WO2018053507A2 - Production de produits sesquiterpènes et de molécules associées - Google Patents

Production de produits sesquiterpènes et de molécules associées Download PDF

Info

Publication number
WO2018053507A2
WO2018053507A2 PCT/US2017/052266 US2017052266W WO2018053507A2 WO 2018053507 A2 WO2018053507 A2 WO 2018053507A2 US 2017052266 W US2017052266 W US 2017052266W WO 2018053507 A2 WO2018053507 A2 WO 2018053507A2
Authority
WO
WIPO (PCT)
Prior art keywords
cell
synthase
acid sequence
recombinant
seq
Prior art date
Application number
PCT/US2017/052266
Other languages
English (en)
Other versions
WO2018053507A3 (fr
Inventor
Bryan Julien
Richard Burlingame
Craig Warren
Original Assignee
Evolva Sa
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Evolva Sa filed Critical Evolva Sa
Publication of WO2018053507A2 publication Critical patent/WO2018053507A2/fr
Publication of WO2018053507A3 publication Critical patent/WO2018053507A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P15/00—Preparation of compounds containing at least three condensed carbocyclic rings
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P5/00—Preparation of hydrocarbons or halogenated hydrocarbons
    • C12P5/007—Preparation of hydrocarbons or halogenated hydrocarbons containing one or more isoprene units, i.e. terpenes

Definitions

  • This disclosure relates to genetic engineering and recombinant host cells useful in producing sesquiterpene products by increasing production and/or accumulation of sesquiterpene products through epi-isozizaene synthase, thujopsene terpene synthase, and/or longifolene synthase.
  • the recombinant host cells provided by the invention generally have higher metabolic flux through the mevalonate biochemical pathway, and can comprise additional recombinant expression constructs encoding epi-isozizaene synthase, thujopsene terpene synthase, longifolene synthase and other enzymes useful for increasing sesquiterpene products downstream of the mevalonate pathway, particularly epi-isozizaene, thujopsene, and/or longifolene.
  • Epi-isozizaene, thujopsene, longifolene, barbatene and related molecules comprise a large class of biologically derived organic molecules produced only in plants or bacterium, and only in small quantities.
  • Epi-isozizaene, thujopsene, longifolene, barbatene and related molecules are derived from the fifteen-carbon precursor famesyl pyrophosphate (FPP).
  • FPP serves as precursor in the biosynthesis of a number of biologically and commercially important molecules including valencene, squalene, ubiquinone, sterol, heme A and dolichol.
  • the present invention comprises methods for increased production of epi-isozizaene, thujopsene, longifolene and related molecules, advantageously in recombinant host cells resulting from overexpression of epi-isozizaene synthase, thujopsene terpene synthase, longifolene synthase and increasing production of farnesyl pyrophosphate (FPP) and other mevalonate pathway precursors.
  • FPP farnesyl pyrophosphate
  • the invention relates to methods for increasing the production and/or accumulation of epi-isozizaene, thujopsene, longifolene, barbatene in recombinant host cells.
  • the invention relates to a method for producing a sesquiterpene product or sesquiterpenoid in a recombinant host cell, the method comprising the steps of: culturing a recombinant host cell comprising one or more recombinant nucleic acids encoding heterologous enzymes for producing the sesquiterpene product or sesquiterpenoid under conditions wherein the sesquiterpene product or sesquiterpenoid is produced, wherein the recombinant host cell has reduced expression or activity of an endogenous squalene synthase.
  • the one or more recombinant nucleic acids encoding heterologous enzymes for producing the sesquiterpene product or sesquiterpenoid is epi- isozizaene synthase, thujopsene terpene synthase, or longifolene synthase.
  • the epi-isozizaene synthase comprises an amino acid sequence having at least 85% identity to the amino acid sequence set forth in SEQ ID NO:08
  • the thujopsene terpene synthase comprises an amino acid sequence having at least 85% identity to the amino acid sequence set forth in SEQ ID NO:06
  • the longifolene synthase comprises an amino acid sequence having at least 85% identity to the amino acid sequence set forth in SEQ ID NO:07.
  • the recombinant host cell is genetically engineered to reduce activity of the endogenous squalene synthase.
  • the invention in a second aspect, relates to a recombinant cell for producing a sesquiterpene product or sesquiterpenoid genetically engineered to have reduced expression or activity of an endogenous squalene synthase, and further comprising one or more recombinant expression constructs encoding heterologous enzymes for producing the sesquiterpene product or sesquiterpenoid.
  • the one or more recombinant nucleic acids encoding heterologous enzymes for producing the sesquiterpene product or sesquiterpenoid is epi-isozizaene synthase, thujopsene terpene synthase, or longifolene synthase.
  • the epi-isozizaene synthase comprises an amino acid sequence having at least 85% identity to the amino acid sequence set forth in SEQ ID NO: 08
  • the thujopsene terpene synthase comprises an amino acid sequence having at least 85% identity to the amino acid sequence set forth in SEQ ID NO:06
  • the longifolene synthase comprises an amino acid sequence having at least 85% identity to the amino acid sequence set forth in SEQ ID NO:07.
  • the recombinant host cell is genetically engineered to reduce activity of the endogenous squalene synthase.
  • the invention relates to a fuel composition comprising one or more of the sesquiterpene products or sesquiterpenoids.
  • the sesquiterpene product or sesquiterpenoid is epi-isozizaene, longifolene, thujopsene and/or barbatene.
  • a method for producing a sesquiterpene product or sesquiterpenoid in a recombinant host cell comprising the steps of: culturing a recombinant host cell comprising one or more recombinant nucleic acids encoding heterologous enzymes for producing the sesquiterpene product or sesquiterpenoid under conditions wherein the sesquiterpene product or sesquiterpenoid is produced, wherein the recombinant host cell has reduced expression or activity of an endogenous squalene synthase.
  • Embodiment 2 The method of embodiment 1, wherein the one or more recombinant nucleic acids encoding heterologous enzymes for producing the sesquiterpene product or sesquiterpenoid is epi-isozizaene synthase, thujopsene terpene synthase, or longifolene synthase.
  • Embodiment 3 The method of embodiment 2, wherein the epi-isozizaene synthase comprises a nucleic acid sequence having at least 85% identity to the nucleic acid sequence set forth in SEQ ID NO:01, the thujopsene terpene synthase comprises a nucleic acid sequence having at least 85% identity to the nucleic acid sequence set forth in SEQ ID NO:02 or SEQ ID NO:03, and the longifolene synthase comprises a nucleic acid sequence having at least 85% identity to the nucleic acid sequence set forth in SEQ ID NO:04 or SEQ ID NO:05.
  • the epi-isozizaene synthase comprises an amino acid sequence having at least 85% identity to the amino acid sequence set forth in SEQ ID NO:08
  • the thujopsene terpene synthase comprises an amino acid sequence having at least 85% identity to the amino acid sequence set forth in SEQ ID NO:06
  • the longifolene synthase comprises an amino acid sequence having at least 85% identity to the amino acid sequence set forth in SEQ ID NO:07.
  • Embodiment 5 The method of embodiment 1, wherein the recombinant host cell is genetically engineered to reduce expression of an enzyme having squalene synthase activity.
  • Embodiment 6 The method of embodiment 1, wherein the recombinant host cell is genetically engineered to reduce activity of the endogenous squalene synthase.
  • Embodiment 7 The method of embodiment 1, wherein the recombinant host cell is genetically engineered to reduce expression of an enzyme having geranylgeranyl diphosphate synthase activity.
  • Embodiment 8 The method of embodiment 5, wherein the enzyme having
  • geranylgeranyl diphosphate synthase activity is encoded by ERG20.
  • Embodiment 9 The method of embodiment 1, wherein the endogenous squalene synthase is encoded by ERG9.
  • Embodiment 10 The method of embodiment 1, wherein the reduced expression of endogenous squalene synthase is caused: (a) by introducing a recombinant genetic construct into the cell, and wherein the squalene synthase is operably linked to a messenger RNA destabilizing motif; or (b) by introducing a recombinant genetic construct into the cell, and wherein the squalene synthase is operably linked to a weak promoter.
  • Embodiment 11 The method of embodiment 1, wherein the reduced activity of endogenous squalene synthase is caused by introducing a recombinant genetic construct into the cell comprising a mutant squalene synthase gene, and wherein the mutant squalene synthase gene encodes an enzyme less active than the endogenous wild type squalene synthase.
  • Embodiment 12 The method of embodiment 1, wherein the recombinant host cell further comprises a truncated version of 3-hydroxy-3-methyl-glutaryl coenzyme A reductase (HMGR) comprising the catalytically active carboxyl terminal portion thereof.
  • HMGR 3-hydroxy-3-methyl-glutaryl coenzyme A reductase
  • Embodiment 13 The method of embodiment 1, wherein the recombinant host cell is a eukaryotic cell or a prokaryotic cell.
  • Embodiment 14 The method of embodiment 13, wherein the eukaryotic cell is a mammalian cell, a plant cell, a fungal cell or a yeast cell.
  • Embodiment 15 The method of embodiment 14, wherein the eukaryotic cell is a yeast cell.
  • Embodiment 16 The method of embodiment 15, wherein the yeast cell is a yeast of species Saccharomyces cerevisiae, Schizosaccharomyces pombe, Yarrowia lipolytica, Candida glabrata, Candida boidinii, Hansenula polymorpha, Kluyveromyces lactis, Pichia pastoris, Ashbya gossypii, Arxula adeninivorans, Cyberlindnera jadinii, Candida albicans, Rhodotorula sp, Sporobolomyces sp, or Rhodosporidium sp.
  • Embodiment 17 The method of embodiment 16, wherein the yeast cell is a
  • Embodiment 18 The method of embodiment 1, wherein the sesquiterpene product or sesquiterpenoid is epi-isozizaene, longifolene, thujopsene, barbatene, or a by-product thereof.
  • Embodiment 19 A method for producing epi-isozizaene, thujopsene, longifolene and/or barbatene from a bioconversion reaction, comprising:
  • Embodiment 20 The method of embodiment 19, wherein the epi-isozizaene synthase comprises a nucleic acid sequence having at least 85% identity to the nucleic acid sequence set forth in SEQ ID NO:01, the thujopsene terpene synthase comprises a nucleic acid sequence having at least 85% identity to the nucleic acid sequence set forth in SEQ ID NO:02 or SEQ ID NO:03, and the longifolene synthase comprises a nucleic acid sequence having at least 85% identity to the nucleic acid sequence set forth in SEQ ID NO:04 or SEQ ID NO:05.
  • Embodiment 21 Embodiment 21.
  • the epi-isozizaene synthase comprises an amino acid sequence having at least 85% identity to the amino acid sequence set forth in SEQ ID NO:08
  • the thujopsene terpene synthase comprises an amino acid sequence having at least 85% identity to the amino acid sequence set forth in SEQ ID NO:06
  • the longifolene synthase comprises an amino acid sequence having at least 85% identity to the amino acid sequence set forth in SEQ ID NO:07.
  • Embodiment 22 The method of embodiment 19, wherein the recombinant host cell is a eukaryotic cell or a prokaryotic cell.
  • Embodiment 23 The method of embodiment 22, wherein the eukaryotic cell is a mammalian cell, a plant cell, a fungal cell, or a yeast cell.
  • Embodiment 24 The method of embodiment 23, wherein the eukaryotic cell is a yeast cell.
  • Embodiment 25 The method of embodiment 24, wherein the yeast cell is a yeast of species Saccharomyces cerevisiae, Schizosaccharomyces pombe, Yarrowia lipolytica, Candida glabrata, Candida boidinii, Hansenula polymorpha, Kluyveromyces lactis,
  • Cyberlindnera jadinii Candida albicans, Rhodotorula sp, Sporobolomyces sp, or
  • Embodiment 26 The method of claim 25, wherein the yeast cell is a Saccharomyces cerevisiae cell.
  • Embodiment 27 A recombinant cell for producing a sesquiterpene product or sesquiterpenoid genetically engineered to have reduced expression or activity of an endogenous squalene synthase, and further comprising one or more recombinant expression constructs encoding heterologous enzymes for producing the sesquiterpene product or sesquiterpenoid.
  • Embodiment 28 The recombinant cell of embodiment 17, wherein the one or more recombinant nucleic acids encodes an epi-isozizaene synthase, a thujopsene terpene synthase, or a longifolene synthase.
  • Embodiment 29 The recombinant cell of embodiment 27, wherein the epi-isozizaene synthase comprises a nucleic acid sequence having at least 85% identity to the nucleic acid sequence set forth in SEQ ID NO:01, the thujopsene terpene synthase comprises a nucleic acid sequence having at least 85% identity to the nucleic acid sequence set forth in SEQ ID NO:02 or SEQ ID NO:03, and the longifolene synthase comprises a nucleic acid sequence having at least 85% identity to the nucleic acid sequence set forth in SEQ ID NO:04 or SEQ ID NO:05.
  • Embodiment 30 The recombinant cell of embodiment 27, wherein the epi-isozizaene synthase comprises an amino acid sequence having at least 85% identity to the amino acid sequence set forth in SEQ ID NO:08, the thujopsene terpene synthase comprises an amino acid sequence having at least 85% identity to the amino acid sequence set forth in SEQ ID NO:06, and the longifolene synthase comprises an amino acid sequence having at least 85% identity to the amino acid sequence set forth in SEQ ID NO:07.
  • Embodiment 31 The recombinant cell of embodiment 27, wherein the cell is genetically engineered to have reduced activity of an endogenous squalene synthase.
  • Embodiment 32 The recombinant cell of embodiment 27, wherein the cell is genetically engineered to have reduced expression of an endogenous squalene synthase.
  • Embodiment 33 The recombinant cell of embodiment 27, wherein the cell is genetically engineered to have reduced expression of an endogenous enzyme having geranylgeranyl diphosphate synthase activity.
  • Embodiment 34 The recombinant cell of embodiment 33, wherein the endogenous enzyme having geranylgeranyl diphosphate synthase activity is ERG20.
  • Embodiment 35 The recombinant cell of embodiment 27, wherein the endogenous squalene synthase is ERG9.
  • Embodiment 36 The recombinant cell of embodiment 27, wherein the reduced expression of the endogenous squalene synthase is caused by introducing into the cell a recombinant genetic construct expressing a messenger RNA destabilizing motif specific to the squalene synthase.
  • Embodiment 37 The recombinant cell of embodiment 27, wherein the reduced expression of endogenous squalene synthase is caused by introducing into the cell a recombinant genetic construct wherein the squalene synthase is operably linked by the construct to a weak promoter.
  • Embodiment 38 The recombinant cell of embodiment 27 further comprising a truncated version of 3-hydroxy-3-methyl-glutaryl coenzyme A reductase (HMGR) comprising the catalytically active carboxyl terminal portion thereof.
  • HMGR 3-hydroxy-3-methyl-glutaryl coenzyme A reductase
  • Embodiment 39 The recombinant cell of embodiment 27, wherein the host cell is a eukaryotic cell or a prokaryotic cell.
  • Embodiment 40 The recombinant cell of embodiment 39, wherein the eukaryotic cell is a mammalian cell, a plant cell, a fungal cell or a yeast cell.
  • Embodiment 41 The recombinant cell of embodiment 39, wherein the eukaryotic cell is a yeast cell.
  • Embodiment 42 The recombinant cell of embodiment 41, wherein the yeast cell is a yeast of species Saccharomyces cerevisiae, Schizosaccharomyces pombe, Yarrowia lipolytica, Candida glabrata, Candida boidinii, Hansenula polymorpha, Kluyveromyces lactis, Pichia pastoris, Ashbya gossypii, Arxula adeninivorans, Cyberlindnera jadinii, Candida albicans, Rhodotorula sp, Sporobolomyces sp, or Rhodosporidium sp.
  • yeast cell is a yeast of species Saccharomyces cerevisiae, Schizosaccharomyces pombe, Yarrowia lipolytica, Candida glabrata, Candida boidinii, Hansenula polymorpha, Kluyveromyces lactis, Pichia pastoris, Ashbya goss
  • Embodiment 43 The recombinant cell of embodiment 41, wherein the yeast cell is a Saccharomyces cerevisiae cell.
  • Embodiment 44 The recombinant cell of embodiment 27, wherein the sesquiterpene product or sesquiterpenoid is epi-isozizaene, longifolene, thujopsene, barbatene , or a byproduct thereof.
  • Embodiment 45 A fuel composition comprising one or more of the sesquiterpene products or sesquiterpenoids of embodiment 1 or embodiment 19 or claim 27.
  • Embodiment 46 The fuel composition of embodiment 45, wherein the sesquiterpene product or sesquiterpenoid is epi-isozizaene, longifolene, thujopsene, barbatene , or a byproduct thereof .
  • Embodiment 47 The fuel composition of embodiment 45, wherein the composition further comprises at least one fuel additive.
  • Embodiment 48 The fuel composition of embodiment 45, wherein the fuel additive is an oxygenate, an antioxidant, a thermal stability improver, a stabilizer, a cold flow improver, a combustion improver, an anti-foam, an anti-haze additive, a corrosion inhibitor, a lubricity improver, an icing inhibitor, an injector cleanliness additive, a smoke suppressant, a drag reducing additive, a metal deactivator, a dispersant, a detergent, a de-emulsifier, a dye, a marker, a static dissipater, a biocide, or combinations thereof.
  • the fuel additive is an oxygenate, an antioxidant, a thermal stability improver, a stabilizer, a cold flow improver, a combustion improver, an anti-foam, an anti-haze additive, a corrosion inhibitor, a lubricity improver, an icing inhibitor, an injector cleanliness additive, a smoke suppressant, a drag reducing additive, a metal deactivator,
  • the recombinant host cell is a eukaryotic cell or a prokaryotic cell.
  • the recombinant host cell can be from a genus such as Agaricus, Anastrepta,
  • the recombinant host cell is a eukaryotic cell and is a mammalian cell, a plant cell, a fungal cell or a yeast cell. In some embodiments, the host cell can be
  • Kluyveromyces lactis Kluvermyces marxianus, Mylia nuda, Mylia taylorii, Nasutitermes ephratae, Nasutitermes rippertii, Panaxa ginseng, Pichia pastoris, Pinus longifolia, Pogostemon cablin, Reboulia hemishpaerica, Saccharomyces cerevisiae, Sarcophyton acutangulum, Schizosaccharomyces pombe, Xanthophyllomyces dendrorhous, or Yarrowia lipolytica.
  • the eukaryotic cell is a yeast cell
  • the yeast cell is
  • Saccharomyces cerevisiae Schizosaccharomyces pombe, Yarrowia lipolytica, Candida glabrata, Candida boidinii, Hansenula polymorpha, Kluyveromyces lactis, Pichia pastoris, Ashbya gossypii, Arxula adeninivorans, Cyberlindnera jadinii, Candida albicans,
  • the yeast cell is Saccharomyces cerevisiae, and includes epi-isozizaene synthase, thujopsene terpene synthase, and/or longifolene synthase.
  • the invention described here relates to recombinant host cells genetically engineered to produce of epi-isozizaene, thujopsene, longifolene, barbatene and related molecules.
  • the recombinant host cells can have increased mevalonate production and/or have higher metabolic flux through the mevalonate biochemical pathway, and can also comprise additional recombinant expression constructs encoding enzymes useful for increasing products of the mevalonate pathway.
  • Figure 1 shows the structure of epi-isozizaene.
  • Figure 2 shows the biosynthetic pathway engineered to produce epi-isozizaene.
  • FIG. 3 shows the nucleic acid sequence of the codon optimized EIZS gene (SEQ ID NO:
  • FIG 4 shows the plasmid expressing the epi-isozizaene synthase gene (EIZS).
  • Figure 5 shows a GC-FID chromatogram from an epi-isozizaene producing strain, showing the product profile of the purified sample.
  • Figure 6 shows the structure of 3-thujopsene.
  • Figure 7 shows the biosynthetic pathway engineered to produce 3-thujopsene.
  • Figure 8 shows the nucleic acid sequence of the wild type At5g44630 gene (SEQ ID NO:02).
  • Figure 9 shows the nucleic acid sequence of the codon optimized At5g44630 gene (SEQ ID NO:03).
  • Figure 10 shows the plasmids expressing the wild type and codon optimized thujopsene terpene synthase gene A t5g44630.
  • Figure 11 shows a GC-FID chromatogram from a thujopsene producing strain, showing the product profile in fermentor broth extract, distillate, and purified samples.
  • Figure 12 shows the structure of (+)-longifolene.
  • Figure 13 shows the biosynthetic pathway engineered to produce (+)-longifolene.
  • PsTPS3 shows the nucleic acid sequence of the wild-type PsTPS3 ⁇ Pinus sylvestris longifolene synthase) gene (SEQ ID NO:04).
  • Figure 15 shows the nucleic acid sequence of the codon optimized PsTPS3 gene (SEQ ID NO: 05).
  • Figure 16 shows the plasmids expressing the wild type and codon optimized P. sylvestris longifolene synthase gene.
  • Figure 17 shows GC-FID chromatogram for a longifolene producing strain, showing the product profile in fermentor broth, distillate, and purified samples.
  • Methods well known to those skilled in the art can be used to construct genetic expression constructs and recombinant cells according to this invention. These methods include in vitro recombinant DNA techniques, synthetic techniques, in vivo recombination techniques, and PCR techniques. See, for example, techniques as described in Maniatis et al., 1989, MOLECULAR CLONING: A LABORATORY MANUAL, Cold Spring Harbor Laboratory, New York; Ausubel et al, 1989, CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, Greene Publishing Associates and Wiley Interscience, New York, and PCR Protocols: A Guide to Methods and Applications (Innis et al, 1990, Academic Press, San Diego, CA).
  • nucleic acid means one or more nucleic acids.
  • the term “substantially” is utilized herein to represent the inherent degree of uncertainty that can be attributed to any quantitative comparison, value, measurement, or other representation.
  • the term “substantially” is also utilized herein to represent the degree by which a quantitative representation can vary from a stated reference without resulting in a change in the basic function of the subject matter at issue.
  • x, y, and/or z can refer to “x” alone, “y” alone, “z” alone, “x, y, and z,” “(x and y) or z,” “x and (y or z),” or “x or y or z.”
  • "and/or” is used to refer to the exogenous nucleic acids that a recombinant cell comprises, wherein a recombinant cell comprises one or more exogenous nucleic acids selected from a group.
  • nucleic acid can be used interchangeably to refer to nucleic acid comprising DNA, RNA, derivatives thereof, or combinations thereof.
  • sesquiterpene As used herein, the term "sesquiterpene,” “sesquiterpene product” or
  • sesquiterpenoid shall be taken to include molecules in which at least part of the molecule is derived from a prenyl pyrophosphate, such as farnesyl pyrophosphate (FPP), isopentenyl pyrophosphate (IPP), dimethylallyl pyrophosphate (DMAPP), etc.
  • FPP farnesyl pyrophosphate
  • IPP isopentenyl pyrophosphate
  • DMAPP dimethylallyl pyrophosphate
  • host cell As used herein, the terms "host cell,” “microorganism,” “microorganism host,” “microorganism host cell,” “recombinant host,” and “recombinant host cell” can be used interchangeably.
  • sequence identity indicates likelihood that a first sequence is derived from a second sequence.
  • Amino acid sequence identity requires identical amino acid sequences between two aligned sequences.
  • a candidate sequence sharing 70% amino acid identity with a reference sequence requires that, following alignment, 70% of the amino acids in the candidate sequence are identical to the corresponding amino acids in the reference sequence.
  • Identity according to the present invention is determined by aid of computer analysis, such as, without limitations, the ClustalW computer alignment program (Higgins et al, 1994, Nucleic Acids Res. 22: 4673-4680), and the default parameters suggested therein.
  • the ClustalW software is available from as a ClustalW WWW Service at the European Bioinformatics Institute at www.ebi.ac.uk/clustalw. Using this program with its default settings, the mature (bioactive) part of a query and a reference polypeptide are aligned. The number of fully conserved residues are counted and divided by the length of the reference polypeptide.
  • the ClustalW algorithm can similarly be used to align nucleotide sequences. Sequence identities can be calculated in a similar way as indicated for amino acid sequences.
  • the cell of the present invention comprises a nucleic acid sequence encoding modified, heterologous and additional enzymatic components of terpene and terpenoid biosynthetic pathways, as defined herein.
  • the methods of the invention can be used, for example, for large-scale production of epi-isozizaene, thujopsene, and/or longifolene and related molecules by a recombinant host cell, as described for the methods of the invention.
  • the methods of the invention can be used to produce recombinant host cells with increased metabolic flux through the pathway of interest and efficient production of epi-isozizaene, thujopsene, and/or longifolene or other related molecule of interest at unexpectedly higher levels in a recombinant host cell.
  • the invention relates to engineered recombinant host cells having altered activity or expression of endogenous mevalonate pathway genes.
  • the recombinant host cells can have altered activity or expression of endogenous enzyme having geranylgeranyl diphosphate synthase activity.
  • the host recombinant host cells of the invention when a wild type host cell expresses an enzyme with geranylgeranyl diphosphate synthase activity, then the host recombinant host cells of the invention preferably have altered activity of said enzyme with geranylgeranyl diphosphate synthase activity.
  • a non-limiting example of this is the microorganism S. cerevisiae and the endogenous enzyme encoded by the ERG20 gene.
  • the wild type host cells do not express any enzyme with geranylgeranyl diphosphate synthase activity.
  • the host cells preferably have reduced activity of geranylgeranyl diphosphate synthase. Said reduced activity results in production or accumulation or both of FPP, and thus, the host cells of the invention are useful in methods for accumulating and producing FPP, as well as compounds having FPP as a precursor, and for producing increased amounts of epi-isozizaene, thujopsene, and/or longifolene.
  • the geranylgeranyl diphosphate synthase can be any of the geranylgeranyl pyrophosphate synthases described herein.
  • the recombinant host cells as provided by the invention have been genetically engineered in order to reduce the activity of geranylgeranyl diphosphate synthase.
  • a recombinant host cell having reduced activity of geranylgeranyl diphosphate synthase activity according to the invention can have an activity of geranylgeranyl diphosphate synthase, which is about 80%, about 50%, about 30%, for example in the range of 10 to 50% of the activity of geranylgeranyl diphosphate synthase in a similar cell having wild type geranylgeranyl diphosphate synthase activity. It is in general important that the recombinant host cell retains at least some geranylgeranyl diphosphate synthase activity, since this is essential for most cells. Geranylgeranyl diphosphate synthase activity can be greatly reduced without significantly impairing cell viability.
  • Recombinant host cells with greatly reduced geranylgeranyl diphosphate synthase activity can have a somewhat slower growth rate than corresponding wild type cells.
  • recombinant host cells of the invention have a growth rate which is at least 50% of the growth of a similar cell having wild type geranylgeranyl diphosphate synthase activity.
  • the recombinant host cell having reduced activity of an enzyme with squalene synthase activity according to the invention has an activity of said enzyme, which is at the most 80%, preferably at the most 50%, such as at the most 30%, for example in the range of 10 to 50% of the activity of said enzyme in a similar host cell having a wild type enzyme with squalene synthase activity. It is in general important that recombinant host cells retain at least some squalene synthase, since this is essential for most host cells. Squalene synthase activity can be greatly reduced without significantly impairing cell viability. Recombinant host cells with greatly reduced activity can have a somewhat slower growth rate than corresponding wild type cells.
  • the recombinant host cells of the invention have a growth rate which is at least 50% of the growth of a similar cell having a wild enzyme with squalene synthase activity.
  • recombinant host cells have altered activity, expression or localization of HMG-CoA synthase.
  • HMG-CoA synthase can have an activity, which is at least 150%, preferably at the least 200%, such as at least 300% or more of the activity of HMG-CoA synthase in a similar host cell having wild type HMG- CoA synthase activity.
  • the HMG-CoA synthase can be truncated so that it is more soluble in the cytoplasm.
  • the wild type promoter of a gene encoding a mevalonate pathway enzyme can be exchanged for a strong promoter, such as any of the strong promoters described herein.
  • the recombinant cell can comprise an ORF encoding a mevalonate pathway enzyme under the control of a strong promoter.
  • cells of the invention can contain one ORF encoding the mevalonate pathway enzymes endogenous to the recombinant host cell, ensuring that the overall levels of the mevalonate pathway enzymes are increased.
  • the promoter sequence can be a strong constitutive promoter or a strong inducible promoter.
  • a strong constitutive promoter or a strong inducible promoter according to the present invention is a promoter, which directs only an increased level of transcription in the recombinant host cell.
  • the strong constitutive promoter or the strong inducible promoter sequence directs expression of an ORF encoding a target protein at an expression level which is significantly higher than the expression level obtained with the wild type target protein promoter.
  • the strong constitutive promoter or the strong inducible promoter sequence can direct expression of the ORF encoding a target protein at an expression level, which is at least 125%, at least 150%, at least 200%, or at least 400% or more of the expression level obtained with the wild target protein.
  • Respective promoters are known in the art, some non-limiting examples of strong constitutive or strong inducible promoters include, but are not limited to, the AOX1, GAL1, PGK, FDH, FLD, CUP, TDH3, TEF1, TPI1, ADH1 or TEF2 promoters.
  • the promoter sequence can be a weak promoter.
  • a weak promoter according to the present invention is a promoter, which directs only a low level of transcription in the recombinant host cell.
  • the weak promoter sequence directs expression of an ORF encoding a target protein at an expression level which is significantly lower than the expression level obtained with the wild type target protein promoter.
  • the weak promoter sequence can direct expression of the ORF encoding a target protein at an expression level, which is at most 70%, or at most 60%, or at most 50%, or at most 40%, or less of the expression level obtained with the wild target protein.
  • Respective promoters are known in the art, some non-limiting examples of weak promoters include, but are not limited to, the CYC-1 promoter or the KEX-2 promoter.
  • the recombinant host cell can comprise a heterologous insert sequence, which increases the expression of mRNA encoding a mevalonate pathway enzyme.
  • the heterologous nucleic acid insert sequence can be positioned between the promoter sequence and the ORF encoding a mevalonate pathway enzyme.
  • the recombinant host cell can also have inactivated and/or no endogenous enzyme activity for molecules downstream of FPP in the wildtype pathway of the recombinant host cell. This can for example be accomplished by: a) deletion of the entire gene encoding downstream endogenous enzymes; or b) deletion of the entire coding region encoding downstream endogenous enzymes; or c) deletion of part of the gene encoding downstream enzymes leading to a total loss of the endogenous enzyme's activity.
  • recombinant host cells are cultivated in the presence of ergosterol;
  • recombinant host cells comprise a heterologous nucleic acid encoding an enzyme with farnesyl pyrophosphate synthase.
  • epi-isozizaene, thujopsene, longifolene and/or barbatene and other sesquiterpene products can be produced artificially by incubating FPP in vitro with heterologously expressed epi-isozizaene synthase, thujopsene terpene synthase, and/or longifolene synthase.
  • the invention further provides a method for producing epi-isozizaene, thujopsene, longifolene and/or barbatene from a bioconversion reaction, comprising:
  • the epi-isozizaene synthase comprises a nucleic acid sequence having at least 85% identity to the nucleic acid sequence set forth in SEQ ID NO:01
  • the thujopsene terpene synthase comprises a nucleic acid sequence having at least 85% identity to the nucleic acid sequence set forth in SEQ ID NO:02 or SEQ ID NO:03
  • the longifolene synthase comprises a nucleic acid sequence having at least 85% identity to the nucleic acid sequence set forth in SEQ ID NO:04 or SEQ ID NO:05.
  • the gene sequences disclosed in SEQ ID NOS: 1, 3 and 5 encode the amino acid sequences of SEQ ID NOS: 8, 6 and 7, respectively.
  • the epi-isozizaene synthase comprises an amino acid sequence having at least 85% identity to the amino acid sequence set forth in SEQ ID NO:08
  • the thujopsene terpene synthase comprises an amino acid sequence having at least 85% identity to the amino acid sequence set forth in SEQ ID NO:06
  • the longifolene synthase comprises an amino acid sequence having at least 85% identity to the amino acid sequence set forth in SEQ ID NO:07.
  • mutants of the ERG9 gene of Saccharomyces cerevisiae can be used (see U. S. Patent Nos. 8,481,286, 8,609,371 and 8,753,842, which are herein incorporated by reference in their entirety).
  • the ERG9 gene encodes squalene synthase. These mutants have reduced, but not eliminated, squalene synthase activity. As such, they allow sufficient production of squalene and subsequent sterols to allow growth, but are sufficiently reduced in activity to allow accumulation of FPP and overproduction of terpenes.
  • the ERG9 gene can have at least one change that occurs in the coding region for the wild-type ERG9 gene and its flanking sequences, including the sequences both upstream and downstream from the coding region.
  • the change in the ERG9 gene can result in reduced ERG9 squalene synthase activity, even though the specific activity may potentially be unaltered.
  • the reduction of the activity of the squalene synthase enzyme can occur through one or more of the following mechanisms: (1) reduction in transcription so that less mRNA that can be translated into squalene synthase enzyme is generated; (2) reduction of mRNA stability, again reducing translation; and (3) reduction of enzyme stability brought about by an increased rate of protein degeneration in vivo.
  • the specific activity of the resulting squalene synthase enzyme is reduced through at least one change in the amino acid sequence of the enzyme expressed from the nucleic acid molecule; or (2) the in vivo activity of the enzyme is reduced through a reduction in transcription, a reduction in translation, or a reduction of enzyme stability.
  • Host and recombinant host cells can be any cell suitable for protein expression ⁇ i.e., expression of heterologous genes) including, but not limited to, eukaryotic cells, prokaryotic cells, yeast cells, fungal cells, mammalian cells, plant cells, microbial cells and bacterial cells.
  • cells according to the invention meet one or more of the following criteria: said cells should be able grow rapidly in large fermenters and should produce small organic molecules in an efficient way.
  • a host cell is a cell that can be genetically engineered according to the invention to produce a recombinant host cell, which is a cell wherein a nucleic acid has been disabled (by deletion or otherwise), or substituted (for example, by homologous recombination at a genetic locus to change the phenotype of the cell, inter alia, to produce reduced expression of a cellular enzyme or any gene of interest), or a heterologous nucleic acid, inter alia, encoding an enzyme or enzymes to confer a novel or enhanced phenotype on the cell has been introduced.
  • recombinant host cells are yeast cells that are of yeast species Saccharomyces cerevisiae, Schizosaccharomyces pombe, Yarrowia lipolytica, Candida glabrata, Ashbya gossypii, Cyberlindnera jadinii, Candida albicans, Arxula adeninivorans, Candida boidinii, Hansenula polymorpha, Kluyveromyces lacti, Pichia pas tor is , Rhodotorula sp, Sporobolomyces sp, and Rhodosporidium sp..
  • yeasts are known in the art to be useful as host cells for genetic engineering and recombinant protein expression. Yeast of different species differ in productivity and with respect to their capabilities to process and modify proteins and to secrete metabolic products thereof. The different 'platforms' of types of yeast make them better suited for different industrial applications. In general, yeasts and fungi are excellent host cells to be used with the present invention. They offer a desired ease of genetic manipulation and rapid growth to high cell densities on inexpensive media. As eukaryotes, they are able to perform protein
  • the host cell for genetic engineering as set forth herein can be a microalgal cell such as a cell from Chlamydomonas, Chlorella or Prototheca species.
  • the host cell can be a cell of a filamentous fungus, for example,
  • the host cell can be a plant cell.
  • the host cell can be a mammalian cell, such as a human, feline, porcine, simian, canine, murine, such as rat or mouse, or rabbit cell.
  • the host cell can also be a CHO, CHO-K1, HEI193T, HEK293, COS, PC12, HiB5, RN33b, BHK cell.
  • the host cell can be a prokaryotic cell, such as a bacterial cell, including, but not limited to E. coli or cells of Corynebacterium, Bacillus, Pseudomonas and Streptomyces species.
  • the invention provides recombinant host cells comprising a heterologous nucleic acid sequence encoding a dual function enzyme, wherein the dual function enzyme is an acetoacetyl-CoA thiolase and a HMG-CoA reductase, including, but not limited to, the mvaE gene encoded by E. faecalis or a functional homologue thereof.
  • the recombinant host cell also can also comprise a heterologous nucleic acid sequence encoding a 3-hydroxy-3-methyl-glutaryl coenzyme A synthase (HMGS), including but not limited to, mvaS gene encoded by E. faecalis or a functional homologue thereof.
  • HMGS 3-hydroxy-3-methyl-glutaryl coenzyme A synthase
  • the invention provides recombinant cells comprising a recombinant expression construct encoding a truncated version of 3-hydroxy-3-methyl- glutaryl coenzyme A reductase (HMGR) comprising the catalytically active carboxyl terminal portion thereof.
  • said recombinant host cell comprises a heterologous nucleic acid sequence encoding a dual function enzyme as set forth herein, wherein said cell produces and/or accumulates enhanced metabolites in the mevalonate pathway, in particular mevalonate, including inter alia expression of heterologous HMGS.
  • said recombinant host cell is a yeast cell that is genetically engineered for reduced ERG9 expression or activity.
  • the invention provides methods and recombinant host cells for producing FPP, particular wherein production and/or accumulation of FPP is enhanced, wherein FPP is obtained in advantageously greater yields by culturing a recombinant host cell that has been genetically engineered for reduced expression of farnesyl diphosphate synthase activity, geranylgeranyl diphosphate synthase activity and/or the activity of an enzyme having both farnesyl diphosphate synthase and geranylgeranyl diphosphate synthase activity, and wherein said recombinant cell further comprises a recombinant expression construct encoding a heterologous FPP synthase.
  • the invention generally relates to fuels produced by the methods, recombinant host cells, and sesquiterpenes produced herein.
  • the invention generally relates to methods for manufacturing fuels including, providing a sesquiterpene composition comprising epi-isozizaene, thujopsene, longifolene and/or barbatene generated by recombinant host cells from substrates including glucose, sucrose, fructose, other reducing sugars, cellobiose, cellulose, hemicellulose, lignocellulose, lignin, methane, and/or CO 2 .
  • Fuel compositions are contemplated herein that can include one or more of epi-isozizaene, thujopsene, longifolene, barbatene and related molecules and mixtures thereof. Further, fuel compositions contemplated herein may include one or more by-products of epi-isozizaene, thujopsene, and longifolene production as either major or minor fuel components.
  • the term "by-product” refers to a chemical compound produced in conjunction with the production of an intended sesquiterpene.
  • a "by-product of thujopsene” refers to any other sesquiterpene or related chemical entity produced during the production of thujopsene, as contemplated herein.
  • a "by-product of epi- isozizaene” and a “by-product of longifolene” refer to any other sesquiterpenes or related chemical entities that are produced during the production of epi-isozizaene and longifolene, respectively.
  • fuel and “fuel composition,” which may be used interchangeably herein, refer to compositions including one or more sesquiterpenes, and/or one or more hydrocarbons, and/or one or more alcohols, and/or one or more fatty esters or a mixture thereof.
  • liquid hydrocarbons are used.
  • Fuel can be used to power internal combustion engines such as reciprocating engines (e.g. , gasoline engines and diesel engines), Wankel engines, jet engines, rocket engines, missile engines and gas turbine engines.
  • fuel typically comprises a mixture of hydrocarbons such as alkanes, cycloalkanes and aromatic hydrocarbons.
  • fuel refers to a composition comprising epi-isozizaene, thujopsene, longifolene and/or barbatene.
  • fuel compound refers to any compound or a mixture of compounds that are used to formulate a fuel composition. There can also be “major fuel components” and “minor fuel components.” A major fuel component is present in a fuel composition by at least 50% by volume, and a minor fuel component is present in a fuel composition by less than 50%. Fuel additives can also be included and represent minor fuel components.
  • fuel additive refers to chemical components added to fuels to alter the properties of the fuel (e.g., to improve engine performance, fuel handling, fuel stability, or for contaminant control).
  • Types of additives include, but are not limited to, antioxidants, thermal stability improvers, cetane improvers, stabilizers, cold flow improvers, combustion improvers, anti-foams, anti-haze additives, corrosion inhibitors, lubricity improvers, icing inhibitors, injector cleanliness additives, smoke suppressants, drag reducing additives, metal deactivators, dispersants, detergents, demulsifiers, dyes, markers, static dissipaters, biocides and combinations thereof.
  • a fuel mixture can comprise greater than 75%, greater than 80%, greater than 85%, greater than 90% or greater than 95% iso-zizaene along with additional sesquiterpenes. In other embodiments, a fuel mixture can comprise greater than 75%, greater than 80%, greater than 85%, greater than 90% or greater than 95% longifolene along with additional sesquiterpenes. In yet other embodiments, a fuel mixture can comprise greater than 10%, greater than 15%, greater than 20% or greater than 25% thujopsene along with additional sesquiterpenes. In yet another embodiment, a fuel mixture can comprise greater than 15%, greater than 20%, greater than 25% or greater than 30% barbatene along with additional sesquiterpenes.
  • a fuel mixture comprising iso-zizaene, longifolene and/or thujopsene mixture can be dimerized to generate a lubricant mixture.
  • Iso-zizaene, longifolene and/or thujopsene can be dimerized thermally or in the presence of a
  • the catalyst can be an acid catalyst including, but not limited to, zeolites, aluminosilicates, clays, or cation exchange resins.
  • antioxidants including phenolics can be added to iso-zizaene, longifolene and/or thujopsene to increase the storage stability of the hydrocarbon.
  • iso-zizaene, longifolene, and/or thujopsene can be hydrogenated in the presence of a catalyst under a hydrogen atmosphere to obtain longifolane or a mixture of saturated sesquiterpenes.
  • the hydrogenation catalyst can have at least one metal selected from Ni, Cu, Pd, Pt, and Ru.
  • the hydrogenation can be conducted in acetic acid.
  • the unsaturated fuel has a density of 0.94 g/mL at 20°C, a net heat of combustion (NHOC) of >142 kBtu/gal, a flashpoint of 88°C, a -20°C dynamic viscosity of 53.1 cP, a 40°C dynamic viscosity of 5.82 cP, and a glass transition temperature of -98°C.
  • NHOC net heat of combustion
  • the hydrogenated hydrocarbon mixture can have a density of 0.918 g/mL, a volumetric NHOC of 138-142 kBtu/gal, a -20°C dynamic viscosity of 70 cP, a 40°C dynamic viscosity of 6.6 cP, and a glass transition temperature of -97°C.
  • the unsaturated fuel has a density of 0.94 g/mL, a volumetric net heat of combustion of 147.4 kBtu/gal, a flashpoint of 98°C, a -20°C dynamic viscosity of 28.2 cP, a 40°C dynamic viscosity of 3.93 cP, and a glass transition temperature of -94°C.
  • the saturated sesquiterpene mixture has a density of 0.929 g/mL, a volumetric net heat of combustion of 141.9 kBtu/gal, a -20°C dynamic viscosity of 42.9 cP, a 40°C dynamic viscosity of 4.3 cP, and a glass transition temperature of -94°C.
  • the unsaturated fuel has a density of 0.93 g/mL, a volumetric net heat of combustion of 144 kBtu/gal, a flashpoint of 98°C, a -20°C dynamic viscosity of 34.9 cP, a 40°C dynamic viscosity of 3.93 cP, and a glass transition temperature of -91°C.
  • the saturated sesquiterpene mixture has a density of 0.901 g/mL, a volumetric net heat of combustion of 138-140 kBtu/gal, a -20°C dynamic viscosity of 46.9 cP, a 40°C dynamic viscosity of 4.9 cP, and a glass transition temperature of -97°C.
  • iso-zizaene, longifolene, thujopsene or saturated sesquiterpene mixtures can be isomerized with an acid catalyst for the purposes of decreasing the viscosity, increasing the density and net heat of combustion, or increasing the cetane number.
  • the product of the isomerization reaction is a diamondoid structure.
  • the isomerized mixture is purified by fractional distillation.
  • the fuels can be pure sesquiterpenes or prepared by selective fractional distillation of sesquiterpene mixtures (density >0.90 g/mL, NHOC > 137,000 btu/gal, cetane number >30).
  • the fuels can be generated by blending sesquiterpene mixtures with known cetane enhancers or antioxidants for fuels.
  • the fuels can be generated by blending sesquiterpene fuels with petroleum- based fuels including JP-10, RJ-4, JP-8, JP-5, F-76, Diesel #2, Jet A, and/or any renewable fuel.
  • the sesquiterpene fuel mixtures can be blended with high cetane fuels derived via a Fischer-Tropsch process or Alcohol-to-Jet (ATJ) process to generate fuels with cetane numbers in the range of 40-50.
  • the sesquiterpene fuel mixtures can be blended with nitrate esters or other cetane enhancers in low concentration to yield fuels with increased cetane numbers.
  • Contemplated fuel compositions include those exemplified by Table 1.
  • At5g44630 ATTTTGATGTCCTTGAAAGAGAGATTGAAGTACTAAAGCCTAAAGTAAGAG gene. AACATATTCGTGTCGTCTTCCACAGACAAAGACGCGATGAAAAAGACAATTCT
  • the plasmid pAlx68-37 containing the codon optimized EIZS gene (SEQ ID NO:01 ; Figure 3), was transformed into ALX11- 30.1 (ura3, trpl, erg9def25, HMG2cat/TRPl::rDNA, dppl, sue) strain of Saccharomyces cerevisiae using a lithium acetate yeast transformation kit (Sigma- Aldrich).
  • ALX11 -30.1 is derived from CALI5-1 (ura3, leu2, his3, trpl, Aerg9::HIS3, HMG2cat/TRPl::rDNA, dppl, sue) (Takahashi, 2007) by three engineering steps. First, the leu2 mutation was restored to wild type by transformation of aLEU2 gene fragment into CALI5-1 to create ALX7-95. Next, the erg9def25 mutant gene was introduced into ALX7-95 to restore ERG9 protein production, allowing the strain to grow in the absence of feeding ergosterol. Finally, the wild type HIS 3 gene was introduced to make the strain prototrophic for histidine. This strain is designated ALXl l-30.
  • Transformants with plasmid pAlx68-37 were selected on SDE-ura medium (0.67 % Bacto yeast nitrogen base without amino acids, 2% glucose, 0.14 % yeast synthetic drop-out medium supplement without uracil, and 40 mg/L ergosterol for strains carrying the Aerg9::HIS3 mutation). Colonies were picked and screened for epi- isozizaene production using a microculture assay in 96 deep well plates. Transformant yeast colonies were inoculated into individual wells of 96-well microtiter plates filled with 200 of SDE. The plate was grown for two to three days at 28 °C.
  • epi-isozizaene was extracted first by introducing 250 ⁇ . of acetone and vortexing, followed by addition of 500 ⁇ . of w-hexane and vortexing. After phase separation, the plate was sealed with aluminum tape and placed on the sample tray of a gas chromatography autosampler. A one microliter sample was injected into the GC. The acetone and hexane used for extraction were each spiked with internal standards to aid in quantitation of the samples. The extracted samples were analyzed by gas chromatography and the amount of epi-isozizaene was calculated from the peak area.
  • the final concentrations of the vitamins in the fermentation batch medium are: thiamine-HCl, 1.8 mg/L; calcium pantothenate, 1.8 mg/L; biotin, 0.5 mg/L; inositol, 9 mg/L; pyridoxine-HCl, 1.8 mg/L.
  • Yeast inoculum for the production fermentation was prepared by propagation of yeast from small starter vials. A sufficient quantity of yeast was generated to enable rapid fermentation in large production fermenters. Seed banks used for inoculation of the seed shake flask were stored at -80 °C with 25% (v/v) glycerol as a cryoprotectant. The seed for a main fermentation was initiated with a shake flask culture inoculated with one or more cryovials (2 mL) obtained from the seed bank. The cryovials were thawed, and the contents were added to the shake flask containing 250 mL of SD-THUL medium in a 1.0 L flask.
  • SD- THUL medium contained 20 g/L glucose, 6.7 g/L yeast nitrogen base without amino acids (DifcoTM, New Jersey, USA), and 1.4 g/L yeast synthetic drop-out medium supplement without histidine, leucine, tryptophan, and uracil (DifcoTM, New Jersey, USA).
  • the shake flasks were incubated with agitation of 250 RPM and temperature of 28° C for 48 hrs.
  • a targeted cell density of the shake flask culture for transfer to the main fermenter is optical density of -10 at 600 nm.
  • the 250 mL shake flask inoculum was transferred to a 15L fermenter (New Brunswick) containing 8L of the fermentation batch medium. Agitation was set at 1100 RPM and aeration is set at 8 slpm (standard liter per minute).
  • the pH of the fermenter vessel was maintained at 5.0 ⁇ 0.1 and controlled with 28% ammonium hydroxide solution.
  • the temperature of the production vessel was maintained at 28 ⁇ 1°C during cultivation. Samples were taken to measure OD, glucose, and ethanol.
  • the fermentation was run in a fed-batch mode where 50% w/w glucose feed solution was added continuously once the batch glucose level dropped to 5 g/L.
  • the glucose feed was added at rates to minimize fermentation by-products formation.
  • the fermentation was run for several days, and the whole broth was harvested when the cell density reached OD 6 oo of 300.
  • the harvested fermentation broth contained -10% cell biomass, -7% oil fraction containing epi-isozizaene, and -83% water.
  • the oil fraction contained the epi-isozizaene, soybean oil, and fatty acids.
  • the epi-isozizaene was purified from the soybean oil by passage through a wiped-film evaporator (WFE, 2-inch wiped-film distillation system made by Pope Scientific, WI, USA). The oil was first run through the WFE and degassed at 1 - 2 Torr at room temperature to remove residual solvent. The epi-isozizaene was then distilled and collected by operating the WFE at 1 -2 Torr and 180°C. The flow rate was maintained at 3 - 5 mL per min.
  • WFE wiped-film evaporator
  • FIG. 1 shows a GC-FID chromatogram from an epi- isozizaene producing strain, showing the product profile of the purified sample.
  • either the plasmid pAlx68-14.3 or pAlx68-14.4, containing either the native At5g44630 (see Figure 8) or codon optimized gene (see Figure 9), respectively, were transformed into ALX11-30.1 (ura3, trpl, erg9def25, HMG2cat/TRP 1 : :rDNA, dppl, sue) strain of Saccharomyces cerevisiae using the lithium acetate yeast transformation kit (Sigma- Aldrich).
  • ALX11-30.1 is derived from CALI5-1 (ura3, leu2, his3, trpl, Aerg9::HIS3, HMG2cat/TRP 1 : : rDNA, dppl, sue) (Takahashi, 2007) by three engineering steps. First, the leu2 mutation was restored to wild type by
  • Transformants with pAlx68-14.3 or pAlx68-14.4 were selected on SDE-ura medium (0.67 % BactoTM yeast nitrogen base without amino acids, 2 % glucose, 0.14 % yeast synthetic drop-out medium supplement without uracil). Colonies were picked and screened for thujopsene production using a microculture assay in 96 deep well plates. Transformant yeast colonies were inoculated into individual wells of 96-well microtiter plates filled with 200 of SDE. The plate was grown for two to three days at 28°C. After growth to saturation, ⁇ 0 ⁇ .
  • thujopsene was extracted first by introducing 250 of acetone vortexing, followed by addition of 500 ⁇ . of n-hexane and vortexing. After phase separation, the plate was sealed with aluminum tape and placed on the sample tray of a gas chromatography autosampler. A one microliter sample was injected into the GC. The acetone and hexane used for extraction were each spiked with internal standards to aid in quantitation of the samples. The extracted samples were analyzed by gas chromatography and the amount of thujopsene was calculated from the peak area.
  • thujopsene was performed in a 15-L fermentation tank (New Brunswick Bioflow 110). Eight liters of fermentation medium was prepared and autoclaved. The medium was composed of glucose, 20 g/L; (NH 4 ) 2 S0 4 , 20 g/L; KH 2 P0 4 , 28 g/L;
  • the final concentrations of the vitamins in the fermentation batch medium were: thiamine-HCl, 1.8 mg/L; calcium pantothenate, 1.8 mg/L; biotin, 0.5 mg/L; inositol, 9 mg/L; pyridoxine-HCl, 1.8 mg/L.
  • Yeast inoculum for the production fermentation was prepared by propagation of yeast from small starter vials. A sufficient quantity of yeast was generated to enable rapid fermentation in large production fermenters. Seed banks used for inoculation of the seed shake flask were stored at -80 °C with 25% (v/v) glycerol as a cryoprotectant. The seed for a main fermentation was initiated with a shake flask culture inoculated with one or more cryovials (2 mL) obtained from the seed bank. The cryovials were thawed and the contents were added to the shake flask containing 250 mL of SD-THUL medium in a 1L flask.
  • SD- THUL medium contained 20 g/L glucose, 6.7 g/L yeast nitrogen base without amino acids (DifcoTM, New Jersey, USA), and 1.4 g/L yeast synthetic drop-out medium supplement without histidine, leucine, tryptophan, and uracil (DifcoTM, New Jersey, USA).
  • the shake flasks were incubated with agitation of 250 RPM and temperature of 28° C for 48 hrs.
  • a targeted cell density of the shake flask culture for transfer to the main fermenter is optical density of -10 at OD 6 oo-
  • the 250 mL shake flask inoculum was transferred to a 15L fermenter (New Brunswick) containing 8L of the fermentation batch medium. Agitation was set at 1 100 RPM and aeration was set at 8 slpm.
  • the pH of the fermenter vessel was maintained at 5.0 ⁇ 0.1 and controlled with 28% ammonium hydroxide solution.
  • the temperature of the production vessel was maintained at 28 ⁇ 1°C during cultivation. Samples were taken to measure OD, glucose, and ethanol.
  • the fermentation was run in a fed-batch mode where 50% w/w glucose feed solution was added continuously once the batch glucose level dropped to 5 g/L. The glucose feed was added at rates to minimize fermentation by-products formation.
  • the fermentation was run for several days and the whole broth was harvested when the cell density reached OD 6 oo of 300.
  • the harvested fermentation broth contained -10% cell biomass, -7% oil fraction containing thujopsene, and -83% water.
  • the oil fraction contained the thujopsene, soybean oil, and fatty acids.
  • the thujopsene was purified from the soybean oil by passage through a wiped-film evaporator (WFE, 2-inch wiped-film distillation system made by Pope Scientific, WI, USA).
  • WFE wiped-film evaporator
  • the oil was first run through the WFE and degassed at 1 - 2 Torr at room temperature to remove residual solvent.
  • the thujopsene was then distilled and collected by operating the WFE at 1 -2 Torr and 180°C. The flow rate was maintained at 3 - 5 mL per min.
  • Figure 11 shows a GC-FID chromatogram from a thujopsene producing strain, showing the product profile in fermentor broth extract, distillate and purified samples.
  • HMG2catlTRP lv.rDNA, dppl, sue strain of Saccharomyces cerevisiae using the lithium acetate yeast transformation kit (Sigma- Aldrich).
  • ALX11-30.1 is derived from CALI5-1 (ura3, leu2, his3, trpl, Aerg9: :HIS3, HMG2catl TRP1 : DNA, dppl, sue) (Takahashi, 2007) by three engineering steps. First, the leu2 mutation was restored to wild type by
  • Transformant yeast colonies were inoculated into individual wells of 96-well microtiter plates filled with 300 of SDE. The plate was grown for two to three days at 28°C. After growth to saturation, 10 from each well was used to inoculate a 96 deep well plate containing 300 of medium suitable for growth and longifolene production. After three days of growth and production, longifolene was extracted first by introducing 250 of acetone vortexing, followed by addition of 500 ⁇ of n-hexane and vortexing. After phase separation, the plate was sealed with aluminum tape and placed on the sample tray of a gas chromatography autosampler. A one microliter sample was injected into the GC. The acetone and hexane used for extraction were each spiked with internal standards to aid in quantitation of the samples. The extracted samples were analyzed by gas chromatography and the amount of longifolene was calculated from the peak area.
  • the medium was composed of glucose, 20 g/L; (NH 4 ) 2 S0 4 , 20 g/L; KH 2 P0 4 , 28 g/L;
  • the final concentrations of the vitamins in the fermentation batch medium are: thiamine-HCl, 1.8 mg/L; calcium pantothenate, 1.8 mg/L; biotin, 0.5 mg/L; inositol, 9 mg/L; pyridoxine-HCl, 1.8 mg/L.
  • Yeast inoculum for the production fermentation was prepared by propagation of yeast from small starter vials. A sufficient quantity of yeast was generated to enable rapid fermentation in large production fermenters. Seed banks used for inoculation of the seed shake flask were stored at -80°C with 25% (v/v) glycerol as a cryoprotectant. The seed for a main fermentation was initiated with a shake flask culture inoculated with one or more cryovials (2 mL) obtained from the seed bank. The cryovials were thawed, and the contents were added to the shake flask containing 250 mL of SD-THUL medium in a 1.0 L flask.
  • SD- THUL medium contained 20 g/L glucose, 6.7 g/L yeast nitrogen base without amino acids (DifcoTM, New Jersey, USA), and 1.4 g/L yeast synthetic drop-out medium supplement without histidine, leucine, tryptophan, and uracil (DifcoTM, New Jersey, USA).
  • the shake flasks were incubated with agitation of 250 RPM and temperature of 28°C for 48 hrs.
  • a targeted cell density of the shake flask culture for transfer to the main fermenter is optical density of -10 at OD 6 oo-
  • the 250 mL shake flask inoculum was transferred to a 15L fermenter (New Brunswick) containing 8L of the fermentation batch medium. Agitation was set at 1100 RPM, and aeration is set at 8 slpm.
  • the pH of the fermenter vessel was maintained at 5.0 ⁇ 0.1 and controlled with 28% ammonium hydroxide solution.
  • the temperature of the production vessel was maintained at 28 ⁇ 1 °C during cultivation.
  • the fermentation was run in a fed-batch mode where 50% w/w glucose feed solution was added continuously once the batch glucose level dropped to 5 g/L. The glucose feed was added at rates to minimize fermentation by-products formation.
  • the fermentation was run for several days and the whole broth was harvested when the cell density reached OD 6 oo of 300.
  • the harvested fermentation broth contained -10% cell biomass, -7% oil fraction containing longifolene, and -83% water.
  • the oil fraction contained the longifolene, soybean oil, and fatty acids.
  • the longifolene was purified from the soybean oil by passage through a wiped-film evaporator (WFE, 2-inch wiped-film distillation system made by Pope Scientific, WI, USA).
  • WFE wiped-film evaporator
  • the oil was first is run through the WFE and degassed at 1 - 2 Torr at room temperature to remove residual solvent.
  • the longifolene was then distilled and collected by operating the WFE at 1 - 2 Torr and 180°C. The flow rate was maintained at 3 - 5 mL per min.

Landscapes

  • Organic Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Microbiology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Biotechnology (AREA)
  • Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention concerne des cellules recombinantes et des procédés de production et des compositions contenant des produits sesquiterpènes ou des sesquiterpénoïdes.
PCT/US2017/052266 2016-09-19 2017-09-19 Production de produits sesquiterpènes et de molécules associées WO2018053507A2 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201662396804P 2016-09-19 2016-09-19
US62/396,804 2016-09-19

Publications (2)

Publication Number Publication Date
WO2018053507A2 true WO2018053507A2 (fr) 2018-03-22
WO2018053507A3 WO2018053507A3 (fr) 2019-05-23

Family

ID=61618946

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2017/052266 WO2018053507A2 (fr) 2016-09-19 2017-09-19 Production de produits sesquiterpènes et de molécules associées

Country Status (1)

Country Link
WO (1) WO2018053507A2 (fr)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110373338A (zh) * 2019-08-15 2019-10-25 东莞东阳光药物研发有限公司 酿酒酵母及其用途
US20200239796A1 (en) * 2018-09-28 2020-07-30 The Regents Of The University Of California Host cells and methods for producing tricyclic sesquiterpenes, aviation and missile fuel precursors

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102413681A (zh) * 2009-03-26 2012-04-11 华盛顿州立大学研究基金会 在具有腺毛的植物中产生萜烯和萜类
AU2013304001B2 (en) * 2012-08-17 2019-01-03 Evolva Sa Increased production of terpenes and terpenoids

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20200239796A1 (en) * 2018-09-28 2020-07-30 The Regents Of The University Of California Host cells and methods for producing tricyclic sesquiterpenes, aviation and missile fuel precursors
CN110373338A (zh) * 2019-08-15 2019-10-25 东莞东阳光药物研发有限公司 酿酒酵母及其用途
CN110373338B (zh) * 2019-08-15 2021-09-28 宜昌东阳光生化制药有限公司 酿酒酵母及其用途

Also Published As

Publication number Publication date
WO2018053507A3 (fr) 2019-05-23

Similar Documents

Publication Publication Date Title
Tang et al. Metabolic engineering of Yarrowia lipolytica for improving squalene production
Zhao et al. Dynamic control of ERG20 expression combined with minimized endogenous downstream metabolism contributes to the improvement of geraniol production in Saccharomyces cerevisiae
KR101543777B1 (ko) 파네산과 파네산 유도체 함유 연료 조성물 및 이를 제조하는 방법, 그리고 사용하는 방법
US8309323B2 (en) Dimethyloctane as an advanced biofuel
Ma et al. Engineering Yarrowia lipolytica for sustainable production of the chamomile sesquiterpene (−)-α-bisabolol
EP2504421B1 (fr) Procédés et compositions de production de squalène à l'aide de levure
Liu et al. Dual regulation of cytoplasm and peroxisomes for improved α-farnesene production in recombinant Pichia pastoris
WO2007140339A2 (fr) Production d'isoprénoïdes
Wang et al. Overproduction of α-farnesene in Saccharomyces cerevisiae by farnesene synthase screening and metabolic engineering
CN102753697A (zh) 改良的使用dxp和mva途径的异戊二烯生产
EP2240593A2 (fr) Méthylbutanol en tant que biocarburant amélioré
WO2009006386A2 (fr) Cellules hôtes et procédés de production d'alcanoates d'isoprényle
Zhang et al. High-yielding terpene-based biofuel production in Rhodobacter capsulatus
WO2018053507A2 (fr) Production de produits sesquiterpènes et de molécules associées
WO2012016177A2 (fr) Microbes génétiquement modifiés produisant de plus hauts niveaux de composés dérivés d'acétyl-coa
Tang et al. Recent advances in the biosynthesis of farnesene using metabolic engineering
Zhang et al. Engineering the oleaginous yeast Candida tropicalis for α-humulene overproduction
Wang et al. Enzyme and metabolic engineering strategies for biosynthesis of α-farnesene in Saccharomyces cerevisiae
Zhao et al. Tuning geraniol biosynthesis via a novel decane-responsive promoter in Candida glycerinogenes
US10533196B2 (en) Xylose utilizing oleaginous yeast
CN107815425B (zh) 一种产脂肪酸乙酯的解脂耶氏酵母基因工程菌及其应用
US20120184008A1 (en) Filamentous fungi and methods for producing trichodiene from lignocellulosic feedstocks
Peng et al. High-Level Production of Patchoulol in Yarrowia lipolytica via Systematic Engineering Strategies
Dai et al. Genetically engineered oleaginous yeast Lipomyces starkeyi for sesquiterpene α-Zingiberene production
WO2012016172A2 (fr) Microbes génétiquement modifiés produisant de plus hauts niveaux de composés dérivés d'acétyl-coa

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17851785

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase in:

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 17851785

Country of ref document: EP

Kind code of ref document: A2