KR102002790B1 - Method for preparing recombinant glycoproteins with improved N-glycan antennary structure by inhibiting biosynthesis of polylactosamine - Google Patents

Abstract

The present invention relates to a method for confirming the reduction of polylactosamine in recombinant human erythropoietin produced from a cell line in which expression of β3gnt2 gene involved in biosynthesis of polylactosamine is inhibited (knocked down) or β3gnt2 gene is knocked out, It was confirmed that increasing the triplet and / or quadrupole antenna structure could increase the half-life of the glycoprotein and play a positive role in the glycoprotein efficacy. As a result, it was confirmed that the recombinant glycoprotein having an increased half-life could be produced by the method of the present invention .

Description

BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to a recombinant glycoprotein having enhanced N-linked sugar chain structure by inhibiting biosynthesis of polylactosamine,

The present invention relates to a method for inhibiting the expression of β3gnt2 (UDP-GlcNAc: betaGal beta-1,3-N-acetylglucosaminyltransferase 2) gene by knocking down the β3gnt2 gene or knocking out β3gnt2 gene, The present invention relates to a method for producing glycoproteins having an increased half-life by inhibiting the biosynthesis of cyamine.

Glycosylation corresponds to a major post-translational expression in mammalian cells, divided into two classes, N- and O-linked glycosylation. N-linked saccharides are attached to Asn (Asn-X-Ser / Thr motifs) in a number of glycoproteins. Glycation affects enzyme activity, protein stability, and immunogenicity.

Sialic acid, a generic term for acyl derivatives of neuraminic acid (Neu), is an essential component of the sugar precursor composition required for the glycation process. Up to now, about 50 kinds of sialic acid-added sugar chain precursors have been found in nature . Sialic acid plays an important role in biological phenomena in cells such as intercellular interactions in mammals, the role of precursors to determine intracellular signals, and the stabilization of glycoproteins. Sialic acid was first isolated from the mucin of the bovine salivary gland by Blix in 1936 and is known as an acidic sugar consisting of 9 carbons and a COOH- group. In addition, sialic acid has been reported to have 23 kinds of sialic acid due to the difference in substituents, and they are known to exhibit a distribution specific to species or tissues. In higher animals, sialic acid is linked by an α-glycosidic bond by the action of a sialyltransferase specific for glycoproteins, glycolipids, Gal, GlcNAc, GalNAc and sialic acid of the oligosaccharide sugar chain, respectively.

Since the sialic acid of the complex saccharide sugar chain is located at the distal end of the sugar chain structure existing on the surface of the cell membrane, it is expected that it will be directly involved in the contact between the cell and the extracellular environment, and the lifespan of blood cells or glycoprotein It is known to be shortened by the removal of sialic acid. As an example of this, asialylation of erythrocyte membrane is achieved, galactose is exposed to the cell surface and binds to a receptor lectin that specifically binds to galactose on the surface of Kupffer cell to induce receptor mediated receptor -mediated endocytosis and sialic acid-removed asialo glycoprotein is also bound by lectin on the surface of the hepatocyte and removed from the circulatory system by a pathway similar to red blood cells. In addition, a glycoprotein having a sialo-linkage such as alpha-antitrypsin, cholinesterase, chorionic gonadotropin, CTLA4Ig, Factor VIII, gamma- Gamma-glutamyltransferase, granulocyte colony-stimulating factor (G-CSF) and luteinizing hormone (LH) have been shown to inhibit sialic acid- (Ngantung FA et al., 2006, Biotechnol. Bioeng 95 (1), 106-119).

Erythropoietin (EPO) is a glycoprotein hormone that induces erythropoiesis, and recombinant EPO is used as an anemia drug. The wild-type EPO has three N-linked sugar chains and one O-linked sugar chain, with up to four sialic acids in one N-linked sugar chain and up to two sialic acids in one O- So that potentially one molecule of EPO can bind a total of 14 sialic acids. As in the case of the glycoprotein, when sialic acid is bound to the sugar chain in the EPO protein, it prevents the degradation of EPO in the liver by blocking binding with the deglycosylated glycoprotein receptor present in the liver.

Polylactosamine is one of the basic structures of oligosaccharides present on glycoproteins as N-acetylglucosamine (GlcNAc) and galactose (Galbeta1-4GlcNAcbeta1-3) n in which the galactose is repeated continuously. For example, in a model glycoprotein such as EPO, polylactosamine accounts for about 10 to 20% of the total N-glycans. In the experiment using mice, EPO containing polylactosamine was found to contain galactose on the surface of the glycoprotein It has been reported that the half-life of the body is significantly reduced regardless of the protective effect.

(Figure 1. Structural characteristics of polylactosamine)

Since the discovery of restriction enzymes that recognize and cut specific sequences of DNA in the 1970s, genetic engineering techniques have developed rapidly over time. However, the limitation of gene manipulation technology using restriction enzymes was clear. Specifically, the restriction enzyme has a short length of about 6 to 8 recognizable gene sequences, and there is a problem that only about 46 (4,096) ordered pairs can be distinguished. The CRISPR / CAS9 system, on the other hand, does not have this limitation and is theoretically applicable to higher life than human beings.

The CRISPR / CAS9 system is a genome editing method called a clustered regularly interspaced short palindromic repeat (CRISPR) gene scissors. It uses RNA (gRNA) that specifically binds to a specific nucleotide sequence and Cas9 nuclease . Using such a CRISPR / CAS9 system, it is possible to knock-out plasmids into cells or animals to inhibit the function of specific genes.

The CRISPR / CAS9 system was discovered by scientists only a few years ago, and is a very old way of organisms, such as bacteria, that keep themselves from bacteriophages. An organism has evolved over millions of years by cutting out the bacteriophage DNA, sticking it to its own gene, remembering it, and surviving through adaptive immunity, which has been studied in a simple and clear way to quickly edit the organism's DNA in the lab. Specifically, the original CRISPR / CAS9 system stores a portion of the DNA of a virus previously infected by the bacteria in its own genome, then retrieves the information again when the virus invades, Protection mechanism. By using it in genome engineering, a primer that searches for the base sequence of a specific gene is made and paired with the enzyme Cas9, which is a cleavage enzyme, to cling to the target DNA sequence to cause DNA cleavage. Therefore, mutation occurs in DNA repair (repair) process.

Accordingly, the present inventors have conducted intensive studies to increase the resistance to degradation of glycoprotein and increase the activity of the glycoprotein by using the siRNA to reduce the content of polylactosamine in the glycoprotein, thereby rusting down the gene involved in polylactosamine synthesis knocked-down CHO cell line, and a CRISPR / CAS9 system. The resulting glycoprotein was knocked out with a gene involved in polylactosamine synthesis, and the resulting glycoprotein was polylactosamine Tri- and / or tetra-antennary structures were increased according to the decrease in the half-life of the glycoprotein, and it was confirmed that the increase of the half-life of the glycoprotein could play a positive role in the efficacy of the glycoprotein. Respectively.

It is an object of the present invention to provide a method for producing a glycoprotein having increased half-life from a cell line inhibited by biosynthesis of polylactosamine.

In order to accomplish the above object, the present invention provides a method for producing a recombinant cell line producing a recombinant glycoprotein with an increased half-life, comprising the step of inhibiting biosynthesis of polylactosamine in a cell line producing a glycoprotein do.

The present invention also provides a recombinant cell line produced by the above method.

In addition,

1) culturing the recombinant cell line; And

2) separating the recombinant glycoprotein from the culture medium of step 1).

In addition, the present invention provides recombinant glycoproteins with increased half-life, separated by the above method.

In addition, the present invention provides a nucleic acid molecule comprising a nucleotide sequence encoding any one of the guide RNAs selected from the group consisting of SEQ ID NOS: 10 to 13; And a Cas9 gene consisting of the nucleotide sequence shown in SEQ ID NO: 14.

The present invention relates to a method for confirming the reduction of polylactosamine in recombinant human erythropoietin produced from a cell line in which expression of β3gnt2 gene involved in biosynthesis of polylactosamine is inhibited (knocked down) or β3gnt2 gene is knocked out, It was confirmed that increasing the triplet and / or quadrupole antenna structure could increase the half-life of the glycoprotein and play a positive role in the glycoprotein efficacy. As a result, it was confirmed that the recombinant glycoprotein having an increased half-life could be produced by the method of the present invention .

Brief Description of the Drawings Fig. 1 compares the expression patterns of polylactosamine synthesis gene candidate groups (? 3gnt 1-9) in CHO cells.
Fig. 2 is a diagram showing the position and sequence of siRNA for knockdown of? 3 gnt2.
FIG. 3 is a graph showing the result of selecting siRNA-2 among candidate siRNAs based on gene expression patterns by siRNA-1, siRNA-2 and siRNA-3 and Western blotting results thereof:
Fig. 3a: Results of gene expression analysis by siRNA-1, siRNA-2 and siRNA-3;
Figure 3b: Western blotting results with siRNA-1, siRNA-2 and siRNA-3;
Figure 3c: Western blotting results with siRNA-2;
Figure 3d: Results of the relative intensities of western blotting by siRNA-2.
Fig. 4 is a diagram showing a quantitative change in sugar chain structure due to inhibition of polylactosamine by siRNA-2:
4a: confirmation of reduction of polylactosamine ratio by siRNA-2;
Figure 4b: Confirmation of the increase of tri- and tetra-antennary N-glycans by siRNA-2.
Figure 5 shows MALDI-TOF MS results for the overall profile identification of polylactosamine Glycan structures by siRNA-2.
Fig. 6 shows LC / MS results for confirming the quantitative change of the polylactosamine structure by siRNA-2. Fig.
7 is a diagram showing knock-out results of? 3gnt2 by gRNA-1, gRNA-2, gRNA-3 and gRNA-4:
7a: cleavage map of vector using CRISPR / Cas9 system;
Figure 7b: Agarose gel results after T7 Endonuclease 1 (T7E1) assay;
Fig. 7c: Results of gene insertion / deletion indent (gRNA-1: 1, gRNA-2: 2, gRNA-3: 3, gRNA-4: 4) after T7 Endonuclease 1 (T7E1) assay.
Fig. 8 shows the results of successful transformation of cloned β3gnt2 gene knockout through CRISPR / Cas9 system (1 = gRNA-1, 2 = gRNA-2, 3 = gRNA- 4):
8a: Flow cytometry results;
Figure 8b: Sanger-sequencing results (deletion, insertion and PAM sequences (GGC, AGG, CCC, CCT) after screening of indel-confirmed clones as compared to the control (WT).
9 is a view for confirming the decrease in the expression of polylactosamine through the r-out of? 3gnt2:
Western blotting of selected clones (clone 1: 9 of gRNA-1/2 of clone 2: 2 of gRNA-4: 12 of gRNA-4/16 of clone 4 of gRNA-4)
Figure 9b: Confirmation of the reduction of the polylactosamine ratio;
FIG. 9c: Tri- and tetra-antennary N-glycan ascertainment.

Hereinafter, the present invention will be described in detail.

The present invention provides a method of producing a recombinant cell line producing a recombinant glycoprotein with an increased half-life, which comprises inhibiting biosynthesis of polylactosamine in a cell line producing a glycoprotein.

The glycoprotein may be selected from the group consisting of erythropoietin, thrombopoietin, alpha-antitrypsin, cholinesterase, chorionic gonadotropin, CTLA4Ig, Factor VIII , Gamma-glutamyltransferase, granulocyte colony-stimulating factor (G-CSF), and luteinizing hormone (LH). Specifically erythropoietin, but is not limited thereto.

Specifically, the expression of β3gnt2 (UDP-GlcNAc: betaGal beta-1,3-N-acetylglucosaminyltransferase 2) gene is knocked down or the β3gnt2 gene is knocked down to inhibit biosynthesis of polylactosamine. And a step of knocking out the signal.

The mRNA of the? 3gnt2 gene may be composed of the nucleotide sequence shown in SEQ ID NO: 1.

Specifically, the β3gnt2 gene inhibitor is degraded, or the antisense nucleotide, siRNA, shRNA, and miRNA binding to β3gnt2 mRNA are treated with the gene for the expression of β3gnt2 gene in a cell line producing the glycoprotein And more specifically, to transfect a cell line producing a glycoprotein with an siRNA binding to? 3gnt2 mRNA.

The siRNA may include any one selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4 and SEQ ID NO: 6, but is not limited thereto.

The siRNA may comprise an independent sense RNA strand homologous to the target sequence and a complementary antisense RNA strand or a single RNA strand of a stem-loop structure in which the sense RNA strand and the antisense RNA strand are connected by a loop.

The siRNA is not limited to a complete pair of double-stranded RNAs paired with each other, and may have a hairpin structure that forms a stem-loop structure. Specifically, the siRNA may be a short hairpin RNA Quot; On the other hand, the double-chain or stem portion may include a non-paired portion due to a mismatch (the corresponding base is not complementary), a bulge (no base corresponding to one chain), or the like. The total length is 10 to 80 bases, preferably 15 to 60 bases, more preferably 20 to 40 bases. In addition, the loop region has no special significance in the sequence, and it is enough to have about 3-10 bases in order to connect the sense sequence and the antisense sequence at appropriate intervals. Previously used examples of siRNA loop regions were as follows: AUG (Sui et al., Proc. Natl. Acad Sci USA 99 (8): 5515-5520, 2002), CCC, CCACC or CCACACC (Nature et al., Nature Biotechnology 20: 505-508, 2002), UUCG (Lee et al., Nature Biotechnology 20: 500-505), CTCGAG, AAGCUU (Editors of Nature Cell Biology Whither RNAi, Nat Cell Biol. USA 99 (9): 6047-6052, 2002) and TTGATATCCG (default spacer at www.genscript.com). The siRNA termini are both blunt or cohesive termini. The sticky end structure can be a protruding structure with a 3 'end and a protruding structure with a 5' end, and the number of protruding bases is not limited. For example, the base water may be from 1 to 8 bases, preferably from 2 to 6 bases. In addition, the siRNA can be added to a protruding portion of one end in a range where the effect of suppressing the expression of the target gene can be maintained, for example, a small RNA (for example, a natural RNA molecule such as tRNA, rRNA, ). The siRNA terminal structure does not need to have a cleavage structure on both sides, and a stem loop structure in which one terminal region of double-stranded RNA is connected by linker RNA may be used. The length of the linker is not particularly limited as long as it does not interfere with the pairing of the stem portions.

In addition, in an siRNA according to the invention, it is possible for the sense RNA strand and / or the antisense RNA strand to comprise at least one chemical modification in its sugar moiety, nucleobase moiety or internucleotide structure. Such modifications can make it possible to inhibit the destruction of siRNA by nuclease in vivo. All chemical modifications that can improve the stability and biocompatibility of siRNA according to the present invention in vivo are within the scope of the present invention. Of the preferred modifications to the sugar moieties, mention may be made of positions 2 ', 2'-fluoro, 2'-amino, 2'-thio, or 2'- And preferably in the presence of 2'-O-methyl replacing the normal 2'-OH group on the ribonucleotide or in the presence of methylene bridges between positions 2 'and 4' of the LNA. In the case of nucleobases, 5-bromo-uridine, 5-iodo-uridine, N3-methyl-uridine, 2,6-diaminopurine (DAP, 5-methyl-2'-deoxycytidine , Modified bases such as 5- (1-propynyl) -2'-deoxy-uridine (pdU), 5- (1-propinyl) -2'-deoxycytidine (pdC) Finally, a preferred modification of the internucleotide backbone involves the substitution of a phosphodiester group in the backbone by phosphorothioate, methylphosphonate, and phosphorodiamidate groups. (Base, sugar, skeleton) composed of N- (2-aminoethyl) -glycine (PNA, peptide nucleic acid) linked by a peptide bond. (A base that is immobilized on the morpholine ring and linked by a phosphorodiamidate group) or PNA (a peptide A base immobilized on an N- (2-aminoethyl) -glycine unit linked by a bond).

Wherein the transfection is selected from the group consisting of Lipofectamine, Hilymax, Fugene, jetPEI, Effectene, and DreamFect from Dojindo, a commercialized transfection reagent; A method using a method using calcium-phosphate, a positively charged polymer, a liposome, a nanoparticle, a nucleofection, an electroporation, a heat shock, and a magnetofection May be performed using any one selected from the group consisting of < RTI ID = 0.0 >

Specifically, the recombination vector capable of knocking out the? 3gnt2 gene may be transformed into a cell line producing a glycoprotein.

The recombinant vector capable of knocking out the? 3gnt2 gene specifically comprises a nucleotide sequence encoding a guide RNA (gRNA) selected from the group consisting of SEQ ID NOS: 10 to 13, (CRISPR associated protein 9) gene consisting of a nucleotide sequence, and the recombinant vector may include a structure in which a Cas9 gene and a gene encoding a fluorescent protein are bound to each other.

Specifically, the recombinant vector capable of knocking out the? 3gnt2 gene may include any one selected from the group consisting of SEQ ID NOs: 15 to 18, but is not limited thereto.

In this method, the cell line may be mammalian cells, yeast cells or insect cells, and the mammalian cells may be chinese hamster ovary cells (CHO ), HT-1080, human lymphoblastoid, SP2 / 0 (mouse myeloma), NS0 (mouse myeloma), baby hamster kidney cells (BHK), human embryonic kidney cells , HEK), PERC.6 (human retinal cells), and EC2-1H9 cells, and most preferably Chinese hamster ovary cells (CHO), but not limited thereto Do not.

In a specific example of the present invention, expression patterns of nine candidate genes related to polylactosamine synthesis were examined. As a result, β3gnt2 gene was selected as a target gene most likely to be involved in the synthesis of polylactosamine structure due to its highest expression amount, and β3gnt2 A target siRNA to inhibit expression was prepared (see FIGS. 1 and 2). In order to confirm the suppression of β3gnt2 gene expression and inhibition of polylactosamine synthesis by siRNA produced by the present invention, EPO produced in siRNA-treated CHO cells was tested for lactosaminyl repeat structure and specific (LEL). As a result, it was confirmed that EPO in which β3gnt2 expression was inhibited by siRNA-2 treatment showed about 70% signal reduction (see FIG. 3).

In addition, the present inventors confirmed the quantitative change of the sugar chain structure by the inhibition of polylactosamine, and as a result, it was confirmed that the proportion of polylactosamine in total N-glycan was significantly reduced from about 19% to 2% (Fig. 4A), confirming that the polylactosamine structure was reduced (Figs. 5 and 6). In addition, it was confirmed that the ratio of tri- and tetra-antennary N-glycans was increased (see FIG. 4B).

In addition, the present inventors prepared a β3gnt2 gene knockout recombinant vector through the CRISPR / Cas9 system. In order to confirm the knockout efficiency by transforming the recombinant vector, the T7E1 assay was performed. As a result, The mismatched DNA region was cut by T7E1 to show multi-band (see FIG. 7B), and the knocked-out sequence was confirmed by flow cytometry and ginger-sequencing (see FIG. 8). In addition, EPO isolated from the knockout clone of β3gnt2 gene (clone 1: 15007-9 / clone 2: 15402-2 / clone 3: 15402-12 / clone 4: 15402-16) did not show any reaction with LEL (See FIG. 9A), it was confirmed that the proportion of polylactosamine in the total N-glycan was significantly reduced from about 15% to about 2% (see FIG. 9B). In addition, it was confirmed that the ratio of tri-antennary and tetra-antennary N-glycans was increased while polylactosamine was decreased (see FIG. 9C).

Accordingly, the present invention provides a method for confirming the reduction of polylactosamine in recombinant human erythropoietin produced from a cell line in which expression of β3gnt2 gene involved in biosynthesis of polylactosamine is inhibited (knocked down) or β3gnt2 gene is knocked out, It is possible to positively increase the half-life of glycoprotein and the glycoprotein efficacy by confirming the increase of the triplet and / or quadrupole antenna structure of the cell. As a result, it is possible to produce a recombinant glycoprotein having an increased half-life through the method of the present invention Respectively.

In addition, the present invention provides a recombinant cell line producing the recombinant glycoprotein produced by the above method and having an increased half-life.

In addition,

1) culturing the recombinant cell line; And

2) separating the recombinant glycoprotein from the culture medium of step 1).

The glycoprotein may be selected from the group consisting of erythropoietin, thrombopoietin, alpha- antitrypsin, choline esterase, chorionic gonadotropin, CTLA4Ig, Factor VIII, gamma-glutamyltransferase, granulocyte colony stimulating factor and luteinizing hormone And may be, but is not limited to, erythropoietin.

In addition, the present invention provides recombinant glycoproteins with increased half-life, separated by the above method.

The recombinant glycoprotein having an increased half-life separated by the above method is characterized by an increased tri- and / or tetra-antennary structure of N-glycan.

In addition, the present invention provides a nucleic acid encoding a nucleotide sequence encoding a guide RNA (gRNA) selected from the group consisting of SEQ ID NOS: 10 to 13; And a Cas9 (CRISPR associated protein 9) gene consisting of the nucleotide sequence shown in SEQ ID NO: 14.

The recombinant vector may include a structure in which a Cas9 gene and a gene encoding a fluorescent protein are bound to each other. Specifically, the recombinant vector may include any one of the nucleotide sequences selected from the group consisting of SEQ ID NOS: 15 to 18 , But is not limited thereto.

Accordingly, the present invention provides a method for confirming the reduction of polylactosamine in recombinant human erythropoietin produced from a cell line in which expression of β3gnt2 gene involved in biosynthesis of polylactosamine is inhibited (knocked down) or β3gnt2 gene is knocked out, It is possible to positively increase the half-life of glycoprotein and the glycoprotein efficacy by confirming the increase of the triplet and / or quadrupole antenna structure of the cell. As a result, it is possible to produce a recombinant glycoprotein having an increased half-life through the method of the present invention Respectively.

Hereinafter, the present invention will be described in detail with reference to examples.

It should be noted, however, that the following examples are illustrative of the present invention and that the present invention is not limited to the following examples.

Polylactosamine ( Polylactosamine ) Of the synthetic gene siRNA  making

<1-1> Polylactosamine  Identification of Synthetic Genes

The synthesis of polylactosamine involves nine kinds of genes (β3gnt1 to 9) that bind β1,3-GlcNAc to galactose, but the genes specifically involved in each tissue or cell type are not the same. Thus, qPCR was performed in CHO cells of three kinds (EC2-1H9, 1098-2, CGT II-4) in order to compare the expression pattern of nine candidate genes.

As a result, as shown in Fig. 1, the target gene most likely to be involved in the synthesis of the polylactosamine structure was selected as the β3gnt2 gene with the highest expression amount, and a target siRNA to inhibit the expression of β3gnt2 was prepared.

<1-2> Construction of siRNA of β3gnt2 gene

siRNA sequences were designed and synthesized to construct siRNA of β3gnt2 gene.

SiRNA sequences were designed from three regions (siRNA-499, siRNA-1101 and siRNA-970) inhibiting hamster β3gnt2 mRNA (GenBank accession no. XM_003502146.2; SEQ ID NO: 1) at the coding region position as shown in FIG. And synthesized. The oligonucleotides used in the siRNAs are as described in Table 1.

siRNA name Oligonucleotide name Oligonucleotide sequence location on cDNA siRNA-1 S-siRNA (SEQ ID NO: 2) 5'-GAAGAAATGCGCAAAGAA-3 ' 499 A-siRNA (SEQ ID NO: 3) (target sequence) 5'-TTCTTTGCGCATTTCTTC-3 ' siRNA-2 S-siRNA (SEQ ID NO: 4) 5'-CTGGAATGTGCCTTCAGAA-3 ' 1101 A-siRNA (SEQ ID NO: 5) (target sequence) 5'-TTCTGAAGGCACATTCCAG-3 ' siRNA-3 S-siRNA (SEQ ID NO: 6) 5'-CATCCCAGAAGTCTTCTAT-3 ' 970 A-siRNA (SEQ ID NO: 7) (target sequence) 5'-ATAGAAGACTTCTGGGATG-3 '

β3gnt2  gene Knockdown (knock-down) CHO  Construction of cell lines

The CHO cell line producing human EPO was transfected with the siRNA of β3gnt2 gene prepared in Example <1-2>.

Specifically, the recombinant human EPO producing CHO cell line, EC2-1H9, Cells were treated with 10% dFBS (dialysed fetal bovine serum, SAFC, US), 3.5 g / L glucose, 20 nM MTX (methotrexate; Sigma) , And 1% Ab-Am (Antibiotic-Antimycotic solution; Gibco) at 37 ° C and 5% CO ₂ .

For transfection of the siRNA prepared in Example <1-2>, EC2-1H9 cells were transfected with β3gnt2-specific or negative control group using Lipofectamine® RNAiMAX transfection reagent (Invitrogen, Carlsbad, CA, USA) Lt; / RTI &gt; (UGCG-specific siRNA). After 24 hours of transfection, the medium was exchanged with serum-free medium (CHO-S-SFM II; Gibco) and incubated for an additional 3 days in an environment of 5% CO ₂ at 37 ° C.

< Experimental Example  1> β3gnt2  Through knock-down Polylactosamine  Confirmation of inhibition of synthesis

In order to confirm the inhibition of β3gnt2 gene expression by siRNA treatment of β3gnt2 gene and the inhibition of synthesis of polylactosamine by this treatment, EPO produced in CHO cell treated with siRNA was tested for lactosaminyl repeat structure and specific Immunoblotting was performed using the Lycopersicon Esculentum Lectin (LEL).

<1-1> β3gnt2  Confirm gene expression

Total RNA of the recombinant CHO cells constructed in Example 2 was extracted using RNeasy 占 Mini (QIAGEN) according to the manufacturer's protocol. 1.0 μg of RNA was reverse-transcribed into cDNA using AccuPower RT-PCR PreMix (Bioneer, Korea). The cDNA was used as a template to identify mRNA transcripts of β3gnt2 using qPCR. (5'-CTG GCG ATT AAG TCC CTC ATT-3 '; SEQ ID NO: 8) and the reverse direction (5'-CTG GCG ATT AAG TCC CTC ATT-3'; SEQ ID NO: 9) primers for qPCR of? iQTM SYBR® Green Supermix (Bio-Rad, Hercules, Calif., USA) was used.

<1-2> Isolation of recombinant human erythropoietin (rhEPO) from recombinant human

To isolate recombinant human erythropoietin (rhEPO), the culture supernatant containing rhEPO was pooled and passed through a 0.45 μm-pore-size membrane. The passed culture medium was concentrated and exchanged with PBS buffer through ultrafiltration (AmiconUltra; Millipore, Bedford, Mass.). Then, rhEPO was purified using an immunoaffinity chromatography column (MAiiA, Uppsala, Sweden). After loading the sample and washing with PBS, the remaining rhEPO was eluted with 0.1 M glycine / 0.5 M NaCl, pH 2.8, and the eluate was immediately neutralized with 1.0 M Tris / HCl, pH 9.0. Purified rhEPO was concentrated and dialyzed with distilled water using ultrafiltration (AmiconUltra; Millipore). The concentration of rhEPO was determined using the Quant-iT ™ protein assay kit (Invitrogen).

<1-3> Of polylactosamine  Immunity for confirmation of expression Blotting

Lectin blot analysis was performed to confirm expression levels of polylactosamine. Specifically, the purified 1 ㎍ EPO was electrophoresed on 12.5% SDS PAGE and transferred to PVDF membrane (Millipore, Billerica, MA) for purified EPO blotting using Lycopersicon Esculentum Lectin (LEL) LEL (Vector Laboratories Inc, Burlingame, Calif., USA). The PVDF membrane was blocked with 5% BSA in TBS-T [TBS (140 mM NaCl, 10 mM Tris-HCl, pH 8.0) /0.05% Tween 20] for 1 hour at room temperature. After blocking, the membrane was incubated overnight at 4 [deg.] C with biotin-labeled lectin diluted 1: 500 in TBS-T. The membrane was then rinsed three times with TBS-T and incubated with ExtraAvidin-Peroxidase (2.0-2.5 mg / ml) diluted 1: 5,000 for 1 hour at room temperature. Finally, the membrane was rinsed 5 times with TBS- kit.

The following experiment was conducted for re-blotting using anti-EPO antibody. Specifically, for the control of the number of EPO, the same blot after lectin blotting was subjected to levotating using an anti-EPO antibody. Namely, the membrane was incubated with a stripping buffer (CANDOR Bioscience GmbH, Wangen imallgau, Germany) for 30 minutes at room temperature and washed five times with TBS-T. The membrane was incubated with 5% BSA in the presence of mouse anti-EPO antibody (100 ug / ml, Santa Cruz, Calif.) Diluted 1: 10,000 in TBS-T at room temperature for 1 hour. After incubation, the membranes were washed 5 times with TBS-T and treated with Supersignal kit. The blotting exponent was calculated as the band intensity in the lectin blot and divided by the levodrobite intensity in the Western blot using anti-EPO antibody.

As a result, as shown in FIG. 3, it was confirmed that siRNA-2 and siRNA-3 inhibited the expression of β3gnt2 more effectively than siRNA-1 treatment (FIGS. 3a and 3b) and inhibited β3gnt2 expression by siRNA- EPO showed a signal reduction of about 70% as a result of blotting (FIG. 3C and FIG. 3D).

< Experimental Example  2> β3gnt2  Through knock-down rhEPO  antenna( antennary ) Confirmation of structure increase

N-glycan mass spectrometry using LC / MS and MALDI was performed to confirm quantitative changes in sugar chain structure due to inhibition of polylactosamine via siRNA of β3gnt2 gene.

Specifically, purified rhEPO was denatured by rapid thermal cycling (25-100 ° C) in aqueous solutions of 100 mM ammonium bicarbonate and 5 mM dithiothreitol. After cooling, 2.0 ul (or 1000 U) of peptide N-glycosidase F was added, followed by mixing and incubation for 16 hours in a 37 ° C water base. The rhEPO lysate was loaded onto the cartridge and washed to remove salts and other buffer material with pure water. N-glycans were eluted from the water (acidic fraction) by the addition of 40% acetonitrile / 0.05% trifluoroacetic acid. The sample was dried under vacuum. The rhEPO N-glycan fraction was redissolved in water and 1.0 ul (corresponding to 1 ug of rhEPO) was spotted onto a stainless steel target plate. Neutral glycans were analyzed in cationic mode ([M ⁺ Na] ⁺ or [M ⁺ H] ⁺ ), while acid glycans were analyzed in anion mode ([M ^- H] ^- ). Each acquired spectra showed a combined signal from 800 laser shots at three arbitrary locations in the field (2400 total laser shots). Mass spectra were recorded over the range of m / z 2000-4500. Maltooligosaccharide ladder was used for external mass calibration. The MS peak was filtered with a signal to noise ratio of 5.0 and deconvolution was performed to obtain a list of compound mass and strength. N-glycan fractions were combined and the amount of 2.0 μL (corresponding to 800 ng EPO) was injected into a porous graphite carbon nano-LC chip (Agilent) with an automatic sample injector. The rapid glycan elution gradient was analyzed using an analytical column (HPLC) to ascend from 6% to 100% B for 20 minutes using (A) aqueous solution of 3.0% acetonitrile / 0.1% formic acid and (B) 90.0% acetonitrile / 0.0 &gt; uL / min. &Lt; / RTI &gt; The remaining non-glycan compounds were washed out with 100% B and then re-equilibrated. The MS spectrum was acquired in cationic mode at a mass range of m / z 500-2000 with an acquisition time of 1.5 seconds per spectrum.

As a result, as shown in Figs. 4 to 6, it was confirmed that the proportion of polylactosamine in the total N-glycan was significantly reduced from about 19% to about 2% (Fig. 4A), and MALDI-TOF MS and LC / MS showed that the polylactosamine structure was reduced (Figs. 5 and 6).

In addition, it was confirmed that the proportion of tri- and tetra-antennary N-glycans was increased while polylactosamine was decreased (Fig. 4B). This seems to be because the components used for polylactosamine synthesis were used for antenna branching. According to the literature, EPO having a bi-antennary sugar chain structure has been reported to have an in-vivo activity reduction of about 85% as compared to EPO having a tetra-antennary sugar chain structure (Takeuchi et al , PNAS, 1989). Therefore, the reduction of polylactosamine and consequently the increase of quadrupole antenna structure can be a positive effect on the increase of half-life of glycoprotein and glycoprotein efficacy.

β3gnt2  gene Knockout (knock-out) CHO  Construction of cell lines

<3-1> Production of recombinant human EPO CHO  Cell preparation

EC2-1H9 cells, which are recombinant human EPO producing CHO cells, Hyo Jeong Hong (Antibody Engineering Research Unit, Korea Research Institute of Bioscience and Biotechnology, Yuseong-gu, Daejeon, Korea). Cells were supplemented with 10% (v / v) dFBS (Gibco), 3.5 g / L glucose, 20 nM MTX (methotrexate; Sigma), and 1% (v / v) Ab-Am (antibiotic-antimycotic solution; Gibco) Gt; 37 C &lt; / RTI &gt; in 5% CO ₂ in MEM-a (Gibco).

<3-2> CRISPR / Cas9  Through the system β3gnt2  Production and Transformation of a Gene Knockout Recombinant Vector

The DNA sequence encoding the gRNA (guide RNA) used to produce the recombinant vector to knock out the β3gnt2 gene was obtained from CPRISPy, a web-based CRISPR design tool specific to the CHO-K1 genome. Such a gRNA is a DNA sequence (synthetic oligonucleotide) that specifically recognizes the β3gnt2 gene of Chais hamsters and each encodes a gRNA sequence designed to knock out the DNA strand of the β3gnt2 gene. This is shown in SEQ ID NOS: 10 to 13 in Table 1 below

Location in the gene Base sequence SEQ ID NO: gRNA-1 15007 TGTTCCAGTACGCCCGGGAA (-) SEQ ID NO: 10 gRNA-2 15181 AGTCTTTAAATCTGTCCGGC (-) SEQ ID NO: 11 gRNA-3 15385 GTAGTGAGAGTCTTCTTGTT (+) SEQ ID NO: 12 gRNA-4 15402 GTTGGGCAAGACGCCCCCCG (+) SEQ ID NO: 13

The DNA sequences (gRNA-1, gRNA-2, gRNA-3, gRNA-4) encoding the gRNA sequence were amplified by PCR using the pCas -Guide-EF1a vector (Origene, Rockville, Maryland). The vector was used as a template to generate gRNA from the DNA represented by the nucleotide sequence of SEQ ID NOS: 10 to 13 and Cas9 mRNA from the Cas9 DNA sequence represented by the nucleotide sequence of SEQ ID NO: 14 at the time of in vivo transcription. At this time, the Cas9 gene is linked to a gene encoding GFP through the linker 2A peptide, so that Cas9 protein and GFP protein can be expressed at once. The cleavage map of the recombinant vector prepared in the above procedure is shown in FIG. 7, and the entire nucleotide sequence of the recombinant vector is shown in SEQ ID NOs: 15 to 18.

The pCas-B3gnt2-EF1a vector prepared above was transformed into EC2-1H9 cells of Example <3-1> using Lipofectamine ™ 2000 (Invitrogen, Carlsbad, Calif.).

< Experimental Example 3> β3gnt2  Gene knock-out results

<3-1> T7E1 Assay (assay)

Non-homologous end-joining (NHEJ) occurs in the genome region when a specific region of the genome is inserted by the CRISPR / Cas9 system. When DNA of this type is denaturated and hybridization is performed at a low temperature, the DNA of the wild type (WT) that is not inserted and the DNA of the inserted clone are mixed with the heteroduplex (mismatch) ), And T7E1 recognizes these mismatched DNA regions and cuts them.

(Indel,%) of gene insertion / deletion by gRNA was measured prior to the construction of the stable cell line in which the B3gnt2 gene was knocked out through the CRISPR / Cas9 system in the above Example <3-2> Lt; / RTI &gt; assay was performed.

Specifically, the genomic DNA was extracted from the transformed cells, quantified, and PCR was performed using 200 ng of the genomic DNA as a template. The primer pair used was a range covering all four recognition sites of the gRNA (SEQ ID NO: 19) / reverse direction: 5'-CCA GAT ATG AGA AAT GAG TGT TGG ACG-3 '(Sequence: SEQ ID NO: No. 20)). 2 μl of PCR products were electrophoresed using 1.5% agarose gel. After confirming proper product size, the product was purified using a qiaquick PCR purification kit (Qiagen). The DNA concentration of the purified PCR product was quantitated and 2 μl of 10 × NEB buffer + 200 ng of PCR product + DDW was added to the final 19 μl, followed by denaturation and hybridization of the DNA using a thermocycler To the annealed DNA fragment, 1 μl of T7 Endonuclease 1 (T7E1) was added, followed by reaction at 37 ° C for 15 minutes. Then, T7E1 was inactivated with proteinase K, and then electrophoresed on 1.5% agarose gel, and compared with the control, and it was confirmed how much the incompletely matched DNA was cleaved by T7E1. The ratio of the intensities of the bands of the whole band intensity (bands of uncut WT positions + cut-out fragments) and cut-out fragments (bands of fragments at two positions due to cutting a specific position) (%, genome edition efficiency).

As a result, as shown in FIG. 7B, when the r-out efficiency using four kinds of gRNA was confirmed, compared with the WT DNA not truncated by T7E1, the DNA of the inserted cell was truncated by T7E1 and the multi- band (Fig. 7B). That is, it was confirmed that all of the four kinds of gRNAs performed the rust-out operation.

<3-2> Sanger - Sequencing sanger -sequencing)

Cells in which the β3gnt2 gene was knocked out through the CRISPR / Cas9 system in Example 3 were selected for 3 weeks by flow cytometry (Beckman coulter Inc, Brea, Calif.), And successfully transformed clones for 3 weeks 8A). The selected clone (clone 1: gRNA-1 9 / clone 2: gRNA-4 2 / clone 3: gRNA-4 12 / clone 4: gRNA-4 16) (Fig. 8B).

< Experimental Example  4> β3gnt2  Through gene knock-out Polylactosamine  Synthesis inhibition and confirmation of increased antenna structure

<4-1> Polylactosamine  Confirmation of inhibition of synthesis

EC2-1H9 cells in which the β3gnt2 gene was confirmed to have been knocked out had 5.0 × 10 ⁶ cells of 10% (v / v) dFBS, 3.5 g / L glucose, 1% (v / v) Ab- Lt; RTI ID = 0.0 &gt; MEM-a. &Lt; / RTI &gt; Culture medium containing recombinant human erythropoietin (rhEPO) was used for SDS-PAGE and then transferred to PVDF membrane (Millipore Corp., Bedford, Mass.). After blocking for 2 hours at room temperature with TBS-T (140 mM NaCl, 10 mM Tris-HCl, with 0.05% Tween 20, pH 8.0) with 5% BSA, PVDF membranes were incubated with biotin labeled lectin (Lycopersicon Esculentum Lectin; LEL) at 4 &lt; 0 &gt; C for 16 hours. After washing three times for 5 minutes with TBS-T, the membranes were incubated with ExtrAvidin-peroxidase (Sigma) at room temperature for 1 hour and developed with ECL kit (Thermo Scientific; Rockford, Ill.).

For reblotting, the membrane was stripped at room temperature for 1 hour using a stripping buffer (Candor Bioscience GmbH, Weissensberg, Germany). The PVDF membrane was washed three times for 5 minutes with TBS-T and then incubated with RP-labeled anti-mouse IgG antibody (Santa Cruz) diluted 1: 5000 for 1 hour at room temperature. Membranes were developed with ECL solution (Thermo Scientific; Rockford, Ill.).

As a result, as shown in FIG. 9A, a clone in which β3gnt2 gene was knocked out (clone 1: 9 of gRNA-1 / clone 2: 2 of gRNA-4 / clone 3: 12 of gRNA- 16) did not show any reaction with LEL (Fig. 9A).

<4-2> Confirmation of increase of antenna structure

EC2-1H9 cells in which the β3gnt2 gene was confirmed to have been knocked out had 5.0 × 10 ⁶ cells of 10% (v / v) dFBS, 3.5 g / L glucose, 1% (v / v) Ab- Lt; RTI ID = 0.0 &gt; MEM-a. &Lt; / RTI &gt; The culture medium was replaced with serum-free medium (CHO-S-SFM II; Gibco) within 3 days. After 2 days, the culture medium was collected and filtered with a 0.45 μm filter (Sartorius, Göttingen, Germany) and dialyzed overnight at 4 ° C. with phosphate buffer saline (PBS, pH 7.4). To purify rhEPO, the culture medium was EPO purified gel (MAIIA Diagnostics, Uppsala, Sweden). The purified rhEPO was dialyzed overnight at 4 ° C with distilled water. Concentrations were measured using the Quant-iT ™ protein assay kit (Invitrogen) and stored at -80 ° C until use.

Specifically, purified rhEPO was denatured by rapid thermal cycling (25-100 ° C) in aqueous solutions of 100 mM ammonium bicarbonate and 5 mM dithiothreitol. After cooling, 2.0 ul (or 1000 U) of peptide N-glycosidase F was added, followed by mixing and incubation for 16 hours in a 37 ° C water base. The rhEPO lysate was loaded onto the cartridge and washed to remove salts and other buffer material with pure water. N-glycans were eluted from the water (acidic fraction) by the addition of 40% acetonitrile / 0.05% trifluoroacetic acid. The sample was dried under vacuum. The rhEPO N-glycan fraction was redissolved in water and 1.0 ul (corresponding to 1 ug of rhEPO) was spotted onto a stainless steel target plate. Neutral glycans were analyzed in cationic mode ([M ⁺ Na] ⁺ or [M ⁺ H] ⁺ ), while acid glycans were analyzed in anion mode ([M ^- H] ^- ). Each acquired spectra showed a combined signal from 800 laser shots at three arbitrary locations in the field (2400 total laser shots). Mass spectra were recorded over the range of m / z 2000-4500. Maltooligosaccharide ladder was used for external mass calibration. The MS peak was filtered with a signal to noise ratio of 5.0 and deconvolution was performed to obtain a list of compound mass and strength. N-glycan fractions were combined and the amount of 2.0 μL (corresponding to 800 ng EPO) was injected into a porous graphitic carbon nano-LC chip (Agilent) using an autosampler. The rapid glycan elution gradient was analyzed using an analytical column (HPLC) to ascend from 6% to 100% B for 20 minutes using (A) aqueous solution of 3.0% acetonitrile / 0.1% formic acid and (B) 90.0% acetonitrile / 0.0 &gt; uL / min. &Lt; / RTI &gt; The remaining non-glycan compounds were washed out with 100% B and then re-equilibrated. The MS spectrum was acquired in cationic mode at a mass range of m / z 500-2000 with an acquisition time of 1.5 seconds per spectrum.

As a result, it was confirmed that the proportion of polylactosamine in the total N-glycan was significantly reduced from about 15% to about 2% as shown in Fig. 9B (Fig. 9B).

In addition, it was confirmed that the proportion of tetra-antennary N-glycans was increased while polylactosamine was decreased (FIG. 9C).

This seems to be because the components used for polylactosamine synthesis were used for antenna branching. According to the literature, EPO having a bi-antennary sugar chain structure has been reported to have an in-vivo activity reduction of about 85% as compared to EPO having a tetra-antennary sugar chain structure (Takeuchi et al , PNAS, 1989). Therefore, the reduction of polylactosamine and consequently the increase of quadrupole antenna structure can be a positive effect on the increase of half-life of glycoprotein and glycoprotein efficacy.

<110> Korea Advanced Institute of Science and Technology <120> Method for preparing recombinant glycoproteins with improved          N-glycan antennary structure by inhibiting biosynthesis          폴리 라코산 <130> 2017P-07-017 <150> KR 10-2016-0100674 <151> 2016-08-08 <160> 20 <170> KoPatentin <210> 1 <211> 2670 <212> RNA <213> Cricetulus griseus <400> 1 tcagatttat gtctgataat ccacactgag atgtcccacc cagagctgtt tgggcacctt 60 cgtagtatga gctagcttat aaaagatatg agaaatgagt gttggacgtc gaagaataaa 120 gttgttgggt atcctgatga tggcaaatgt cttcatttat ttgattgtgg aagtctccaa 180 aaatagtagc caagaaaaaa atggaaaggg gggagtaata atacccaaag aaaagttctg 240 gaagatattc agcccttccc gggcgtactg gaacagagag caagagaaac tgaacaagtg 300 gtacaatccc attctgaaca ggctggccaa ccagacaggg gatttgtatt cgtctccaaa 360 tataagtcat ctgggctatt gtgaacctga cccaagggtc atgacagctg tgacagattt 420 taataacctg ccggacagat ttaaagactt cctcttgtat ttgagatgcc gaaattactc 480 actgcttata gatcaaccga agaaatgcgc aaagaaaccc ttcttactgc tggcgattaa 540 gtccctcatt ccacattttg ccagaaggca agcaattcgg gaatcttggg gcagagaaac 600 caatgtgggg aaccagacagt tagtgagagt cttcttgttg ggcaagacgc cccccgagga 660 caaccaccct gacctttcag acatgctgaa gtttgagagt gagaggcacc aggacattct 720 catgtggaac tatagagaca ctttcttcaa cctgtctctg aaggaggtgc tgtttctccg 780 gtgggtgagc acttcctgtc cagatgcgga gtttgttttc aaaggcgatg atgatgtgtt 840 tgtgaatact caccacatcc tgaattactt gaatagctta tccaagaaca aagccaaaga 900 tttgtttata ggtgacgtga tccacaatgc tgggcctcat cgggataaga aactgaagta 960 ctacatccca gaagtcttct atactggggt ctacccaccg tatgcaggag gaggtgggtt 1020 cctgtactcc ggagccctgg ccctgagact gtacaatata actgaccggg tccacctcta 1080 tcccatagat gatgtttata ctggaatgtg ccttcagaaa ctgggccttg ttcccgagaa 1140 acacaaaggc ttcaggacat ttgatattga agagaaaaat aaaaaaaata tttgttcata 1200 tgtagatcta atgttagtgc atagcagaaa acctcaagag atgattgata tttggtctca 1260 gttgcagagt cctaatttaa aatgctaacg tgcactggag ctgcatttca caaaaaggcc 1320 tatcctgcct agttcccatg ttgtgctttc acagtagggt gacttctgta tgaagccatc 1380 agccttgatg agtagcatct gaaccctgag ccctcagttc cacacttttg tggccagggg 1440 aaaagctgaa gataattcac catggtcaga tgattggttc tgacccttcc tctggctgcc 1500 agtcctcagt tcctaatttt tacttctcca aaatcatgtt tagaattcga ccatggaggt 1560 cttttttttg tctttatgat ggtatactcc tgcttccatt ttaatgatgg atacagacca 1620 ggtgtttata aactggctac gcaagatttt gtaggacatg attttgtgtt tttgtgaaat 1680 ggaattatgg aattatattt attttcataa gattttgatg ggcttttaaa attggctaga 1740 aaatggactg atgttgaaat tccccgtcac cccaacagta ttctccttgt tactagaacc 1800 catccctttc ttataaaaag aaagccacca tgcaacacat gcagttcatc tcgtctggcc 1860 ttatggccat gagaagggca gaaggttttc ttttacctgt gtttggtttg ctgggtagca 1920 tcatgatggt taattttagt atttggaaat cttgagtgtg attccaaatg gccaactgaa 1980 gactcagtag cctgacagcc atatgggttt gtgaatgttc aatgtgggtc agggaagcat 2040 ttgtgtcttt tgaacttgaa atgaaaagct agatcttgaa ggcattttct taagtggttt 2100 gtcagtttaa aactccagga ttctattctt gccatattat ctatcagatg ttgcttagct 2160 gaagcttttc tgagtagtga tgcttccctg tctcagtgta gaagtacctg tgtttttatt 2220 tattgttcag atcaaagacc aaaacatttt cttaagaata ttttgtgtaa tattttattt 2280 gtatacagtg ttgtttgtga aatatttaac tagagcatga tattttattt tttctcattt 2340 taaattagtt tttttttgag aatttcatac aatgtgtttt gatccatatt cgcctccccc 2400 aactcctccc agatctagcc ccagcatgtt ttaaatgtta agctataaca tatgttgaat 2460 aaagttaact cttatttttt gaattttaaa atttggattg ggggggcaga acggctagag 2520 ttgataaagt tctgccaaat tgttgcttat accttgtatc ttgtaacatg ctttcttgaa 2580 actttttttt gttttgtttt agagggttct cctttgtgct gttggggatt gggggaaaag 2640 tggaaataaa gtgactgtat tttttaatca 2670 <210> 2 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> siRNA-499 S <400> 2 gaagaaatgc gcaaagaa 18 <210> 3 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> siRNA-499A <400> 3 ttctttgcgc atttcttc 18 <210> 4 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> siRNA-1101 S <400> 4 ctggaatgtg ccttcagaa 19 <210> 5 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> siRNA-1101A <400> 5 ttctgaaggc acattccag 19 <210> 6 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> siRNA-970 S <400> 6 catcccagaa gtcttctat 19 <210> 7 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> siRNA-970A <400> 7 atagaagact tctgggatg 19 <210> 8 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> beta 3gnt2 qPCR F <400> 8 ctggcgatta agtccctcat t 21 <210> 9 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> beta 3gnt2 qPCR R <400> 9 ctggcgatta agtccctcat t 21 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> gRNA-1 <400> 10 tgttccagta cgcccgggaa 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> gRNA-2 <400> 11 agtctttaaa tctgtccggc 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> gRNA-3 <400> 12 gtagtgagag tcttcttgtt 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> gRNA-4 <400> 13 gttgggcaag acgccccccg 20 <210> 14 <211> 4251 <212> DNA <213> Artificial Sequence <220> <223> Cas9 DNA <400> 14 atggataaga aatactcaat aggactggat attggcacaa atagcgtcgg atgggctgtg 60 atcactgatg aatataaggt tccttctaaa aagttcaagg ttctgggaaa tacagaccgc 120 cacagtatca aaaaaaatct tataggggct cttctgtttg acagtggaga gacagccgaa 180 gctactagac tcaaacggac agctaggaga aggtatacaa gacggaagaa taggatttgt 240 tatctccagg agattttttc aaatgagatg gccaaagtgg atgatagttt ctttcataga 300 cttgaagagt cttttttggt ggaagaagac aagaagcatg aaagacatcc tatttttgga 360 aatatagtgg atgaagttgc ttatcacgag aaatatccaa ctatctatca tctgagaaaa 420 aaattggtgg attctactga taaagccgat ttgcgcctga tctatttggc cctggcccac 480 atgattaagt ttagaggtca ttttttgatt gagggcgatc tgaatcctga taatagtgat 540 gtggacaaac tgtttatcca gttggtgcaa acctacaatc aactgtttga agaaaaccct 600 attaacgcaa gtggagtgga tgctaaagcc attctttctg caagattgag taaatcaaga 660 agactggaaa atctcattgc tcagctcccc ggtgagaaga aaaatggcct gtttgggaat 720 ctcattgctt tgtcattggg tttgacccct aattttaaat caaattttga tttggcagaa 780 gatgctaaac tccagctttc aaaagatact tacgatgatg atctggataa tctgttggct 840 caaattggag atcaatatgc tgatttgttt ttggcagcta agaatctgtc agatgctatt 900 ctgctttcag acatcctgag agtgaatact gaaataacta aggctcccct gtcagcttca 960 atgattaaac gctacgatga acatcatcaa gacttgactc ttctgaaagc cctggttaga 1020 caacaacttc cagaaaagta taaagaaatc ttttttgatc aatcaaaaaa cggatatgca 1080 ggttatattg atggcggcgc aagccaagaa gaattttata aatttatcaa accaattctg 1140 gaaaaaatgg atggtactga ggaactgttg gtgaaactga atagagaaga tttgctgcgc 1200 aagcaacgga cctttgacaa cggctctatt ccccatcaaa ttcacttggg tgagctgcat 1260 gctattttga gaagacaaga agacttttat ccatttctga aagacaatag agagaagatt 1320 gaaaaaatct tgacttttag gattccttat tatgttggtc cattggccag aggcaatagt 1380 aggtttgcat ggatgactcg gaagtctgaa gaaacaatta ccccatggaa ttttgaagaa 1440 gttgtcgata aaggtgcttc agctcaatca tttattgaac gcatgacaaa ctttgataaa 1500 aatcttccaa atgaaaaagt gctgccaaaa catagtttgc tttatgagta ttttaccgtt 1560 tataacgaat tgacaaaggt caaatatgtt actgaaggaa tgagaaaacc agcatttctt 1620 tcaggtgaac agaagaaagc cattgttgat ctgctcttca aaacaaatag gaaagtgacc 1680 gttaagcaac tgaaagaaga ttatttcaaa aaaatagaat gttttgatag tgttgaaatt 1740 tcaggagttg aagatagatt taatgcttca ctgggtacat accatgattt gctgaaaatt 1800 attaaagata aagatttttt ggataatgaa gaaaatgaag acatcctgga ggatattgtt 1860 ctgacattga ccctgtttga agatagggag atgattgagg aaagacttaa aacatacgct 1920 cacctctttg atgataaggt gatgaaacag cttaaaagac gcagatatac tggttgggga 1980 aggttgtcca gaaaattgat taatggtatt agggataagc aatctggcaa aacaatactg 2040 gattttttga aatcagatgg ttttgccaat cgcaatttta tgcagctcat ccatgatgat 2100 agtttgacat ttaaagaaga catccaaaaa gcacaagtgt ctggacaagg cgatagtctg 2160 catgaacata ttgcaaatct ggctggtagc cctgctatta aaaaaggtat tctccagact 2220 gtgaaagttg ttgatgaatt ggtcaaagtg atggggcggc ataagccaga aaatatcgtt 2280 attgaaatgg caagagaaaa tcagacaact caaaagggcc agaaaaattc cagagagagg 2340 atgaaaagaa tcgaagaagg tatcaaagaa ctgggaagtc agattcttaa agagcatcct 2400 gttgaaaata ctcaattgca aaatgaaaag ctctatctct attatctcca aaatggaaga 2460 gatatgtatg tggaccaaga actggatatt aataggctga gtgattatga tgtcgatcac 2520 attgttccac aaagtttcct taaagacgat tcaatagaca ataaggtcct gaccaggtct 2580 gataaaaata gaggtaaatc cgataacgtt ccaagtgaag aagtggtcaa aaagatgaaa 2640 aactattgga gacaacttct gaacgccaag ctgatcactc aaaggaagtt tgataatctg 2700 accaaagctg aaagaggagg tttgagtgaa cttgataaag ctggttttat caaacgccaa 2760 ttggttgaaa ctcgccaaat cactaagcat gtggcacaaa ttttggatag tcgcatgaat 2820 actaaatacg atgaaaatga taaacttatt agagaggtta aagtgattac cctgaaatct 2880 aaactggttt ctgacttcag aaaagatttc caattctata aagtgagaga gattaacaat 2940 taccatcatg cccatgatgc ctatctgaat gccgtcgttg gaactgcttt gattaagaaa 3000 tatccaaaac ttgaaagcga gtttgtctat ggtgattata aagtttatga tgttaggaaa 3060 atgattgcta agtctgagca agaaataggc aaagcaaccg caaagtattt cttttactct 3120 aatatcatga acttcttcaa aacagaaatt acacttgcaa atggagagat tcgcaaacgc 3180 cctctgatcg aaactaatgg ggaaactgga gaaattgtct gggataaagg gagagatttt 3240 gccacagtgc gcaaagtgtt gtccatgccc caagtcaata tcgtcaagaa aacagaagtg 3300 cagacaggcg gattctctaa ggagtcaatt ctgccaaaaa gaaattccga caagctgatt 3360 gctaggaaaa aagactggga cccaaaaaaa tatggtggtt ttgatagtcc aaccgtggct 3420 tattcagtcc tggtggttgc taaggtggaa aaagggaaat ccaagaagct gaaatccgtt 3480 aaagagctgc tggggatcac aattatggaa agaagttcct ttgaaaaaaa tcccattgac 3540 tttctggaag ctaaaggata taaggaagtt aaaaaagacc tgatcattaa actgcctaaa 3600 tatagtcttt ttgagctgga aaacggtagg aaacggatgc tggctagtgc cggagaactg 3660 caaaaaggaa atgagctggc tctgccaagc aaatatgtga attttctgta tctggctagt 3720 cattatgaaa agttgaaggg tagtccagaa gataacgaac aaaaacaatt gtttgtggag 3780 cagcataagc attatctgga tgagattatt gagcaaatca gtgaattttc taagagagtt 3840 attctggcag atgccaatct ggataaagtt cttagtgcat ataacaaaca tagagacaaa 3900 ccaataagag aacaagcaga aaatatcatt catctgttta ccttgaccaa tcttggagca 3960 cccgctgctt ttaaatactt tgatacaaca attgatagga aaagatatac ctctacaaaa 4020 gaagttctgg atgccactct tatccatcaa tccatcactg gtctttatga aacacgcatt 4080 gatttgagtc agctgggagg tgaccccaag aaaaaacgca aggtggaaga tcctaagaaa 4140 aagcggaaag tggacacgcg tacgcggccg ctcgagcaga aactcatctc agaagaggat 4200 ctggcagcaa atgatatcct ggattacaag gatgacgacg ataaggttta a 4251 <210> 15 <211> 10458 <212> DNA <213> Artificial Sequence <220> <223> pCas-Guide-EF1a-GFP-15007 <400> 15 gaattcccca gtggaaagac gcgcaggcaa aacgcaccac gtgacggagc gtgaccgcgc 60 gccgagcgcg cgccaaggtc gggcaggaag agggcctatt tcccatgatt ccttcatatt 120 tgcatatacg atacaaggct gttagagaga taattagaat taatttgact gtaaacacaa 180 agatattagt acaaaatacg tgacgtagaa agtaataatt tcttgggtag tttgcagttt 240 taaaattatg ttttaaaatg gactatcata tgcttaccgt aacttgaaag tatttcgatt 300 tcttgggttt atatatcttg tggaaaggac gcgggatcgt gttccagtac gcccgggaag 360 ttttagagct agaaatagca agttaaaata aggctagtcc gttatcaact tgaaaaagtg 420 gcaccgagtc ggtgcttttt ttggtgtaca cgtgaggctc cggtgcccgt cagtgggcag 480 agcgcacatc gcccacagtc cccgagaagt tggggggagg ggtcggcaat tgaaccggtg 540 cctagagaag gtggcgcggg gtaaactggg aaagtgatgt cgtgtactgg ctccgccttt 600 ttcccgaggg tgggggagaa ccgtatataa gtgcagtagt cgccgtgaac gttctttttc 660 gcaacgggtt tgccgccaga acacaggtaa gtgccgtgtg tggttcccgc gggcctggcc 720 tctttacggg ttatggccct tgcgtgcctt gaattacttc cacctggctg cagtacgtga 780 ttcttgatcc cgagcttcgg gttggaagtg ggtgggagag ttcgaggcct tgcgcttaag 840 gagccccttc gcctcgtgct tgagttgagg cctggcctgg gcgctggggc cgccgcgtgc 900 gaatctggtg gcaccttcgc gcctgtctcg ctgctttcga taagtctcta gccatttaaa 960 atttttgatg acctgctgcg acgctttttt tctggcaaga tagtcttgta aatgcgggcc 1020 aagatctgca cactggtatt tcggtttttg gggccgcggg cggcgacggg gcccgtgcgt 1080 cccagcgcac atgttcggcg aggcggggcc tgcgagcgcg gccaccgaga atcggacggg 1140 ggtagtctca agctggccgg cctgctctgg tgcctggcct cgcgccgccg tgtatcgccc 1200 cgccctgggc ggcaaggctg gcccggtcgg caccagttgc gtgagcggaa agatggccgc 1260 ttcccggccc tgctgcaggg agctcaaaat ggaggacgcg gcgctcggga gagcgggcgg 1320 gtgagtcacc cacacaaagg aaaagggcct ttccgtcctc agccgtcgct tcatgtgact 1380 ccacggagta ccgggcgccg tccaggcacc tcgattagtt ctcgagcttt tggagtacgt 1440 cgtctttagg ttggggggag gggttttatg cgatggagtt tccccacact gagtgggtgg 1500 agactgaagt taggccagct tggcacttga tgtaattctc cttggaattt gccctttttg 1560 agtttggatc ttggttcatt ctcaagcctc agacagtggt tcaaagtttt tttcttccat 1620 ttcaggtgtc gtgactatag ggcggccgga cgtgacaaat ggaagtagca cgcctcacta 1680 ggctcgtgca gatggacagc accgctgcag ccatggagag cgacgagagc ggcctgcccg 1740 ccatggagat cgagtgccgc atcaccggca ccctgaacgg cgtggagttc gagctggtgg 1800 gcggcggaga gggcaccccc gagcagggcc gcatgaccaa caagatgaag agcaccaaag 1860 gcgccctgac cttcagcccc tacctgctga gccacgtgat gggctacggc ttctaccact 1920 tcggcaccta ccccagcggc tacgagaacc ccttcctgca cgccatcaac aacggcggct 1980 acaccaacac ccgcatcgag aagtacgagg acggcggcgt gctgcacgtg agcttcagct 2040 accgctacga ggccggccgc gtgatcggcg acttcaaggt gatgggcacc ggcttccccg 2100 aggacagcgt gatcttcacc gacaagatca tccgcagcaa cgccaccgtg gagcacctgc 2160 accccatggg cgataacgat ctggatggca gcttcacccg caccttcagc ctgcgcgacg 2220 gcggctacta cagctccgtg gtggacagcc acatgcactt caagagcgcc atccacccca 2280 gcatcctgca gaacgggggc cccatgttcg ccttccgccg cgtggaggag gatcacagca 2340 acaccgagct gggcatcgtg gagtaccagc acgccttcaa gaccccggat gcagatgccg 2400 gtgaagaaag agtttaatcg atgatatcag atccccggga tgcagaaatt gatgatctat 2460 taaacaataa agatgtccac taaaatggaa gtttttcctg tcatactttg ttaagaaggg 2520 tgagaacaga gtacctacat tttgaatgga aggattggag ctacgggggt gggggtgggg 2580 tgggattaga taaatgcctg ctctttactg aaggctcttt actattgctt tatgataatg 2640 tttcatagtt ggatatcata atttaaacaa gcaaaaccaa attaagggcc agctcattcc 2700 tcccactcat gatctataga tctatagatc tctcgtggga tcattgtttt tctcttgatt 2760 cccactttgt ggttctaagt actgtggttt ccaaatgtgt cagtttcata gcctgaagaa 2820 cgagatcagc agcctctgtt ccacatacac ttcattctca gtattgtttt gccaagttct 2880 aattccatca gaagctggtc gagatccgga acccttaata taacttcgta taatgtatgc 2940 tatacgaagt tattaggtcc actagttatt aatagtaatc aattacgggg tcattagttc 3000 atagcccata tatggagttc cgcgttacat aacttacggt aaatggcccg cctggctgac 3060 cgcccaacga cccccgccca ttgacgtcaa taatgacgta tgttcccata gtaacgccaa 3120 tagggacttt ccattgacgt caatgggtgg agtatttacg gtaaactgcc cacttggcag 3180 tacatcaagt gtatcatatg ccaagtccgc cccctattga cgtcaatgac ggtaaatggc 3240 ccgcctggca ttatgcccag tacatgacct tacgggactt tcctacttgg cagtacatct 3300 acgtattagt catcgctatt accatggtga tgcggttttg gcagtacacc aatgggcgtg 3360 gatagcggtt tgactcacgg ggatttccaa gtctccaccc cattgacgtc aatgggagtt 3420 tgttttggca ccaaaatcaa cgggactttc caaaatgtcg taataacccc gccccgttga 3480 cgcaaatggg cggtaggcgt gtacggtggg aggtctatat aagcagagct cgtttagtga 3540 accgtcagaa ttttgtaata cgactcacta tagggcggcc gggaattcgt cgactggaac 3600 cggtaccgag gagatctgcc gccgcgatcg ccatggataa gaaatactca ataggactgg 3660 atattggcac aaatagcgtc ggatgggctg tgatcactga tgaatataag gttccttcta 3720 aaaagttcaa ggttctggga aatacagacc gccacagtat caaaaaaaat cttatagggg 3780 ctcttctgtt tgacagtgga gagacagccg aagctactag actcaaacgg acagctagga 3840 gaaggtatac aagacggaag aataggattt gttatctcca ggagattttt tcaaatgaga 3900 tggccaaagt ggatgatagt ttctttcata gacttgaaga gtcttttttg gtggaagaag 3960 acaagaagca tgaaagacat cctatttttg gaaatatagt ggatgaagtt gcttatcacg 4020 agaaatatcc aactatctat catctgagaa aaaaattggt ggattctact gataaagccg 4080 atttgcgcct gatctatttg gccctggccc acatgattaa gtttagagt cattttttga 4140 ttgagggcga tctgaatcct gataatagtg atgtggacaa actgtttatc cagttggtgc 4200 aaacctacaa tcaactgttt gaagaaaacc ctattaacgc aagtggagtg gatgctaaag 4260 ccattctttc tgcaagattg agtaaatcaa gaagactgga aaatctcatt gctcagctcc 4320 ccggtgagaa gaaaaatggc ctgtttggga atctcattgc tttgtcattg ggtttgaccc 4380 ctaattttaa atcaaatttt gatttggcag aagatgctaa actccagctt tcaaaagata 4440 cttacgatga tgatctggat aatctgttgg ctcaaattgg agatcaatat gctgatttgt 4500 ttttggcagc taagaatctg tcagatgcta ttctgctttc agacatcctg agagtgaata 4560 ctgaaataac taaggctccc ctgtcagctt caatgattaa acgctacgat gaacatcatc 4620 aagacttgac tcttctgaaa gccctggtta gacaacaact tccagaaaag tataaagaaa 4680 tcttttttga tcaatcaaaa aacggatatg caggttatat tgatggcggc gcaagccaag 4740 aagaatttta taaatttatc aaaccaattc tggaaaaaat ggatggtact gaggaactgt 4800 tggtgaaact gaatagagaa gatttgctgc gcaagcaacg gacctttgac aacggctcta 4860 ttccccatca aattcacttg ggtgagctgc atgctatttt gagaagacaa gaagactttt 4920 atccatttct gaaagacaat agagagaaga ttgaaaaaat cttgactttt aggattcctt 4980 attatgttgg tccattggcc agaggcaata gtaggtttgc atggatgact cggaagtctg 5040 aagaaacaat taccccatgg aattttgaag aagttgtcga taaaggtgct tcagctcaat 5100 catttattga acgcatgaca aactttgata aaaatcttcc aaatgaaaaa gtgctgccaa 5160 aacatagttt gctttatgag tattttaccg tttataacg attgacaaag gtcaaatatg 5220 ttactgaagg aatgagaaaa ccagcatttc tttcaggtga acagaagaaa gccattgttg 5280 atctgctctt caaaacaaat aggaaagtga ccgttaagca actgaaagaa gattatttca 5340 aaaaaataga atgttttgat agtgttgaaa tttcaggagt tgaagataga tttaatgctt 5400 cactgggtac ataccatgat ttgctgaaaa ttattaaaga taaagatttt ttggataatg 5460 aagaaaatga agacatcctg gaggatattg ttctgacatt gaccctgttt gaagataggg 5520 agatgattga ggaaagactt aaaacatacg ctcacctctt tgatgataag gtgatgaaac 5580 agcttaaaag acgcagatat actggttggg gaaggttgtc cagaaaattg attaatggta 5640 ttagggataa gcaatctggc aaaacaatac tggatttttt gaaatcagat ggttttgcca 5700 atcgcaattt tatgcagctc atccatgatg atagtttgac atttaaagaa gacatccaaa 5760 aagcacaagt gtctggacaa ggcgatagtc tgcatgaaca tattgcaaat ctggctggta 5820 gccctgctat taaaaaaggt attctccaga ctgtgaaagt tgttgatgaa ttggtcaaag 5880 tgatggggcg gcataagcca gaaaatatcg ttattgaaat ggcaagagaa aatcagacaa 5940 ctcaaaaggg ccagaaaaat tccagagaga ggatgaaaag aatcgaagaa ggtatcaaag 6000 aactgggaag tcagattctt aaagagcatc ctgttgaaaa tactcaattg caaaatgaaa 6060 agctctatct ctattatctc caaaatggaa gagatatgta tgtggaccaa gaactggata 6120 ttaataggct gagtgattat gatgtcgatc acattgttcc acaaagtttc cttaaagacg 6180 attcaataga caataaggtc ctgaccaggt ctgataaaaa tagaggtaaa tccgataacg 6240 ttccaagtga agaagtggtc aaaaagatga aaaactattg gagacaactt ctgaacgcca 6300 agctgatcac tcaaaggaag tttgataatc tgaccaaagc tgaaagagga ggtttgagtg 6360 aacttgataa agctggtttt atcaaacgcc aattggttga aactcgccaa atcactaagc 6420 atgtggcaca aattttggat agtcgcatga atactaaata cgatgaaaat gataaactta 6480 ttagagaggt taaagtgatt accctgaaat ctaaactggt ttctgacttc agaaaagatt 6540 tccaattcta taaagtgaga gagattaaca attaccatca tgcccatgat gcctatctga 6600 atgccgtcgt tggaactgct ttgattaaga aatatccaaa acttgaaagc gagtttgtct 6660 atggtgatta taaagtttat gatgttagga aaatgattgc taagtctgag caagaaatag 6720 gcaaagcaac cgcaaagtat ttcttttact ctaatatcat gaacttcttc aaaacagaaa 6780 ttacacttgc aaatggagag attcgcaaac gccctctgat cgaaactaat ggggaaactg 6840 gagaaattgt ctgggataaa gggagagatt ttgccacagt gcgcaaagtg ttgtccatgc 6900 cccaagtcaa tatcgtcaag aaaacagaag tgcagacagg cggattctct aaggagtcaa 6960 ttctgccaaa aagaaattcc gacaagctga ttgctaggaa aaaagactgg gacccaaaaa 7020 aatatggtgg ttttgatagt ccaaccgtgg cttattcagt cctggtggtt gctaaggtgg 7080 aaaaagggaa atccaagaag ctgaaatccg ttaaagagct gctggggatc acaattatgg 7140 aaagaagttc ctttgaaaaa aatcccattg actttctgga agctaaagga tataaggaag 7200 ttaaaaaaga cctgatcatt aaactgccta aatatagtct ttttgagctg gaaaacggta 7260 ggaaacggat gctggctagt gccggagaac tgcaaaaagg aaatgagctg gctctgccaa 7320 gcaaatatgt gaattttctg tatctggcta gtcattatga aaagttgaag ggtagtccag 7380 aagataacga acaaaaacaa ttgtttgtgg agcagcataa gcattatctg gatgagatta 7440 ttgagcaaat cagtgaattt tctaagagag ttattctggc agatgccaat ctggataaag 7500 ttcttagtgc atataacaaa catagagaca aaccaataag agaacaagca gaaaatatca 7560 ttcatctgtt taccttgacc aatcttggag cacccgctgc ttttaaatac tttgatacaa 7620 caattgatag gaaaagatat acctctacaa aagaagttct ggatgccact cttatccatc 7680 aatccatcac tggtctttat gaaacacgca ttgatttgag tcagctggga ggtgacccca 7740 agaaaaaacg caaggtggaa gatcctaaga aaaagcggaa agtggacacg cgtacgcggc 7800 cgctcgagca gaaactcatc tcagaagagg atctggcagc aaatgatatc ctggattaca 7860 aggatgacga cgataaggtt taaacggccg gccgcggtca tagctgtttc ctgaacagat 7920 cccgggtggc atccctgtga cccctcccca gtgcctctcc tggccctgga agttgccact 7980 ccagtgccca ccagccttgt cctaataaaa ttaagttgca tcattttgtc tgactaggtg 8040 tccttctata atattatggg gtggaggggg gtggtatgga gcaaggggca agttgggaag 8100 acaacctgta gggcctgcgg ggtctattgg gaaccaagct ggagtgcagt ggcacaatct 8160 tggctcactg caatctccgc ctcctgggtt caagcgattc tcctgcctca gcctcccgag 8220 ttgttgggat tccaggcatg catgaccagg ctcagctaat ttttgttttt ttggtagagg 8280 cggggtttca ccatattggc caggctggtc tccaactcct aatctcaggt gatctaccca 8340 ccttggcctc ccaaattgct gggattacag gcgtgaacca ctgctccctt ccctgtcctt 8400 ctgattttaa aataactata ccagcaggag gacgtccaga cacagcatag gctacctggc 8460 catgcccaac cggtgggaca tttgagttgc ttgcttggca ctgtcctctc atgcgttggg 8520 tccactcagt agatgcctgt tgaattgggt acgcggccag cggcgagcgg tatcagctca 8580 ctcaaaggcg gtaatacggt tatccacaga atcaggggat aacgcaggaa agaacatgtc 8640 cgtaaaaagg ccgcgttgct ggcgtttttc cataggctcc gcccccctga cgagcatcac 8700 aaaaatcgac gctcaagtca gaggtggcga aacccgacag gactataaag ataccaggcg 8760 tttccccctg gaagctccct cgtgcgctct cctgttccga ccctgccgct taccggatac 8820 ctgtccgcct ttctcccttc gggaagcgtg gcgctttctc atagctcacg ctgtaggtat 8880 ctcagttcgg tgtaggtcgt tcgctccaag ctgggctgtg tgcacgaacc ccccgttcag 8940 cccgaccgct gcgccttatc cggtaactat cgtcttgagt ccaacccggt aagacacgac 9000 ttatcgccac tggcagcagc cactggtaac aggattagca gagcgaggta tgtaggcggt 9060 gctacagagt tcttgaagtg gtggcctaac tacggctaca ctagaagaac agtatttggt 9120 atctgcgctc tgctgaagcc agttaccttc ggaaaaagag ttggtagctc ttgatccggc 9180 aaacaaacca ccgctggtag cggtggtttt tttgtttgca agcagcagat tacgcgcaga 9240 aaaaaaggat ctcaagaaga tcctttgatc ttttctacgg ggtctgacgc tcagtggaac 9300 gcgcgtaac tcacgttaag ggattttggt catgagatta tcaaaaagga tcttcaccta 9360 gatccttttg cggccgcaaa tcaatctaaa gtatatatga gtaaacttgg tctgacagtt 9420 accaatgctt aatcagtgag gcacctatct cagcgatctg tctatttcgt tcatccatag 9480 ttgcctgact ccccgtcgtg tagataacta cgatacggga gggcttacca tctggcccca 9540 gtgctgcaat gataccgcga gacccacgct caccggctcc agatttatca gcaataaacc 9600 agccagccgg aagggccgag cgcagaagtg gtcctgcaac tttatccgcc tccatccagt 9660 ctattaattg ttgccgggaa gctagagtaa gtagttcgcc agttaatagt ttgcgcaacg 9720 ttgttgccat tgctacaggc atcgtggtgt cacgctcgtc gtttggtatg gcttcattca 9780 gctccggttc ccaacgatca aggcgagtta catgatcccc catgttgtgc aaaaaagcgg 9840 ttagctcctt cggtcctccg atcgttgtca gaagtaagtt ggccgcagtg ttatcactca 9900 tggttatggc agcactgcat aattctctta ctgtcatgcc atccgtaaga tgcttttctg 9960 tgactggtga gtactcaacc aagtcattct gagaatagtg tatgcggcga ccgagttgct 10020 cttgcccggc gtcaatacgg gataataccg cgccacatag cagaacttta aaagtgctca 10080 tcattggaaa acgttcttcg gggcgaaaac tctcaaggat cttaccgctg ttgagatcca 10140 gttcgatgta acccactcgt gcacccaact gatcttcagc atcttttact ttcaccagcg 10200 tttctgggtg agcaaaaaca ggaaggcaaa atgccgcaaa aaagggaata agggcgacac 10260 ggaaatgttg aatactcata ctcttccttt ttcaatatta ttgaagcatt tatcagggtt 10320 attgtctcat gatgatatat ttttatcttg tgcaatgtaa catcagagat tttgagacac 10380 gggccagagc tgccaggaaa cagctatgac catgtaatac gactcactat aggggatatc 10440 agctggatgg cagttaac 10458 <210> 16 <211> 10458 <212> DNA <213> Artificial Sequence <220> <223> pCas-Guide-EF1a-GFP-15181 <400> 16 gaattcccca gtggaaagac gcgcaggcaa aacgcaccac gtgacggagc gtgaccgcgc 60 gccgagcgcg cgccaaggtc gggcaggaag agggcctatt tcccatgatt ccttcatatt 120 tgcatatacg atacaaggct gttagagaga taattagaat taatttgact gtaaacacaa 180 agatattagt acaaaatacg tgacgtagaa agtaataatt tcttgggtag tttgcagttt 240 taaaattatg ttttaaaatg gactatcata tgcttaccgt aacttgaaag tatttcgatt 300 tcttgggttt atatatcttg tggaaaggac gcgggatcga gtctttaaat ctgtccggcg 360 ttttagagct agaaatagca agttaaaata aggctagtcc gttatcaact tgaaaaagtg 420 gcaccgagtc ggtgcttttt ttggtgtaca cgtgaggctc cggtgcccgt cagtgggcag 480 agcgcacatc gcccacagtc cccgagaagt tggggggagg ggtcggcaat tgaaccggtg 540 cctagagaag gtggcgcggg gtaaactggg aaagtgatgt cgtgtactgg ctccgccttt 600 ttcccgaggg tgggggagaa ccgtatataa gtgcagtagt cgccgtgaac gttctttttc 660 gcaacgggtt tgccgccaga acacaggtaa gtgccgtgtg tggttcccgc gggcctggcc 720 tctttacggg ttatggccct tgcgtgcctt gaattacttc cacctggctg cagtacgtga 780 ttcttgatcc cgagcttcgg gttggaagtg ggtgggagag ttcgaggcct tgcgcttaag 840 gagccccttc gcctcgtgct tgagttgagg cctggcctgg gcgctggggc cgccgcgtgc 900 gaatctggtg gcaccttcgc gcctgtctcg ctgctttcga taagtctcta gccatttaaa 960 atttttgatg acctgctgcg acgctttttt tctggcaaga tagtcttgta aatgcgggcc 1020 aagatctgca cactggtatt tcggtttttg gggccgcggg cggcgacggg gcccgtgcgt 1080 cccagcgcac atgttcggcg aggcggggcc tgcgagcgcg gccaccgaga atcggacggg 1140 ggtagtctca agctggccgg cctgctctgg tgcctggcct cgcgccgccg tgtatcgccc 1200 cgccctgggc ggcaaggctg gcccggtcgg caccagttgc gtgagcggaa agatggccgc 1260 ttcccggccc tgctgcaggg agctcaaaat ggaggacgcg gcgctcggga gagcgggcgg 1320 gtgagtcacc cacacaaagg aaaagggcct ttccgtcctc agccgtcgct tcatgtgact 1380 ccacggagta ccgggcgccg tccaggcacc tcgattagtt ctcgagcttt tggagtacgt 1440 cgtctttagg ttggggggag gggttttatg cgatggagtt tccccacact gagtgggtgg 1500 agactgaagt taggccagct tggcacttga tgtaattctc cttggaattt gccctttttg 1560 agtttggatc ttggttcatt ctcaagcctc agacagtggt tcaaagtttt tttcttccat 1620 ttcaggtgtc gtgactatag ggcggccgga cgtgacaaat ggaagtagca cgcctcacta 1680 ggctcgtgca gatggacagc accgctgcag ccatggagag cgacgagagc ggcctgcccg 1740 ccatggagat cgagtgccgc atcaccggca ccctgaacgg cgtggagttc gagctggtgg 1800 gcggcggaga gggcaccccc gagcagggcc gcatgaccaa caagatgaag agcaccaaag 1860 gcgccctgac cttcagcccc tacctgctga gccacgtgat gggctacggc ttctaccact 1920 tcggcaccta ccccagcggc tacgagaacc ccttcctgca cgccatcaac aacggcggct 1980 acaccaacac ccgcatcgag aagtacgagg acggcggcgt gctgcacgtg agcttcagct 2040 accgctacga ggccggccgc gtgatcggcg acttcaaggt gatgggcacc ggcttccccg 2100 aggacagcgt gatcttcacc gacaagatca tccgcagcaa cgccaccgtg gagcacctgc 2160 accccatggg cgataacgat ctggatggca gcttcacccg caccttcagc ctgcgcgacg 2220 gcggctacta cagctccgtg gtggacagcc acatgcactt caagagcgcc atccacccca 2280 gcatcctgca gaacgggggc cccatgttcg ccttccgccg cgtggaggag gatcacagca 2340 acaccgagct gggcatcgtg gagtaccagc acgccttcaa gaccccggat gcagatgccg 2400 gtgaagaaag agtttaatcg atgatatcag atccccggga tgcagaaatt gatgatctat 2460 taaacaataa agatgtccac taaaatggaa gtttttcctg tcatactttg ttaagaaggg 2520 tgagaacaga gtacctacat tttgaatgga aggattggag ctacgggggt gggggtgggg 2580 tgggattaga taaatgcctg ctctttactg aaggctcttt actattgctt tatgataatg 2640 tttcatagtt ggatatcata atttaaacaa gcaaaaccaa attaagggcc agctcattcc 2700 tcccactcat gatctataga tctatagatc tctcgtggga tcattgtttt tctcttgatt 2760 cccactttgt ggttctaagt actgtggttt ccaaatgtgt cagtttcata gcctgaagaa 2820 cgagatcagc agcctctgtt ccacatacac ttcattctca gtattgtttt gccaagttct 2880 aattccatca gaagctggtc gagatccgga acccttaata taacttcgta taatgtatgc 2940 tatacgaagt tattaggtcc actagttatt aatagtaatc aattacgggg tcattagttc 3000 atagcccata tatggagttc cgcgttacat aacttacggt aaatggcccg cctggctgac 3060 cgcccaacga cccccgccca ttgacgtcaa taatgacgta tgttcccata gtaacgccaa 3120 tagggacttt ccattgacgt caatgggtgg agtatttacg gtaaactgcc cacttggcag 3180 tacatcaagt gtatcatatg ccaagtccgc cccctattga cgtcaatgac ggtaaatggc 3240 ccgcctggca ttatgcccag tacatgacct tacgggactt tcctacttgg cagtacatct 3300 acgtattagt catcgctatt accatggtga tgcggttttg gcagtacacc aatgggcgtg 3360 gatagcggtt tgactcacgg ggatttccaa gtctccaccc cattgacgtc aatgggagtt 3420 tgttttggca ccaaaatcaa cgggactttc caaaatgtcg taataacccc gccccgttga 3480 cgcaaatggg cggtaggcgt gtacggtggg aggtctatat aagcagagct cgtttagtga 3540 accgtcagaa ttttgtaata cgactcacta tagggcggcc gggaattcgt cgactggaac 3600 cggtaccgag gagatctgcc gccgcgatcg ccatggataa gaaatactca ataggactgg 3660 atattggcac aaatagcgtc ggatgggctg tgatcactga tgaatataag gttccttcta 3720 aaaagttcaa ggttctggga aatacagacc gccacagtat caaaaaaaat cttatagggg 3780 ctcttctgtt tgacagtgga gagacagccg aagctactag actcaaacgg acagctagga 3840 gaaggtatac aagacggaag aataggattt gttatctcca ggagattttt tcaaatgaga 3900 tggccaaagt ggatgatagt ttctttcata gacttgaaga gtcttttttg gtggaagaag 3960 acaagaagca tgaaagacat cctatttttg gaaatatagt ggatgaagtt gcttatcacg 4020 agaaatatcc aactatctat catctgagaa aaaaattggt ggattctact gataaagccg 4080 atttgcgcct gatctatttg gccctggccc acatgattaa gtttagagt cattttttga 4140 ttgagggcga tctgaatcct gataatagtg atgtggacaa actgtttatc cagttggtgc 4200 aaacctacaa tcaactgttt gaagaaaacc ctattaacgc aagtggagtg gatgctaaag 4260 ccattctttc tgcaagattg agtaaatcaa gaagactgga aaatctcatt gctcagctcc 4320 ccggtgagaa gaaaaatggc ctgtttggga atctcattgc tttgtcattg ggtttgaccc 4380 ctaattttaa atcaaatttt gatttggcag aagatgctaa actccagctt tcaaaagata 4440 cttacgatga tgatctggat aatctgttgg ctcaaattgg agatcaatat gctgatttgt 4500 ttttggcagc taagaatctg tcagatgcta ttctgctttc agacatcctg agagtgaata 4560 ctgaaataac taaggctccc ctgtcagctt caatgattaa acgctacgat gaacatcatc 4620 aagacttgac tcttctgaaa gccctggtta gacaacaact tccagaaaag tataaagaaa 4680 tcttttttga tcaatcaaaa aacggatatg caggttatat tgatggcggc gcaagccaag 4740 aagaatttta taaatttatc aaaccaattc tggaaaaaat ggatggtact gaggaactgt 4800 tggtgaaact gaatagagaa gatttgctgc gcaagcaacg gacctttgac aacggctcta 4860 ttccccatca aattcacttg ggtgagctgc atgctatttt gagaagacaa gaagactttt 4920 atccatttct gaaagacaat agagagaaga ttgaaaaaat cttgactttt aggattcctt 4980 attatgttgg tccattggcc agaggcaata gtaggtttgc atggatgact cggaagtctg 5040 aagaaacaat taccccatgg aattttgaag aagttgtcga taaaggtgct tcagctcaat 5100 catttattga acgcatgaca aactttgata aaaatcttcc aaatgaaaaa gtgctgccaa 5160 aacatagttt gctttatgag tattttaccg tttataacg attgacaaag gtcaaatatg 5220 ttactgaagg aatgagaaaa ccagcatttc tttcaggtga acagaagaaa gccattgttg 5280 atctgctctt caaaacaaat aggaaagtga ccgttaagca actgaaagaa gattatttca 5340 aaaaaataga atgttttgat agtgttgaaa tttcaggagt tgaagataga tttaatgctt 5400 cactgggtac ataccatgat ttgctgaaaa ttattaaaga taaagatttt ttggataatg 5460 aagaaaatga agacatcctg gaggatattg ttctgacatt gaccctgttt gaagataggg 5520 agatgattga ggaaagactt aaaacatacg ctcacctctt tgatgataag gtgatgaaac 5580 agcttaaaag acgcagatat actggttggg gaaggttgtc cagaaaattg attaatggta 5640 ttagggataa gcaatctggc aaaacaatac tggatttttt gaaatcagat ggttttgcca 5700 atcgcaattt tatgcagctc atccatgatg atagtttgac atttaaagaa gacatccaaa 5760 aagcacaagt gtctggacaa ggcgatagtc tgcatgaaca tattgcaaat ctggctggta 5820 gccctgctat taaaaaaggt attctccaga ctgtgaaagt tgttgatgaa ttggtcaaag 5880 tgatggggcg gcataagcca gaaaatatcg ttattgaaat ggcaagagaa aatcagacaa 5940 ctcaaaaggg ccagaaaaat tccagagaga ggatgaaaag aatcgaagaa ggtatcaaag 6000 aactgggaag tcagattctt aaagagcatc ctgttgaaaa tactcaattg caaaatgaaa 6060 agctctatct ctattatctc caaaatggaa gagatatgta tgtggaccaa gaactggata 6120 ttaataggct gagtgattat gatgtcgatc acattgttcc acaaagtttc cttaaagacg 6180 attcaataga caataaggtc ctgaccaggt ctgataaaaa tagaggtaaa tccgataacg 6240 ttccaagtga agaagtggtc aaaaagatga aaaactattg gagacaactt ctgaacgcca 6300 agctgatcac tcaaaggaag tttgataatc tgaccaaagc tgaaagagga ggtttgagtg 6360 aacttgataa agctggtttt atcaaacgcc aattggttga aactcgccaa atcactaagc 6420 atgtggcaca aattttggat agtcgcatga atactaaata cgatgaaaat gataaactta 6480 ttagagaggt taaagtgatt accctgaaat ctaaactggt ttctgacttc agaaaagatt 6540 tccaattcta taaagtgaga gagattaaca attaccatca tgcccatgat gcctatctga 6600 atgccgtcgt tggaactgct ttgattaaga aatatccaaa acttgaaagc gagtttgtct 6660 atggtgatta taaagtttat gatgttagga aaatgattgc taagtctgag caagaaatag 6720 gcaaagcaac cgcaaagtat ttcttttact ctaatatcat gaacttcttc aaaacagaaa 6780 ttacacttgc aaatggagag attcgcaaac gccctctgat cgaaactaat ggggaaactg 6840 gagaaattgt ctgggataaa gggagagatt ttgccacagt gcgcaaagtg ttgtccatgc 6900 cccaagtcaa tatcgtcaag aaaacagaag tgcagacagg cggattctct aaggagtcaa 6960 ttctgccaaa aagaaattcc gacaagctga ttgctaggaa aaaagactgg gacccaaaaa 7020 aatatggtgg ttttgatagt ccaaccgtgg cttattcagt cctggtggtt gctaaggtgg 7080 aaaaagggaa atccaagaag ctgaaatccg ttaaagagct gctggggatc acaattatgg 7140 aaagaagttc ctttgaaaaa aatcccattg actttctgga agctaaagga tataaggaag 7200 ttaaaaaaga cctgatcatt aaactgccta aatatagtct ttttgagctg gaaaacggta 7260 ggaaacggat gctggctagt gccggagaac tgcaaaaagg aaatgagctg gctctgccaa 7320 gcaaatatgt gaattttctg tatctggcta gtcattatga aaagttgaag ggtagtccag 7380 aagataacga acaaaaacaa ttgtttgtgg agcagcataa gcattatctg gatgagatta 7440 ttgagcaaat cagtgaattt tctaagagag ttattctggc agatgccaat ctggataaag 7500 ttcttagtgc atataacaaa catagagaca aaccaataag agaacaagca gaaaatatca 7560 ttcatctgtt taccttgacc aatcttggag cacccgctgc ttttaaatac tttgatacaa 7620 caattgatag gaaaagatat acctctacaa aagaagttct ggatgccact cttatccatc 7680 aatccatcac tggtctttat gaaacacgca ttgatttgag tcagctggga ggtgacccca 7740 agaaaaaacg caaggtggaa gatcctaaga aaaagcggaa agtggacacg cgtacgcggc 7800 cgctcgagca gaaactcatc tcagaagagg atctggcagc aaatgatatc ctggattaca 7860 aggatgacga cgataaggtt taaacggccg gccgcggtca tagctgtttc ctgaacagat 7920 cccgggtggc atccctgtga cccctcccca gtgcctctcc tggccctgga agttgccact 7980 ccagtgccca ccagccttgt cctaataaaa ttaagttgca tcattttgtc tgactaggtg 8040 tccttctata atattatggg gtggaggggg gtggtatgga gcaaggggca agttgggaag 8100 acaacctgta gggcctgcgg ggtctattgg gaaccaagct ggagtgcagt ggcacaatct 8160 tggctcactg caatctccgc ctcctgggtt caagcgattc tcctgcctca gcctcccgag 8220 ttgttgggat tccaggcatg catgaccagg ctcagctaat ttttgttttt ttggtagagg 8280 cggggtttca ccatattggc caggctggtc tccaactcct aatctcaggt gatctaccca 8340 ccttggcctc ccaaattgct gggattacag gcgtgaacca ctgctccctt ccctgtcctt 8400 ctgattttaa aataactata ccagcaggag gacgtccaga cacagcatag gctacctggc 8460 catgcccaac cggtgggaca tttgagttgc ttgcttggca ctgtcctctc atgcgttggg 8520 tccactcagt agatgcctgt tgaattgggt acgcggccag cggcgagcgg tatcagctca 8580 ctcaaaggcg gtaatacggt tatccacaga atcaggggat aacgcaggaa agaacatgtc 8640 cgtaaaaagg ccgcgttgct ggcgtttttc cataggctcc gcccccctga cgagcatcac 8700 aaaaatcgac gctcaagtca gaggtggcga aacccgacag gactataaag ataccaggcg 8760 tttccccctg gaagctccct cgtgcgctct cctgttccga ccctgccgct taccggatac 8820 ctgtccgcct ttctcccttc gggaagcgtg gcgctttctc atagctcacg ctgtaggtat 8880 ctcagttcgg tgtaggtcgt tcgctccaag ctgggctgtg tgcacgaacc ccccgttcag 8940 cccgaccgct gcgccttatc cggtaactat cgtcttgagt ccaacccggt aagacacgac 9000 ttatcgccac tggcagcagc cactggtaac aggattagca gagcgaggta tgtaggcggt 9060 gctacagagt tcttgaagtg gtggcctaac tacggctaca ctagaagaac agtatttggt 9120 atctgcgctc tgctgaagcc agttaccttc ggaaaaagag ttggtagctc ttgatccggc 9180 aaacaaacca ccgctggtag cggtggtttt tttgtttgca agcagcagat tacgcgcaga 9240 aaaaaaggat ctcaagaaga tcctttgatc ttttctacgg ggtctgacgc tcagtggaac 9300 gcgcgtaac tcacgttaag ggattttggt catgagatta tcaaaaagga tcttcaccta 9360 gatccttttg cggccgcaaa tcaatctaaa gtatatatga gtaaacttgg tctgacagtt 9420 accaatgctt aatcagtgag gcacctatct cagcgatctg tctatttcgt tcatccatag 9480 ttgcctgact ccccgtcgtg tagataacta cgatacggga gggcttacca tctggcccca 9540 gtgctgcaat gataccgcga gacccacgct caccggctcc agatttatca gcaataaacc 9600 agccagccgg aagggccgag cgcagaagtg gtcctgcaac tttatccgcc tccatccagt 9660 ctattaattg ttgccgggaa gctagagtaa gtagttcgcc agttaatagt ttgcgcaacg 9720 ttgttgccat tgctacaggc atcgtggtgt cacgctcgtc gtttggtatg gcttcattca 9780 gctccggttc ccaacgatca aggcgagtta catgatcccc catgttgtgc aaaaaagcgg 9840 ttagctcctt cggtcctccg atcgttgtca gaagtaagtt ggccgcagtg ttatcactca 9900 tggttatggc agcactgcat aattctctta ctgtcatgcc atccgtaaga tgcttttctg 9960 tgactggtga gtactcaacc aagtcattct gagaatagtg tatgcggcga ccgagttgct 10020 cttgcccggc gtcaatacgg gataataccg cgccacatag cagaacttta aaagtgctca 10080 tcattggaaa acgttcttcg gggcgaaaac tctcaaggat cttaccgctg ttgagatcca 10140 gttcgatgta acccactcgt gcacccaact gatcttcagc atcttttact ttcaccagcg 10200 tttctgggtg agcaaaaaca ggaaggcaaa atgccgcaaa aaagggaata agggcgacac 10260 ggaaatgttg aatactcata ctcttccttt ttcaatatta ttgaagcatt tatcagggtt 10320 attgtctcat gatgatatat ttttatcttg tgcaatgtaa catcagagat tttgagacac 10380 gggccagagc tgccaggaaa cagctatgac catgtaatac gactcactat aggggatatc 10440 agctggatgg cagttaac 10458 <210> 17 <211> 10458 <212> DNA <213> Artificial Sequence <220> <223> pCas-Guide-EF1a-GFP-15385 <400> 17 gaattcccca gtggaaagac gcgcaggcaa aacgcaccac gtgacggagc gtgaccgcgc 60 gccgagcgcg cgccaaggtc gggcaggaag agggcctatt tcccatgatt ccttcatatt 120 tgcatatacg atacaaggct gttagagaga taattagaat taatttgact gtaaacacaa 180 agatattagt acaaaatacg tgacgtagaa agtaataatt tcttgggtag tttgcagttt 240 taaaattatg ttttaaaatg gactatcata tgcttaccgt aacttgaaag tatttcgatt 300 tcttgggttt atatatcttg tggaaaggac gcgggatcgg tagtgagagt cttcttgttg 360 ttttagagct agaaatagca agttaaaata aggctagtcc gttatcaact tgaaaaagtg 420 gcaccgagtc ggtgcttttt ttggtgtaca cgtgaggctc cggtgcccgt cagtgggcag 480 agcgcacatc gcccacagtc cccgagaagt tggggggagg ggtcggcaat tgaaccggtg 540 cctagagaag gtggcgcggg gtaaactggg aaagtgatgt cgtgtactgg ctccgccttt 600 ttcccgaggg tgggggagaa ccgtatataa gtgcagtagt cgccgtgaac gttctttttc 660 gcaacgggtt tgccgccaga acacaggtaa gtgccgtgtg tggttcccgc gggcctggcc 720 tctttacggg ttatggccct tgcgtgcctt gaattacttc cacctggctg cagtacgtga 780 ttcttgatcc cgagcttcgg gttggaagtg ggtgggagag ttcgaggcct tgcgcttaag 840 gagccccttc gcctcgtgct tgagttgagg cctggcctgg gcgctggggc cgccgcgtgc 900 gaatctggtg gcaccttcgc gcctgtctcg ctgctttcga taagtctcta gccatttaaa 960 atttttgatg acctgctgcg acgctttttt tctggcaaga tagtcttgta aatgcgggcc 1020 aagatctgca cactggtatt tcggtttttg gggccgcggg cggcgacggg gcccgtgcgt 1080 cccagcgcac atgttcggcg aggcggggcc tgcgagcgcg gccaccgaga atcggacggg 1140 ggtagtctca agctggccgg cctgctctgg tgcctggcct cgcgccgccg tgtatcgccc 1200 cgccctgggc ggcaaggctg gcccggtcgg caccagttgc gtgagcggaa agatggccgc 1260 ttcccggccc tgctgcaggg agctcaaaat ggaggacgcg gcgctcggga gagcgggcgg 1320 gtgagtcacc cacacaaagg aaaagggcct ttccgtcctc agccgtcgct tcatgtgact 1380 ccacggagta ccgggcgccg tccaggcacc tcgattagtt ctcgagcttt tggagtacgt 1440 cgtctttagg ttggggggag gggttttatg cgatggagtt tccccacact gagtgggtgg 1500 agactgaagt taggccagct tggcacttga tgtaattctc cttggaattt gccctttttg 1560 agtttggatc ttggttcatt ctcaagcctc agacagtggt tcaaagtttt tttcttccat 1620 ttcaggtgtc gtgactatag ggcggccgga cgtgacaaat ggaagtagca cgcctcacta 1680 ggctcgtgca gatggacagc accgctgcag ccatggagag cgacgagagc ggcctgcccg 1740 ccatggagat cgagtgccgc atcaccggca ccctgaacgg cgtggagttc gagctggtgg 1800 gcggcggaga gggcaccccc gagcagggcc gcatgaccaa caagatgaag agcaccaaag 1860 gcgccctgac cttcagcccc tacctgctga gccacgtgat gggctacggc ttctaccact 1920 tcggcaccta ccccagcggc tacgagaacc ccttcctgca cgccatcaac aacggcggct 1980 acaccaacac ccgcatcgag aagtacgagg acggcggcgt gctgcacgtg agcttcagct 2040 accgctacga ggccggccgc gtgatcggcg acttcaaggt gatgggcacc ggcttccccg 2100 aggacagcgt gatcttcacc gacaagatca tccgcagcaa cgccaccgtg gagcacctgc 2160 accccatggg cgataacgat ctggatggca gcttcacccg caccttcagc ctgcgcgacg 2220 gcggctacta cagctccgtg gtggacagcc acatgcactt caagagcgcc atccacccca 2280 gcatcctgca gaacgggggc cccatgttcg ccttccgccg cgtggaggag gatcacagca 2340 acaccgagct gggcatcgtg gagtaccagc acgccttcaa gaccccggat gcagatgccg 2400 gtgaagaaag agtttaatcg atgatatcag atccccggga tgcagaaatt gatgatctat 2460 taaacaataa agatgtccac taaaatggaa gtttttcctg tcatactttg ttaagaaggg 2520 tgagaacaga gtacctacat tttgaatgga aggattggag ctacgggggt gggggtgggg 2580 tgggattaga taaatgcctg ctctttactg aaggctcttt actattgctt tatgataatg 2640 tttcatagtt ggatatcata atttaaacaa gcaaaaccaa attaagggcc agctcattcc 2700 tcccactcat gatctataga tctatagatc tctcgtggga tcattgtttt tctcttgatt 2760 cccactttgt ggttctaagt actgtggttt ccaaatgtgt cagtttcata gcctgaagaa 2820 cgagatcagc agcctctgtt ccacatacac ttcattctca gtattgtttt gccaagttct 2880 aattccatca gaagctggtc gagatccgga acccttaata taacttcgta taatgtatgc 2940 tatacgaagt tattaggtcc actagttatt aatagtaatc aattacgggg tcattagttc 3000 atagcccata tatggagttc cgcgttacat aacttacggt aaatggcccg cctggctgac 3060 cgcccaacga cccccgccca ttgacgtcaa taatgacgta tgttcccata gtaacgccaa 3120 tagggacttt ccattgacgt caatgggtgg agtatttacg gtaaactgcc cacttggcag 3180 tacatcaagt gtatcatatg ccaagtccgc cccctattga cgtcaatgac ggtaaatggc 3240 ccgcctggca ttatgcccag tacatgacct tacgggactt tcctacttgg cagtacatct 3300 acgtattagt catcgctatt accatggtga tgcggttttg gcagtacacc aatgggcgtg 3360 gatagcggtt tgactcacgg ggatttccaa gtctccaccc cattgacgtc aatgggagtt 3420 tgttttggca ccaaaatcaa cgggactttc caaaatgtcg taataacccc gccccgttga 3480 cgcaaatggg cggtaggcgt gtacggtggg aggtctatat aagcagagct cgtttagtga 3540 accgtcagaa ttttgtaata cgactcacta tagggcggcc gggaattcgt cgactggaac 3600 cggtaccgag gagatctgcc gccgcgatcg ccatggataa gaaatactca ataggactgg 3660 atattggcac aaatagcgtc ggatgggctg tgatcactga tgaatataag gttccttcta 3720 aaaagttcaa ggttctggga aatacagacc gccacagtat caaaaaaaat cttatagggg 3780 ctcttctgtt tgacagtgga gagacagccg aagctactag actcaaacgg acagctagga 3840 gaaggtatac aagacggaag aataggattt gttatctcca ggagattttt tcaaatgaga 3900 tggccaaagt ggatgatagt ttctttcata gacttgaaga gtcttttttg gtggaagaag 3960 acaagaagca tgaaagacat cctatttttg gaaatatagt ggatgaagtt gcttatcacg 4020 agaaatatcc aactatctat catctgagaa aaaaattggt ggattctact gataaagccg 4080 atttgcgcct gatctatttg gccctggccc acatgattaa gtttagagt cattttttga 4140 ttgagggcga tctgaatcct gataatagtg atgtggacaa actgtttatc cagttggtgc 4200 aaacctacaa tcaactgttt gaagaaaacc ctattaacgc aagtggagtg gatgctaaag 4260 ccattctttc tgcaagattg agtaaatcaa gaagactgga aaatctcatt gctcagctcc 4320 ccggtgagaa gaaaaatggc ctgtttggga atctcattgc tttgtcattg ggtttgaccc 4380 ctaattttaa atcaaatttt gatttggcag aagatgctaa actccagctt tcaaaagata 4440 cttacgatga tgatctggat aatctgttgg ctcaaattgg agatcaatat gctgatttgt 4500 ttttggcagc taagaatctg tcagatgcta ttctgctttc agacatcctg agagtgaata 4560 ctgaaataac taaggctccc ctgtcagctt caatgattaa acgctacgat gaacatcatc 4620 aagacttgac tcttctgaaa gccctggtta gacaacaact tccagaaaag tataaagaaa 4680 tcttttttga tcaatcaaaa aacggatatg caggttatat tgatggcggc gcaagccaag 4740 aagaatttta taaatttatc aaaccaattc tggaaaaaat ggatggtact gaggaactgt 4800 tggtgaaact gaatagagaa gatttgctgc gcaagcaacg gacctttgac aacggctcta 4860 ttccccatca aattcacttg ggtgagctgc atgctatttt gagaagacaa gaagactttt 4920 atccatttct gaaagacaat agagagaaga ttgaaaaaat cttgactttt aggattcctt 4980 attatgttgg tccattggcc agaggcaata gtaggtttgc atggatgact cggaagtctg 5040 aagaaacaat taccccatgg aattttgaag aagttgtcga taaaggtgct tcagctcaat 5100 catttattga acgcatgaca aactttgata aaaatcttcc aaatgaaaaa gtgctgccaa 5160 aacatagttt gctttatgag tattttaccg tttataacg attgacaaag gtcaaatatg 5220 ttactgaagg aatgagaaaa ccagcatttc tttcaggtga acagaagaaa gccattgttg 5280 atctgctctt caaaacaaat aggaaagtga ccgttaagca actgaaagaa gattatttca 5340 aaaaaataga atgttttgat agtgttgaaa tttcaggagt tgaagataga tttaatgctt 5400 cactgggtac ataccatgat ttgctgaaaa ttattaaaga taaagatttt ttggataatg 5460 aagaaaatga agacatcctg gaggatattg ttctgacatt gaccctgttt gaagataggg 5520 agatgattga ggaaagactt aaaacatacg ctcacctctt tgatgataag gtgatgaaac 5580 agcttaaaag acgcagatat actggttggg gaaggttgtc cagaaaattg attaatggta 5640 ttagggataa gcaatctggc aaaacaatac tggatttttt gaaatcagat ggttttgcca 5700 atcgcaattt tatgcagctc atccatgatg atagtttgac atttaaagaa gacatccaaa 5760 aagcacaagt gtctggacaa ggcgatagtc tgcatgaaca tattgcaaat ctggctggta 5820 gccctgctat taaaaaaggt attctccaga ctgtgaaagt tgttgatgaa ttggtcaaag 5880 tgatggggcg gcataagcca gaaaatatcg ttattgaaat ggcaagagaa aatcagacaa 5940 ctcaaaaggg ccagaaaaat tccagagaga ggatgaaaag aatcgaagaa ggtatcaaag 6000 aactgggaag tcagattctt aaagagcatc ctgttgaaaa tactcaattg caaaatgaaa 6060 agctctatct ctattatctc caaaatggaa gagatatgta tgtggaccaa gaactggata 6120 ttaataggct gagtgattat gatgtcgatc acattgttcc acaaagtttc cttaaagacg 6180 attcaataga caataaggtc ctgaccaggt ctgataaaaa tagaggtaaa tccgataacg 6240 ttccaagtga agaagtggtc aaaaagatga aaaactattg gagacaactt ctgaacgcca 6300 agctgatcac tcaaaggaag tttgataatc tgaccaaagc tgaaagagga ggtttgagtg 6360 aacttgataa agctggtttt atcaaacgcc aattggttga aactcgccaa atcactaagc 6420 atgtggcaca aattttggat agtcgcatga atactaaata cgatgaaaat gataaactta 6480 ttagagaggt taaagtgatt accctgaaat ctaaactggt ttctgacttc agaaaagatt 6540 tccaattcta taaagtgaga gagattaaca attaccatca tgcccatgat gcctatctga 6600 atgccgtcgt tggaactgct ttgattaaga aatatccaaa acttgaaagc gagtttgtct 6660 atggtgatta taaagtttat gatgttagga aaatgattgc taagtctgag caagaaatag 6720 gcaaagcaac cgcaaagtat ttcttttact ctaatatcat gaacttcttc aaaacagaaa 6780 ttacacttgc aaatggagag attcgcaaac gccctctgat cgaaactaat ggggaaactg 6840 gagaaattgt ctgggataaa gggagagatt ttgccacagt gcgcaaagtg ttgtccatgc 6900 cccaagtcaa tatcgtcaag aaaacagaag tgcagacagg cggattctct aaggagtcaa 6960 ttctgccaaa aagaaattcc gacaagctga ttgctaggaa aaaagactgg gacccaaaaa 7020 aatatggtgg ttttgatagt ccaaccgtgg cttattcagt cctggtggtt gctaaggtgg 7080 aaaaagggaa atccaagaag ctgaaatccg ttaaagagct gctggggatc acaattatgg 7140 aaagaagttc ctttgaaaaa aatcccattg actttctgga agctaaagga tataaggaag 7200 ttaaaaaaga cctgatcatt aaactgccta aatatagtct ttttgagctg gaaaacggta 7260 ggaaacggat gctggctagt gccggagaac tgcaaaaagg aaatgagctg gctctgccaa 7320 gcaaatatgt gaattttctg tatctggcta gtcattatga aaagttgaag ggtagtccag 7380 aagataacga acaaaaacaa ttgtttgtgg agcagcataa gcattatctg gatgagatta 7440 ttgagcaaat cagtgaattt tctaagagag ttattctggc agatgccaat ctggataaag 7500 ttcttagtgc atataacaaa catagagaca aaccaataag agaacaagca gaaaatatca 7560 ttcatctgtt taccttgacc aatcttggag cacccgctgc ttttaaatac tttgatacaa 7620 caattgatag gaaaagatat acctctacaa aagaagttct ggatgccact cttatccatc 7680 aatccatcac tggtctttat gaaacacgca ttgatttgag tcagctggga ggtgacccca 7740 agaaaaaacg caaggtggaa gatcctaaga aaaagcggaa agtggacacg cgtacgcggc 7800 cgctcgagca gaaactcatc tcagaagagg atctggcagc aaatgatatc ctggattaca 7860 aggatgacga cgataaggtt taaacggccg gccgcggtca tagctgtttc ctgaacagat 7920 cccgggtggc atccctgtga cccctcccca gtgcctctcc tggccctgga agttgccact 7980 ccagtgccca ccagccttgt cctaataaaa ttaagttgca tcattttgtc tgactaggtg 8040 tccttctata atattatggg gtggaggggg gtggtatgga gcaaggggca agttgggaag 8100 acaacctgta gggcctgcgg ggtctattgg gaaccaagct ggagtgcagt ggcacaatct 8160 tggctcactg caatctccgc ctcctgggtt caagcgattc tcctgcctca gcctcccgag 8220 ttgttgggat tccaggcatg catgaccagg ctcagctaat ttttgttttt ttggtagagg 8280 cggggtttca ccatattggc caggctggtc tccaactcct aatctcaggt gatctaccca 8340 ccttggcctc ccaaattgct gggattacag gcgtgaacca ctgctccctt ccctgtcctt 8400 ctgattttaa aataactata ccagcaggag gacgtccaga cacagcatag gctacctggc 8460 catgcccaac cggtgggaca tttgagttgc ttgcttggca ctgtcctctc atgcgttggg 8520 tccactcagt agatgcctgt tgaattgggt acgcggccag cggcgagcgg tatcagctca 8580 ctcaaaggcg gtaatacggt tatccacaga atcaggggat aacgcaggaa agaacatgtc 8640 cgtaaaaagg ccgcgttgct ggcgtttttc cataggctcc gcccccctga cgagcatcac 8700 aaaaatcgac gctcaagtca gaggtggcga aacccgacag gactataaag ataccaggcg 8760 tttccccctg gaagctccct cgtgcgctct cctgttccga ccctgccgct taccggatac 8820 ctgtccgcct ttctcccttc gggaagcgtg gcgctttctc atagctcacg ctgtaggtat 8880 ctcagttcgg tgtaggtcgt tcgctccaag ctgggctgtg tgcacgaacc ccccgttcag 8940 cccgaccgct gcgccttatc cggtaactat cgtcttgagt ccaacccggt aagacacgac 9000 ttatcgccac tggcagcagc cactggtaac aggattagca gagcgaggta tgtaggcggt 9060 gctacagagt tcttgaagtg gtggcctaac tacggctaca ctagaagaac agtatttggt 9120 atctgcgctc tgctgaagcc agttaccttc ggaaaaagag ttggtagctc ttgatccggc 9180 aaacaaacca ccgctggtag cggtggtttt tttgtttgca agcagcagat tacgcgcaga 9240 aaaaaaggat ctcaagaaga tcctttgatc ttttctacgg ggtctgacgc tcagtggaac 9300 gcgcgtaac tcacgttaag ggattttggt catgagatta tcaaaaagga tcttcaccta 9360 gatccttttg cggccgcaaa tcaatctaaa gtatatatga gtaaacttgg tctgacagtt 9420 accaatgctt aatcagtgag gcacctatct cagcgatctg tctatttcgt tcatccatag 9480 ttgcctgact ccccgtcgtg tagataacta cgatacggga gggcttacca tctggcccca 9540 gtgctgcaat gataccgcga gacccacgct caccggctcc agatttatca gcaataaacc 9600 agccagccgg aagggccgag cgcagaagtg gtcctgcaac tttatccgcc tccatccagt 9660 ctattaattg ttgccgggaa gctagagtaa gtagttcgcc agttaatagt ttgcgcaacg 9720 ttgttgccat tgctacaggc atcgtggtgt cacgctcgtc gtttggtatg gcttcattca 9780 gctccggttc ccaacgatca aggcgagtta catgatcccc catgttgtgc aaaaaagcgg 9840 ttagctcctt cggtcctccg atcgttgtca gaagtaagtt ggccgcagtg ttatcactca 9900 tggttatggc agcactgcat aattctctta ctgtcatgcc atccgtaaga tgcttttctg 9960 tgactggtga gtactcaacc aagtcattct gagaatagtg tatgcggcga ccgagttgct 10020 cttgcccggc gtcaatacgg gataataccg cgccacatag cagaacttta aaagtgctca 10080 tcattggaaa acgttcttcg gggcgaaaac tctcaaggat cttaccgctg ttgagatcca 10140 gttcgatgta acccactcgt gcacccaact gatcttcagc atcttttact ttcaccagcg 10200 tttctgggtg agcaaaaaca ggaaggcaaa atgccgcaaa aaagggaata agggcgacac 10260 ggaaatgttg aatactcata ctcttccttt ttcaatatta ttgaagcatt tatcagggtt 10320 attgtctcat gatgatatat ttttatcttg tgcaatgtaa catcagagat tttgagacac 10380 gggccagagc tgccaggaaa cagctatgac catgtaatac gactcactat aggggatatc 10440 agctggatgg cagttaac 10458 <210> 18 <211> 10458 <212> DNA <213> Artificial Sequence <220> <223> pCas-Guide-EF1a-GFP-15402 <400> 18 gaattcccca gtggaaagac gcgcaggcaa aacgcaccac gtgacggagc gtgaccgcgc 60 gccgagcgcg cgccaaggtc gggcaggaag agggcctatt tcccatgatt ccttcatatt 120 tgcatatacg atacaaggct gttagagaga taattagaat taatttgact gtaaacacaa 180 agatattagt acaaaatacg tgacgtagaa agtaataatt tcttgggtag tttgcagttt 240 taaaattatg ttttaaaatg gactatcata tgcttaccgt aacttgaaag tatttcgatt 300 tcttgggttt atatatcttg tggaaaggac gcgggatcgg ttgggcaaga cgccccccgg 360 ttttagagct agaaatagca agttaaaata aggctagtcc gttatcaact tgaaaaagtg 420 gcaccgagtc ggtgcttttt ttggtgtaca cgtgaggctc cggtgcccgt cagtgggcag 480 agcgcacatc gcccacagtc cccgagaagt tggggggagg ggtcggcaat tgaaccggtg 540 cctagagaag gtggcgcggg gtaaactggg aaagtgatgt cgtgtactgg ctccgccttt 600 ttcccgaggg tgggggagaa ccgtatataa gtgcagtagt cgccgtgaac gttctttttc 660 gcaacgggtt tgccgccaga acacaggtaa gtgccgtgtg tggttcccgc gggcctggcc 720 tctttacggg ttatggccct tgcgtgcctt gaattacttc cacctggctg cagtacgtga 780 ttcttgatcc cgagcttcgg gttggaagtg ggtgggagag ttcgaggcct tgcgcttaag 840 gagccccttc gcctcgtgct tgagttgagg cctggcctgg gcgctggggc cgccgcgtgc 900 gaatctggtg gcaccttcgc gcctgtctcg ctgctttcga taagtctcta gccatttaaa 960 atttttgatg acctgctgcg acgctttttt tctggcaaga tagtcttgta aatgcgggcc 1020 aagatctgca cactggtatt tcggtttttg gggccgcggg cggcgacggg gcccgtgcgt 1080 cccagcgcac atgttcggcg aggcggggcc tgcgagcgcg gccaccgaga atcggacggg 1140 ggtagtctca agctggccgg cctgctctgg tgcctggcct cgcgccgccg tgtatcgccc 1200 cgccctgggc ggcaaggctg gcccggtcgg caccagttgc gtgagcggaa agatggccgc 1260 ttcccggccc tgctgcaggg agctcaaaat ggaggacgcg gcgctcggga gagcgggcgg 1320 gtgagtcacc cacacaaagg aaaagggcct ttccgtcctc agccgtcgct tcatgtgact 1380 ccacggagta ccgggcgccg tccaggcacc tcgattagtt ctcgagcttt tggagtacgt 1440 cgtctttagg ttggggggag gggttttatg cgatggagtt tccccacact gagtgggtgg 1500 agactgaagt taggccagct tggcacttga tgtaattctc cttggaattt gccctttttg 1560 agtttggatc ttggttcatt ctcaagcctc agacagtggt tcaaagtttt tttcttccat 1620 ttcaggtgtc gtgactatag ggcggccgga cgtgacaaat ggaagtagca cgcctcacta 1680 ggctcgtgca gatggacagc accgctgcag ccatggagag cgacgagagc ggcctgcccg 1740 ccatggagat cgagtgccgc atcaccggca ccctgaacgg cgtggagttc gagctggtgg 1800 gcggcggaga gggcaccccc gagcagggcc gcatgaccaa caagatgaag agcaccaaag 1860 gcgccctgac cttcagcccc tacctgctga gccacgtgat gggctacggc ttctaccact 1920 tcggcaccta ccccagcggc tacgagaacc ccttcctgca cgccatcaac aacggcggct 1980 acaccaacac ccgcatcgag aagtacgagg acggcggcgt gctgcacgtg agcttcagct 2040 accgctacga ggccggccgc gtgatcggcg acttcaaggt gatgggcacc ggcttccccg 2100 aggacagcgt gatcttcacc gacaagatca tccgcagcaa cgccaccgtg gagcacctgc 2160 accccatggg cgataacgat ctggatggca gcttcacccg caccttcagc ctgcgcgacg 2220 gcggctacta cagctccgtg gtggacagcc acatgcactt caagagcgcc atccacccca 2280 gcatcctgca gaacgggggc cccatgttcg ccttccgccg cgtggaggag gatcacagca 2340 acaccgagct gggcatcgtg gagtaccagc acgccttcaa gaccccggat gcagatgccg 2400 gtgaagaaag agtttaatcg atgatatcag atccccggga tgcagaaatt gatgatctat 2460 taaacaataa agatgtccac taaaatggaa gtttttcctg tcatactttg ttaagaaggg 2520 tgagaacaga gtacctacat tttgaatgga aggattggag ctacgggggt gggggtgggg 2580 tgggattaga taaatgcctg ctctttactg aaggctcttt actattgctt tatgataatg 2640 tttcatagtt ggatatcata atttaaacaa gcaaaaccaa attaagggcc agctcattcc 2700 tcccactcat gatctataga tctatagatc tctcgtggga tcattgtttt tctcttgatt 2760 cccactttgt ggttctaagt actgtggttt ccaaatgtgt cagtttcata gcctgaagaa 2820 cgagatcagc agcctctgtt ccacatacac ttcattctca gtattgtttt gccaagttct 2880 aattccatca gaagctggtc gagatccgga acccttaata taacttcgta taatgtatgc 2940 tatacgaagt tattaggtcc actagttatt aatagtaatc aattacgggg tcattagttc 3000 atagcccata tatggagttc cgcgttacat aacttacggt aaatggcccg cctggctgac 3060 cgcccaacga cccccgccca ttgacgtcaa taatgacgta tgttcccata gtaacgccaa 3120 tagggacttt ccattgacgt caatgggtgg agtatttacg gtaaactgcc cacttggcag 3180 tacatcaagt gtatcatatg ccaagtccgc cccctattga cgtcaatgac ggtaaatggc 3240 ccgcctggca ttatgcccag tacatgacct tacgggactt tcctacttgg cagtacatct 3300 acgtattagt catcgctatt accatggtga tgcggttttg gcagtacacc aatgggcgtg 3360 gatagcggtt tgactcacgg ggatttccaa gtctccaccc cattgacgtc aatgggagtt 3420 tgttttggca ccaaaatcaa cgggactttc caaaatgtcg taataacccc gccccgttga 3480 cgcaaatggg cggtaggcgt gtacggtggg aggtctatat aagcagagct cgtttagtga 3540 accgtcagaa ttttgtaata cgactcacta tagggcggcc gggaattcgt cgactggaac 3600 cggtaccgag gagatctgcc gccgcgatcg ccatggataa gaaatactca ataggactgg 3660 atattggcac aaatagcgtc ggatgggctg tgatcactga tgaatataag gttccttcta 3720 aaaagttcaa ggttctggga aatacagacc gccacagtat caaaaaaaat cttatagggg 3780 ctcttctgtt tgacagtgga gagacagccg aagctactag actcaaacgg acagctagga 3840 gaaggtatac aagacggaag aataggattt gttatctcca ggagattttt tcaaatgaga 3900 tggccaaagt ggatgatagt ttctttcata gacttgaaga gtcttttttg gtggaagaag 3960 acaagaagca tgaaagacat cctatttttg gaaatatagt ggatgaagtt gcttatcacg 4020 agaaatatcc aactatctat catctgagaa aaaaattggt ggattctact gataaagccg 4080 atttgcgcct gatctatttg gccctggccc acatgattaa gtttagagt cattttttga 4140 ttgagggcga tctgaatcct gataatagtg atgtggacaa actgtttatc cagttggtgc 4200 aaacctacaa tcaactgttt gaagaaaacc ctattaacgc aagtggagtg gatgctaaag 4260 ccattctttc tgcaagattg agtaaatcaa gaagactgga aaatctcatt gctcagctcc 4320 ccggtgagaa gaaaaatggc ctgtttggga atctcattgc tttgtcattg ggtttgaccc 4380 ctaattttaa atcaaatttt gatttggcag aagatgctaa actccagctt tcaaaagata 4440 cttacgatga tgatctggat aatctgttgg ctcaaattgg agatcaatat gctgatttgt 4500 ttttggcagc taagaatctg tcagatgcta ttctgctttc agacatcctg agagtgaata 4560 ctgaaataac taaggctccc ctgtcagctt caatgattaa acgctacgat gaacatcatc 4620 aagacttgac tcttctgaaa gccctggtta gacaacaact tccagaaaag tataaagaaa 4680 tcttttttga tcaatcaaaa aacggatatg caggttatat tgatggcggc gcaagccaag 4740 aagaatttta taaatttatc aaaccaattc tggaaaaaat ggatggtact gaggaactgt 4800 tggtgaaact gaatagagaa gatttgctgc gcaagcaacg gacctttgac aacggctcta 4860 ttccccatca aattcacttg ggtgagctgc atgctatttt gagaagacaa gaagactttt 4920 atccatttct gaaagacaat agagagaaga ttgaaaaaat cttgactttt aggattcctt 4980 attatgttgg tccattggcc agaggcaata gtaggtttgc atggatgact cggaagtctg 5040 aagaaacaat taccccatgg aattttgaag aagttgtcga taaaggtgct tcagctcaat 5100 catttattga acgcatgaca aactttgata aaaatcttcc aaatgaaaaa gtgctgccaa 5160 aacatagttt gctttatgag tattttaccg tttataacg attgacaaag gtcaaatatg 5220 ttactgaagg aatgagaaaa ccagcatttc tttcaggtga acagaagaaa gccattgttg 5280 atctgctctt caaaacaaat aggaaagtga ccgttaagca actgaaagaa gattatttca 5340 aaaaaataga atgttttgat agtgttgaaa tttcaggagt tgaagataga tttaatgctt 5400 cactgggtac ataccatgat ttgctgaaaa ttattaaaga taaagatttt ttggataatg 5460 aagaaaatga agacatcctg gaggatattg ttctgacatt gaccctgttt gaagataggg 5520 agatgattga ggaaagactt aaaacatacg ctcacctctt tgatgataag gtgatgaaac 5580 agcttaaaag acgcagatat actggttggg gaaggttgtc cagaaaattg attaatggta 5640 ttagggataa gcaatctggc aaaacaatac tggatttttt gaaatcagat ggttttgcca 5700 atcgcaattt tatgcagctc atccatgatg atagtttgac atttaaagaa gacatccaaa 5760 aagcacaagt gtctggacaa ggcgatagtc tgcatgaaca tattgcaaat ctggctggta 5820 gccctgctat taaaaaaggt attctccaga ctgtgaaagt tgttgatgaa ttggtcaaag 5880 tgatggggcg gcataagcca gaaaatatcg ttattgaaat ggcaagagaa aatcagacaa 5940 ctcaaaaggg ccagaaaaat tccagagaga ggatgaaaag aatcgaagaa ggtatcaaag 6000 aactgggaag tcagattctt aaagagcatc ctgttgaaaa tactcaattg caaaatgaaa 6060 agctctatct ctattatctc caaaatggaa gagatatgta tgtggaccaa gaactggata 6120 ttaataggct gagtgattat gatgtcgatc acattgttcc acaaagtttc cttaaagacg 6180 attcaataga caataaggtc ctgaccaggt ctgataaaaa tagaggtaaa tccgataacg 6240 ttccaagtga agaagtggtc aaaaagatga aaaactattg gagacaactt ctgaacgcca 6300 agctgatcac tcaaaggaag tttgataatc tgaccaaagc tgaaagagga ggtttgagtg 6360 aacttgataa agctggtttt atcaaacgcc aattggttga aactcgccaa atcactaagc 6420 atgtggcaca aattttggat agtcgcatga atactaaata cgatgaaaat gataaactta 6480 ttagagaggt taaagtgatt accctgaaat ctaaactggt ttctgacttc agaaaagatt 6540 tccaattcta taaagtgaga gagattaaca attaccatca tgcccatgat gcctatctga 6600 atgccgtcgt tggaactgct ttgattaaga aatatccaaa acttgaaagc gagtttgtct 6660 atggtgatta taaagtttat gatgttagga aaatgattgc taagtctgag caagaaatag 6720 gcaaagcaac cgcaaagtat ttcttttact ctaatatcat gaacttcttc aaaacagaaa 6780 ttacacttgc aaatggagag attcgcaaac gccctctgat cgaaactaat ggggaaactg 6840 gagaaattgt ctgggataaa gggagagatt ttgccacagt gcgcaaagtg ttgtccatgc 6900 cccaagtcaa tatcgtcaag aaaacagaag tgcagacagg cggattctct aaggagtcaa 6960 ttctgccaaa aagaaattcc gacaagctga ttgctaggaa aaaagactgg gacccaaaaa 7020 aatatggtgg ttttgatagt ccaaccgtgg cttattcagt cctggtggtt gctaaggtgg 7080 aaaaagggaa atccaagaag ctgaaatccg ttaaagagct gctggggatc acaattatgg 7140 aaagaagttc ctttgaaaaa aatcccattg actttctgga agctaaagga tataaggaag 7200 ttaaaaaaga cctgatcatt aaactgccta aatatagtct ttttgagctg gaaaacggta 7260 ggaaacggat gctggctagt gccggagaac tgcaaaaagg aaatgagctg gctctgccaa 7320 gcaaatatgt gaattttctg tatctggcta gtcattatga aaagttgaag ggtagtccag 7380 aagataacga acaaaaacaa ttgtttgtgg agcagcataa gcattatctg gatgagatta 7440 ttgagcaaat cagtgaattt tctaagagag ttattctggc agatgccaat ctggataaag 7500 ttcttagtgc atataacaaa catagagaca aaccaataag agaacaagca gaaaatatca 7560 ttcatctgtt taccttgacc aatcttggag cacccgctgc ttttaaatac tttgatacaa 7620 caattgatag gaaaagatat acctctacaa aagaagttct ggatgccact cttatccatc 7680 aatccatcac tggtctttat gaaacacgca ttgatttgag tcagctggga ggtgacccca 7740 agaaaaaacg caaggtggaa gatcctaaga aaaagcggaa agtggacacg cgtacgcggc 7800 cgctcgagca gaaactcatc tcagaagagg atctggcagc aaatgatatc ctggattaca 7860 aggatgacga cgataaggtt taaacggccg gccgcggtca tagctgtttc ctgaacagat 7920 cccgggtggc atccctgtga cccctcccca gtgcctctcc tggccctgga agttgccact 7980 ccagtgccca ccagccttgt cctaataaaa ttaagttgca tcattttgtc tgactaggtg 8040 tccttctata atattatggg gtggaggggg gtggtatgga gcaaggggca agttgggaag 8100 acaacctgta gggcctgcgg ggtctattgg gaaccaagct ggagtgcagt ggcacaatct 8160 tggctcactg caatctccgc ctcctgggtt caagcgattc tcctgcctca gcctcccgag 8220 ttgttgggat tccaggcatg catgaccagg ctcagctaat ttttgttttt ttggtagagg 8280 cggggtttca ccatattggc caggctggtc tccaactcct aatctcaggt gatctaccca 8340 ccttggcctc ccaaattgct gggattacag gcgtgaacca ctgctccctt ccctgtcctt 8400 ctgattttaa aataactata ccagcaggag gacgtccaga cacagcatag gctacctggc 8460 catgcccaac cggtgggaca tttgagttgc ttgcttggca ctgtcctctc atgcgttggg 8520 tccactcagt agatgcctgt tgaattgggt acgcggccag cggcgagcgg tatcagctca 8580 ctcaaaggcg gtaatacggt tatccacaga atcaggggat aacgcaggaa agaacatgtc 8640 cgtaaaaagg ccgcgttgct ggcgtttttc cataggctcc gcccccctga cgagcatcac 8700 aaaaatcgac gctcaagtca gaggtggcga aacccgacag gactataaag ataccaggcg 8760 tttccccctg gaagctccct cgtgcgctct cctgttccga ccctgccgct taccggatac 8820 ctgtccgcct ttctcccttc gggaagcgtg gcgctttctc atagctcacg ctgtaggtat 8880 ctcagttcgg tgtaggtcgt tcgctccaag ctgggctgtg tgcacgaacc ccccgttcag 8940 cccgaccgct gcgccttatc cggtaactat cgtcttgagt ccaacccggt aagacacgac 9000 ttatcgccac tggcagcagc cactggtaac aggattagca gagcgaggta tgtaggcggt 9060 gctacagagt tcttgaagtg gtggcctaac tacggctaca ctagaagaac agtatttggt 9120 atctgcgctc tgctgaagcc agttaccttc ggaaaaagag ttggtagctc ttgatccggc 9180 aaacaaacca ccgctggtag cggtggtttt tttgtttgca agcagcagat tacgcgcaga 9240 aaaaaaggat ctcaagaaga tcctttgatc ttttctacgg ggtctgacgc tcagtggaac 9300 gcgcgtaac tcacgttaag ggattttggt catgagatta tcaaaaagga tcttcaccta 9360 gatccttttg cggccgcaaa tcaatctaaa gtatatatga gtaaacttgg tctgacagtt 9420 accaatgctt aatcagtgag gcacctatct cagcgatctg tctatttcgt tcatccatag 9480 ttgcctgact ccccgtcgtg tagataacta cgatacggga gggcttacca tctggcccca 9540 gtgctgcaat gataccgcga gacccacgct caccggctcc agatttatca gcaataaacc 9600 agccagccgg aagggccgag cgcagaagtg gtcctgcaac tttatccgcc tccatccagt 9660 ctattaattg ttgccgggaa gctagagtaa gtagttcgcc agttaatagt ttgcgcaacg 9720 ttgttgccat tgctacaggc atcgtggtgt cacgctcgtc gtttggtatg gcttcattca 9780 gctccggttc ccaacgatca aggcgagtta catgatcccc catgttgtgc aaaaaagcgg 9840 ttagctcctt cggtcctccg atcgttgtca gaagtaagtt ggccgcagtg ttatcactca 9900 tggttatggc agcactgcat aattctctta ctgtcatgcc atccgtaaga tgcttttctg 9960 tgactggtga gtactcaacc aagtcattct gagaatagtg tatgcggcga ccgagttgct 10020 cttgcccggc gtcaatacgg gataataccg cgccacatag cagaacttta aaagtgctca 10080 tcattggaaa acgttcttcg gggcgaaaac tctcaaggat cttaccgctg ttgagatcca 10140 gttcgatgta acccactcgt gcacccaact gatcttcagc atcttttact ttcaccagcg 10200 tttctgggtg agcaaaaaca ggaaggcaaa atgccgcaaa aaagggaata agggcgacac 10260 ggaaatgttg aatactcata ctcttccttt ttcaatatta ttgaagcatt tatcagggtt 10320 attgtctcat gatgatatat ttttatcttg tgcaatgtaa catcagagat tttgagacac 10380 gggccagagc tgccaggaaa cagctatgac catgtaatac gactcactat aggggatatc 10440 agctggatgg cagttaac 10458 <210> 19 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> indel F <400> 19 gcattgtgga tcacgtcacc tataaac 27 <210> 20 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> indole R <400> 20 ccagatatga gaaatgagtg ttggacg 27

Claims (19)

The expression of β3gnt2 (UDP-GlcNAc: betaGal beta-1,3-N-acetylglucosaminyltransferase 2) gene is knocked down or the β3gnt2 gene is knocked out ), Wherein the recombinant glycoprotein has an increased half-life.
delete 2. The method according to claim 1, wherein the mRNA of the? 3gnt2 gene is a nucleotide sequence as set forth in SEQ ID NO: 1, wherein the recombinant glycoprotein has an increased half-life.
The method according to claim 1, wherein the rust-down of the? 3gnt2 gene expression comprises treating the β3gnt2 gene inhibitor or producing any one selected from the group consisting of antisense nucleotides, siRNA, shRNA and miRNA binding to β3gnt2 mRNA, A recombinant cell line producing a recombinant glycoprotein with increased half-life.
5. The recombinant cell line according to claim 4, wherein the siRNA comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4 and SEQ ID NO: 6. &Lt; / RTI &gt;
The method according to claim 1, wherein the β3gnt2 gene knock-out transforms a recombinant vector into a cell line producing a glycoprotein, wherein the recombinant vector produces a recombinant glycoprotein with an increased half-life,
Wherein the recombinant vector comprises
A nucleotide sequence encoding any one of the guide RNAs (gRNA) selected from the group consisting of SEQ ID NOS: 10 to 13; And
And a Cas9 (CRISPR associated protein 9) gene consisting of the nucleotide sequence shown in SEQ ID NO: 14. The method for producing a recombinant cell line according to claim 1,
[Claim 7] The method according to claim 6, wherein the recombinant vector comprises a Cas9 gene and a gene encoding a fluorescent protein.
7. The method according to claim 6, wherein the recombinant vector comprises any one of the nucleotide sequences selected from the group consisting of SEQ ID NOS: 15 to 18, wherein the recombinant vector produces an increased half-life of the recombinant glycoprotein.
The method of claim 1, wherein the glycoprotein is selected from the group consisting of erythropoietin, thrombopoietin, alpha-antitrypsin, cholinesterase, chorionic gonadotropin ), CTLA4Ig, Factor VIII, gamma-glutamyltransferase, granulocyte colony-stimulating factor (G-CSF) and luteinizing hormone (LH) Wherein the recombinant glycoprotein is any one selected from the group consisting of the recombinant cell line and the recombinant cell line.
The method of claim 1, wherein the cell line is a recombinant glycoprotein with an increased half-life, which is produced from any one selected from the group consisting of mammalian cells, yeast cells and insect cells. Producing a recombinant cell line.
The method of claim 1, wherein the cells are selected from the group consisting of Chinese hamster ovary cells (CHO), HT-1080, human lymphoblastoid, SP2 / 0 (mouse myeloma), NS0 (mouse myeloma) Wherein the antibody is any one selected from the group consisting of human hamster kidney cells (BHK), human embryonic kidney cells (HEK), PERC.6 (human retinal cells), and EC2-1H9 A method for producing a recombinant cell line that produces a recombinant glycoprotein.
A cell line produced by the method of claim 1 which produces an increased half-life of recombinant glycoprotein.
1) culturing the recombinant cell line of claim 12; And
2) separating the recombinant glycoprotein from the culture of step 1);
Wherein the recombinant glycoprotein has an increased half-life.
14. The method of claim 13, wherein the glycoprotein is selected from the group consisting of erythropoietin, thrombopoietin, alpha-antitrypsin, cholinesterase, chorionic gonadotropin, CTLA4Ig, Factor VIII, gamma-glutamyltransferase , A granulocyte colony stimulating factor, and a luteinizing hormone, wherein the half-life is increased.
14. The method of claim 13, wherein the recombinant glycoprotein has an increased tri- or tetra-antennary structure.


delete delete delete delete

Images