WO2018030738A1 - Method for preparation of recombinant glycoprotein having n-linked glycan antenna structure reinforced by inhibition of polylactosamine biosynthesis - Google Patents

Abstract

In the present invention, it was confirmed that polylactosamine was reduced in recombinant human-derived erythropoietin produced by inhibiting (knocking down) the expression of the β3gnt2 gene, which is involved in polylactosamine biosynthesis, or from a cell line with the knocked out β3gnt2 gene, and thus triple and/or quadruple antenna structures of N-glycan was increased, leading to positive roles in increasing the half-life of glycoprotein and the efficacy of glycoprotein. Therefore, it was confirmed that a recombinant glycoprotein with an increased half-life can be produced through the method of the present invention.

Description

Method for producing recombinant glycoproteins with enhanced N-linked sugar chain antenna structure by inhibiting polylactosamine biosynthesis

The present invention provides a method for inhibiting the expression of the β3gnt2 (UDP-GlcNAc: betaGal beta-1,3-N-acetylglucosaminyltransferase 2) gene by knocking down or knocking out the β3gnt2 gene. It relates to a method for producing glycoproteins having increased half-life by inhibiting biosynthesis of samine.

Glycosylation is a major post-translational formula in mammalian cells and is divided into two classes, N- and O-linked glycosylation. N-linked glycosylation is attached to Asn (Asn-X-Ser / Thr motif) in many glycoproteins. Glycation affects enzyme activity, protein stability, and immunogenicity.

Sialic acid, a generic term for acyl derivatives of neuraminic acid (Neu), is an essential component of the sugar precursor composition required for the saccharification process. So far, about 50 kinds of sialic acid added sugar chain precursors have been found in nature. It became. Sialic acid plays an important role in cellular phenomena in mammals, including intercellular interactions, the role of precursors in determining signals in cells, and the stabilization of glycoproteins. Sialic acid was first isolated from mucin in the bovine salivary gland by Blix in 1936 and is known as an acidic sugar consisting of 9 carbons and having a COOH- group. In addition, sialic acid is reported to have 23 kinds of sialic acid due to differences in substituents, and these are known to exhibit a specific distribution in a species or tissue. In higher animals, sialic acid is linked to α-glycosidic bonds by the action of sialic acid transferases specific for Gal, GlcNAc, GalNAc and sialic acid of glycoproteins, glycolipids, oligosaccharide sugar chains.

Since sialic acid of the complex sugar sugar chain is located at the far end of the sugar chain structure on the surface of the cell membrane, it is expected to be directly involved in contact between the cell and the extracellular environment, and long-lasting lifespan of blood cells or glycoproteins in body fluids It is known to be shortened by the removal of sialic acid. As an example, when sialic acid in erythrocyte membranes is removed, galactose is exposed to the cell surface and binds to a receptor lectin that specifically binds to galactose on the Kupffer cell surface, thereby receptor mediated receptors. It is removed from the circulatory system by -mediated endocytosis, and sialic acid-free asialo glycoproteins are also bound by lectins on the surface of hepatocytes and removed from the circulatory system in a similar way as red blood cells. In addition, glycoproteins with sial binding, alpha-antitrypsin, cholinesterase, chorionic gonadotropin, CTLA4Ig, factor VIII, and gamma- Glamma-glutamyltransferase, granulocyte colony-stimulating factor (G-CSF), and luteinizing hormone (LH) are not sialic acid bound for sialic acid-bound glycoproteins. It has been reported that the half-life of glycoproteins is significantly increased compared to that (Ngantung FA. Et al., 2006, Biotechnol. Bioeng 95 (1), 106-119).

Among glycoproteins with sial binding, erythropoietin (EPO) is a glycoprotein hormone that induces red blood cell production, and recombinant EPO is used as an anemia treatment agent. Wild-type EPO has three N-linked sugar chains and one O-linked sugar chain, up to four sialic acids in one N-linked sugar chain, and up to two sialic acids in one O-linked sugar chain. It is possible to bind potentially one molecule of EPO to a total of 14 sialic acids. Similarly to the glycoprotein, when sialic acid is bound to the sugar chain in the EPO protein, it prevents the degradation of EPO in the liver by preventing binding to the desialalo glycoprotein receptor present in the liver.

Polylactosamine is one of the basic structures of oligosaccharides present on glycoproteins as a structure (Galbeta1-4GlcNAcbeta1-3) n, in which N-acetylglucosamine (GlcNAc) and galactose (Galactose) are continuously repeated. For example, in model glycoproteins such as EPO, polylactosamine accounts for about 10-20% of the total N-glycans. In mouse experiments, polylactosamine-containing EPO is used for galactose on the surface of glycoproteins by sialic acid. It has been reported that body half-life is significantly reduced regardless of its protective effect.

(Figure 1. Structural Features of Polylactosamines)

With the discovery of restriction enzymes that recognize and cut specific sequences of DNA in the 1970s, genetic engineering has evolved rapidly over the years. However, the limitation of genetic engineering techniques using restriction enzymes was clear. Specifically, the restriction enzyme has a problem that can distinguish only about 46 (4,096) sequence pairs because the length of the recognizable gene sequence is about 6 to 8 very short. The CRISPR / CAS9 system, on the other hand, lacks these limitations and can theoretically be applied to higher organisms beyond humans.

The CRISPR / CAS9 system is a genome editing method called the clustered regularly interspaced short palindromic repeat (CRISPR) gene shear, which is an RNA (gRNA) that specifically binds to a specific sequence and a scissors that cut a specific sequence. It consists of. The CRISPR / CAS9 system enables knock-out that can inhibit the function of specific genes by introducing plasmid DNA into cells or animals.

The CRISPR / CAS9 system was discovered by scientists just a few years ago and is a very old way for single-celled organisms, such as bacteria, to protect themselves from bacteriophages. The organism evolved over millions of years, cutting off the DNA of the bacteriophage, attaching it to its own genes, and then surviving through adaptive immunity, which were studied in a simple and straightforward way that allows the lab to quickly edit the organism's DNA. Specifically, the original CRISPR / CAS9 system stores a portion of the virus's DNA previously invaded in its genome, and then retrieves the information when the virus invades and finds and cuts only the viral DNA. Protection mechanism. By using this in genomic engineering, a primer is produced that searches for the nucleotide sequence of a specific gene, paired with Cas9 enzyme, a cleavage enzyme, and attached to a target DNA nucleotide sequence to cause DNA cleavage. As a result, mutations occur during DNA repair.

Therefore, the present inventors knock-down genes involved in polylactosamine synthesis by using siRNA to reduce the content of polylactosamine in glycoproteins as a method for enhancing the degradation resistance of glycoproteins and increasing the activity in the body. The knock-down CHO cell line and the CRISPR / CAS9 system were used to construct a CHO cell line that knocked out genes involved in polylactosamine synthesis, and the glycoprotein produced therefrom was polylactosamine. Tri- and / or tetra-antennary structures increased with the decrease, thereby increasing the half-life of the glycoprotein, thus completing the present invention by confirming that it may play a positive role in the efficacy of the glycoprotein. It was.

It is an object of the present invention to provide a method for producing a glycoprotein with increased half-life from a cell line in which biosynthesis of polylactosamine is inhibited.

In order to achieve the above object, the present invention provides a method for producing a recombinant cell line producing a recombinant glycoprotein with increased half-life, comprising the step of inhibiting the biosynthesis of polylactosamine in the cell line producing a glycoprotein do.

The present invention also provides a recombinant cell line prepared by the above method.

In addition, the present invention

1) culturing the recombinant cell line; And

2) provides a method for producing a recombinant glycoprotein having an increased half-life comprising the step of separating the recombinant glycoprotein from the culture of step 1).

The present invention also provides a recombinant glycoprotein with increased half-life, separated by the above method.

In addition, the present invention comprises a base sequence encoding any one guide RNA selected from the group consisting of SEQ ID NO: 10 to 13; And a Cas9 gene consisting of the nucleotide sequence set forth in SEQ ID NO: 14.

The present invention confirms the reduction of polylactosamine in recombinant human-derived erythropoietin produced from a cell line that inhibits (knocks down) the expression of the β3gnt2 gene involved in the biosynthesis of polylactosamine or knocks out the β3gnt2 gene. By confirming the triple and / or quadruple antenna structure increase, it was confirmed that a positive role is possible in increasing the half-life and glycoprotein efficacy of the glycoprotein. The method of the present invention confirmed that the preparation of the recombinant glycoprotein with increased half-life is possible. .

1 is a diagram comparing expression patterns of polylactosamine synthesis gene candidate groups (β3gnt 1 to 9) in CHO cells.

2 is a diagram showing the position and sequence of siRNA for knock-down expression of β3gnt2.

Figure 3 is a diagram confirming the results of siRNA-2 selection siRNA candidates through siRNA-1, siRNA-2 and siRNA-3 gene expression patterns and the resulting Western blotting results:

3A: Results of confirming gene expression patterns by siRNA-1, siRNA-2 and siRNA-3;

3B: Western blotting results by siRNA-1, siRNA-2 and siRNA-3;

3C: Western blotting results by siRNA-2;

3D: Relative intensity confirming results of western blotting by siRNA-2.

4 is a diagram confirming the quantitative change of the sugar chain structure by polylactosamine inhibition by siRNA-2:

Figure 4a: Confirmation of reduced polylactosamine ratio by siRNA-2;

4B: Confirmation of increase of Tri- and Tetra-antennary N-glycans by siRNA-2.

5 is MALDI-TOF MS results for confirming the overall profile of polylactosamine Glycan structures by siRNA-2:

5A: control;

5B: siRNA-2 treatment group.

FIG. 6 shows LC / MS results for identifying quantitative changes in polylactosamine structure by siRNA-2:

6A: control;

6B: siRNA-2 treatment group.

Figure 7 shows the results of knock-out of β3gnt2 by gRNA-1, gRNA-2, gRNA-3 and gRNA-4:

7A: cleavage map of the vector using the CRISPR / Cas9 system;

7B: Agarose gel results after T7 Endonuclease 1 (T7E1) assay;

Fig. 7C: Indel results of gene insertion (gRNA-1: 1, gRNA-2: 2, gRNA-3: 3, gRNA-4: 4) after T7 Endonuclease 1 (T7E1) assay.

Figure 8 shows the results of successful transformed clone selection with β3gnt2 gene knocked out via the CRISPR / Cas9 system (1 = gRNA-1, 2 = gRNA-2, 3 = gRNA-3, 4 = gRNA- 4):

8A: Flow cytometry results;

FIG. 8B: Sanger-sequencing results (delete, insert and PAM sequences (GGC, AGG, CCC, CCT)) after screening clones with confirmed indel compared to control (WT).

Figure 9 shows the decrease in expression of polylactosamine through knock-out of β3gnt2:

9A: Western blotting of selected clones (Clone 1: 9 of gRNA-1 / Clone 2: 2 of gRNA-4 / Clone 3: 12 of gRNA-4 / Clone 4: 16 of gRNA-4);

9B: Confirmation of reduced polylactosamine ratio;

9C: Confirmation of increase of Tri- and Tetra-antennary N-glycans.

Hereinafter, the present invention will be described in detail.

The present invention provides a method for producing a recombinant cell line for producing a recombinant glycoprotein with increased half-life, comprising the step of inhibiting the biosynthesis of polylactosamine in a cell line producing a glycoprotein.

The glycoprotein is erythropoietin, thrombopoietin, thrombopoietin, alpha-antitrypsin, cholinesterase, chorionic gonadotropin, CTLA4Ig, Factor VIII , Gamma-glutamyltransferase, granulocyte colony-stimulating factor (G-CSF) and luteinizing hormone (LH) may be any one selected from the group consisting of. And, specifically, it may be erythropoietin, but is not limited thereto.

In order to inhibit biosynthesis of the polylactosamine, specifically, knock-down expression of β3gnt2 (UDP-GlcNAc: betaGal beta-1,3-N-acetylglucosaminyltransferase 2) gene or knock-down β3gnt2 gene It may include knocking out.

The mRNA of the β3gnt2 gene may be composed of the nucleotide sequence set forth in SEQ ID NO: 1.

The knock-down of the β3gnt2 gene expression is specifically directed to a cell line producing glycoproteins, either selected from the group consisting of antisense nucleotides, siRNAs, shRNAs and miRNAs that process β3gnt2 gene inhibitors or bind to β3gnt2 mRNAs. It may be infectious, and more specifically, siRNA that binds to β3gnt2 mRNA may be transfected into cell lines producing glycoproteins.

The siRNA may include any one base sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, and SEQ ID NO: 6, but is not limited thereto.

The siRNA may comprise a single RNA strand of stem-loop structure comprising an independent sense RNA strand and a complementary antisense RNA strand homologous to the target sequence, or wherein the sense RNA strand and antisense RNA strand are connected by a loop.

The siRNA is not limited to completely paired double-chain RNA portion paired with RNA, and may have a hairpin structure that forms a stem-loop structure, in particular, shRNA (short hairpin RNA). Refers to. On the other hand, the double chain or stem region may include a portion not paired by mismatch (corresponding base is not complementary), bulge (the base does not correspond to one chain) and the like. The total length is 10 to 80 bases, preferably 15 to 60 bases, more preferably 20 to 40 bases. In addition, the loop region has no special meaning in the sequence, and only has 3 to 10 bases in order to connect the sense sequence and the antisense sequence at appropriate intervals. Examples that have conventionally been used as the loop region of siRNAs are as follows: AUG (Sui et al., Proc. Natl. Acad. Sci. USA 99 (8): 5515-5520, 2002), CCC, CCACC or CCACACC ( Paul et al., Nature Biotechnology 20: 505-508, 2002), UUCG (Lee et al., Nature Biotechnology 20: 500-505), CTCGAG, AAGCUU (Editors of Nature Cell Biology Whither RNAi, Nat Cell Biol. 5: 489-490, 2003), UUCAAGAGA (Yu et al., Proc. Natl. Acad. Sci. USA 99 (9): 6047-6052, 2002) and TTGATATCCG (default spacer at www.genscript.com). siRNA terminal structures can be either blunt or cohesive. The cohesive end structure can be both a 3 'protruding structure and a 5' end protruding structure, and the number of protruding bases is not limited. For example, the number of bases may be 1 to 8 bases, preferably 2 to 6 bases. In addition, siRNA is a low-molecular RNA (for example, natural RNA molecules such as tRNA, rRNA, viral RNA or artificial RNA molecules such as tRNA, rRNA, viral RNA, etc.) in a range capable of maintaining the expression inhibitory effect of the target gene. ) May be included. The siRNA terminal structure does not need to have a cleavage structure at both sides, and may be a stem loop type structure in which one terminal portion of the double chain RNA is connected by a linker RNA. The length of the linker is not particularly limited as long as it does not interfere with pairing of stem portions.

In addition, in siRNA according to the present invention, it is possible for the sense RNA strand and / or antisense RNA strand to comprise at least one chemical modification in its sugar moiety, nucleobase moiety or internucleotide structure. Such modifications may make it possible to inhibit the destruction of siRNA by nucleases in vivo. All chemical modifications that can enhance the stability and biocompatibility of siRNA according to the present invention in vivo are included in the scope of the present invention. Among the preferred variants for the sugar moiety, mention may be made of the position 2 'of the ribose, such as 2'-deoxy, 2'-fluoro, 2'-amino, 2'-thio, or 2'-0-alkyl, And preferably is a modification that takes place in the presence of a methylene bridge between positions 2 'and 4' of 2'-0-methyl or LNA replacing a normal 2'-OH group on ribonucleotides. For nucleobases, 5-bromo-uridine, 5-iodo-uridine, N3-methyl-uridine, 2,6-diaminopurine (DAP, 5-methyl-2'-deoxycytidine Bound to cholesterol or a modified base such as 5- (1-propynyl) -2'-deoxy-uridine (pdU), 5- (1-propynyl) -2'-deoxycytidine (pdC) Finally, preferred modifications of the internucleotide backbone include substituting phosphodiester groups in the backbone by phosphorothioate, methylphosphonate, phosphorodiamidate groups. Or using a backbone consisting of N- (2-aminoethyl) -glycine (PNA, peptide nucleic acid) linked by peptide bonds.Various modifications (base, sugar, backbone) are modified nucleic acids of morpholino type. (Bases anchored to morpholine rings and linked by phosphorodiamidate groups) or PNA (peptides) Base attached to an N- (2-aminoethyl) -glycine unit linked by a bond).

The transfection is any one commercially available transfection reagent selected from the group consisting of Lipofectamine, Lijinfect, Dojindo's Hilymax, Fugene, jetPEI, Effectene and DreamFect; Calcium-phosphate, positively charged polymers, liposomes, nanoparticles, nucleofection, electroporation, heatshock, magnetofection It can be carried out using any one selected from the group.

The knock-out of the β3gnt2 gene may specifically be a transformation of a recombinant vector capable of knocking out the β3gnt2 gene into a cell line producing a glycoprotein.

The recombinant vector capable of knocking out the β3gnt2 gene is specifically, nucleotide sequence encoding any one of the guide RNA (guide RNA; gRNA) selected from the group consisting of SEQ ID NO: 10 and SEQ ID NO: 14 It may include a Cas9 (CRISPR associated protein 9) gene consisting of a nucleotide sequence, the recombinant vector may include a structure in which a Cas9 gene and a gene encoding a fluorescent protein is combined.

Specifically, the recombinant vector capable of knocking out the β3gnt2 gene may include any one base sequence selected from the group consisting of SEQ ID NOs: 15 to 18, but is not limited thereto.

In the method, the cell line may use mammalian cells, yeast cells or insect cells, the mammalian cells are Chinese hamster ovary cells (CHO) ), HT-1080, human lymphoblastoid, SP2 / 0 (mouse myeloma), NS0 (mouse myeloma), baby hamster kidney cells (BHK), human embryonic kidney cells , HEK), PERC.6 (human retinal cells) and EC2-1H9 cells may be any one selected from the group consisting of, Chinese hamster ovary cells (Chinese hamster ovary cells, CHO) is most preferred, but not limited thereto. Do not.

In a specific embodiment of the present invention, as a result of confirming the expression patterns of nine types of gene candidate group related to polylactosamine synthesis, β3gnt2 gene was selected as the target gene to be most involved in polylactosamine structure synthesis. Target siRNAs were constructed to inhibit expression (see FIGS. 1 and 2). In order to confirm the inhibition of the expression of β3gnt2 gene by the siRNA prepared in the present invention and the resulting inhibition of the synthesis of polylactosamine, lactosaminyl repeat structure and specificity of EPO produced from siRNA-treated CHO cells Immunoblotting was performed using a lectin (LEL) which binds to the result. As a result, EPO inhibited β3gnt2 expression by siRNA-2 treatment showed a signal reduction of about 70% (see FIG. 3).

In addition, the present inventors confirmed a quantitative change in the sugar chain structure by polylactosamine inhibition, and as a result, the ratio of polylactosamine in total N-glycans was significantly reduced from about 19% to about 2%. (FIG. 4A), it was confirmed that the polylactosamine structure was reduced (FIGS. 5 and 6). In addition, it was confirmed that the ratio of tri- and tetra-antennary N-glycans was increased (see FIG. 4B).

In addition, the present inventors prepared β3gnt2 gene knockout recombinant vector through the CRISPR / Cas9 system, and the result of performing the T7E1 assay to confirm the knockout efficiency by transforming the recombinant vector, the DNA of the inserted cells compared to the WT DNA is It was confirmed that the mismatched DNA region was cut by T7E1 to show multi bands (see FIG. 7B), and the knocked out sequences were confirmed by flow cytometry and Sanger-sequencing (see FIG. 8). In addition, all of the EPOs isolated from clones knocked out of the β3gnt2 gene (clone 1: 15007-9 / clone 2: 15402-2 / clone 3: 15402-12 / clone 4: 15402-16) did not react with LEL. (See FIG. 9A), it was confirmed that the proportion of polylactosamine in total N-glycans was significantly reduced from about 15% to about 2% (see FIG. 9B). In addition, it was confirmed that the ratio of Tri-antennary and Tetra-antennary N-glycans increased in addition to decreasing polylactosamine (see FIG. 9C).

Accordingly, the present invention confirms the reduction of polylactosamine in recombinant human-derived erythropoietin produced from a cell line that inhibits (knocks down) the expression of the β3gnt2 gene involved in the biosynthesis of polylactosamine or knocks out the β3gnt2 gene. The increase in the half-life and glycoprotein efficacy of the glycan protein was confirmed by confirming the increase in the triple and / or quadruple antenna structure of the compartment, and thus, the method of the present invention enables the production of recombinant glycoproteins having increased half-life. Confirmed.

The present invention also provides a recombinant cell line producing a recombinant glycoprotein with increased half-life produced by the above method.

In addition, the present invention

1) culturing the recombinant cell line; And

2) providing a method for producing a recombinant glycoprotein having increased half-life, comprising the step of separating the recombinant glycoprotein from the culture medium of step 1).

The glycoproteins include erythropoietin, thrombopoietin, alpha-antitrypsin, cholinesterase, chorionic gonadotropin, CTLA4Ig, Factor VIII, gamma-glutamyltransferase, granulocyte colony stimulating factor and luteinizing hormone It may be any one selected from the group consisting of, specifically, it may be erythropoietin, but is not limited thereto.

The present invention also provides a recombinant glycoprotein with increased half-life, separated by the above method.

Recombinant glycoproteins with increased half-life isolated by the above method are characterized by an increase in triple- and / or tetra-antennary structures of N-glycans.

In addition, the present invention includes a base sequence encoding any one of the guide RNA (guide RNA; gRNA) selected from the group consisting of SEQ ID NO: 10 to 13; And it provides a recombinant vector comprising a Cas9 (CRISPR associated protein 9) gene consisting of the nucleotide sequence set forth in SEQ ID NO: 14.

The recombinant vector may include a structure in which a Cas9 gene and a gene encoding a fluorescent protein are combined, and specifically, the recombinant vector includes any one nucleotide sequence selected from the group consisting of SEQ ID NOs: 15 to 18. It may be, but is not limited thereto.

Accordingly, the present invention confirms the reduction of polylactosamine in recombinant human-derived erythropoietin produced from a cell line that inhibits (knocks down) the expression of the β3gnt2 gene involved in the biosynthesis of polylactosamine or knocks out the β3gnt2 gene. The increase in the half-life and glycoprotein efficacy of the glycan protein was confirmed by confirming the increase in the triple and / or quadruple antenna structure of the compartment, and thus, the method of the present invention enables the production of recombinant glycoproteins having increased half-life. Confirmed.

Hereinafter, the present invention will be described in detail by way of examples.

However, the following examples are merely to illustrate the invention, but the content of the present invention is not limited to the following examples.

< Example  1> Polylactosamine ( Polylactosamine A) of synthetic genes siRNA  making

<1-1> Identification of genes related to polylactosamine synthesis

Synthesis of polylactosamine involves 9 genes (β3gnt1-9) that bind β1,3-GlcNAc to galactose, but the genes that are specifically involved in each tissue or cell type are not identical. Accordingly, qPCR was performed on three types of CHO cells (EC2-1H9, 1098-2, CGT II-4) to compare the expression patterns of nine gene candidate groups.

As a result, as shown in FIG. 1, the β3gnt2 gene was selected as a target gene that is most involved in polylactosamine structure synthesis, and a target siRNA was prepared to inhibit the expression of β3gnt2.

<1-2> siRNA production of β3gnt2 gene

siRNA sequences were designed and synthesized to produce siRNA of β3gnt2 gene.

Design siRNA sequences in three regions (siRNA-499, siRNA-1101 and siRNA-970) that inhibit hamster β3gnt2 mRNA (GenBank accession no. XM_003502146.2; SEQ ID NO: 1) at the coding region location as shown in FIG. And synthesized. Oligonucleotides used in the siRNA are as described in Table 1.

siRNA name	Oligonucleotide Name	Oligonucleotide sequence	Position on cDNA
siRNA-1	S-siRNA (SEQ ID NO: 2)	5'-GAAGAAATGCGCAAAGAA-3 '	499
	A-siRNA (SEQ ID NO: 3) (target sequence)	5'-TTCTTTGCGCATTTCTTC-3 '
siRNA-2	S-siRNA (SEQ ID NO: 4)	5'-CTGGAATGTGCCTTCAGAA-3 '	1101
	A-siRNA (SEQ ID NO: 5) (target sequence)	5'-TTCTGAAGGCACATTCCAG-3 '
siRNA-3	S-siRNA (SEQ ID NO: 6)	5'-CATCCCAGAAGTCTTCTAT-3 '	970
	A-siRNA (SEQ ID NO: 7) (target sequence)	5'-ATAGAAGACTTCTGGGATG-3 '

< Example  2> β3gnt2  gene Knockdown (knock-down) CHO  Cell line construction

SiRNA of β3gnt2 gene prepared in Example <1-2> was used to transfect human EPO producing CHO cell line.

Specifically, EC2-1H9, a recombinant human EPO producing CHO cell line, Hyo Jeong Hong (Department of Systems Immunology, Kangwon National University, Chuncheon, Korea) Cells were 10% dFBS (dialyzed fetal bovine serum; SAFC, US), 3.5 g / L glucose, 20 nM MTX (methotrexate; Sigma) , And 1% Ab-Am (Antibiotic-Antimycotic solution; Gibco) were incubated at 37 ° C., 5% CO ₂ in MEM-α.

For transfection of siRNA prepared in Example <1-2>, EC2-1H9 cells were β3gnt2 specific or negative control using Lipofectamine® RNAiMAX transfection reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's protocol. Transfected with 10 μM siRNA (UGCG-specific siRNA). 24 hours after transfection, the medium was exchanged with serum free medium (CHO-S-SFM II; Gibco) and incubated for additional 3 days at 37 ° C. in a 5% CO ₂ environment.

< Experimental Example  1> β3gnt2  Through knock-down Polylactosamine  Confirmation of Synthetic Inhibition

In order to confirm the inhibition of β3gnt2 gene expression by the siRNA treatment of the β3gnt2 gene and the resulting inhibition of the synthesis of polylactosamine, the lactosaminyl repeat structure specifically for EPO produced from siRNA-treated CHO cells Immunoblotting was performed using binding lectins (Lycopersicon Esculentum Lectin, LEL).

<1-1> β3gnt2  Gene expression confirmation

Total RNA of recombinant CHO cells constructed in Example 2 was extracted using RNeasy® Mini (QIAGEN) according to the manufacturer's protocol. Reverse transcription to cDNA was performed using AccuPower RT-PCR PreMix (Bioneer, Korea) using 1.0 μg of RNA. cDNA was used as a template to identify β3gnt2 mRNA transcript using qPCR. For qPCR of β3gnt2, forward (5′-CTG GCG ATT AAG TCC CTC ATT-3 ′; SEQ ID NO: 8) and reverse (5′-CTG GCG ATT AAG TCC CTC ATT-3 ′; SEQ ID NO: 9) primers iQTM SYBR® Green Supermix (Bio-Rad, Hercules, CA, USA) was used.

<1-2> recombinant human erythropoietin; rhEPO ) Separation

To isolate recombinant human-derived erythropoietin (rhEPO), culture supernatants containing rhEPO were collected and passed through a 0.45 μm-pore-size membrane. Passed culture medium was concentrated and exchanged with PBS buffer through ultrafiltration (AmiconUltra; Millipore, Bedford, Mass.). And, rhEPO was purified using an immunochromatography column (Mamunoaffinity chromatography column, MAiiA, Uppsala, Sweden). After loading the sample and washing with PBS, the remaining rhEPO was eluted with 0.1 M glycine / 0.5 M NaCl, pH 2.8, the eluate immediately neutralized with 1.0 M Tris / HCl, pH 9.0. Purified rhEPO was concentrated and dialyzed with distilled water using ultrafiltration (AmiconUltra; Millipore). The concentration of rhEPO was measured using Quant-iT ™ protein assay kit (Invitrogen).

<1-3> Polylactosamine  Immunity to confirm expression Blotting

Lectin blot analysis was performed to confirm the expression level of polylactosamine. Specifically, for purified EPO blotting using Lycopersicon Esculentum Lectin (LEL), the purified 1 μg EPO was electrophoresed on 12.5% SDS PAGE and transferred to PVDF membranes (Millipore, Billerica, MA), and biotin-labeled. BEL (Vector Laboratories Inc, Burlingame, CA, USA). The PVDF membrane was blocked for 1 hour at room temperature with 5% BSA in TBS-T [TBS (140 mM NaCl, 10 mM Tris-HCl, pH 8.0) /0.05% Tween 20]. After blocking, the membrane was incubated overnight at 4 ° C with biotin labeled lectins diluted 1: 500 in TBS-T. The membrane was then rinsed three times with TBS-T and incubated with ExtrAvidin-Peroxidase (2.0-2.5 mg / ml) diluted 1: 5,000 for 1 hour at room temperature, and finally rinsed five times with TBS-T for Supersignal The kit was processed.

The following experiment was performed for reblotting using anti-EPO antibody. Specifically, the same blots were subjected to reblotting using anti-EPO antibodies after lectin blots for controlling the number of EPO. That is, the membrane was incubated with stripping buffer (CANDOR Bioscience GmbH, Wangen imallgau, Germany) for 30 minutes at room temperature and washed five times with TBS-T. The membrane was incubated overnight with mouse anti-EPO antibody (100 ug / ml, Santa Cruz, CA) diluted 1 hour at room temperature with 5% BSA and diluted 1: 10,000 in TBS-T. After incubation, the membrane was washed 5 times with TBS-T and treated using a Supersignal kit. Blotting indices were calculated as band intensities in lectin blots and divided by riblot band intensities in western blots using anti-EPO antibodies.

As a result, it was confirmed that β3gnt2 expression inhibition effect by siRNA-2 and siRNA-3 is greater than siRNA-1 treatment as shown in Figure 3 (Figs. 3a and 3b), β3gnt2 expression is inhibited by siRNA-2 treatment It was confirmed that the EPO showed a signal reduction of about 70% as a result of blotting (FIGS. 3C and 3D).

< Experimental Example  2> β3gnt2  Through knock-down rhEPO  antenna( antennary A) increase in structure

N-glycan mass spectrometry using LC / MS and MALDI was performed to confirm the quantitative change in sugar chain structure by polylactosamine inhibition through siRNA of β3gnt2 gene.

Specifically, purified rhEPO was denatured by rapid thermal cycling (25-100 ° C.) in an aqueous solution of 100 mM ammonium bicarbonate and 5 mM dithiothreitol. After cooling, 2.0 ul (or 1000 U) of peptide N-glycosidase F was added, then mixed and incubated in a 37 ° C. water base for 16 hours. The rhEPO digest was loaded into the cartridge and washed with pure water to remove salts and other buffer material. N-glycans were eluted in water (acidic fraction) by the addition of 40% acetonitrile / 0.05% trifluoroacetic acid. The sample was dried under vacuum. rhEPO N-glycan fractions were redissolved in water and 1.0 ul (corresponding to 1 ug of rhEPO) was spotted on stainless steel target plates. Neutral glycans were analyzed in cationic mode ([M ⁺ Na] ⁺ or [M ⁺ H] ⁺ ), while acidic glycans were analyzed in anionic mode ([M ^- H] ^- ). Each acquired spectrum showed a combined signal from 800 laser shots at three random locations in the field (2400 laser shots in total). Mass spectra were recorded over a range of m / z 2000-4500. Maltooligosaccharide ladder was used for external mass calibration. MS peaks were filtered with a signal-to-noise ratio of 5.0 and deconvolution was performed to obtain a list of compound masses and intensities. The N-glycan fractions were combined and an amount of 2.0 μL (corresponding to 800 ng EPO) was injected into the porous graphite carbon nano-LC chip (Agilent) with an automatic sample injector. Analytical column to elevate rapid glycan elution gradient from 6% to 100% B for 20 minutes using (A) 3.0% acetonitrile / 0.1% formic acid solution and (B) 90.0% acetonitrile / 0.1% formic acid solution Was applied at 0.3 μL / min. The remaining non-glycan compound was washed with 100% B and then equilibrated. MS spectra were acquired in cation mode in the mass range of m / z 500-2000 with an acquisition time of 1.5 seconds per spectrum.

As a result, as shown in Figures 4 to 6 it was confirmed that the proportion of polylactosamine in the total N-glycans significantly decreased from about 19% to about 2% (Fig. 4a), MALDI-TOF MS and LC / MS results confirmed that the polylactosamine structure was reduced (FIGS. 5 and 6).

In addition, it was confirmed that the ratio of tri- and tetra-antennary N-glycans increased in addition to decreasing polylactosamine (FIG. 4B). This seems to be because components used for polylactosamine synthesis were used for antenna branching. According to the literature, an EPO with a bi-antennary sugar chain structure has been reported to reduce in-vivo activity by about 85% compared to an EPO with a tetra-antennary sugar chain structure (Takeuchi et al. , PNAS, 1989). Therefore, the decrease in polylactosamine and the increase in the quadruple antenna structure can be said to be a result that can play a positive role in increasing the half-life of glycoproteins and glycoprotein efficacy.

< Example  3> β3gnt2  gene Knockout (knock-out) CHO  Cell line construction

<3-1> Preparation of CHO Cells Producing Recombinant Human EPO

EC2-1H9 cells, which are CHO cells that produce recombinant human EPO, Hyo Jeong Hong (Antibody Engineering Research Unit, Korea Research Institute of Bioscience and Biotechnology, Yuseong-gu, Daejeon, Korea). Cells were supplemented with 10% (v / v) dFBS (Gibco), 3.5 g / L glucose, 20 nM MTX (methotrexate; Sigma), and 1% (v / v) Ab-Am (antibiotic-antimycotic solution; Gibco) Was maintained in a humidified environment containing 37%, 5% CO ₂ in MEM-α (Gibco).

<3-2> CRISPR Of Cas9  Through the system β3gnt2  Preparation and Transformation of Gene Knockout Recombinant Vectors

DNA sequences encoding gRNAs (guide RNAs) used to prepare recombinant vectors for knocking out the β3gnt2 gene were obtained from CPRISPy, a web-based CRISPR design tool specific to the CHO-K1 genome. Such gRNAs are DNA sequences (synthetic oligonucleotides) that encode the gRNA sequences that are specifically designed to recognize the β3gnt2 gene of the Chinese hamster and each knock out the DNA strand of the β3gnt2 gene. This is represented by SEQ ID NOs: 10 to 13 in Table 1 below.

	Location in the gene	Sequence	SEQ ID NO:
gRNA-1	15007	TGTTCCAGTACGCCCGGGAA (-)	SEQ ID NO: 10
gRNA-2	15181	AGTCTTTAAATCTGTCCGGC (-)	SEQ ID NO: 11
gRNA-3	15385	GTAGTGAGAGTCTTCTTGTT (+)	SEQ ID NO: 12
gRNA-4	15402	GTTGGGCAAGACGCCCCCCG (+)	SEQ ID NO: 13

DNA sequences encoding gRNA sequences (gRNA-1, gRNA-2, gRNA-3, gRNA-4) include a UC promoter expressing gRNA and a G9 tagged Cas9 enzyme that recognizes the expressed gRNA. -Guide-EF1a vector (Origene, Rockville, Maryland) was inserted. The vector was used as a template for generating gRNA from DNA represented by the nucleotide sequences of SEQ ID NOs: 10 to 13 and Cas9 mRNA from the Cas9 DNA sequence represented by the nucleotide sequences of SEQ ID NO: 14 during in vivo transcription. At this time, the Cas9 gene is linked to a gene encoding GFP through a linker 2A peptide, so that Cas9 protein and GFP protein can be expressed at a time. The cleavage map of the recombinant vector prepared through the above process is shown in FIG. 7, and the entire nucleotide sequence of the recombinant vector is represented by SEQ ID NOs: 15 to 18.

The prepared pCas-B3gnt2-EF1a vector was transformed into EC2-1H9 cells of Example <3-1> using Lipofectamine ™ 2000 (Invitrogen, Carlsbad, Calif.).

< Experimental Example 3> β3gnt2  Gene knock-out results

<3-1> T7E1 Assay

Non-homologous end-joining (NHEJ) occurs in the genome region when a specific region of the genome is inserted by the CRISPR / Cas9 system. After denaturation of this type of DNA followed by hybridization by lowering the temperature, a hetero duplex is formed in which a non-inserted wild type (WT) DNA and an inserted clone's DNA bind in a mismatch form. ) And T7E1 recognizes and cuts these mismatched DNA regions.

In Example <3-2>, the frequency (Indel,%) of gene insertion / deletion by gRNA was measured prior to constructing a stable cell line in which the B3gnt2 gene was knocked out through the CRISPR / Cas9 system. T7E1 assay was performed.

Specifically, genomic DNA was extracted and quantified from the transformed cells, and PCR was performed using 200 ng of genomic DNA as a template, and the primer pairs used cover all four kinds of gRNA recognition sites. (849 bp) (Forward: 5'- GCA TTG TGG ATC ACG TCA CCT ATA AAC-3 '(SEQ ID NO: 19) / Reverse: 5'- CCA GAT ATG AGA AAT GAG TGT TGG ACG -3' Number 20)). 2 μl of PCR products were electrophoresed using 1.5% Agarose gel and purified using a kit (qiaquick pcr purification kit; Qiagen) after confirming the correct product size. After quantifying the DNA concentration of the purified PCR product, 10X NEB buffer 2 ul + PCR product 200 ng + DDW was finally adjusted to 19 μl, and DNA was denatured and hybridized by using a thermocycler. 1 μl of T7 Endonuclease 1 (T7E1) was added to the annealed DNA fragment, followed by reaction at 37 ° C. for 15 minutes. Thereafter, T7E1 was inactivated using proteinase K and electrophoresed again on 1.5% Agarose gel to compare with the control group. The percentage of non-perfectly matched DNA was cut by T7E1. Indel is the ratio of the intensity of the entire band (the band at the uncut WT position + the band of the fragments cut out) and the bands of the cut fragments (the bands of the fragments are created at two positions by cutting a specific position). (%, genome edition efficiency).

As a result, as shown in FIG. 7B, as a result of confirming knock-out efficiency using four kinds of gRNAs, DNA of the inserted cells was cut by T7E1 compared to WT DNA which was not cut by T7E1. band) was observed (FIG. 7b). That is, it was confirmed that all four kinds of gRNAs performed knock-out operation.

<3-2> Sanger Sequencing ( sanger -sequencing)

In <Example 3>, cells in which the β3gnt2 gene was knocked out through the CRISPR / Cas9 system were selected for clones successfully transformed by flow cytometry (Beckman coulter Inc, Brea, CA) for 3 weeks ( 8a). Selected clones (clone 1: 9 of gRNA-1 / clone 2: gRNA-4 2 / clone 3: gRNA-4 / clone 4: gRNA-4 16) Sanger-sequencing according to PCR based on genomic DNA It was confirmed by (FIG. 8B).

< Experimental Example  4> β3gnt2  Through gene knock-out Polylactosamine  Confirmation of synthesis inhibition and increased antenna structure

<4-1> Polylactosamine synthesis inhibition

EC2-1H9 cells 5.0x10 ⁶ confirmed that the β3gnt2 gene was knocked out were 10% (v / v) dFBS, 3.5 g / L glucose, 1% (v / v) Ab-Am solution, and 20 nM MTX Incubated in a T175 culture flask containing this supplemented MEM-α. Culture medium containing recombinant human derived erythropoietin (rhEPO) was used for SDS-PAGE and then transferred to PVDF membrane (Millipore Corp., Bedford, Mass.). After blocking for 2 hours at room temperature with TBS-T (140 mM NaCl, 10 mM Tris-HCl, with 0.05% Tween 20, pH 8.0) with 5% BSA, the PVDF membrane was biotin-labeled lectin (Lycopersicon Esculentum Lectin; LEL) was incubated at 4 ° C. for 16 hours. After washing three times for 5 minutes using TBS-T, the membrane was incubated with ExtrAvidin-peroxidase (Sigma) at room temperature for 1 hour and then developed with an ECL kit (Thermo Scientific; Rockford, IL).

For reblotting, the membrane was stripped at room temperature for 1 hour using a stripping buffer (Candor Bioscience GmbH, Weissensberg, Germany). PVDF membranes were washed three times with TBS-T for 5 minutes and then incubated with RP labeled anti-mouse IgG antibody (Santa Cruz) diluted 1: 5000 for 1 hour at room temperature. The membrane was developed with ECL solution (Thermo Scientific; Rockford, IL).

As a result, as shown in FIG. 9A, a clone in which the β3gnt2 gene was knocked out (clone 1: 9 of gRNA-1 / clone 2: gRNA-4 2 / clone 3: gRNA-4 12 / clone 4: gRNA-4 All of the EPO isolated from 16) showed no reaction with LEL (FIG. 9A).

<4-2> Confirmation of Antenna Structure Increase

EC2-1H9 cells 5.0x10 ⁶ confirmed that the β3gnt2 gene was knocked out were 10% (v / v) dFBS, 3.5 g / L glucose, 1% (v / v) Ab-Am solution, and 20 nM MTX Incubated in a T175 culture flask containing this supplemented MEM-α. Culture medium was replaced with serum-free medium (CHO-S-SFM II; Gibco) within 3 days. After 2 days, the culture medium was collected, filtered with a 0.45 um filter (Sartorius, Gottingen, Germany) and dialyzed overnight at 4 ° C. with phosphate buffer saline (PBS, pH 7.4). To purify rhEPO, culture medium was used as EPO purification gel (MAIIA Diagnostics, Uppsala, Sweden). Purified rhEPO was dialyzed with distilled water overnight at 4 ° C. The concentration was measured using a Quant-iT ™ protein assay kit (Invitrogen) and stored at -80 ° C until use.

Specifically, purified rhEPO was denatured by rapid thermal cycling (25-100 ° C.) in an aqueous solution of 100 mM ammonium bicarbonate and 5 mM dithiothreitol. After cooling, 2.0 ul (or 1000 U) of peptide N-glycosidase F was added, then mixed and incubated in a 37 ° C. water base for 16 hours. The rhEPO digest was loaded into the cartridge and washed with pure water to remove salts and other buffer material. N-glycans were eluted in water (acidic fraction) by the addition of 40% acetonitrile / 0.05% trifluoroacetic acid. The sample was dried under vacuum. rhEPO N-glycan fractions were redissolved in water and 1.0 ul (corresponding to 1 ug of rhEPO) was spotted on stainless steel target plates. Neutral glycans were analyzed in cationic mode ([M ⁺ Na] ⁺ or [M ⁺ H] ⁺ ), while acidic glycans were analyzed in anionic mode ([M ^- H] ^- ). Each acquired spectrum showed a combined signal from 800 laser shots at three random locations in the field (2400 laser shots in total). Mass spectra were recorded over a range of m / z 2000-4500. Maltooligosaccharide ladder was used for external mass calibration. MS peaks were filtered with a signal-to-noise ratio of 5.0 and deconvolution was performed to obtain a list of compound masses and intensities. The N-glycan fractions were combined and an amount of 2.0 μL (corresponding to 800 ng EPO) was injected into the porous graphite carbon nano-LC chip (Agilent) with an automatic sample injector. Analytical column to elevate rapid glycan elution gradient from 6% to 100% B for 20 minutes using (A) 3.0% acetonitrile / 0.1% formic acid solution and (B) 90.0% acetonitrile / 0.1% formic acid solution Was applied at 0.3 μL / min. The remaining non-glycan compound was washed with 100% B and then equilibrated. MS spectra were acquired in cation mode in the mass range of m / z 500-2000 with an acquisition time of 1.5 seconds per spectrum.

As a result, as shown in FIG. 9b, the ratio of polylactosamine in total N-glycans was significantly reduced from about 15% to about 2% (Fig. 9b).

In addition, it was confirmed that the ratio of tetra-antennary N-glycans increased in addition to decreasing polylactosamine (FIG. 9C).

This seems to be because components used for polylactosamine synthesis were used for antenna branching. According to the literature, an EPO with a bi-antennary sugar chain structure has been reported to reduce in-vivo activity by about 85% compared to an EPO with a tetra-antennary sugar chain structure (Takeuchi et al. , PNAS, 1989). Therefore, the decrease in polylactosamine and the increase in the quadruple antenna structure can be said to be a result that can play a positive role in increasing the half-life of glycoproteins and glycoprotein efficacy.

Claims (19)

1. A method for producing a recombinant cell line producing a recombinant glycoprotein with increased half-life, comprising the step of inhibiting the biosynthesis of polylactosamine in a cell line producing a glycoprotein.
2. The method of claim 1, wherein the inhibiting biosynthesis of polylactosamine knocks down the expression of β3gnt2 (UDP-GlcNAc: betaGal beta-1,3-N-acetylglucosaminyltransferase 2) gene, or A method of producing a recombinant cell line that produces a recombinant glycoprotein with increased half-life, comprising knocking out the β3gnt2 gene.
3. According to claim 2, wherein the β3gnt2 gene mRNA is composed of the nucleotide sequence described in SEQ ID NO: 1, a method for producing a recombinant cell line with increased half-life recombinant glycoprotein.
4. The method of claim 2, wherein the knock-down of β3gnt2 gene expression produces a glycoprotein, either selected from the group consisting of antisense nucleotides, siRNAs, shRNAs and miRNAs that process β3gnt2 gene inhibitors or bind to β3gnt2 mRNAs. Method for producing a recombinant cell line to produce a recombinant glycoprotein with increased half-life, which is transfected into the cell line.
5. The recombinant cell line of claim 4, wherein the siRNA comprises a nucleotide sequence described in any one selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, and SEQ ID NO: 6. 6. Manufacturing method.
6. According to claim 2, wherein the knock-out of the β3gnt2 gene is a method for producing a recombinant cell line producing a recombinant glycoprotein with increased half-life, transforming the recombinant vector to a cell line producing a glycoprotein,

   Wherein the recombinant vector is

   A base sequence encoding any one guide RNA (gRNA) selected from the group consisting of SEQ ID NOs: 10-13; And

   A method for producing a recombinant cell line producing a recombinant glycoprotein having increased half-life, comprising a Cas9 (CRISPR associated protein 9) gene consisting of the nucleotide sequence set forth in SEQ ID NO: 14.
7. The method of claim 6, wherein the recombinant vector comprises a structure in which a Cas9 gene and a gene encoding a fluorescent protein are combined with each other, thereby producing a recombinant glycoprotein having increased half-life.
8. The method of claim 6, wherein the recombinant vector comprises any one of nucleotide sequences selected from the group consisting of SEQ ID NOs: 15 to 18, a method for producing a recombinant cell line with increased half-life recombinant glycoprotein.
9. According to claim 1, wherein the glycoprotein is erythropoietin (erythropoietin), thrombopoietin (thrombopoietin), alpha-antitrypsin, cholinesterase (cholinesterase), chorionic gonadotropin ), CTLA4Ig, Factor VIII, gamma-glutamyltransferase, granulocyte colony-stimulating factor (G-CSF) and luteinizing hormone (LH) Any one of the methods of producing a recombinant cell line to produce a recombinant glycoprotein with increased half-life.
10. The half-life recombinant glycoprotein of claim 1, wherein the cell line is prepared from any one selected from the group consisting of mammalian cells, yeast cells, and insect cells. Method for producing a recombinant cell line to produce.
11. The method of claim 1, wherein the cells are Chinese hamster ovary cells (CHO), HT-1080, human lymphoblastoid, SP2 / 0 (mouse myeloma), NS0 (mouse myeloma), baby hamster Increased half-life, one selected from the group consisting of baby hamster kidney cells (BHK), human embryonic kidney cells (HEK), PERC.6 (human retinal cells) and EC2-1H9 Method for producing a recombinant cell line to produce a recombinant glycoprotein.
12. A cell line produced by the method of claim 1 which produces a recombinant glycoprotein with increased half-life.
13. 1) culturing the recombinant cell line of claim 12; And

    2) separating the recombinant glycoprotein from the culture solution of step 1);

    Comprising a method for producing a recombinant glycoprotein having increased half-life.
14. The method of claim 13, wherein the glycoprotein is erythropoietin, thrombopoietin, alpha-antitrypsin, cholinesterase, chorionic gonadotropin, CTLA4Ig, Factor VIII, gamma-glutamyltransferase, granulocyte colony stimulation A method for producing a recombinant glycoprotein having increased half-life, which is any one selected from the group consisting of factor and luteinizing hormone.
15. The method of claim 13, wherein the recombinant glycoprotein has an increased tri- or tetra-antennary structure.
16. A nucleotide sequence encoding any one guide RNA selected from the group consisting of SEQ ID NOs: 10 to 13; And

    Recombinant vector comprising a Cas9 gene consisting of the nucleotide sequence set forth in SEQ ID NO: 14.
17. The recombinant vector of claim 16, wherein the recombinant vector comprises a structure in which a Cas9 gene and a gene encoding a fluorescent protein are combined.
18. The recombinant vector according to claim 16, wherein the recombinant vector comprises any one nucleotide sequence selected from the group consisting of SEQ ID NOs: 15 to 18.
19. A recombinant glycoprotein with increased half-life, isolated by the method of claim 13.

Images