. tumefaciens cells EHA105(pXY01-SYP61-mC) alone or mixed with ES I (25 μΜ). In controls, transiently expressed SYP61-mCherry labeled the round-shaped early endosomes in N. benthamiana epidermal cells. ESI treatment induced the aggregation of SYP61 -containing endosomes (arrowed). (B) Aggregation of SYP61 -containing endosomes restricted VirE2 trafficking in N. benthamiana epidermal cells. Wild type N. benthamiana leaves were infiltrated with evenly mixed A. tumefaciens cells EHA105vzr£2::G P77(pGFPl-10) and EHA105vzr£2::G P77(pXY01-SYP61-mC) together with chemical effector ES I. Projected Z-series of images were obtained 2 d post agroinfiltration. Scale bars, 20 μπι.
[00018] Figure 8 shows mutations at VirE2 endocytic motifs affected VirE2 internalization and impaired Agrobacterium-mediated transformation. (A) Schematic locations of VirE2 putative endocytic motifs identified by the Eukaryotic Linear Motif resource for functional sites in proteins (www.ELM.eu.org). The invariant amino acids of endocytic motifs are labeled in red. (B) Mutations at the dual endocytic motifs at VirE2 C-terminus affected VirE2 internalization into host cells. N. benthamiana (Nb308A) leaves were infiltrated with A. tumefaciens EHA105vz'r£2: :GFP11 or mutant strains containing the corresponding tyrosine substitutions with alanine. Projected Z-series of images were obtained at 2 d post agroinfiltration. Scale bars, 20 μιη. (C) Percentage of VirE2 staying at the cell borders is represented as the intensity of VirE2-GFPCOmp associated with host cell borders divided by the total intensity in each image, n: the number of images measured. (D) Mutations at the dual endocytic motifs at VirE2 C-terminus decreased transient transformation efficiency. Wild type N. benthamiana leaves were infiltrated with A. tumefaciens EHA105 or mutant strains containing the binary vector pQH121-mC (with free mCherry under the control of CaMV 35S promoter in T-DNA). Projected Z-series of images were obtained at 2 d post agroinfiltration under confocal microscope with Olympus UPL SAPO 10χ N.A. 0.40 objective. Single optical sections of bright field were shown to indicate the cell shapes (lower panel). Scale bars, 50 μιη. (E) The intensity of transiently expressed mCherry was measured in each image, n: the number of images measured. (F) Mutations at the dual endocytic motifs at VirE2 C-terminus decreased stable transformation efficiency. A. tumefaciens A348 and mutant strains were used for tumor formation assay. (G) Quantification of the frequency of tumor formation. *p<0.05, **p < 0.01 (unpaired Student's t test).
[00019] Figure 9 shows mutations at other putative VirE2 endocytic sorting motifs did not affect VirE2 internalization in host cells. N. benthamiana (Nb308A) leaves were infiltrated with A. tumefaciens EHA105 vz'r£2: :GFP11 or VirE2 mutants, in which the corresponding tyrosine residues or leucine residues were substituted with alanine. Projected Z-series of images were obtained at 2 d post agroinfiltration. Scale bars, 20 μπι.
[00020] Figure 10 shows sequence alignment analysis of VirE2 from different types of Ti plasmids. Sequence alignment revealed that the dual tyrosine-based endocytic motifs at C-terminus were conserved on VirE2 proteins from different types of Ti plasmids.
[00021] Figure 11 shows endocytic motifs at VirE2 C-terminus interacted with plant AP2M and ap2m mutations attenuated tumorigenesis. (A) VirE2 C-terminal tail interacted with AP2M. VirE2 C-terminal tail fused onto GST (GST-VirE2C) was used to conduct an in vitro pull-down assay with AP2M cargo binding domain fused onto MBP (MBP-AP2MC). The pull down (upper panel) and 20% of input (lower panels) factions were analyzed by western blot. Free MBP and MBP-AP2MC fusion protein are asterisked. (B) Double mutation at the dual endocytic motifs eliminated the interaction between VirE2 C-terminal tail and AP2M cargo binding domain. The pull down (upper panel) and 20% of input (lower panels) factions were analyzed by western blot. MBP-AP2MC fusion is asterisked. (C) A. thaliana ap2m-l and ap2m-2 mutations attenuated tumorigenesis in root transformation assay. (D) Quantification of the frequency of tumor formation. **p < 0.01 (unpaired Student's t test). PD: pulled down; IB: immunoblot.
DETAILED DESCRIPTION OF THE INVENTION
[00022] It is an object of the present invention to meet the above need by providing compounds and methods to target a molecule to a specific cellular localization. Surprisingly, the inventors found that the internalization of VirE2 is mediated by a specific sequence motif as set forth in SEQ ID NO: l. Conjugation of said motif to other molecular groups, such as drugs, will mediate the internalization of the conjugate. Further, this motif allows establishing methods to visualize internalization and to internalize a drug into a cell.
[00023] In a first aspect, the present invention is thus directed to a peptide comprising or consisting of (i) the amino acid sequence of SEQ ID NO: l or (ii) an amino acid sequence having at least 80% sequence identity to the amino acid sequence of SEQ ID NO: 1 over its entire length.
[00024] In various embodiments of the invention, said peptide is 10 to 200 amino acids in length. In alternative embodiments, the peptide of the invention consists of not more than 500 amino acids, not more than 450 amino acids, not more than 400 amino acids, not more than 350 amino acids, not more than 300 amino acids, not more than 250 amino acids, not more than 200 amino acids, not more than 150 amino acids, not more than 100 amino acids, not more than 80 amino acids, not more than 50 amino acids or not more than 30 amino. In other embodiments, the peptide is 10 to 100 amino in length, 15 to 130 amino acids in length, 20 to 170 amino acids in length or 30 to 210 amino acids in length.
[00025] The scope of the present invention also encompasses various embodiments wherein the amino acid sequence having at least 85%, at least 87%, at least 90%, at least 93%, at least 95%, at least 97% or at least 99% sequence identity to the amino acid sequence of SEQ ID NO: l over its entire length.
[00026] In a further aspect, the present invention relates to a conjugate comprising a peptide of the invention, wherein said peptide further comprises at least one functional moiety.
[00027] In various embodiments of the invention, said at least one functional moiety is conjugated to the N-terminus of said peptide.
[00028] The scope of the present invention also encompasses various embodiments wherein said at least one functional moiety is conjugated to the C-terminus of said peptide.
[00029] In various embodiments of the above aspect, said at least one functional moiety does not comprise the amino acid sequence set forth in SEQ ID NO:2 or a C-terminal fragment thereof.
[00030] In a further aspect, the present invention relates to a conjugate of the invention with the proviso that said at least one functional moiety does not comprise the amino acid sequence set forth in SEQ ID NO: 3 or an N-terminal fragment thereof.
[00031] In various embodiments of the invention, wherein the functional moiety is a pharmaceutically or biologically active compound.
[00032] The scope of the present invention also encompasses various embodiments wherein the functional moiety further comprises or is the green fluorescent protein (GFP) or a fragment thereof.
[00033] In various embodiments of the invention, said conjugate further comprises at least one moiety for translocation into a cell. In more preferred embodiments, said moiety for translocation into a cell is the C-terminal sequence of VirE2. In even more preferred embodiments, said moiety for translocation into a cell comprises or consists of the sequence of R-X(7)-R-X-R-X-R-X-X, wherein X is any proteinogenic amino acid and R is arginine. In additional preferred embodiments, said moiety for translocation into a cell is a cell-penetrating peptide or agent.
[00034] In a third aspect, the present invention relates to a vector comprising a nucleotide sequence encoding the peptide of the invention.
[00035] In a further aspect, the present invention relates to a host cell comprising the vector of the invention. [00036] In a fifth aspect, the present invention relates to a bio-imaging system for visualization of internalization comprising (a) a conjugate of the invention which is conjugated to a first GFP fragment; and (b) a cell which expresses a second GFP fragment, wherein the first GFP fragment and the second GFP fragment can assemble to form a functional GFP.
[00037] In various embodiments of the invention, (a) the conjugate of (a) is conjugated to a peptide according to SEQ ID NO:5; and/or (b) the cell expresses a peptide according to SEQ ID NO:6.
[00038] The scope of the present invention also encompasses various embodiments wherein the cell is selected from the group consisting of a plant cell, yeast cell, fungi, algae or cultured mammalian cell. In preferred embodiments, the cell is a plant cell.
[00039] In various embodiments of the above aspect, the cell expresses the clathrin-associated adaptor AP2 complex (AP2M).
[00040] In a further aspect, the present invention relates to a method to visualize internalization comprising: (a) providing the bio-imaging system of the invention; and (b) contacting the conjugate and the cell.
[00041] In a seventh aspect, the present invention relates to a method to internalize a drug into a cell comprising: (a) providing the conjugate of the invention and a cell; and (b) contacting the conjugate and the cell.
[00042] In an eighteenth aspect, the present invention relates to a conjugate of the invention for use as a medicament.
[00043] In a last aspect, the present invention relates to the use of a conjugate of the invention as a research reagent.
[00044] "At least one", as used herein, relates to one or more, in particular 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more.
EXAMPLES
Materials and Methods
Strains, plasmids and growth conditions
[00045] Bacterial strains and plasmids used in this study are listed in Table 1. A. tumefaciens strains were grown at 28 °C in LB (Luria-Bertani) medium. Media were supplemented with 100 μg ml"1 carbenicillin or 50 μg ml"1 kanamycin when necessary.
Plant materials
[00046] Arabidopsis thaliana (ecotype Columbia-0) wild type and mutant plants were used in root transformation assay. The AP2M insertional mutants, ap2m-l (SALK_083693) and ap2m-2 (CS807972), were obtained from the Arabidopsis Biological Resource Center at Ohio State University.
[00047] Nicotiana benthamiana wild type and transgenic line Nb308A (expressing GFPl-10 and DsRed) were used in agro-infiltration assays (36).
Constructs
GFPl-10 construct
[00048] To construct a binary vector (pXYOl) for target gene expression in plant cells, a primer set of 5'- CTAGTCTAGACCCGGGCTCGAGCCATGGGGATCCGAGCTCGAATTTCCCCGATCGTTCAAACATTTG GCA ATAAAGTTT-3 ' and 5 ' -CT AGTCT AG AGCT AGCTCCGG ACTT A AG A was used to amplify the binary vector backbone from the plasmid er-gb (37) to generate a DNA fragment, in which the ER marker cassette was replaced with a multiple cloning site sequence; the PCR product was then digested with Xbal and self-ligated to generate the binary vector pXYOl.
[00049] The GFPl-10 coding sequence was amplified from pQH308A (36) with primers 5'- CT AGTCT AGAATGGTTTCGAAAGGCGAGGA-3' and 5'-
CGCGGATCCTTATTTCTCGTTTGGGTCTTTGC-3' and inserted into pXYOl to generate pGFPl-10.
Agrobacterium-labeling constructs [00050] A primer set of 5 ' -ACGCGTCGACCTCGAGGGGGG-3 ' and 5'- ACGCGTCGACTCTCAGTAAAGCGCTGGCTG-3' was used to amplify the backbone from pCB301 (59); the PCR product was then digested with Sail and self-ligated to generate pXY301, which lacks the T-DNA right border sequence. A virB promoter region was amplified from the plasmid pTiA6 with primers 5'- ACGCGTCGACATGGGTTTACAGACAGCGTAATCTC-3 ' and 5 ' -ACCTTATCTCCTTAGCTCGC AAC-3 ' and cloned into pXY301 to generate pVB. The DsRed coding sequence was amplified with primers 5'- CGGGGTACCATGGCCTCCTCCGAGG ACG-3 ' and 5 ' -CGGGGTACCTTACAGGAACAGGTGGTGGCG-3 ' and cloned into pVB to generate pVB-RFP. The GFP coding sequence was amplified with primers 5'- CGGGGTACCATGTCTAAAGGTGAAGAATTATTCACTG-3' and 5'-
CGGGGTACCTTATTTGTACAATTCATCCATACCATG-3' and cloned into pVB to generate pVB-GFP. An ampicillin resistance cassette was then amplified from pACT2 (Clontech) with primers 5'- ATGCAATCATGATTCAAATATGTATCCGCTCAAGAGA-3' and 5'-
ATGCAATCATGACTCACGTTAAGGGATTTTGGACAT-3' and inserted into pVB-RFP to replace the kanamycin resistance cassette to generate pVBA-RFP.
Hub construct
[00051] The 1860 bp DNA fragment encoding the C-terminal part of CHC1 (At3gl l l30) was amplified from a total Arabidopsis cDNA preparation with primers 5'-
TCCCCCCGGG ATG AAGA AGTTT AACTT AA ATGTTC AGGCTG- 3 ' and 5'-
CGCGGATCCTTAGTAGCCGCCCATCGGT-3 ' . The PCR fragment was cloned into vector pXYOl to generate pXY01-Hub, in which the Hub was under the control of a CaMV 35S promoter.
SYP61 constructs
[00052] To label the early endosomes, the full length genomic sequence of Arabidopsis thaliana SYP61 (Atlg28490) was amplified from A. thaliana genomic DNA with primers 5'- CTAGTCTAGAATGTCTTCAGCTCAAGATCCATTCT-3' and 5'-
CCGCTCGAGGGTCAAGAAGACAAGAACGAATAGG-3' and cloned into a binary vector pXYOl so that SYP61 was under the control of a CaMV 35S promoter. The mCherry coding sequence was subsequently amplified with primers 5 ' -CCGCTCGAGGGAGGTGGCTCTGGCGGGGGATCAATGGTGAGCAAGGGCGAGGA-3 ' and 5 ' -CGCGGATCCTTACTTGTAC AGCTCGTCC ATGCCG-3 ' ; the PCR fragment was cloned at the C- terminus to generate pXY01-SYP61-mC.
Transient mCherry expression constructs
[00053] The mCherry coding sequence was amplified with primers 5'- CCGCTCGAGATGGTGAGCAAGGGCGAGGA-3' and 5'-
CGGGGTACCTTACTTGTACAGCTCGTCCATGCCG-3' and cloned into a binary vector pQH121 to generate pQH121-mC, in which the mCherry was under the control of a CaMV 35S promoter.
Pull-down constructs
[00054] The coding sequence of 295 amino acid C-terminal cargo-binding domain of Li2-subunit (AP2M) was amplified from A. thaliana cDNA with primers 5 ' -CGCGGATCCTCACC ATTTTCATCGAAGCCA-3 ' and 5 ' -CTAGTCTAGATCAGCATCTGATCTCGTAAGATCCC-3 ' ; the PCR fragment was cloned into vector pMAL-c2x (New England Biolabs) to generate pMBP-AP2MC.
[00055] The coding sequence of 76 amino acid C-terminal tail of VirE2 was amplified from pTibo542(EHA105) with primers 5 ' -CGCGG ATCC ATCGTCGCCG ATCGC AA- 3 ' and 5'- CCGCTCGAGTCAAAAGCTGTTGACGCTTTG-3 ' ; the PCR fragment was cloned into a vector pGEX-4T-l (GE Healthcare) to generate pGST-VirE2C.
Agroinfiltration
[00056] A. tumefaciens cells were grown overnight in LB; the cultures were then diluted 50 times in LB medium and further grown for 5-6 h. The bacteria were collected and re-suspended in H2O to OD6oo=1.0 unless otherwise specified. The bacterial suspension was infiltrated to the underside of fully expended N. benthamiana leaves using a syringe. The infiltrated plants were then placed at 22 °C under a photoperiod of 16 h light/8 h dark.
Detection of Agrobacterium -delivered VirE2 m N. benthamiana [00057] Agrobacterium-delivered VirE2 was detected using a split-GFP system as described (36). The VirE2-GFPl l fusion was expressed inside bacteria using the tagged A. tumefaciens strain EHA105virE2: :GFP11. GFPl-10 was expressed in plant cells either using a transgenic line Nb308A or by transient expression using A. tumefaciens strains containing the binary plasmid pGFPl-10.
Detection of plant plasma membrane and early endosomes
[00058] Plasma membranes or early endosomes were detected by transient expression with A. tumefaciens strains containing a binary plasmid pm-rb (37), which harbors T-DNA encoding a plasma membrane marker, or pXY01-SYP61-mC, which harbors T-DNA encoding the early endosome marker SYP61, respectively.
FM4-64 staining
[00059] FM4-64 (Invitrogen) was infiltrated into the underside of N. benthamiana leaves at a concentration of 25 μΜ in distilled water. Images were taken at 1 h post infiltration.
Transient transformation assay
[00060] A. tumefaciens EHA105 or mutant strains containing pQH121-mC, which harbors T-DNA encoding the mCherry, were infiltrated into wild type N. benthamiana leaves in low concentration (OD6oo=0.005). Images were obtained at 2 d post agroinfiltration and used for intensity calculation.
Stable transformation assay
[00061] A. thaliana wild type or mutant seeds (Col-0) were surface-sterilized using 15% bleach solution and incubated at 4 °C for 2 days. The seeds were then placed onto solidified l/2x MS medium (supplemented with 1% sucrose and 0.5 g L 1 MES, pH 5.8) and incubated under a photoperiod of 16 h light/8 h dark at 22 °C for 10- 12 days. Roots from individual seedlings were cut into 3-5 mm segments and mixed with 1 ml A. tumefaciens cells (A348 or mutant) at a concentration of 1 χ 108 cells/ml and spread onto a solidified 1/2* MS plate. The plates were subsequently incubated at 22 °C for 36 h. The root segments were aligned onto l/2x MS medium plates containing 100 μg mL"1 cefotaxime and kept at 22 °C for 5-6 weeks.
Chemical treatment
[00062] A. tumefaciens cells were grown and the cell concentrations were adjusted to ODeoo=0.5 in H2O; and ES I was added into the cell suspensions at a final concentration of 25 uM. The mixtures were then infiltrated into N. benthamiana leaves. As the control, A. tumefaciens cell suspensions in H2O were infiltrated into N. benthamiana leaves alone. The infiltrated plants were then placed at 22 °C under a photoperiod of 16 h light/8 h dark.
[00063] During a stable transformation assay, A. thaliana roots from individual seedlings were cut into 3-5 mm segments and mixed with ES I or Tyrphostin A23 (Sigma) at a final concentration of 60 μΜ or 50 uM respectively in H2O, the mixtures were then kept in dark for 3 h. As the control, the root fragments were treated with H2O alone. The root fragments were then mixed with A. tumefaciens for root transformation assay as described above.
In vitro pull-down assay
[00064] Fusion proteins were produced using BL21(DE3) E. coli strain. Single colonies of cells were inoculated into LB broth to grow overnight at 37 °C. The cell cultures were then diluted into fresh LB broth at ODeoo=0.1 and grown at 28 °C for another 1.5 hours until ODeoo=0.6. Expression of fusion proteins was then induced at 28 °C for 6 hours with Isopropyl beta-D-l-thiogalactopyranoside (IPTG) at a final concentration of 1 mM.
[00065] Bacterial cells were harvested by centrifugation at 5000 g at 4 °C for 5 min and washed once with Pull-Down Lysis Buffer (50 mM Tris«HCl, 50 mM NaCl, pH 7.5). The cells were then resuspended in Pull-Down Lysis Buffer containing protease inhibitor cocktail (Nacalai Tesque) and were subjected for brief sonication (12 bursts of 20 sec with 40% power). Cell debris was removed by centrifugation at 12000 g at 4 °C for 15 min.
[00066] The supernatant of bait proteins (MBP or MBP tagged proteins) were incubated with 150 μΐ of amylose resin (New England Biolabs) on a rotator at 4 °C for 3 h. The column was then washed 5 times with the Pull-Down Wash Buffer (50 mM Tris-HCl, 50 mM NaCl, 0.5% Triton X-100 pH 7.5). [00067] The supernatant of prey proteins (GST-tagged proteins) were added to the column containing the immobilized MBP-tagged bait protein and incubated on a rotator at 4 °C for overnight. The column was then washed 5 times with the Pull-Down Wash Buffer and captured proteins were eluted with the Pull-Down Lysis Buffer containing 10 mM maltose.
[00068] MBP-tagged proteins were detected by immunoblotting with anti-MBP antibody (sc-809, Santa Cruz Biotechnology) and GST-tagged proteins were detected by immunoblotting with anti-GST antibody (sc-459, Santa Cruz Biotechnology).
Confocal microscopy
[00069] A PerkinElmer Ultra View Vox Spinning Disk system with EM-CCD cameras was used for confocal microscopy. Agroinfiltrated N. benthamiana leaves were observed at 2 d post agroinfiltration unless specified otherwise. To observe leaf epidermis, agroinfiltrated leaf tissues were detached from N. benthamiana plants and immersed in H2O on a glass slide with a coverslip. All images were processed by Volocity® 3D Image Analysis Software 6.2.1. All images were obtained under confocal microscope with Olympus UPLSAPO 60 x N.A. 1.20 water immersion objective unless otherwise specified.
Quantification of fluorescence intensity
[00070] Fluorescence intensity was measured using ImageJ (http://rsbweb.nih.gov/ij/).
Statistical Analysis
[00071] Quantitative data are presented as means ± SEM from at least three independent experiments. When appropriate, statistical differences between groups were analyzed using an unpaired Student's t test. Differences were considered significant at P < 0.05.
Table 1. Strains and plasmids used in the present experiments.
Figure imgf000010_0001
A348-virE2(Y478A) A348 derivative, with a point mutation Y478A at virE2 This study
A348-virE2(Y472A A348 derivative, with point mutations Y472A and
This study Y478A) Y478A at virE2
Plasmids
A binary vector containing a plant plasma membrane
pm-rb (37) marker; Km' er-gb A binary vector containing a plant ER marker; Km1 (37)
A binary vector for target gene expression under the
pXYOl This study control of CaMV 35 S promoter; Km1 pXYOl derivative, with GFPl-10 coding sequence
pGFPl-10 This study under the control of CaMV 35S promoter; Km1 pXYOl derivative, with Hub coding sequence under the pXYOl-Hub This study control of CaMV 35 S promoter; Km1 pXYOl derivative, with SYP61-mCherry coding
pXY01-SYP61-mC sequence under the control of CaMV 35S promoter; This study
Km1 pCB301 A mini binary vector; Km' (59) pCB301 derivative, with T-DNA right border sequence pXY301 This study deleted; Km' pVB pXY301 derivative, with a VirB promoter region; Km' This study pVB derivative, with DsRed coding sequence under the pVB-RFP This study control of VirB promoter; Km' pVB-RFP derivative, with kanamycin resistance
pVBA-RFP cassette replaced by ampicillin resistance cassette; This study
Amp' pVB derivative, with GFP coding sequence under the
pVB-GFP This study control of VirB promoter; Km' pBim A binary vector; Km1 (62) pQH121 pBI121 derivative, with gusA deleted; Km' This study pQH121 derivative, with mCherry coding sequence
pQH121-mC This study
under the control of CaMV 35S promoter; Km1 pMAL-c2x MBP tag expression vector; Ampr New England Biolabs pMAL-c2x derivative, expressing MBP-AP2MC fusion
pMBP-AP2MC This study
protein; Ampr pGEX-4T-l GST tag expression vector; Ampr GE Healthcare pGEX-4T-l derivative, expressing MBP-VirE2C fusion
pGST-VirE2C This study
protein; Ampr pGEX-4T-l derivative, expressing MBP- pGST-VirE2C(Y488A) This study
VirE2C(Y488A) fusion protein; Ampr pGEX-4T-l derivative, expressing MBP- pGST-VirE2C(Y494A) This study
VirE2C(Y494A) fusion protein; Ampr pGST-VirE2C(Y488A pGEX-4T-l derivative, expressing MBP-
This study
/Y494A) VirE2C(Y488A /Y494A) fusion protein; Ampr
Example 1: Association of VirE2 with host plasma membrane upon delivery
[00072] To visualize VirE2 delivery, the VirE2-GFPl 1 fusion was expressed in A. tumefaciens and GFPl- 10 was expressed in plant cells. Upon delivery of VirE2-GFPl l into plant cells, VirE2-GFPComP fluorescence signals resulting from the complementation of VirE2-GFPl l and GFPl-10 were visualized (36).
[00073] First, the VirE2 delivery into tobacco cells was observed at the early stage; a T-DNA free strain EHA105 was used to avoid any potential complication due to T-DNA trafficking. A. tumefaciens EHA105 vz'r£2: :GFP11 producing VirE2-GFPl l was infiltrated into transgenic N. benthamiana (Nb308A) leaves expressing both GFPl-10 and DsRed. The VirE2 delivery into tobacco cells was examined under a confocol microscope at different time points. As shown in Fig. 1A, a small amount of VirE2 started to appear at tobacco cell borders at 32 hours after agroinfiltration (upper panel). As the time goes, more VirE2 was observed at the cell borders; the VirE2 signals became filamentous. Most of tobacco cells exhibited VirE2 accumulation in the nucleus at 48 hours after agroinfiltration (Fig. 1A lower panel). The data indicated that VirE2 first appeared at tobacco cell borders and then moved into the nucleus.
[00074] Subsequently the spacious positioning of A. tumefaciens cells inside plant tissues was determined. The bacterial cells were constructed to express GFP under the control of the virB promoter and thus they became fluorescently labeled naturally during agro-infiltration. After GFP-labeled A. tumefaciens cells EHA105(pAT- GFP) were infiltrated into N. benthamiana leaves, it was observed that most of the bacterial cells lined up at the intercellular space of agro-infiltrated tobacco cells (Fig. 2A). Then GFP-labeled bacterial cells were evenly mixed with DsRed-labeled bacterial cells; the mixture was infiltrated into the N. benthamiana leaves; it was observed that the bacterial cells tightly lined up at the intercellular spaces separately as single cells (Fig. 2B). These suggest that the limited intercellular spaces of N. benthamiana epidermal cells could only accommodate single bacterial cells and the space limitation might allow only the lateral side of the bacterium to closely contact with the host cell.
[00075] Then the relative positioning of A. tumefaciens cells and VirE2 delivered into plant cells was determined. Wild type N. benthamiana leaves were infiltrated with DsRed-labeled A. tumefaciens strain EHA105vjV£2::G P77(pGFPl-10 and pVBA-RFP), which is also capable of delivering VirE2-GFPl l and the T- DNA expressing GFPl-10. At 48 hours after agroinfiltration, VirE2 accumulated at the cytoplasmic sides of tobacco cells that are in a close contact with A. tumefaciens cells (Fig. IB). Interestingly, VirE2 was delivered into plant cells from both sides of the bacterial cells. This suggests that a single bacterium could deliver VirE2 into two neighboring host cells simultaneously.
[00076] To determine the subcellular location of Agrobacterium-dehvered VirE2 inside host cells, a specific plant plasma membrane tracker was expressed inside plant cells by T-DNA delivered by the same bacterial cells delivering VirE2-GFPl l (37). It was found that Agrobacterium-dehvered VirE2 co-localized with the transiently expressed plasma membrane tracker (Fig. 1C), suggesting that VirE2 was associated with plant cytoplasmic membrane upon the delivery.
Example 2: Association of Agrobacterium -delivered VirE2 with endoc tic vesicles
[00077] To investigate how the membrane-bound VirE2 moved into the cytoplasm, a fluorescent styryl dye FM4-64 was used to label the membranes and then monitor the dynamics (38). This dye is lipophilic; it can label membranes where it is applied, but it cannot penetrate the membranes by itself. This property would allow us to monitor the trafficking process of VirE2-bound membranes. A. tumefaciens EHA105virE2::GFPll cells were infiltrated into N. benthamiana leaves to start the VirE2 delivery; 48 h later the FM4-64 dye was then infiltrated into the same areas. As shown in Fig. ID, VirE2 was co-localized with FM4-64-labeled plasma membranes (upper panel), in a manner similar to using plasma membrane tracker (Fig. 1C). Interestingly, VirE2 was also co- localized with FM4-64-labeled endocytic vesicles, which pinched off from the plasma membranes (Fig. ID lower panel).
[00078] Moreover, the co-localization of VirE2 with FM4-64-labeled endocytic vesicles continued even when FM4-64-labeled vesicles moved inside the cytoplasm (Fig. 3). The speed of the movement ranged from 0.4 to 2.1 urn/sec, which is consistent with the endosome dynamics as reported in previous studies (39). The data suggest that VirE2 delivered onto host plasma membranes might utilize the host endocytosis for cellular internalization and cytoplasmic movement.
Example 3: Endocytosis is required for efficient VirE2 trafficking
[00079] Subsequently, it was examined whether host endocytosis process was required for the internalization of VirE2 protein. It has been reported that plant endocytosis process is mediated by clathrin triskelions (40); overexpression of a C-terminal part of clathrin heavy chain (Hub) that could bind to and deplete clathrin light chain would lead to strong dominant-negative effects on clathrin-mediated endocytosis (CME) (41- 43).
[00080] We then tested the effect of Hub overexpression in N. benthamiana leaves; the FM4-64 dye was used to monitor the general endocytosis process. It was found that transient expression of Hub under CaMV 35S promoter dramatically decreased the internalization of FM4-64 dye (Fig. 5). This suggests that a dominant negative strategy using Hub could indeed affect the endocytosis process in N. benthamiana epidermal cells. Interestingly, it was found that Hub overexpression increased VirE2 accumulation at cell borders (Fig. 4 A and B). A time-course experiment demonstrated that VirE2 stayed much longer at the cell borders in the tobacco cells over-expressing Hub as compared to the control (Fig. 6). These indicate that functional clathrin and active CME process were required for VirE2 departure from plant cellular membrane.
[00081] To confirm that host endocytosis is important for VirE2 trafficking, a chemical inhibitor endosidinl (ES I) was used to interfere with the endocytosis process, as ES I affected the endocytosis pathway and caused aggregation of early endosomes in Arabidopsis thaliana (44). SYP61-mCherry was used to label the highly dynamic round-shaped early endosomes (44, 45); it was transiently expressed in N. benthamiana epidermal cells that were treated with ES I. It was found that ESI treatment caused abnormal aggregation of SYP61-mCherry marker (Fig. 7A), indicating aggregation of early endosomes in leaf epidermal cells. Interestingly, ES I treatment caused abnormal VirE2 trafficking in host cytoplasm; VirE2 was accumulated inside the ESI -induced endosome aggregates (Fig. 7B). This indicated that ES I interfered with host endocytosis and restricted the VirE2 movement.
[00082] Then the effect of ESI on nuclear targeting of VirE2 was tested, as it was shown previously that Agrobacterium-delivered VirE2 was efficiently targeted to plant nucleus in a nuclear localization signal (NLS)- dependent manner (36). As shown in Fig. 4 C and D, ES I treatment dramatically decreased the nuclear accumulation of VirE2 inside tobacco cells, while VirE2 accumulated at the cell borders or inside cytoplasm. This indicates that ES I affected VirE2 trafficking rather than delivery or oligomerization of VirE2. Taken together, these findings indicate that host endocytosis played an important role in the cytoplasmic trafficking and subsequent nuclear targeting of VirE2 inside plant cells.
Example 4: Endocytosis is required for AMT process
[00083] To confirm the importance of endocytosis, the effects of chemical inhibitors on Agrobacterium- mediated transformation (AMT) were studied, as functional VirE2 is required for the transformation process. Tumorigenesis assays were conducted using A. thaliana roots treated with either ESI or Tyrphostin A23, which is also a CME inhibitor for A. thaliana (46). As shown in Fig. 4 E and F, treatment with ES I or Tyrphostin A23 significantly attenuated the tumorigenesis. These results suggest that interference with host endocytosis could attenuate the stable transformation of plant cells, presumably because a blocked endocytosis affected VirE2 movement and thus its role in AMT.
Example 5: Dual endocytic motifs at C-terminal tail of VirE2 are required for VirE2 trafficking
[00084] Subsequently, it was investigated how VirE2 was selected as a cargo for internalization. In general, selection of plasma membrane associated cargo proteins for internalization depends upon the recognition of endocytic signals at the cytosolic side of cargo proteins by a variety of host adaptors (47, 48). Upon delivery into host plant cells through T4SS, VirE2 might interact with one of host adaptor proteins at the plasma membrane. Sequence analysis indicated that the VirE2 (accession no. AAZ50538) contained 5 putative endocytic sorting motifs (Fig. 8A).
[00085] To test the importance of these putative motifs for VirE2 trafficking, the potential critical leucine or tyrosine residue for each of the dileucine-based or tyrosine-based motifs (49) were mutated to alanine. In addition, a double mutant was constructed for the two tyrosine-based motifs of spatial proximity at the C-terminus (Fig. 8A). Then the cellular localization and distribution of Agrobacterium-delivered VirE2 for each of the mutants was tested. Neither single mutation nor double mutation of the dual C-terminal tyrosine-based motifs affected the VirE2 delivery to host cellular membrane (Fig. 8 B and C); however, the double mutation caused a significantly higher level of VirE2 accumulation at the membrane sites (Fig. 8C). Mutations at other putative endocytic motifs of VirE2 did not affect the VirE2 delivery or internalization (Fig. 9). The results suggest that the putative dual C- terminal tyrosine-based motifs were important for the VirE2 trafficking.
Example 6: Dual endocytic motifs at C-terminal tail of VirE2 are required for AMT
[00086] To determine if the dual C-terminal tyrosine-based motifs are required for VirE2 function, assays for transient expression of mCherry under the control of a CaMV 35S promoter on T-DNA after AMT were conducted. The mCherry expression was analyzed based on the fluorescence intensity due to VirE2 mutations at the dual C-terminal endocytic signals. As shown in Fig. 8 D and E, both single and double mutations at the dual C- terminal endocytic signals significantly decreased the transient AMT efficiency, although the effect of a double mutation (Y488A/Y494A) was more dramatic than the single mutation Y494A, which affected the function more than Y488A. These suggest that the dual C-terminal endocytic signals were required for VirE2 function and the last endocytic signal at the VirE2 terminus was more important.
[00087] Sequence alignment analysis indicated that the dual C-terminal tyrosine-based endocytic motifs were conserved on VirE2 proteins from different Ti plasmids, suggesting their conserved roles in different Agrobacterium strains (Fig. 10). Moreover, mutations at these conserved motifs on VirE2 from the virulent strain A348 also attenuated tumor formation on Arabidopsis root fragments (Fig. 8 F and G). The results demonstrated that the dual tyrosine-based endocytic signals located at the VirE2 C-terminus were important for VirE2 function for both transient and stable AMT process.
Example 7: Endocytic motifs at VirE2 C-terminus interact with plant AP2M [00088] The above results led us to hypothesize that the dual C-terminal tyrosine-based endocytic motifs of VirE2 might be recognized by a clathrin-associated sorting protein, since clathrin-mediated endocytosis process is facilitated by a group of host adaptors known as "clathrin-associated sorting proteins", which are responsible for endocytic signal recognition and cargo binding (47, 48). Among them, the adaptor protein 2 (AP-2) complex recognizes the tyrosine-based endocytic signal and binds to it through the C-terminal domain of μ-subunit (AP2M) (50).
[00089] To test a potential interaction of VirE2 with AP-2 complex, an in vitro pull down assay with their fusion proteins was conducted. As shown in Fig. 11 A, when the C-terminal tail of VirE2 was fused onto GST (GST-VirE2C), it interacted with the cargo binding domain of AP2M that was fused onto MBP (MBP-AP2MC). However, a double mutation at the dual tyrosine-based endocytic signals eliminated the interaction (Fig. 11B). These results suggest that the AP2M recognizes and binds to VirE2 C-terminal tail through the dual tyrosine-based sorting motifs.
Example 8: ap2m mutations attenuates tumorigenesis
[00090] To further confirm the importance of host AP-2 complex in AMT process, two insertional mutants of A. thaliana AP2M were tested for tumorigenesis. As shown in Fig. 11 C and D, both two insertional mutants of AP-2M displayed significantly attenuated tumor formation, as compared to the wild type control. These demonstrated that the host AP-2 complex was indeed required for Agrobacterium-mediated transformation of plant cells.
[00091] The invention has been described broadly and generically herein. Each of the narrower species and subgeneric groupings falling within the generic disclosure also form part of the invention. This includes the generic description of the invention with a proviso or negative limitation removing any subject-matter from the genus, regardless of whether or not the excised material is specifically recited herein. Other embodiments are within the following claims. In addition, where features or aspects of the invention are described in terms of Markush groups, those skilled in the art will recognize that the invention is also thereby described in terms of any individual member or subgroup of members of the Markush group.
[00092] One skilled in the art would readily appreciate that the present invention is well adapted to carry out the objects and obtain the ends and advantages mentioned, as well as those inherent therein. Further, it will be readily apparent to one skilled in the art that varying substitutions and modifications may be made to the invention disclosed herein without departing from the scope and spirit of the invention. The compositions, methods, procedures, treatments, molecules and specific compounds described herein are presently representative of preferred embodiments are exemplary and are not intended as limitations on the scope of the invention. Changes therein and other uses will occur to those skilled in the art which are encompassed within the spirit of the invention are defined by the scope of the claims. The listing or discussion of a previously published document in this specification should not necessarily be taken as an acknowledgement that the document is part of the state of the art or is common general knowledge.
[00093] The invention illustratively described herein may suitably be practiced in the absence of any element or elements, limitation or limitations, not specifically disclosed herein. Thus, for example, the terms "comprising", "including", "containing", etc. shall be read expansively and without limitation. The word "comprise" or variations such as "comprises" or "comprising" will accordingly be understood to imply the inclusion of a stated integer or groups of integers but not the exclusion of any other integer or group of integers. Additionally, the terms and expressions employed herein have been used as terms of description and not of limitation, and there is no intention in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the invention claimed. Thus, it should be understood that although the present invention has been specifically disclosed by exemplary embodiments and optional features, modification and variation of the inventions embodied therein herein disclosed may be resorted to by those skilled in the art, and that such modifications and variations are considered to be within the scope of this invention.
[00094] The content of all documents and patent documents cited herein is incorporated by reference in their entirety. REFERENCES
1. M. D. Chilton, M. H. Drummond, D. J. Merio, D. Sciaky, A. L. Montoya, M. P. Gordon, E. W. Nester, Stable incorporation of plasmid DNA into higher plant cells: the molecular basis of crown gall tumorigenesis. Cell 11, 263 (1977).
2. P. Zambryski, M. Holsters, K. Kruger, A. Depicker, J. Schell, M. Van Montagu, H. M. Goodman, Tumor DNA structure in plant cells transformed by A. tumefaciens. Science 209, 1385 (1980).
3. L. M. Albright, M. F. Yanofsky, B. Leroux, D. Q. Ma, E. W. Nester, Processing of the T-DNA of Agrobacterium tumefaciens generates border nicks and linear, single-stranded T-DNA. /. Bacteriol. 169, 1046 (1987).
4. P. Bundock, A. den Dulk-Ras, A. Beijersbergen, P. J. Hooykaas, Trans-kingdom T-DNA transfer from Agrobacterium tumefaciens to Saccharomyces cerevisiae. EMBO J. 14, 3206 (1995).
5. K. L. Piers, J. D. Heath, X. Liang, K. M. Stephens, E. W. Nester, Agrobacterium tumefaciens-mediated transformation of yeast. Proc. Natl. Acad. Sci. U. S. A. 93, 1613 (1996).
6. M. J. de Groot, P. Bundock, P. J. Hooykaas, A. G. Beijersbergen, Agrobacterium tumefaciens-mediated transformation of filamentous fungi. Nat. Biotechnol. 16, 839 (1998).
7. S. Kathiresan, A. Chandrashekar, G. A. Ravishankar, R. Sarada, Agrobacterium-Mediated Transformation in the Green Alga Haematococcus Pluvialis (Chlorophyceae, Volvocales)(l). /. Phycol. 45, 642 (2009).
8. T. Kunik, T. Tzfira, Y. Kapulnik, Y. Gafni, C. Dingwall, V. Citovsky, Genetic transformation of HeLa cells by Agrobacterium. Proc. Natl. Acad. Sci. U. S. A. 98, 1871 (2001).
9. T. Tzfira, V. Citovsky, Agrobacterium-mediated genetic transformation of plants: biology and biotechnology. Curr. Opin. Biotechnol. 17, 147 (2006).
10. C. B. Michielse, P. J. Hooykaas, C. A. van den Hondel, A. F. Ram, Agrobacterium-mediated
transformation as a tool for functional genomics in fungi. Curr. Genet. 48, 1 (2005).
11. K. J. Fullner, J. C. Lara, E. W. Nester, Pilus assembly by Agrobacterium T-DNA transfer genes. Science 273, 1107 (1996).
12. E. Cascales, P. J. Christie, Definition of a bacterial type IV secretion pathway for a DNA substrate.
Science 304, 1170 (2004).
13. A. Beijersbergen, A. D. Dulk-Ras, R. A. Schilperoort, P. J. Hooykaas, Conjugative Transfer by the Virulence System of Agrobacterium tumefaciens. Science 256, 1324 (1992).
14. H. H. Low, F. Gubellini, A. Rivera-Calzada, N. Braun, S. Connery, A. Dujeancourt, F. Lu, A. Redzej, R. Fronzes, E. V. Orlova, G. Waksman, Structure of a type IV secretion system. Nature 508, 550 (2014).
15. E. Cascales, P. J. Christie, The versatile bacterial type IV secretion systems. Nat. Rev. Microbiol. 1, 137 (2003).
16. V. Chandran Darbari, G. Waksman, Structural Biology of Bacterial Type IV Secretion Systems. Annu. Rev. Biochem. 84, 603 (2015).
17. P. J. Christie, K. Atmakuri, V. Krishnamoorthy, S. Jakubowski, E. Cascales, Biogenesis, architecture, and function of bacterial type IV secretion systems. Annu. Rev. Microbiol. 59, 451 (2005).
18. A. C. Vergunst, B. Schrammeijer, A. den Dulk-Ras, C. M. de Vlaam, T. J. Regensburg-Tuink, P. J.
Hooykaas, VirB/D4-dependent protein translocation from Agrobacterium into plant cells. Science 290, 979 (2000).
19. A. C. Vergunst, M. C. van Lier, A. den Dulk-Ras, T. A. Stuve, A. Ouwehand, P. J. Hooykaas, Positive charge is an important feature of the C-terminal transport signal of the VirB/D4-translocated proteins of
Agrobacterium. Proc. Natl. Acad. Sci. U. S. A. 102, 832 (2005).
20. B. Schrammeijer, A. den Dulk-Ras, A. C. Vergunst, E. Jurado Jacome, P. J. Hooykaas, Analysis of Vir protein translocation from Agrobacterium tumefaciens using Saccharomyces cerevisiae as a model: evidence for transport of a novel effector protein VirE3. Nucleic Acids Res. 31, 860 (2003).
21. S. B. Gelvin, Plant proteins involved in Agrobacterium-mediated genetic transformation. Annu. Rev. Phytopathol. 48, 45 (2010).
22. K. Wang, L. Herrera-Estrella, M. Van Montagu, P. Zambryski, Right 25 bp terminus sequence of the nopaline T-DNA is essential for and determines direction of DNA transfer from Agrobacterium to the plant genome. Cell 38, 455 (1984).
23. M. F. Yanofsky, S. G. Porter, C. Young, L. M. Albright, M. P. Gordon, E. W. Nester, The virD operon of Agrobacterium tumefaciens encodes a site-specific endonuclease. Cell 47, 471 (1986).
24. P. Scheiffele, W. Pansegrau, E. Lanka, Initiation of Agrobacterium tumefaciens T-DNA processing. Purified proteins VirD 1 and VirD2 catalyze site- and strand-specific cleavage of superhelical T-border DNA in vitro. J. Biol. Chem. 270, 1269 (1995). 25. P. J. Christie, J. E. Ward, S. C. Winans, E. W. Nester, The Agrobacterium tumefaciens virE2 gene product is a single-stranded-DNA-binding protein that associates with T-DNA. /. Bacteriol. 170, 2659 (1988).
26. V. Citovsky, M. L. Wong, P. Zambryski, Cooperative interaction of Agrobacterium VirE2 protein with single-stranded DNA: implications for the T-DNA transfer process. Proc. Natl. Acad. Sci. U. S. A. 86, 1193 (1989).
27. P. Sen, G. J. Pazour, D. Anderson, A. Das, Cooperative binding of Agrobacterium tumefaciens VirE2 protein to single- stranded DNA. /. Bacteriol. 171, 2573 (1989).
28. S. Bhattacharjee, L. Y. Lee, H. Oltmanns, H. Cao, Veena, J. Cuperus, S. B. Gelvin, IMPa-4, an
Arabidopsis importin alpha isoform, is preferentially involved in Agrobacterium-mediated plant transformation. Plant Cell 20, 2661 (2008).
29. F. Dumas, M. Duckely, P. Pelczar, P. Van Gelder, B. Hohn, An Agrobacterium VirE2 channel for transferred-DNA transport into plant cells. Proc. Natl. Acad. Sci. U. S. A. 98, 485 (2001).
30. L. Rossi, B. Hohn, B. Tinland, Integration of complete transferred DNA units is dependent on the activity of virulence E2 protein of Agrobacterium tumefaciens. Proc. Natl. Acad. Sci. U. S. A. 93, 126 (1996).
31. V. M. Yusibov, T. R. Steck, V. Gupta, S. B. Gelvin, Association of single-stranded transferred DNA from Agrobacterium tumefaciens with tobacco cells. Proc. Natl. Acad. Sci. U. S. A. 91, 2994 (1994).
32. T. Tzfira, M. Vaidya, V. Citovsky, VIPl, an Arabidopsis protein that interacts with Agrobacterium VirE2, is involved in VirE2 nuclear import and Agrobacterium infectivity. EMBO J. 20, 3596 (2001).
33. A. Djamei, A. Pitzschke, H. Nakagami, I. Rajh, H. Hirt, Trojan horse strategy in Agrobacterium transformation: abusing MAPK defense signaling. Science 318, 453 (2007).
34. J. Li, A. Krichevsky, M. Vaidya, T. Tzfira, V. Citovsky, Uncoupling of the functions of the Arabidopsis VIPl protein in transient and stable plant genetic transformation by Agrobacterium. Proc. Natl. Acad. Sci. U. S. A. 102, 5733 (2005).
35. A. Anand, A. Krichevsky, S. Schornack, T. Lahaye, T. Tzfira, Y. Tang, V. Citovsky, K. S. Mysore, Arabidopsis VIRE2 INTERACTING PROTEIN2 is required for Agrobacterium T-DNA integration in plants. Plant Cell 19, 1695 (2007).
36. X. Li, Q. Yang, H. Tu, Z. Lim, S. Q. Pan, Direct visualization of Agrobacterium-de vered VirE2 in recipient cells. Plant J. 77, 487 (2014).
37. B. K. Nelson, X. Cai, A. Nebenfuhr, A multicolored set of in vivo organelle markers for co-localization studies in Arabidopsis and other plants. Plant J. 51, 1126 (2007).
38. N. Geldner, N. Anders, H. Wolters, J. Keicher, W. Kornberger, P. Muller, A. Delbarre, T. Ueda, A.
Nakano, G. Jurgens, The Arabidopsis GNOM ARF-GEF mediates endosomal recycling, auxin transport, and auxin-dependent plant growth. Cell 112, 219 (2003).
39. A. Maizel, D. von Wangenheim, F. Federici, J. Haseloff, E. H. Stelzer, High-resolution live imaging of plant growth in near physiological bright conditions using light sheet fluorescence microscopy. Plant J. 68, 377 (2011).
40. H. T. McMahon, E. Boucrot, Molecular mechanism and physiological functions of clathrin-mediated endocytosis. Nat. Rev. Mol. Cell Biol. 12, 517 (2011).
41. S. H. Liu, M. L. Wong, C. S. Craik, F. M. Brodsky, Regulation of clathrin assembly and trimerization defined using recombinant triskelion hubs. Cell 83, 257 (1995).
42. S. Kitakura, S. Vanneste, S. Robert, C. Lofke, T. Teichmann, H. Tanaka, J. Friml, Clathrin mediates endocytosis and polar distribution of PIN auxin transporters in Arabidopsis. Plant Cell 23, 1920 (2011).
43. P. Dhonukshe, F. Aniento, I. Hwang, D. G. Robinson, J. Mravec, Y. D. Stierhof, J. Friml, Clathrin- mediated constitutive endocytosis of PIN auxin efflux carriers in Arabidopsis. Curr. Biol. 17, 520 (2007).
44. S. Robert, S. N. Chary, G. Drakakaki, S. Li, Z. Yang, N. V. Raikhel, G. R. Hicks, Endosidinl defines a compartment involved in endocytosis of the bras sino steroid receptor BRI1 and the auxin transporters PIN2 and AUX1. Proc. Natl. Acad. Sci. U. S. A. 105, 8464 (2008).
45. O. Foresti, J. Denecke, Intermediate organelles of the plant secretory pathway: identity and function. Traffic 9, 1599 (2008).
46. D. N. Banbury, J. D. Oakley, R. B. Sessions, G. Banting, Tyrphostin A23 inhibits internalization of the transferrin receptor by perturbing the interaction between tyrosine motifs and the medium chain subunit of the AP- 2 adaptor complex. /. Biol. Chem. 278, 12022 (2003).
47. J. S. Bonifacino, L. M. Traub, Signals for sorting of transmembrane proteins to endosomes and lysosomes. Annu. Rev. Biochem. 72, 395 (2003).
48. L. M. Traub, Tickets to ride: selecting cargo for clathrin-regulated internalization. Nat. Rev. Mol. Cell Biol. 10, 583 (2009). 49. L. M. Traub, J. S. Bonifacino, Cargo recognition in clathrin-mediated endocytosis. Cold Spring Harb. Perspect. Biol. 5, a016790 (2013).
50. L. P. Jackson, B. T. Kelly, A. J. McCoy, T. Gaffry, L. C. James, B. M. Collins, S. Honing, P. R. Evans, D. J. Owen, A large-scale conformational change couples membrane recruitment to cargo binding in the AP2 clathrin adaptor complex. Cell 141, 1220 (2010).
51. M. De Cleene, J. De Ley, The host range of crown gall. The Botanical Review 42, 389 (1976).
52. B. Lacroix, T. Tzfira, A. Vainstein, V. Citovsky, A case of promiscuity: Agrobacterium 's endless hunt for new partners. Trends Genet. 22, 29 (2006).
53. L. Otten, H. De Greve, J. Leemans, R. Hain, P. Hooykaas, J. Schell, Restoration of virulence of Vir region mutants oi Agrobacterium tumefaciens strain B6S3 by coinfection with normal and mutant Agrobacterium strains. Mol Gen Genet. 195, 159-163 (1984).
54. J. Aguilar, J. Zupan, T. A. Cameron, P. C. Zambryski, Agrobacterium type IV secretion system and its substrates form helical arrays around the circumference of virulence-induced cells. Proc. Natl. Acad. Sci. U. S. A. 107, 3758 (2010).
55. L. G. Wu, E. Hamid, W. Shin, H. C. Chiang, Exocytosis and endocytosis: modes, functions, and coupling mechanisms. Annu. Rev. Physiol. 76, 301 (2014).
56. J. Mercer, M. Schelhaas, A. Helenius, Virus entry by endocytosis. Annu. Rev. Biochem. 79, 803 (2010).
57. M. Bar, A. Avni, Endosomal trafficking and signaling in plant defense responses. Curr. Opin. Plant Biol. 22, 86 (2014).
58. X. Chen, N. G. Irani, J. Friml, Clathrin-mediated endocytosis: the gateway into plant cells. Curr. Opin. Plant Biol. 14, 674 (2011).
59. C. Xiang, P. Han, I. Lutziger, K. Wang, D. J. Oliver, A mini binary vector series for plant transformation. Plant Mol. Biol. 40, 711-717 (1999).
60. E. E. Hood, S. B. Gelvin, L. S. Melchers, A. Hoekema, New Agrobacterium helper plasmids for gene transfer to plants. Transgenic Res. 2, 208-218 (1993).
61. V. C. Knauf, E. W. Nester, Wide host range cloning vectors: a cosmid clone bank of an Agrobacterium Ti plasmid. Plasmid 8, 45-54 (1982).
62. P. Y. Chen, C. K. Wang, S. C. Soong, K. Y. To, Complete sequence of the binary vector pBI121 and its application in cloning T-DNA insertion from transgenic plants. Mol. Breed. 11, 287-293 (2003).

Claims

1. Peptide comprising or consisting of (i) the amino acid sequence of SEQ ID NO: l or (ii) an amino acid sequence having at least 80% sequence identity to the amino acid sequence of SEQ ID NO: l over its entire length.
2. The peptide according to claim 1, wherein said peptide is 10 to 200 amino acids in length.
3. Conjugate comprising a peptide according to claims 1 or 2, wherein said peptide further comprises at least one functional moiety.
4. The conjugate according to claim 3, wherein said at least one functional moiety is conjugated to the N- terminus of said peptide.
5. The conjugate according to claim 3, wherein said at least one functional moiety is conjugated to the C- terminus of said peptide.
6. The conjugate according to claim 4, with the proviso that said at least one functional moiety does not comprise the amino acid sequence set forth in SEQ ID NO:2 or a C-terminal fragment thereof.
7. The conjugate according to claim 5, with the proviso that said at least one functional moiety does not comprise the amino acid sequence set forth in SEQ ID NO:3 or an N-terminal fragment thereof.
8. The conjugate according to any one of claims 3 to 7, wherein the functional moiety is a pharmaceutically or biologically active compound.
9. The conjugate according to any one of claims 3 to 8, wherein the functional moiety further comprises or is the green fluorescent protein (GFP) or a fragment thereof.
10. The conjugate according to any one of claims 3 to 9, wherein said conjugate further comprises at least one moiety for translocation into a cell.
11. The conjugate according to claim 10, wherein said moiety for translocation into cells is the C-terminal sequence of VirE2.
12. The conjugate according to claim 10, wherein said moiety for translocation into a cell is a cell-penetrating peptide or agent.
13. A vector comprising a nucleotide sequence encoding the peptide according to claim 1 or 2.
14. A host cell comprising the vector according to claim 13.
15. A bio-imaging system for visualization of internalization comprising
(a) a conjugate according to any one of claims 3 to 12 which is conjugated to a first GFP fragment; and
(b) a cell which expresses a second GFP fragment,
wherein the first GFP fragment and the second GFP fragment can assemble to form a functional GFP.
16. The bio-imaging system according to claim 15, wherein
(a) the conjugate of (a) is conjugated to a peptide according to SEQ ID NO:5; and/or
(b) the cell expresses a peptide according to SEQ ID NO:6.
17. The bio-imaging system according to claim 15 or 16, wherein the cell is selected from the group consisting of a plant cell, yeast cell, fungi, algae or cultured mammalian cell.
18. The bio-imaging system according to claim 17, wherein the cell is a plant cell.
19. The bio-imaging system according to any one of claims 15 to 18, wherein the cell expresses the clathrin- associated adaptor AP2 complex (AP2M).
20. A method to visualize internalization comprising:
providing the bio-imaging system according to any one of claims 15 to 19; and
contacting the conjugate of claim 16(a) and the cell of claim 16(b).
21. A method to internalize a drug into a cell comprising:
providing the conjugate according to any of claims 8 to 12 and a cell; and
contacting the conjugate and the cell.
22. The conjugate according to any of claims 8 to 12 for use as a medicament.
23. Use of the conjugate according to any of claims 8 to 12 as a research reagent.
PCT/SG2017/050533 2016-10-24 2017-10-24 Compounds and methods to target a molecule to a specific cellular location Ceased WO2018080396A2 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201780065902.5A CN110036021B (en) 2016-10-24 2017-10-24 Compounds and methods for targeting molecules to specific cellular locations

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
SG10201608928QA SG10201608928QA (en) 2016-10-24 2016-10-24 Compounds and methods to target a molecule to a specific cellular location
SG10201608928Q 2016-10-24

Publications (2)

Publication Number Publication Date
WO2018080396A2 true WO2018080396A2 (en) 2018-05-03
WO2018080396A3 WO2018080396A3 (en) 2018-09-27

Family

ID=62025316

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/SG2017/050533 Ceased WO2018080396A2 (en) 2016-10-24 2017-10-24 Compounds and methods to target a molecule to a specific cellular location

Country Status (3)

Country Link
CN (1) CN110036021B (en)
SG (1) SG10201608928QA (en)
WO (1) WO2018080396A2 (en)

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE10254167A1 (en) * 2002-11-20 2004-06-09 Icon Genetics Ag Process for the control of cellular processes in plants
US8053638B2 (en) * 2006-08-07 2011-11-08 The Samuel Roberts Noble Foundation Method for agrobacterium-mediated transformation of plants

Also Published As

Publication number Publication date
CN110036021A (en) 2019-07-19
WO2018080396A3 (en) 2018-09-27
CN110036021B (en) 2023-04-11
SG10201608928QA (en) 2018-05-30

Similar Documents

Publication Publication Date Title
Pitzschke et al. New insights into an old story: Agrobacterium-induced tumour formation in plants by plant transformation
Gordon et al. The agrobacterium Ti plasmids
Li et al. Agrobacterium delivers VirE2 protein into host cells via clathrin-mediated endocytosis
Tzfira et al. VIP1, an Arabidopsis protein that interacts with Agrobacterium VirE2, is involved in VirE2 nuclear import and Agrobacterium infectivity
Zottini et al. Agroinfiltration of grapevine leaves for fast transient assays of gene expression and for long-term production of stable transformed cells
Li et al. Direct visualization of A grobacterium‐delivered V ir E 2 in recipient cells
Gelvin Finding a way to the nucleus
Tenea et al. Overexpression of several Arabidopsis histone genes increases Agrobacterium-mediated transformation and transgene expression in plants
KR20110009197A (en) Bacterial toxin vaccine
AU2010360293B2 (en) Molecular interaction between Xa10 and AvrXa10
CN101628941B (en) Bovine lactoferrin antibacterial peptide fusion protein, coding gene and application thereof
US11279941B2 (en) Method for introducing protein into plant cell
Tu et al. Real-time trafficking of Agrobacterium virulence protein VirE2 inside host cells
CN110036021B (en) Compounds and methods for targeting molecules to specific cellular locations
US10526611B2 (en) Gene targeting using mutant Agrobacterium strains
US20160369286A1 (en) Compositions and methods for galls fl and galls ct mediated transformation of plants
Zakharchenko et al. Use of the gene of antimicrobial peptide cecropin P1 for producing marker-free transgenic plants
Roushan et al. Visualization of virulence protein translocation from Agrobacterium to yeast and plant cells using the split GFP approach
Pant Cytoplasmic Sorting and Transport of Agrobacterium-Delivered Vire2 Inside Plant Cells
Roushan et al. Targeting Agrobacterium tumefaciens virulence proteins into the organelles of plant and yeast cells
Citovsky Agrobacterium Induces Expression of a Host F-Box Protein Required for Tumorigenicity
Gordon et al. The Agrobacterium Ti Plasmids 17
DEYING Identification and characterization of host factors important for Agrobacterium-eukaryote gene transfer
Hooykaas Visualization of VirE2 protein translocation by the Agrobacterium type IV secretion system into host cells
Matsuoka Genetic engineering of Agrobacterium tumefaciens to target chloroplasts and identification of a novel nuclear localization signal of VIRD2 protein

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17864553

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 17864553

Country of ref document: EP

Kind code of ref document: A2