WO2018053058A1 - Procédés basés sur la fermentation de biomasse lignocellulosique - Google Patents

Procédés basés sur la fermentation de biomasse lignocellulosique Download PDF

Info

Publication number
WO2018053058A1
WO2018053058A1 PCT/US2017/051442 US2017051442W WO2018053058A1 WO 2018053058 A1 WO2018053058 A1 WO 2018053058A1 US 2017051442 W US2017051442 W US 2017051442W WO 2018053058 A1 WO2018053058 A1 WO 2018053058A1
Authority
WO
WIPO (PCT)
Prior art keywords
lignocellulosic biomass
acetamidase
enzyme
acetamide
identity
Prior art date
Application number
PCT/US2017/051442
Other languages
English (en)
Inventor
Rafael F. Sala
Brian F. Schmidt
Original Assignee
Danisco Us Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Danisco Us Inc. filed Critical Danisco Us Inc.
Publication of WO2018053058A1 publication Critical patent/WO2018053058A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/40—Preparation of oxygen-containing organic compounds containing a carboxyl group including Peroxycarboxylic acids
    • C12P7/54—Acetic acid
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/78—Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5)
    • C12N9/80—Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5) acting on amide bonds in linear amides (3.5.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
    • C12P7/04—Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic
    • C12P7/06—Ethanol, i.e. non-beverage
    • C12P7/065—Ethanol, i.e. non-beverage with microorganisms other than yeasts
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
    • C12P7/04—Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic
    • C12P7/06—Ethanol, i.e. non-beverage
    • C12P7/08—Ethanol, i.e. non-beverage produced as by-product or from waste or cellulosic material substrate
    • C12P7/10—Ethanol, i.e. non-beverage produced as by-product or from waste or cellulosic material substrate substrate containing cellulosic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y305/00—Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5)
    • C12Y305/01—Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5) in linear amides (3.5.1)
    • C12Y305/01004—Amidase (3.5.1.4)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P2201/00—Pretreatment of cellulosic or lignocellulosic material for subsequent enzymatic treatment or hydrolysis
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P2203/00—Fermentation products obtained from optionally pretreated or hydrolyzed cellulosic or lignocellulosic material as the carbon source
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02E—REDUCTION OF GREENHOUSE GAS [GHG] EMISSIONS, RELATED TO ENERGY GENERATION, TRANSMISSION OR DISTRIBUTION
    • Y02E50/00—Technologies for the production of fuel of non-fossil origin
    • Y02E50/10—Biofuels, e.g. bio-diesel

Definitions

  • This disclosure relates to the field of lignocellulosic biomass fermentation. Methods and compositions for lowering acetamide levels in a process stream of a lignocellulosic biomass fermentation process are provided. BACKGROUND
  • Lignocellulosic feedstocks and wastes such as agricultural residues, wood, forestry wastes, sludge from paper manufacture, and municipal and industrial solid wastes, provide a potentially large renewable feedstock for the production of chemicals, plastics, fuels and feeds.
  • Lignocellulosic feedstocks and wastes containing the carbohydrate polymers cellulose, and hemicellulose, as well as lignin, are generally treated by a variety of chemical, mechanical and enzymatic means to release primarily hexose and pentose sugars, which can then be fermented to useful products.
  • Pretreatment methods are used to make the carbohydrate polymers, or polysaccharides, of lignocellulosic biomass more readily accessible to cellulolytic enzymes used in saccharification.
  • An impediment to cellulolytic enzyme digestion of polysaccharide is the presence of lignin, which is a barrier that limits the access of the enzymes to their substrates, and provides a surface to which the enzymes bind non-productively.
  • the crystallinity of cellulose microfibrils restricts enzyme access providing an obstacle to saccharification.
  • Pretreatment methods that attempt to overcome these challenges include: steam explosion, hot water, dilute acid, ammonia fiber explosion, alkaline hydrolysis (including ammonia recycled percolation), oxidative delignification, organosolv, and ozonation.
  • Biomass pretreatment using low amounts of aqueous ammonia and a high solids concentration is disclosed in US 7,932,063.
  • US20080008783 discloses treatment of biomass with anhydrous ammonia.
  • Lignocellulosic bio-refineries employing such pretreatment processes may produce not only ethanol, but substantial amounts of lignocellulosic co-products from the distillation of ethanol. Such lignocellulosic co-products can find application in several end uses such as in the landscape industry, with much reduced environmental footprint. Thus, there is a need in the art for methods to alter the composition of process streams to affect the composition of resulting products.
  • Methods for lowering the acetamide level in a lignocellulosic fermentation process stream comprise contacting a process stream with an effective amount of an acetamidase enzyme whereby the acetamide level is lowered.
  • acetamide is hydrolyzed to acetic acid, hence acetic acid levels may be increased.
  • the process stream is pretreated lignocellulosic biomass, lignocellulosic biomass hydrolysate, a fermentation broth comprising lignocellulosic biomass hydrolysate, whole stillage, thin stillage, syrup, or filter cake.
  • the level of acetamide is lowered by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90%. In embodiments, after the contacting, acetamide is no longer detectable in the process stream.
  • the pretreated lignocellulosic biomass process stream is produced by a process comprising contacting lignocellulosic biomass with ammonia.
  • the lignocellulosic biomass is corn stover, switchgrass, bagasse, or wheat straw.
  • the acetamidase enzyme is added to the process stream.
  • the fermentation broth comprising lignocellulosic biomass hydrolysate comprises a fermentation microorganism which expresses said acetamidase enzyme.
  • the pH of the process stream is between about 5 and about 7 or is adjusted to between about 5 and about 7 prior to or during the contact.
  • the temperature of the process stream is or is adjusted to to between about 40°C and about 60°C prior to or during the contact.
  • the decrease of acetamide is measured by a decrease in acetamide in the process stream. In embodiments, the decrease of acetamide is measured in the whole stillage, thin stillage, syrup, or filter cake.
  • the acetamidase enzyme is from a bacterial or fungal microorganism. In embodiments, acetamidase enzyme is from Pseudomonas, Emericella, Bacillus, Brevibacterium, Aspergillus, Saccharomyces, Paenibacillus, Geobacillus, or Geomicrobium. In embodiments, the acetamidase has at least 80% identity to SEQ ID NO: 2. In embodiments, the acetamidase has at least 80% identity to SEQ ID NO: 4. In embodiments, the acetamidase has at least 90% identity to SEQ ID NO: 2 or SEQ ID NO: 4. In embodiments, the acetamidase is encoded by a nucleic acid sequence having at least 80% identity to SEQ ID NO: 1 or SEQ ID NO: 3.
  • compositions comprising ammonia pretreated lignocellulosic biomass, ammonia pretreated lignocellulosic biomass hydrolysate, or fermentation broth comprising lignocellulosic biomass hydrolysate and an acetamidase enzyme in an amount sufficient to reduce the amount of acetamide in the ammonia pretreated lignocellulosic biomass, ammonia pretreated lignocellulosic biomass hydrolysate, or fermentation broth comprising lignocellulosic biomass hydrolysate.
  • the fermentation broth comprising lignocellulosic biomass hydrolysate comprises an engineered Zymomonas mobilis strain capable of producing ethanol from the hydrolysate.
  • the fermentation broth comprising lignocellulosic biomass hydrolysate comprises an engineered Saccharomyces cerevisiae strain capable of producing ethanol from the hydrolysate.
  • the acetamidase enzyme comprises at least 80% identity to SEQ ID NO: 2 or 4 or 5.
  • Also disclosed herein are recombinant host cells comprising a heterologous nucleic acid sequence which encodes a polypeptide having at least about 80% identity to SEQ ID NO: 2 or 4 or 5.
  • the host cell is selected from Trichoderma, Myceliophthora, Streptomyces, or Bacillus.
  • the host cell is Bacillus subtilis.
  • the host cell is protease-deficient Bacillus subtilis.
  • acetamidase enzyme comprising: culturing a recombinant host cell as provided herein under conditions suitable for expression of the acetamidase enzyme, and recovering the culture broth containing the enzyme.
  • the methods comprise further processing the culture broth.
  • Also disclosed herein are methods of producing a target product from a lignocellulosic biomass material comprising: a) pretreating lignocellulosic biomass material to produce pretreated lignocellulosic biomass, b) contacting the pretreated lignocellulosic biomass material with an enzyme consortium under conditions suitable to produce a lignocellulosic biomass hydrolysate, c) contacting the lignocellulosic biomass hydrolysate with a fermentation microorganism under conditions suitable for production of a target product, and d) removing target product to produce a depleted broth, wherein an acetamidase enzyme is present during any one of or all of steps a)-d).
  • contacting the pretreated lignocellulosic biomass material with an enzyme consortium occurs concurrently with contacting the lignocellulosic biomass hydrolysate with a fermentation microorganism.
  • the acetamidase enzyme is present in any one of or all of a, b, or c. In embodiments, the acetamidase enzyme is present in a). In embodiments, the acetamidase enzyme is present in b). In embodiments, the acetamidase enzyme is present in c). In embodiments, the acetamidase enzyme is present in d).
  • the acetamide level in the depleted broth is lower as compared to that of a process wherein the acetamidase enzyme is not present in any one of, a combination of, or all of the steps.
  • the lignocellulosic biomass material is corn stover, switchgrass, bagasse, or wheat straw.
  • the lignocellulosic biomass material is pretreated by a low ammonia pretreatment process.
  • the target product is ethanol.
  • FIG 1A depicts the activity of EnzA (Geobacillus sterothermophilus; EnzAj at different concentrations in pH 5.6 citrate buffer.
  • Y-axis is in units of relative HPLC response.
  • “+H2O” is a control that represents the dilution effect of enzyme addition.
  • FIG 1 B depicts activity of EnzA at different concentrations in pH 7.2 phosphate buffer.
  • Y-axis is in units of relative HPLC response.
  • “+H2O” is a control that represents the dilution effect of enzyme addition.
  • FIG 2. depicts activity of EnzA in end-of-fermentation broth (EOF) and in distilled EOF.
  • Y-axis is in units of relative HPLC response.
  • “+H2O” is a control that represents the dilution effect of enzyme addition.
  • Table 1 provides the sequences of certain protein and nucleic acid sequences referenced herein. DETAILED DESCRIPTION
  • Ammonia pretreatment chemistry may generate acetamide as a by-product due to the ammonolysis reaction occurring between ammonia with acetate-saccharide esters present in the xylan or glucan content of the feedstock. During this reaction ammonia forms acetamide when it displaces the alcohol forming ester from the acetate ester.
  • compositions and methods related to enzymatic contact of process streams wherein acetamide levels are lowered are Described herein.
  • compositions comprising, “comprising,” “includes,” “including,” “has,” “having,” “contains” or “containing,” or any other variation thereof, are intended to cover a non-exclusive inclusion.
  • a composition, a mixture, process, method, article, or apparatus that comprises a list of elements is not necessarily limited to only those elements but may include other elements not expressly listed or inherent to such composition, mixture, process, method, article, or apparatus.
  • “or” refers to an inclusive or and not to an exclusive or. For example, a condition A or B is satisfied by any one of the following: A is true (or present) and B is false (or not present), A is false (or not present) and B is true (or present), and both A and B are true (or present).
  • the term “about” also encompasses amounts that differ due to different equilibrium conditions for a composition resulting from a particular initial mixture. Whether or not modified by the term “about”, the claims include equivalents to the quantities. In one embodiment, the term “about” means within 10% of the reported numerical value, preferably within 5% of the reported numerical value.
  • acetamidase or "acetamidase enzyme” refers to an enzyme capable of catalyzing the hydrolysis of acetamide into acetic acid and ammonia. Suitable acetamidase enzymes may be amidases classified under E.C. number 3.5.1 .4 (www.brenda-enzymes.org).
  • transferable sugar refers to oligosaccharides and monosaccharides that can be used as a carbon source by a microorganism in a fermentation process.
  • lignocellulosic refers to a composition comprising both lignin and cellulose. Lignocellulosic material may also comprise hemicellulose.
  • cellulosic refers to a composition comprising cellulose and additional components, including hemicellulose.
  • sacharification refers to the production of fermentable sugars from polysaccharides.
  • pretreated biomass means biomass that has been subjected to pretreatment prior to saccharification.
  • the pretreatment may take the form of physical, thermal or chemical means and combinations thereof.
  • lignocellulosic biomass refers to any lignocellulosic material and includes materials comprising cellulose, hemicellulose, lignin, starch, oligosaccharides and/or monosaccharides. Biomass can also comprise additional components, such as protein and/or lipid. Biomass can be derived from a single source, or biomass can comprise a mixture derived from more than one source; for example, biomass could comprise a mixture of corn cobs and corn stover, or a mixture of grass and leaves.
  • Lignocellulosic biomass includes, but is not limited to, bioenergy crops, agricultural residues, municipal solid waste, industrial solid waste, sludge from paper manufacture, yard waste, wood and forestry waste.
  • biomass examples include, but are not limited to, corn cobs, crop residues such as corn husks, corn stover, grasses (including Miscanthus), wheat straw, barley straw, hay, rice straw, switchgrass, waste paper, sugar cane bagasse, sorghum material, soybean plant material, components obtained from milling of grains or from using grains in production processes (such as DDGS: dried distillers grains with solubles), trees, branches, roots, leaves, wood chips, sawdust, shrubs and bushes, vegetables, fruits, flowers, empty palm fruit bunch, and energy cane.
  • corn cobs crop residues such as corn husks, corn stover, grasses (including Miscanthus), wheat straw, barley straw, hay, rice straw, switchgrass, waste paper, sugar cane bagasse, sorghum material, soybean plant material, components obtained from milling of grains or from using grains in production processes (such as DDGS: dried distillers grains with solubles), trees, branches, roots, leaves, wood chips, sawdust, shrub
  • energy cane refers to sugar cane that is bred for use in energy production. It is selected for a higher percentage of fiber than sugar.
  • pretreated lignocellulosic biomass refers to biomass which has been subjected to a physical, thermal and/or chemical treatment prior to saccharification.
  • ammonia pretreated lignocellulosic biomass refers to biomass which has been subjected at least to a pretreatment process employing ammonia.
  • ammonia pretreatment is a low ammonia pretreatment where biomass is contacted with an aqueous solution comprising ammonia to form a biomass-aqueous ammonia mixture where the ammonia concentration is sufficient to maintain alkaline pH of the biomass- aqueous ammonia mixture but is less than about 12 weight percent relative to dry weight of biomass, and where dry weight of biomass is at least about 15 weight percent solids relative to the weight of the biomass-aqueous ammonia mixture, as disclosed in the U.S. Patent No. 7,932,063, which is herein incorporated by reference.
  • the term "lignocellulosic biomass hydrolysate" refers to the product resulting from saccharification of lignocellulosic biomass.
  • the biomass may also be pretreated or pre-processed prior to saccharification.
  • lignocellulosic biomass hydrolysate fermentation broth is broth containing product resulting from biocatalyst growth and production in a medium comprising lignocellulosic biomass hydrolysate. This broth includes components of lignocellulosic biomass hydrolysate that are not consumed by the biocatalyst, as well as the biocatalyst itself and product made by the biocatalyst.
  • slurry refers to a mixture of insoluble material and a liquid.
  • a slurry may also contain a high level of dissolved solids. Examples of slurries include a saccharification broth, a fermentation broth, and a stillage.
  • lignocellulosic filter cake or “filter cake” refer to high lignin- content solids that results from separation of whole stillage into solids (filter cake) and liquids (thin stillage) fractions.
  • lignocellulosic syrup or "syrup”, as used herein, refer to the liquid fraction of the whole stillage that is further processed by evaporation. When the water is removed from the liquid fraction, a high solids syrup is produced.
  • target product refers to any product that is produced by a microbial production host cell in a fermentation process.
  • Target products may be the result of genetically engineered enzymatic pathways in host cells or may be produced by endogenous pathways.
  • Typical target products include but are not limited to acids, alcohols, alkanes, alkenes, aromatics, aldehydes, ketones, biopolymers, proteins, peptides, amino acids, vitamins, antibiotics, and pharmaceuticals.
  • fixation refers broadly to the use of a biocatalyst to produce a target product.
  • the biocatalyst grows in a fermentation broth utilizing a carbon source in the broth, and through its metabolism produces a target product.
  • Solids refers to soluble solids and insoluble solids. Solids from a lignocellulosic fermentation process contain residue from the lignocellulosic biomass used to make hydrolysate medium.
  • Volatiles refers herein to components that will largely be vaporized in a process where heat is introduced. Volatile content is measured herein by establishing the loss in weight resulting from heating under rigidly controlled conditions to 950 ° C (as in ASTM D-3175). Typical volatiles include, but are not limited to, hydrogen, oxygen, nitrogen, acetic acid, and some carbon and sulfur.
  • “Sugars” as referred to herein means a total of monosaccharide and soluble oligosaccharides.
  • host cell By the term “host cell” is meant a cell that contains a vector and supports the replication, and/or transcription and/or transcription and translation (expression) of the expression construct.
  • Host cells for use in the present invention may be prokaryotic cells, such as E. coli, or eukaryotic cells such as yeast, plant, insect, amphibian, or mammalian cells. In certain embodiments, host cells are filamentous fungi.
  • heterologous when used with reference to portions of a nucleic acid indicates that the nucleic acid comprises two or more subsequences that are not normally found in the same relationship to each other in nature.
  • the nucleic acid is typically recombinantly produced, having two or more sequences, e.g., from unrelated genes arranged to make a new functional nucleic acid, e.g., a promoter from one source and a coding region from another source.
  • sequence heterologous to a host cell indicates that the sequence is not present in the native host cell.
  • a heterologous polypeptide will often refer to two or more subsequences that are not found in the same relationship to each other in nature (e.g., a fusion polypeptide).
  • recombinant when used with reference, e.g., to a cell, or nucleic acid, polypeptide, or vector, indicates that the cell, nucleic acid, polypeptide or vector, has been modified by the introduction of a heterologous nucleic acid or polypeptide or the alteration of a native nucleic acid or polypeptide, or that the cell is derived from a cell so modified.
  • recombinant cells express genes that are not found within the native (non- recombinant) form of the cell or express native genes that are otherwise abnormally expressed, under expressed or not expressed at all.
  • the biomass is treated to release sugars such as glucose, xylose, and arabinose from the polysaccharides of the biomass.
  • Lignocellulosic biomass may be treated by any method known by one skilled in the art to produce fermentable sugars in a hydrolysate.
  • the biomass may be pretreated using physical, thermal, or chemical treatments, or a combination thereof, and saccharified enzymatically.
  • Thermo- chemical pretreatment methods include steam explosion or methods of swelling the biomass to release sugars (see for example WO20101 13129; WO20101 13130, both of which are incorporated by reference). Chemical saccharification may also be used. Physical treatments may be used for particle size reduction prior to further chemical treatment.
  • Chemical treatments include base treatment such as with strong base (ammonia or NaOH), or acid treatment (US8545633, WO2012103220, incorporated by reference).
  • the biomass is pretreated with ammonia (US 20080008783, US 7932063, US 7781 191 , US 7998713, US7915017, all of which are incorporated by reference). These treatments release polymeric sugars from the biomass.
  • pretreatment is a low ammonia pretreatment where biomass is contacted with an aqueous solution comprising ammonia to form a biomass- aqueous ammonia mixture where the ammonia concentration is sufficient to maintain alkaline pH of the biomass-aqueous ammonia mixture but is less than about 12 weight percent relative to dry weight of biomass.
  • the dry weight of biomass is at least about 15 weight percent solids relative to the weight of the biomass-aqueous ammonia mixture, as disclosed in the U.S. Patent No. 7,932,063, which is herein incorporated by reference.
  • Saccharification which converts polymeric sugars to monomeric sugars, may be either by enzymatic or chemical treatments.
  • the pretreated biomass is contacted with a saccharification enzyme consortium under suitable conditions to produce a lignocellulosic biomass hydrolysate which comprises fermentable sugars.
  • the pretreated biomass Prior to saccharification, the pretreated biomass can be brought to the desired moisture content and treated to alter the pH, composition or temperature such that the enzymes of the saccharification enzyme consortium will be active.
  • the pH can be altered through the addition of acids in solid or liquid form.
  • CO2 carbon dioxide
  • CO2 can be collected from a fermenter and fed into the pretreatment product headspace in the flash tank or bubbled through the pretreated biomass if adequate liquid is present while monitoring the pH, until the desired pH is achieved.
  • the temperature is brought to a temperature that is compatible with saccharification enzyme activity, as noted below.
  • suitable conditions can include temperature from about 40 °C to about 50 °C and pH between from about 4.8 to about 5.8.
  • Enzymatic saccharification of cellulosic or lignocellulosic biomass typically makes use of an enzyme composition or blend to break down cellulose and/or hemicellulose and to produce a hydrolysate containing sugars such as, for example, glucose, xylose, and arabinose.
  • Saccharification enzymes are reviewed in Lynd, L. R., et al. (Microbiol. Mol. Biol. Rev., 66:506-577, 2002).
  • a saccharification enzyme blend is used that includes one or more glycosidases.
  • Glycosidases hydrolyze the ether linkages of di-, oligo-, and polysaccharides and are found in the enzyme classification EC 3.2.1 .x (Enzyme Nomenclature 1992, Academic Press, San Diego, CA with Supplement 1 (1993), Supplement 2 (1994), Supplement 3 (1995, Supplement 4 (1997) and Supplement 5 [in Eur. J. Biochem., 223: 1 -5, 1994; Eur. J. Biochem., 232: 1 -6, 1995; Eur. J. Biochem., 237:1 -5, 1996; Eur. J. Biochem., 250: 1 -6, 1997; and Eur. J.
  • Glycosidases useful in saccharification can be categorized by the biomass components they hydrolyze. Glycosidases useful in saccharification can include cellulose-hydrolyzing glycosidases (for example, cellulases, endoglucanases, exoglucanases, cellobiohydrolases, ⁇ -glucosidases), hemicellulose-hydrolyzing glycosidases (for example, xylanases, endoxylanases, exoxylanases, ⁇ -xylosidases, arabino-xylanases, mannases, galactases, pectinases, glucuronidases), and starch-hydrolyzing glycosidases (for example, amylases, a-amylases, ⁇ -amylases, glucoamylases
  • peptidases EC 3.4. x.y
  • lipases EC 3.1.1 .x and 3.1.4.x
  • ligninases EC 1.1 1 .1.x
  • feruloyl esterases EC 3.1 .1 .73
  • a "cellulase” from a microorganism can comprise a group of enzymes, one or more or all of which can contribute to the cellulose-degrading activity.
  • Commercial or non-commercial enzyme preparations, such as cellulase can comprise numerous enzymes depending on the purification scheme utilized to obtain the enzyme.
  • Many glycosyl hydrolase enzymes and compositions thereof that are useful for saccharification are disclosed in WO 201 1/038019 or WO 2012/125937, incorporated herein by reference.
  • Additional enzymes for saccharification include, for example, glycosyl hydrolases that hydrolyze the glycosidic bond between two or more carbohydrates, or between a carbohydrate and a noncarbohydrate moiety.
  • Suitable enzymes may include enzymes from Glycoside hydrolase families, such as the families GH3, GH5, GH 6 & GH 7, GH39, GH43, GH51 , GH10, GH1 1 .
  • GHs are a group of enzymes that hydrolyze the glycosidic bond between two or more carbohydrates, or between a carbohydrate and a noncarbohydrate moiety. Families of GHs have been classified based on sequence similarity and are available in the Carbohydrate-Active enzyme (CAZy) database (Cantarel et al. (2009) Nucleic Acids Res. 37 (Database issue): D233-238). These enzymes are able to act on a number of substrates and are effective in the saccharification process.
  • CAZy Carbohydrate-Active enzyme
  • Glycoside hydrolase family 3 (“GH3") enzymes have a number of known activities: ⁇ -glucosidase (EC:3.2.1 .21 ); ⁇ -xylosidase (EC:3.2.1 .37); N- acetyl ⁇ - glucosaminidase (EC:3.2.1 .52); glucan ⁇ -1 ,3-glucosidase (EC:3.2.1 .58); cellodextrinase (EC:3.2.1 .74); exo-1 ,3-1 ,4-glucanase (EC:3.2.1 ); and ⁇ - galactosidase (EC 3.2.1.23).
  • Glycoside hydrolase family 39 (“GH39”) enzymes have a-L-iduronidase (EC:3.2.1 .76) or ⁇ -xylosidase (EC:3.2.1.37) activity.
  • Glycoside hydrolase family 43 (“GH43”) enzymes have the following activities: L- a-arabinofuranosidase (EC 3.2.1 .55); ⁇ -xylosidase (EC 3.2.1 .37); endoarabinanase (EC 3.2.1 .99); and galactan 1 ,3 ⁇ -galactosidase (EC 3.2.1 .145).
  • Glycoside hydrolase family 51 (“GH51 ”) enzymes have L-a- arabinofuranosidase (EC 3.2.1 .55) or endoglucanase (EC 3.2.1 .4) activity.
  • Glycoside hydrolase family 10 (“GH10") are described, for example, in Schmidt et a/., 1999, Biochemistry 38:2403-2412 and Lo Leggio et al., 2001 , FEBS Lett 509: 303-308) and the Glycoside hydrolase family 1 1 (“GH1 1 ”) are more fully described in Hakouvainen et a/., 1996, Biochemistry 35:9617-24.
  • Suitable enzymes may include glycoside hydrolase family 61 ("GH61 ") enzymes which have been reclassified into Auxiliary Activity Family 9 (AA9; Merriypedia.org) and may be referred to as GH61 enzymes herein.
  • suitable enzymes may include EG4 (such as from Trichoderma reesei and variants thereof as described, for example, in WO201517256A1 , WO201517255A1 , WO201517254A1 , incorporated by reference), Fv3A, Fv51A and/or Fv43D (such as from Fusarium verticilloides as described, for example in US2014/016408, incorporated by reference).
  • Suitable enzymes may include, for example, enzymes disclosed in PCT Application Publication Nos.
  • WO03/027306 WO2003521 18_A2, WO200352054_A2, WO200352057_A2, WO200352055_A2, WO200352056_A2, WO200416760_A2, WO9210581_A1 , WO200448592_A2, WO200443980_A2, WO200528636_A2, WO200501065_A2, WO2005/001036, WO2005/093050, WO200593073_A1 , WO200674005_A2, WO2009/149202, WO201 1/038019, WO2010/141779, WO201 1/063308, WO2012/125951 , WO2012/125925, WO2012125937, WO/201 1/153276, WO2014/093275, WO2014/070837, WO2014/070841 , WO2014/070844, WO2014/093281 , WO2014/093282, WO2014/09
  • Saccharification enzymes can be obtained commercially. Such enzymes include, for example, Spezyme ® CP cellulase, Multifect ® xylanase, Accelerase ® 1500, Accellerase ® DUET, and Accellerase ® TrioTM (DupontTM/ Genencor ® , Wilmington, DE), and Novozyme-188 (Novozymes, 2880 Bagsvaerd, Denmark).
  • saccharification enzymes can be provided as crude preparations of a cell extract or a whole cell broth. The enzymes can be produced using recombinant microorganisms that have been engineered to express one or more saccharifying enzymes.
  • an H3A protein preparation that may be used for saccharification of pretreated lignocellulosic biomass is a crude preparation of enzymes produced by a genetically engineered strain of Trichoderma reesei, which includes a combination of cellulases and hemicellulases and is described in WO 201 1/038019, which is incorporated herein by reference.
  • the enzyme may be introduced with or separate from the saccharification enzyme consortium.
  • Chemical saccharification treatments can be used and are known to one skilled in the art, such as treatment with mineral acids including HCI and H2SO4 (US5580389, WO201 1002660, both incorporated by reference).
  • Sugars such as glucose, xylose and arabinose are released by saccharification of lignocellulosic biomass and these monomeric sugars provide a carbohydrate source for a biocatalyst used in a fermentation process.
  • the sugars are present in a biomass hydrolysate that is used as fermentation medium.
  • the fermentation medium can be composed solely of hydrolysate, or can include components additional to the hydrolysate such as sorbitol or mannitol at a final concentration of about 5 mM as described in US 7,629, 156, which is incorporated herein by reference.
  • the biomass hydrolysate may make up at least about 50% of the fermentation medium. In embodiments, about 10% of the final volume of fermentation broth is seed inoculum containing the fermentation microorganism.
  • the fermentation medium comprising lignocellulosic biomass hydrolysate contacted with a fermentation microorganism is fermented in a fermentation vessel, which is any vessel that holds the fermentation medium and at least one biocatalyst, and has valves, vents, and/or ports used in managing the fermentation process.
  • a fermentation vessel which is any vessel that holds the fermentation medium and at least one biocatalyst, and has valves, vents, and/or ports used in managing the fermentation process.
  • Any microorganism that produces a target product utilizing glucose and preferably also xylose, either naturally or through genetic engineering, may be used for fermentation of the fermentable sugars in the lignocellulosic biomass hydrolysate.
  • Target products that may be produced by fermentation include, for example, acids, alcohols, alkanes, alkenes, aromatics, aldehydes, ketones, biopolymers, proteins, peptides, amino acids, vitamins, antibiotics, and pharmaceuticals.
  • Alcohols include, but are not limited to methanol, ethanol, propanol, isopropanol, butanol, ethylene glycol, propanediol, butanediol, glycerol, erythritol, xylitol, mannitol, and sorbitol.
  • Acids may include acetic acid, formic acid, lactic acid, propionic acid, 3-hydroxypropionic acid, butyric acid, gluconic acid, itaconic acid, citric acid, succinic acid, 3- hydroxyproprionic acid, fumaric acid, maleic acid, and levulinic acid.
  • Amino acids may include glutamic acid, aspartic acid, methionine, lysine, glycine, arginine, threonine, phenylalanine and tyrosine.
  • Additional target products include methane, ethylene, acetone and industrial enzymes.
  • the fermentation of sugars in lignocellulosic biomass hydrolysate to target products can be carried out by one or more appropriate microorganisms, that are able to grow in medium containing biomass hydrolysate, in single or multistep fermentations.
  • Suitable microorganisms may be selected from bacteria, filamentous fungi and yeast.
  • the suitable microorganisms can be wild type microorganisms or recombinant microorganisms, and can include, for example, organisms belonging to the genera of Escherichia, Zymomonas, Saccharomyces, Candida, Pichia, Streptomyces, Bacillus, Lactobacillus, and Clostridiuma.
  • Suitable microorganisms include recombinant Escherichia coli, Zymomonas mobiiis, Bacillus stearothermophilus, Saccharomyces cerevisiae, Clostridia thermocellum, Thermoanaerobacterium saccharolyticum, and Pichia stipitis.
  • a microorganism can be selected or engineered to have higher tolerance to inhibitors present in biomass hydrolysate such as acetate.
  • the biocatalyst may produce ethanol as a target product, such as production of ethanol by Zymomonas mobiiis, or production of ethanol by Saccharomyces cerevisiae.
  • a target product such as production of ethanol by Zymomonas mobiiis, or production of ethanol by Saccharomyces cerevisiae.
  • Suitable engineered Zymomonas mobiiis and Saccharomyces cerevisiae strains are known in the art, for example as described in US 8,247,208 and US 8,669,076, both incorporated herein by reference.
  • Fermentation is carried out with conditions appropriate for the particular microorganism used. Adjustments can be made for conditions such as pH, temperature, oxygen content, and mixing. Conditions for fermentation of yeast and bacterial biocatalysts are well known in the art.
  • saccharification and fermentation may occur at the same time in the same vessel, called simultaneous saccharification and fermentation (SSF).
  • SSF simultaneous saccharification and fermentation
  • partial saccharification may occur prior to a period of concurrent saccharification and fermentation in a process called HSF (hybrid saccharification and fermentation).
  • seed culture For large scale fermentations, typically a smaller culture (seed culture) of the fermentation microorganism is first grown.
  • the seed culture is added to the fermentation medium as an inoculum typically in the range from about 2% to about 20% of the final volume.
  • fermentation by the fermentation microorganism produces a fermentation broth containing the target product made by the organism.
  • the fermentation broth may be a beer containing from about 6% to about 10% ethanol.
  • the fermentation broth contains water, solutes, solids from the hydrolysate medium and from biocatalyst metabolism of sugars in the hydrolysate medium, as well as the biocatalyst itself.
  • the target product may be isolated from the fermentation broth producing a depleted broth, which can be called whole stillage.
  • the broth is distilled, typically using a beer column, to generate an ethanol product stream and a whole stillage.
  • Distillation can be using any conditions known to one skilled in the art including at atmospheric or reduced pressure.
  • the distilled ethanol is further passed through a rectification column and molecular sieve to recover an ethanol product.
  • the target product may alternatively be removed in a later step such as from a solid or liquid fraction after separation of fermentation broth.
  • Whole stillage refers to a cloudy liquid remaining after fermentation of lignocellulosic biomass hydrolysate and subsequent distillation of a volatile target product that can be separated from the fermentation broth by distillation such as an alcohol, for example ethanol.
  • the whole stillage includes solids that are not readily dissolved during fermentation, soluble materials, oils, organic acids, salts, proteins, and various other components.
  • Whole stillage can contain approximately 5-12% suspended solids (7-20% total solids). Water and other volatile components can be evaporated from whole stillage to concentrate the whole stillage and produce thick whole stillage that is a concentrated whole stillage.
  • Thick whole stillage can have approximately 9-50% total solids. Thick whole stillage is prepared from whole stillage to allow adjusting viscosity of final formulations for landscape applications.
  • Solids can be separated from the whole stillage using a filter press, centrifugation, or other solid separation method. These solids are called filter cake.
  • the remaining liquid fraction containing solutes also called thin stillage, can be passed through an evaporation train to produce a syrup containing low- volatility solutes and water vapor containing high-volatility solutes, that may be condensed and further treated to remove contaminants, then recycled.
  • thin stillage refers to a liquid fraction resulting from solid/liquid separation of a whole stillage, fermentation broth, or product depleted fermentation broth.
  • thin stillage can be combined with filter cake solids to reconstitute a whole stillage.
  • Syrup can be recombined with filter cake solids to reconstitute a thick whole stillage.
  • Example syrup compositions produced from lignocellulosic biomass are described in US8,721 ,794, incorporated by reference herein.
  • Whole stillage, thin stillage, or syrup may be treated with sulfuric acid or treated with calcium oxide or sodium hydroxide and heat to reduce the concentration of acetamide in the resulting pretreated whole stillage as described in US 20160262389A1 , and herein incorporated by reference. Reduction of Acetamide in a Lignocellulosic Biomass Fermentation Process Stream
  • the pH of the process stream is or is adjusted to be between about pH 4 and about pH 7. In one embodiment, the pH of the process stream is or is adjusted to be between about pH 4 and about pH 8. In one embodiment, the pH of the process stream is or is adjusted to be between about pH 4 and about pH 7.5. In one embodiment, the pH of the process stream is or is adjusted to be between about pH 4.5 and about pH 7.5. In embodiments, the pH is or is adjusted to be between about pH 5 and about pH 7. In embodiments, the pH is or is adjusted to be between about pH 5 and about pH 8. Suitable methods for pH measurement and adjustment are well known in the art.
  • the contacting may take place at a temperature suitable for enzyme activity and thus reduction of acetamide.
  • the temperature is or is adjusted to be between about 35°C and about 70°C prior to and/or during said contacting.
  • the temperature is or is adjusted to be between about 40°C and about 60°C prior to and/or during said contacting.
  • the temperature is adjusted to be between about 40°C and about 50°C prior to and/or during said contacting.
  • the temperature is adjusted to be between about 50°C and about 60°C prior to and/or during said contacting.
  • the amount of acetamidase enzyme used and the time for enzyme treatment may be determined by standard methods and may be optimized for a process stream given the initial acetamide level and/or the desired decrease in acetamide level.
  • the contacting may occur for less than about 1 hr, for at least about 1 hr, at least about 3 hours, at least about 5 hours, at least about 15 hours, or at least about 20 hours.
  • suitable amounts of acetamidase enzyme can be readily determined.
  • the acetamidase enzyme is present at at least about 5 ppm of the process stream, at least about 7 ppm, at least about 10 ppm, at least about 20 ppm, at least about 50 ppm, at least about 100 ppm, at least about 250 ppm, at least about 500 ppm, at least about 700 ppm, or at least about 1000 ppm.
  • suitable conditions for contacting a process stream with an acetamidase enzyme can be readily identified by one of skill in the art using known techniques. It is contemplated that the contacting of a process stream disclosed herein may not necessarily occur under optimal conditions for maximizing enzyme activity, however, the contacting is carried out under conditions that allow for reduction of acetamide in the process stream. It will be also appreciated that the methods and compositions provided herein may be used in combination with other methods and compositions for lowering acetamide levels.
  • acetamide concentrations is known in the art and or described herein (see Example 3). Samples may be analyzed for acetamide concentration, for example, by gas chromatography.
  • an Agilent Technologies HP 6890 Gas Chromatograph system equipped with an auto- sampler and a flame ionization detector may be used with an Agilent Technologies J&W DB-FFAP (30 m x 250 pm ID x 0.25 pm nominal thickness column) gas chromatograph column and sulfolane as an external reference, as described in US20160262389A1 , and herein incorporated by reference.
  • measured increase in acetic acid may be indicative of lowered acetamide.
  • a process stream is contacted with an acetamidase enzyme to lower the level of acetamide to less than 80%, less than 70%, less than 60%, or less than 50% of the original level.
  • the acetamide is lowered to less than 45%, 40%, 35%, 30%, 35%, 10%, 15%, 10%, 5%, or to less than 1 % of the original level.
  • the acetamide is not detectable in the process stream after such contact.
  • Reduction of acetamide in any one process stream can likewise reduce acetamide in downstream process streams and in products and co-products. Accordingly, lowering of acetamide may be measured and confirmed in one or more downstream process streams and/or one or more products or coproducts.
  • Acetamidase enzymes which may be employed in the methods and compositions disclosed herein may include enzymes from a variety of sources, for example, enzymes from bacterial or fungal microorganisms.
  • Suitable acetamidase enzymes can be purchased commercially, isolated from the host (e.g. see Andrade, J, Karmali A, Carrondo, MA, and Frazao, C, J. Biol. Chem., "Structure of amidase from Pseudomonas aeruginosa showing a trapped acyl transfer reaction intermediate state", 282: 19598-19605, 2007), or the genes expressed recombinantly (e.g. see Cheong, TK and Oriel PJ, Cloning of a wide-spectrum amidase from Bacillus sterothermophilus BR388 in Escherichia coli and marked enhancement of amidase expression using directed evolution", Enzyme Microb. Tech., 26: 152-158, 2000) by methods well known in the art.
  • Enzymes which may be employed in methods and compositions herein may include amidases from bacterial or fungal microorganisms. Enzymes which may be employed in methods and compositions herein may include amidases from bacterial or fungal microorganisms. such as Pseudomonas, Emericella, Bacillus, Brevi bacterium, Aspergillus, Saccharomyces, Paenibacillus, Geobacillus, or Geomicrobium. Microbial amidases from Pseudomonas bacterium are available in the art and/or commercially. Examples include amidases from Pseudomonas aeruginosa (Sigma-Aldrich, St.
  • Enzymes may include one or more other amidases known in the art such as those from Bacillus sterothermophilus BR388 (Cheong, et al., 2000, Enzyme and Microbial Technol., 26: 152-158 incorporated by reference), Brevibacterium sp.
  • strain R312 (Mayaux, et al., 1990, J. Bacteriol. p.6764-6773), Bacillus sp. BR443 (Kim and Oriel, 2000, Enzyme and Microbial Technol. P.492-501 incorporated by reference), Aspergillus nidulans (US6548285 incorporated by reference; Genbank Accession No. HM015509.1 ), Aspergillus oryzae (US6548285 incorporated by reference), Aspergillus niger (EP0758020 incorporated by reference), Saccharomyces cerevisiae (US6548285 incorporated by reference), or Geomicrobium sp. JCM 19037 (Genbank Accession No.
  • Enzymes may include SEQ ID NO: 2, 4, or 5 (Table 1 ).
  • the acetamidase enzyme has at least about 70% identity, at least about 75% identity, at least about 80% identity, at least about 85% identity, at least about 90% identity, at least about 95% identity or is identical to SEQ ID NO: 2, 4, or 5.
  • the acetamidase enzyme has at least about 70% identity, at least about 75% identity, at least about 80% identity, at least about 85% identity, at least about 90% identity, at least about 95% identity or is identical to an acetamidase enzyme sequence from Pseudomonas, Emericella, Bacillus, Brevibacterium, Saccharomyces, Paenibacillus, Geobacillus, or Geomicrobium.
  • the acetamidase enzyme has at least about 70% identity, at least about 75% identity, at least about 80% identity, at least about 85% identity, at least about 90% identity, at least about 95% identity or is identical to an acetamidase enzymes sequence from Emericella, Bacillus, Brevibacterium, Saccharomyces, Paenibacillus, Geobacillus or Geomicrobium. In embodiments, the acetamidase enzyme has at least about 70% identity, at least about 75% identity, at least about 80% identity, at least about 85% identity, at least about 90% identity, at least about 95% identity or is identical to an acetamidase enzymes sequence from Geomicrobium.
  • the acetamidase enzyme has at least about 70% identity, at least about 75% identity, at least about 80% identity, at least about 85% identity, at least about 90% identity, at least about 95% identity or is identical to an acetamidase enzymes sequence from Geobacillus. In embodiments, the acetamidase enzyme has at least about 70% identity, at least about 75% identity, at least about 80% identity, at least about 85% identity, at least about 90% identity, at least about 95% identity or is identical to an acetamidase enzyme sequence from Geobacillus sterothermophilus.
  • the acetamidase enzyme has at least about 70% identity, at least about 75% identity, at least about 80% identity, at least about 85% identity, at least about 90% identity, at least about 95% identity or is identical to an acetamidase enzymes sequence from Psuedomonas. In embodiments, the acetamidase enzyme has at least about 70% identity, at least about 75% identity, at least about 80% identity, at least about 85% identity, at least about 90% identity, at least about 95% identity or is identical to an acetamidase enzymes sequence from Psuedomonas aeruginosa.
  • the acetamidase enzyme has at least about 70% identity, at least about 75% identity, at least about 80% identity, at least about 85% identity, at least about 90% identity, at least about 95% identity or is identical to SEQ ID NO: 2 or 4 or an active fragment thereof.
  • An amidase which reduces the amount of acetamide in a composition provided herein may be referred to as an acetamidase.
  • Acetamidase enzymes from Pseudomonas, Geobacillus, and Geomicrobium are in the nitrilase super family (EC 3.5.1 .4; Andrade, et al. J. Biol Chem. Vol 282: 27, pp. 19598-19605).
  • acetamidase enzymes are nitrilase super family enzymes.
  • Jack bean urease is a nickel metalloenzyme in the aminohydrolase superfamily (EC 3.5.1 .5; Balasubramanian A, Ponnuraj K, J. Mol. Biol. 400, p. 274 (2010).
  • an enzyme used in the methods herein is not in the aminohydrolase superfamily.
  • an enzyme used in the methods herein is not a urease.
  • the urease is not urease from Canavlia ensiformis (jack bean; Sigma-Aldrich, #111500; see Example 5 from US20160262389A1 , and herein incorporated by reference).
  • sequence information for suitable acetamidase enzymes is also available to one of skill in the art and/or are provided herein.
  • One of ordinary skill in the art can employ sequence information to construct recombinant host cells comprising nucleic acid sequences encoding target proteins (see, for example, WO 201 1/038019, US8153412B2, US8124399, US2009001 1463, incorporated by reference) such as acetamidases, and can use such host cells in methods to produce the acetamidase enzymes using methods known in the art and/or provided herein.
  • acetamidases from Geobacillus sterothermophilus SEQ ID: 2
  • Geomicrobium sp. SEQ ID: 4
  • Bacillus subtilis as a production host
  • Schallmey M, Singh A, Ward OP Schallmey M, Singh A, Ward OP, "Developments in the use of Bacillus species for industrial production", 50: 1 -17, 2004, incorporated by reference.
  • Bacillus expression systems strains, promoters, terminators, media and protein recovery methods
  • Acetamidase enzymes produced inside the cells can be recovered by typical cell lytic methods (e.g. treatment with lysozyme).
  • the acetamidase enzymes recovered from lysed cell broth can be concentrated and purified as necessary using methods known in the art.
  • suitable host cells may include fungal cells.
  • the fungal cell is a filamentous fungal cell selected from the group consisting of: Trichoderma reesei, Trichoderma longibrachiatum, Trichoderma viride, Trichoderma koningii, Trichoderma harzianum, Penicillium, Humicola, Humicola insolens, Humicola grisea, Chrysosporium, Chrysosporium lucknowense, Myceliophthora, Myceliophthora thermophilia, Gliocladium, Aspergillus, Fusarium, Neurospora, Hypocrea, Emericeiia, Aspergillus niger, Aspergillus awamori, Aspergillus aculeatus, and Aspergillus nidulans.
  • the host cell is a Trichoderma, Myceliophthora, Streptomyces or Bacillus host cell.
  • TCA 1 1 1 GTTCAAGCTGCTTCACCGCGGTTACACTGGCTTGATCCAATCTGG
  • the acetamidase enzymes in this example were produced in Bacillus subtilis using a standard replicating vector and promoter (see Babe, LM, Yoast, S, Dreyer, M and Schmidt, BF, "Heterologous expression of human granzyme K in Bacillus subtilis and characterization of its hydrolytic activity in vitro", Biotechol. Appl. Biochem., 27: 1 17-124, 1998, incorporated by reference). Specifically, transcription was driven by the B. subtilis aprE promoter fused to the start codon of synthetic nucleic acid sequences encoding the Geobacillus sterothermophilus (SEQ ID: 1 ) and Geomicrobium sp.
  • SEQ ID: 1 Geobacillus sterothermophilus
  • Acetamidase enzymes were produced in shake flasks using the B. subtilis strain (with nine native protease genes deleted), medium (with 10 ppm neomycin) and growth conditions essentially as described previously (Vogtentanz, G, Collier, KD, Bodo, M, Chang, JH, Day, AG, Estell, DA, Falcon, BC, Ganshaw, G, Jarnagin, AS, Kellis, JT Jr., Kolkman, MAB, Lai, CS, Meneses, R, Miller, JV, de Nobel, H, Power, S, Weyler, W, Wong, DL, and Schmidt, BF, "A Bacillus subtilis fusion protein system to produce soybean Bowman-Birk protease inhibitor", Protein Expr.
  • acetamidase produced inside the cells was recovered using lysozyme (Ready- LyseTM Lysozyme, Epicentre® Biotechnologies) essentially as described by the manufacturer.
  • the produced acetamidase enzymes were concentrated as needed using standard protein ultrafiltration systems.
  • Total reaction volumes were 1 .1 ml, consisting of 1 .0 ml of acetamide- containing buffer or dilute ammonia corn stover hydrolysate (end-of-fermentation liquor, or distilled end-of-fermentation liquor), plus 0.1 ml of the enzyme preparation (or 0.1 ml water control).
  • EnzA (Geobacillus sterothermophilus; SEQ ID NO: 2) was diluted in water to create stocks that would deliver 7 ppm, 70 ppm, or 700 ppm.
  • the reaction mixture was incubated at 50C in Eppendorf tubes. Each time point sample was quenched by adding 20 uL of 6N HCI.
  • the dilute ammonia pretreated corn stover was prepared as previously described (WO2015/017255, WO061 10901 , or US Patent Applications 20070031918, 20070031919, 2007-0031953, or 20070037259, all incorporated by reference).
  • the hydrolysate was generated by incubating a slurry of 10% solids, prepared in 50 mM citrate buffer to achieve pH 5.6, with Accellerase TRIO enzyme cocktail (Danisco US, Inc) for 48 hours at 50C, with mixing.
  • the pH was adjusted to pH 5.8 with sodium hydroxide.
  • a 10% addition of Zymomonas mobilis seed culture was inoculated and incubated at 33C for 48 hrs, with mixing, for fermentation of the monomeric sugars to ethanol.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

L'invention concerne un procédé et une composition qui se rapportent à l'hydrolyse enzymatique de l'acétamide dans un flux de procédé de fermentation de biomasse lignocellulosique à l'aide d'acétamidase EnzA provenant de Geobacillus stérothermophilus ou de Geomicrobium sp.
PCT/US2017/051442 2016-09-14 2017-09-14 Procédés basés sur la fermentation de biomasse lignocellulosique WO2018053058A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201662394572P 2016-09-14 2016-09-14
US62/394,572 2016-09-14

Publications (1)

Publication Number Publication Date
WO2018053058A1 true WO2018053058A1 (fr) 2018-03-22

Family

ID=59955713

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2017/051442 WO2018053058A1 (fr) 2016-09-14 2017-09-14 Procédés basés sur la fermentation de biomasse lignocellulosique

Country Status (1)

Country Link
WO (1) WO2018053058A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111334456A (zh) * 2020-03-18 2020-06-26 吉林省农业科学院 用于北方低温条件下秸秆腐解菌剂的制备方法及应用

Citations (56)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1992010581A1 (fr) 1990-12-10 1992-06-25 Genencor International, Inc. SACCHARIFICATION AMELIOREE DE CELLULOSE PAR CLONAGE ET AMPLIFICATION DU GENE DE β-GLUCOSIDASE DE TRICHODERMA REESEI
US5580389A (en) 1993-03-26 1996-12-03 Arkenol, Inc. Method of separating acids and sugars resulting from strong acid hydrolysis
EP0758020A2 (fr) 1995-08-03 1997-02-12 Gist-Brocades B.V. Des gènes homologues à amdS pour l'utilisation comme marqueurs sélectionnables
WO2003027306A2 (fr) 2001-09-21 2003-04-03 Genencor International, Inc. Beta-glucosidase bgl3 et acides nucleiques la codant
WO2003052054A2 (fr) 2001-12-18 2003-06-26 Genencor International, Inc. Bgl5 béta-glucosidase et acides nucléiques codant ce dernier
WO2003052057A2 (fr) 2001-12-18 2003-06-26 Genencor International, Inc. Endoglucanase egvi et acides nucleiques la codant
WO2003052055A2 (fr) 2001-12-18 2003-06-26 Genencor International, Inc. Endoglucanase egvii et acides nucleiques la codant
WO2003052056A2 (fr) 2001-12-18 2003-06-26 Genencor International, Inc. Endoglucanase egviii et acides nucleiques la codant
WO2003052118A2 (fr) 2001-12-18 2003-06-26 Genencor International, Inc. Beta-glucosidase bgl4 et acides nucleiques la codant
WO2004016760A2 (fr) 2002-08-16 2004-02-26 Genencor International, Inc. Nouveau variants de cellulases hyprocrea jecorina cbh1
WO2004043980A2 (fr) 2002-11-07 2004-05-27 Genencor International, Inc. Beta glucosidase bgl6 et acides nucleiques codant celle-ci
WO2004048592A2 (fr) 2002-11-21 2004-06-10 Genencor International, Inc. Beta-glucosidase bgl7 et acides nucleiques codant cette sequence
WO2005001036A2 (fr) 2003-05-29 2005-01-06 Genencor International, Inc. Nouveaux genes de trichoderma
WO2005001065A2 (fr) 2003-04-01 2005-01-06 Genencor International, Inc. Cbh1.1 d'humicola grisea variant
WO2005028636A2 (fr) 2003-03-21 2005-03-31 Genencor International, Inc. Cellulases s'homologues cbh1 et de variants cbh1
WO2005093050A2 (fr) 2004-03-25 2005-10-06 Genencor International, Inc. Proteine de fusion cellulase et construction de fusion cellulase heterologue codant ladite proteine
WO2005093073A1 (fr) 2004-03-25 2005-10-06 Genencor International, Inc. Proteine de fusion de cellulase exo-endo
WO2006040358A2 (fr) * 2004-10-15 2006-04-20 Dsm Ip Assets B.V. Genes amds homologues utilises comme marqueur selectionnable
WO2006074005A2 (fr) 2004-12-30 2006-07-13 Genencor International, Inc. Nouveaux variants de cellulases d'hypocrea jecorina cbh2
WO2006110901A2 (fr) 2005-04-12 2006-10-19 E. I. Du Pont De Nemours And Company Traitement de biomasse en vue d'obtenir des sucres fermentescibles
US20070031919A1 (en) 2005-04-12 2007-02-08 Dunson James B Jr Treatment of biomass to obtain a target chemical
US20080008783A1 (en) 2006-05-01 2008-01-10 Board Of Trustees Of Michigan University Process for the treatment of lignocellulosic biomass
US20090011463A1 (en) 2004-04-09 2009-01-08 Walter Weyler Pcka Modifications and Enhanced Protein Expression in Bacillus
US7629156B2 (en) 2006-09-28 2009-12-08 E.I. Du Pont De Nemours And Company Ethanol production in fermentation of mixed sugars containing xylose
WO2009149202A2 (fr) 2008-06-06 2009-12-10 Danisco Us Inc., Genencor Division Compositions et procédés comprenant des variants de cellulase avec une affinité réduite pour les matières non cellulosiques
WO2010113129A2 (fr) 2009-03-31 2010-10-07 Chemtex Italia S.R.L. Procédé de prétraitement de biomasse perfectionné
WO2010113130A2 (fr) 2009-03-31 2010-10-07 Chemtex Italia S.R.L. Procédé amélioré pour l'hydrolyse rapide d'une biomasse à haute teneur en solides
WO2010141779A1 (fr) 2009-06-03 2010-12-09 Danisco Us Inc. Variants de cellulose à expression, activité et/ou stabilité améliorée(s), et utilisation associée
WO2011002660A1 (fr) 2009-07-01 2011-01-06 Wisconsin Alumni Research Foundation Hydrolyse de biomasse
WO2011038019A2 (fr) 2009-09-23 2011-03-31 Danisco Us Inc. Nouvelles enzymes glycosyl hydrolases et utilisations de celles-ci
WO2011046818A2 (fr) * 2009-10-12 2011-04-21 E. I. Du Pont De Nemours And Company Prétraitement à l'ammoniac de biomasse pour profil d'inhibiteur amélioré
WO2011063308A2 (fr) 2009-11-20 2011-05-26 Danisco Us Inc. Variants de bêta-glucosidase à propriétés améliorées
WO2011153276A2 (fr) 2010-06-01 2011-12-08 California Institute Of Technology Enzymes cellobiohydrolases chimères fonctionnelles et stables de classe i
US8124399B2 (en) 2002-03-29 2012-02-28 Danisco Us Inc. Enhanced protein expression in Bacillus
US8153412B2 (en) 2007-11-05 2012-04-10 Danisco Us Inc. Variants of Bacillus sp. TS-23 alpha-amylase with altered properties
WO2012103220A1 (fr) 2011-01-26 2012-08-02 Abengoa Bioenergy New Technologies, Inc. Procédé et appareil pour le traitement d'une matière première cellulosique
US8247208B2 (en) 2008-12-22 2012-08-21 Alliance For Sustainable Energy Llc Zymomonas with improved xylose utilization in stress conditions
WO2012125925A2 (fr) 2011-03-17 2012-09-20 Danisco Us Inc. Procédé de réduction de la viscosité dans les procédés de saccharification
WO2012125951A1 (fr) 2011-03-17 2012-09-20 Danisco Us Inc Compositions de cellulase et procédés d'utilisation de celles-ci pour conversion améliorée de biomasse lignocellulosique en sucres fermentescibles
WO2012125937A2 (fr) 2011-03-17 2012-09-20 Danisco Us Inc. Enzymes glycosyl hydrolase et leurs utilisations pour une hydrolyse de la biomasse
US8545633B2 (en) 2009-08-24 2013-10-01 Abengoa Bioenergy New Technologies, Inc. Method for producing ethanol and co-products from cellulosic biomass
US20140016408A1 (en) 2010-07-02 2014-01-16 Changhyun LEE Nonvolatile memory devices having vertically integrated nonvolatile memory cell sub-strings therein
US8669076B1 (en) 2013-03-11 2014-03-11 E I Du Pont De Nemours And Company Cow rumen xylose isomerases active in yeast cells
WO2014070837A1 (fr) 2012-10-31 2014-05-08 Danisco Us Inc. Bêta-glucosidase provenant de magnaporthe grisea
WO2014070841A1 (fr) 2012-10-31 2014-05-08 Danisco Us Inc. Compositions et procédés d'utilisation
WO2014070844A1 (fr) 2012-10-31 2014-05-08 Danisco Us Inc. Beta-glucosidase provenant de neurospora crassa
US8721794B2 (en) 2010-04-28 2014-05-13 E I Du Pont De Nemours And Company Production of high solids syrup from lignocellulosic biomass hydrolysate fermentation broth
WO2014093287A1 (fr) 2012-12-12 2014-06-19 Danisco Us Inc. Variants de cellobiohydrolases
WO2014093294A1 (fr) 2012-12-12 2014-06-19 Danisco Us Inc. Variants de cellobiohydrolases
WO2014093281A1 (fr) 2012-12-12 2014-06-19 Danisco Us Inc. Variants de cellobiohydrolases
WO2014093275A1 (fr) 2012-12-12 2014-06-19 Danisco Us Inc. Variants de cellobiohydrolases
WO2014093282A1 (fr) 2012-12-12 2014-06-19 Danisco Us Inc. Variants de cellobiohydrolases
WO2015017256A1 (fr) 2013-07-29 2015-02-05 Danisco Us Inc. Enzymes variantes
WO2015084596A1 (fr) 2013-12-04 2015-06-11 Danisco Us Inc. Compositions comportant un polypeptide à activité béta-glucosidase et leurs procédés d'utilisation
WO2016069541A1 (fr) 2014-10-27 2016-05-06 Danisco Us Inc Compositions et procédés relatifs à une bêta-glucosidase
WO2016145297A1 (fr) * 2015-03-12 2016-09-15 E I Du Pont De Nemours And Company Co-produits d'un procédé de fermentation d'une biomasse lignocellulosique pour application de type aménagement paysager

Patent Citations (68)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1992010581A1 (fr) 1990-12-10 1992-06-25 Genencor International, Inc. SACCHARIFICATION AMELIOREE DE CELLULOSE PAR CLONAGE ET AMPLIFICATION DU GENE DE β-GLUCOSIDASE DE TRICHODERMA REESEI
US5580389A (en) 1993-03-26 1996-12-03 Arkenol, Inc. Method of separating acids and sugars resulting from strong acid hydrolysis
EP0758020A2 (fr) 1995-08-03 1997-02-12 Gist-Brocades B.V. Des gènes homologues à amdS pour l'utilisation comme marqueurs sélectionnables
US6548285B1 (en) 1995-08-03 2003-04-15 Dsm N.V. Polynucleotides encoding Aspergillus Niger and Penicillium Chrysogenum acetamidases and methods of use as selectable markers
WO2003027306A2 (fr) 2001-09-21 2003-04-03 Genencor International, Inc. Beta-glucosidase bgl3 et acides nucleiques la codant
WO2003052054A2 (fr) 2001-12-18 2003-06-26 Genencor International, Inc. Bgl5 béta-glucosidase et acides nucléiques codant ce dernier
WO2003052057A2 (fr) 2001-12-18 2003-06-26 Genencor International, Inc. Endoglucanase egvi et acides nucleiques la codant
WO2003052055A2 (fr) 2001-12-18 2003-06-26 Genencor International, Inc. Endoglucanase egvii et acides nucleiques la codant
WO2003052056A2 (fr) 2001-12-18 2003-06-26 Genencor International, Inc. Endoglucanase egviii et acides nucleiques la codant
WO2003052118A2 (fr) 2001-12-18 2003-06-26 Genencor International, Inc. Beta-glucosidase bgl4 et acides nucleiques la codant
US8124399B2 (en) 2002-03-29 2012-02-28 Danisco Us Inc. Enhanced protein expression in Bacillus
WO2004016760A2 (fr) 2002-08-16 2004-02-26 Genencor International, Inc. Nouveau variants de cellulases hyprocrea jecorina cbh1
WO2004043980A2 (fr) 2002-11-07 2004-05-27 Genencor International, Inc. Beta glucosidase bgl6 et acides nucleiques codant celle-ci
WO2004048592A2 (fr) 2002-11-21 2004-06-10 Genencor International, Inc. Beta-glucosidase bgl7 et acides nucleiques codant cette sequence
WO2005028636A2 (fr) 2003-03-21 2005-03-31 Genencor International, Inc. Cellulases s'homologues cbh1 et de variants cbh1
WO2005001065A2 (fr) 2003-04-01 2005-01-06 Genencor International, Inc. Cbh1.1 d'humicola grisea variant
WO2005001036A2 (fr) 2003-05-29 2005-01-06 Genencor International, Inc. Nouveaux genes de trichoderma
WO2005093050A2 (fr) 2004-03-25 2005-10-06 Genencor International, Inc. Proteine de fusion cellulase et construction de fusion cellulase heterologue codant ladite proteine
WO2005093073A1 (fr) 2004-03-25 2005-10-06 Genencor International, Inc. Proteine de fusion de cellulase exo-endo
US20090011463A1 (en) 2004-04-09 2009-01-08 Walter Weyler Pcka Modifications and Enhanced Protein Expression in Bacillus
WO2006040358A2 (fr) * 2004-10-15 2006-04-20 Dsm Ip Assets B.V. Genes amds homologues utilises comme marqueur selectionnable
WO2006074005A2 (fr) 2004-12-30 2006-07-13 Genencor International, Inc. Nouveaux variants de cellulases d'hypocrea jecorina cbh2
US7781191B2 (en) 2005-04-12 2010-08-24 E. I. Du Pont De Nemours And Company Treatment of biomass to obtain a target chemical
US20070031953A1 (en) 2005-04-12 2007-02-08 Dunson James B Jr Treatment of biomass to obtain ethanol
US7998713B2 (en) 2005-04-12 2011-08-16 E. I. Du Pont De Nemours And Company Treatment of biomass to obtain ethanol
US7932063B2 (en) 2005-04-12 2011-04-26 E. I. Du Pont De Nemours And Company Treatment of biomass to obtain fermentable sugars
US20070031918A1 (en) 2005-04-12 2007-02-08 Dunson James B Jr Treatment of biomass to obtain fermentable sugars
US20070031919A1 (en) 2005-04-12 2007-02-08 Dunson James B Jr Treatment of biomass to obtain a target chemical
US20070037259A1 (en) 2005-04-12 2007-02-15 Hennessey Susan M Integration of alternative feedstreams for biomass treatment and utilization
WO2006110901A2 (fr) 2005-04-12 2006-10-19 E. I. Du Pont De Nemours And Company Traitement de biomasse en vue d'obtenir des sucres fermentescibles
US20080008783A1 (en) 2006-05-01 2008-01-10 Board Of Trustees Of Michigan University Process for the treatment of lignocellulosic biomass
US7915017B2 (en) 2006-05-01 2011-03-29 Board Of Trustees Of Michigan State University Process for the treatment of lignocellulosic biomass
US7629156B2 (en) 2006-09-28 2009-12-08 E.I. Du Pont De Nemours And Company Ethanol production in fermentation of mixed sugars containing xylose
US8153412B2 (en) 2007-11-05 2012-04-10 Danisco Us Inc. Variants of Bacillus sp. TS-23 alpha-amylase with altered properties
WO2009149202A2 (fr) 2008-06-06 2009-12-10 Danisco Us Inc., Genencor Division Compositions et procédés comprenant des variants de cellulase avec une affinité réduite pour les matières non cellulosiques
US8247208B2 (en) 2008-12-22 2012-08-21 Alliance For Sustainable Energy Llc Zymomonas with improved xylose utilization in stress conditions
WO2010113130A2 (fr) 2009-03-31 2010-10-07 Chemtex Italia S.R.L. Procédé amélioré pour l'hydrolyse rapide d'une biomasse à haute teneur en solides
WO2010113129A2 (fr) 2009-03-31 2010-10-07 Chemtex Italia S.R.L. Procédé de prétraitement de biomasse perfectionné
WO2010141779A1 (fr) 2009-06-03 2010-12-09 Danisco Us Inc. Variants de cellulose à expression, activité et/ou stabilité améliorée(s), et utilisation associée
WO2011002660A1 (fr) 2009-07-01 2011-01-06 Wisconsin Alumni Research Foundation Hydrolyse de biomasse
US8545633B2 (en) 2009-08-24 2013-10-01 Abengoa Bioenergy New Technologies, Inc. Method for producing ethanol and co-products from cellulosic biomass
WO2011038019A2 (fr) 2009-09-23 2011-03-31 Danisco Us Inc. Nouvelles enzymes glycosyl hydrolases et utilisations de celles-ci
WO2011046818A2 (fr) * 2009-10-12 2011-04-21 E. I. Du Pont De Nemours And Company Prétraitement à l'ammoniac de biomasse pour profil d'inhibiteur amélioré
WO2011063308A2 (fr) 2009-11-20 2011-05-26 Danisco Us Inc. Variants de bêta-glucosidase à propriétés améliorées
US8721794B2 (en) 2010-04-28 2014-05-13 E I Du Pont De Nemours And Company Production of high solids syrup from lignocellulosic biomass hydrolysate fermentation broth
WO2011153276A2 (fr) 2010-06-01 2011-12-08 California Institute Of Technology Enzymes cellobiohydrolases chimères fonctionnelles et stables de classe i
US20140016408A1 (en) 2010-07-02 2014-01-16 Changhyun LEE Nonvolatile memory devices having vertically integrated nonvolatile memory cell sub-strings therein
WO2012103220A1 (fr) 2011-01-26 2012-08-02 Abengoa Bioenergy New Technologies, Inc. Procédé et appareil pour le traitement d'une matière première cellulosique
WO2012125925A2 (fr) 2011-03-17 2012-09-20 Danisco Us Inc. Procédé de réduction de la viscosité dans les procédés de saccharification
WO2012125951A1 (fr) 2011-03-17 2012-09-20 Danisco Us Inc Compositions de cellulase et procédés d'utilisation de celles-ci pour conversion améliorée de biomasse lignocellulosique en sucres fermentescibles
WO2012125937A2 (fr) 2011-03-17 2012-09-20 Danisco Us Inc. Enzymes glycosyl hydrolase et leurs utilisations pour une hydrolyse de la biomasse
US20140106408A1 (en) 2011-03-17 2014-04-17 Danisco Us Inc. Glycosyl hydrolase enzymes and uses thereof for biomass hydrolysis
WO2014070844A1 (fr) 2012-10-31 2014-05-08 Danisco Us Inc. Beta-glucosidase provenant de neurospora crassa
WO2014070841A1 (fr) 2012-10-31 2014-05-08 Danisco Us Inc. Compositions et procédés d'utilisation
WO2014070837A1 (fr) 2012-10-31 2014-05-08 Danisco Us Inc. Bêta-glucosidase provenant de magnaporthe grisea
WO2014093275A1 (fr) 2012-12-12 2014-06-19 Danisco Us Inc. Variants de cellobiohydrolases
WO2014093287A1 (fr) 2012-12-12 2014-06-19 Danisco Us Inc. Variants de cellobiohydrolases
WO2014093294A1 (fr) 2012-12-12 2014-06-19 Danisco Us Inc. Variants de cellobiohydrolases
WO2014093281A1 (fr) 2012-12-12 2014-06-19 Danisco Us Inc. Variants de cellobiohydrolases
WO2014093282A1 (fr) 2012-12-12 2014-06-19 Danisco Us Inc. Variants de cellobiohydrolases
US8669076B1 (en) 2013-03-11 2014-03-11 E I Du Pont De Nemours And Company Cow rumen xylose isomerases active in yeast cells
WO2015017256A1 (fr) 2013-07-29 2015-02-05 Danisco Us Inc. Enzymes variantes
WO2015017255A1 (fr) 2013-07-29 2015-02-05 Danisco Us Inc. Enzymes variantes
WO2015017254A1 (fr) 2013-07-29 2015-02-05 Danisco Us Inc. Variants enzymatiques
WO2015084596A1 (fr) 2013-12-04 2015-06-11 Danisco Us Inc. Compositions comportant un polypeptide à activité béta-glucosidase et leurs procédés d'utilisation
WO2016069541A1 (fr) 2014-10-27 2016-05-06 Danisco Us Inc Compositions et procédés relatifs à une bêta-glucosidase
WO2016145297A1 (fr) * 2015-03-12 2016-09-15 E I Du Pont De Nemours And Company Co-produits d'un procédé de fermentation d'une biomasse lignocellulosique pour application de type aménagement paysager
US20160262389A1 (en) 2015-03-12 2016-09-15 E I Du Pont De Nemours And Company Co-products of lignocellulosic biomass process for landscape application

Non-Patent Citations (30)

* Cited by examiner, † Cited by third party
Title
"Enzyme Nomenclature", vol. 1, 1993, ACADEMIC PRESS
"ENZYME NOMENCLATURE", vol. 2, 1994
"ENZYME NOMENCLATURE", vol. 3, 1995
"ENZYME NOMENCLATURE", vol. 4, 1997
"ENZYME NOMENCLATURE", vol. 5
ANDRADE ET AL., J. BIOL CHEM., vol. 282, no. 27, pages 19598 - 19605
ANDRADE ET AL., JBC, vol. 282, no. 27, 2007, pages 19598 - 19605
ANDRADE, J; KARMALI A; CARRONDO, MA; FRAZAO, C: "Structure of amidase from Pseudomonas aeruginosa showing a trapped acyl transfer reaction intermediate state", J. BIOL. CHEM., vol. 282, 2007, pages 19598 - 19605
BABE, LM; YOAST, S; DREYER, M; SCHMIDT, BF: "Heterologous expression of human granzyme K in Bacillus subtilis and characterization of its hydrolytic activity in vitro", BIOTECHOL. APPL. BIOCHEM., vol. 27, 1998, pages 117 - 124
BALASUBRAMANIAN A; PONNURAJ K, J. MOL. BIOL., vol. 400, 2010, pages 274
CANTAREL ET AL., NUCLEIC ACIDS RES., vol. 37, 2009, pages D233 - 238
CHEONG ET AL., ENZYME AND MICROBIAL TECHNOL., vol. 26, 2000, pages 152 - 158
CHEONG TAE KYOU ET AL: "Cloning of a wide-spectrum amidase from Bacillus stearothermophilus BR388 in Escherichia coli and marked enhancement of amidase expression using directed evolution", ENZYME AND MICROBIAL TECHNOLOGY, STONEHAM, MA, US, vol. 26, no. 2-4, 1 February 2000 (2000-02-01), pages 152 - 158, XP002304495, ISSN: 0141-0229, DOI: 10.1016/S0141-0229(99)00150-7 *
CHEONG, TK; ORIEL PJ: "Cloning of a wide-spectrum amidase from Bacillus sterothermophilus BR388 in Escherichia coli and marked enhancement of amidase expression using directed evolution", ENZYME MICROB. TECH., vol. 26, 2000, pages 152 - 158, XP002304495, DOI: doi:10.1016/S0141-0229(99)00150-7
DATABASE UniProt [online] 3 September 2014 (2014-09-03), "RecName: Full=Aliphatic amidase {ECO:0000256|HAMAP-Rule:MF_01242}; EC=3.5.1.4 {ECO:0000256|HAMAP-Rule:MF_01242}; AltName: Full=Acylamide amidohydrolase {ECO:0000256|HAMAP-Rule:MF_01242};", XP002775664, retrieved from EBI accession no. UNIPROT:A0A061NI82 Database accession no. A0A061NI82 *
DATABASE UniProt [online] 30 May 2003 (2003-05-30), "RecName: Full=Aliphatic amidase; EC=3.5.1.4; AltName: Full=Acylamide amidohydrolase; AltName: Full=Wide spectrum amidase;", XP002775663, retrieved from EBI accession no. UNIPROT:Q9RQ17 Database accession no. Q9RQ17 *
EUR. J. BIOCHEM., vol. 223, 1994, pages 1 - 5
EUR. J. BIOCHEM., vol. 232, 1995, pages 1 - 6
EUR. J. BIOCHEM., vol. 237, 1996, pages 1 - 5
EUR. J. BIOCHEM., vol. 250, 1997, pages 1 - 6
EUR. J. BIOCHEM., vol. 264, 1999, pages 610 - 650
HAKOUVAINEN ET AL., BIOCHEMISTRY, vol. 35, 1996, pages 9617 - 24
KIM; ORIEL, ENZYME AND MICROBIAL TECHNOL. P., 2000, pages 492 - 501
LO LEGGIO ET AL., FEBS LETT, vol. 509, 2001, pages 303 - 308
LYND, L. R. ET AL., MICROBIOL. MOL. BIOL. REV., vol. 66, 2002, pages 506 - 577
MAYAUX ET AL., J. BACTERIOL., 1990, pages 6764 - 6773
SCHALLMEY M; SINGH A; WARD OP, DEVELOPMENTS IN THE USE OF BACILLUS SPECIES FOR INDUSTRIAL PRODUCTION, vol. 50, 2004, pages 1 - 17
SCHMIDT ET AL., BIOCHEMISTRY, vol. 38, 1999, pages 2403 - 2412
SHANKER ET AL., ARCH. MICROBIOL., vol. 154, 1990, pages 192 - 198
VOGTENTANZ, G; COLLIER, KD; BODO, M; CHANG, JH; DAY, AG; ESTELL, DA; FALCON, BC; GANSHAW, G; JARNAGIN, AS; KELLIS, JT JR.: "A Bacillus subtilis fusion protein system to produce soybean Bowman-Birk protease inhibitor", PROTEIN EXPR. PURIF., vol. 55, 2007, pages 40 - 52, XP022206975, DOI: doi:10.1016/j.pep.2007.05.001

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111334456A (zh) * 2020-03-18 2020-06-26 吉林省农业科学院 用于北方低温条件下秸秆腐解菌剂的制备方法及应用

Similar Documents

Publication Publication Date Title
US20190161772A1 (en) Methods for improving the efficiency of simultaneous saccharification and fermentation reactions
US11421256B2 (en) Process for enzymatic hydrolysis of lignocellulosic material and fermentation of sugars
Bhatia et al. An economic and ecological perspective of ethanol production from renewable agro waste: a review
EP2563924B1 (fr) Procédé de séparation liquide/solide de bouillon de fermentation d'hydrolysat de biomasse lignocellulosique
AU2016201077B2 (en) Production of high solids syrup from lignocellulosic biomass hydrolysate fermentation broth
EP2478111B1 (fr) Saccharification et fermentation simultanées, mais cloisonnées, de la biomasse
Sarangi et al. Recent advances in consolidated bioprocessing for microbe-assisted biofuel production
Silva et al. A review of holocellulase production using pretreated lignocellulosic substrates
CN112204151A (zh) 从碳水化合物材料产生糖的方法
CN111278986A (zh) 用于酶促水解木质纤维素材料和发酵糖的方法
WO2018053058A1 (fr) Procédés basés sur la fermentation de biomasse lignocellulosique
CN113544280A (zh) 用于产生发酵液的方法
EP3262164B1 (fr) Compositions dégradant l'hémicellulose et utilisations de celles-ci
AU2015261652B2 (en) Methods for improving the efficiency of simultaneous saccharification and fermentation reactions
CN111225982A (zh) 用于木质纤维素材料的酶促水解和糖发酵的方法
TOZLUOĞLU Bioethanol production from common reed (Phragmites australis): Enzymatic hydrolysis and fermentation
AU2012203986B2 (en) Efficient lignocellulose hydrolysis with integrated enzyme production
WO2010099406A9 (fr) Procédés de conversion de polysaccharides végétaux
FONSECA DEVELOPMENT OF A (HEMI) CELLULASES PRODUCTION PROCESS UNDER
Prakash et al. Utilization of Lignocellulosic Biomass for Biobutanol Production: A Review

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17772239

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 17772239

Country of ref document: EP

Kind code of ref document: A1