WO2017078461A1 - Expression vector for production of target protein and method for overexpression of target protein using same - Google Patents

Abstract

The present invention relates to a vector capable of improving production efficiency of a target protein and a method for the production of a target protein using the same. The vector of the present invention comprises: 1) a gene fragment for RNA interference targeting 3'-UTR of mRNA of an endogenous amplifiable gene of a host cell; and 2) a construct comprising a gene and an exogenous amplifiable gene of a target protein. The introduction of the vector into a host cell enables the production of a target protein, and thus, the vector can be useful to produce necessary proteins in a food field and a medical field.

Description

Expression vector for the production of target protein and method of overexpression of the target protein using the same

The present invention relates to an expression vector for producing a target protein and a method for overexpression of the target protein using the same.

Production of recombinant proteins using animal cells has been difficult due to low productivity, but development of gene amplification technology has made it possible to manufacture animal cells with high productivity. Gene amplification techniques utilize amplifiable genes, ie amplifiable genes, in cells. Amplifiable genes are essential genes expressed in cells. When expression of amplifiable genes is inhibited, cell growth does not occur normally. Conventionally, the target protein has been increased by using the characteristics of such amplifiable genes.

For example, expression vectors containing these amplifiable genes and target protein genes are introduced into cell lines that lack amplifiable genes such as dihydrofolate reductase (dhfr) and glutamine sysnthetase (gs). In addition, it is a method that can increase the number of copies of the expression vector by treating methotrexate (MTX), methionine sulfoximine (MSX), and the like which are inhibitors of these genes. As such, as the number of copies of the expression vector per unit cell increases, the expression amount of the target protein increases.

Gene amplification technology was made possible in the 1980s by producing radiation on mutations in some of the Chinese hamster ovary (CHO) cell lines to produce DXB11 and DG44 cell lines that lack the dhfr gene. Tissue plasminogen activator, the first recombinant protein drug produced in animal cells, is produced in this DXB11 cell line. The production of cell lines capable of gene amplification overcomes the limited production of recombinant proteins in animal cells. Made it possible. The cell lines capable of amplifying such genes are known as CHOK1SV and NS0 cell lines with low expression of the gs gene in addition to DXB11 and DG44.

Recombinant protein drugs are being produced in various cell lines other than the CHO cell line, but the types of cell lines capable of gene amplification are limited. Recently, a cell line capable of gene amplification has been reported by lacking the dhfr and gs genes in the CHO-K1 cell line using zinc-finger nuclease technology.

RNA interference (RNAi) technology, on the other hand, is closely associated with post-transcriptional gene silencing mechanisms, while small non-coding RNAs are used for intracellular homologous gene sequences. Recognize and cause degradation. microRNA (miRNA), small interference RNA (small interference RNA, siRNA) is a typical non-coding RNA and there is a difference in the path of development. siRNAs are known to be synthetic or predominantly foreign molecules that temporarily inhibit the gene of interest, while also inducing the formation of heterochromatins. miRNAs are generated from the genome in host cells and are known to affect the stability and expression of messenger RNA (mRNA) by targeting the 3'-untranslated region (3'UTR) of the gene to be regulated. . Since genes of miRNA are extensive, they are advantageous for regulating overall cellular function, but there are limitations in regulation of expression of one specific gene. The use of siRNA to inhibit the expression of a particular gene is temporary, so short hairpin RNA (shRNA) can be used for continuous expression in plasmid vectors.

As described above, although a technique for producing a recombinant protein by introducing a vector containing an exogenous amplifiable gene and a gene of a target protein into a cell line lacking an amplifiable gene has been studied, RNA which interferes with expression of a specific gene in a general animal cell Combining interference technology with exogenous amplifiable genes and recombinant protein expression methods using genes of the desired protein has produced a cell line with amplification-deficient genes, and has also produced an expression vector that can induce the production of recombinant proteins. It is not studied until now.

The inventors have established a cell line in which expression of an amplifiable gene has been suppressed in the past, introducing a recombinant vector expressing an amplifiable gene and a target protein into the established cell line, while simplifying a process for producing a recombinant protein, while efficiently reducing the target protein. And a method of increasing the concentration of the amplified gene, and the shRNA inhibiting the expression of the endogenous amplifiable gene of the cell in a general host cell without separately establishing a cell line in which the expression of the amplifiable gene is suppressed; And a construct of a gene of the protein of interest and an exogenous amplifiable gene bound thereto, and by introducing an inhibitor of the amplifiable gene protein to select a transduced cell line to efficiently produce the protein of interest. It was confirmed that it could.

SUMMARY OF THE INVENTION An object of the present invention is to provide an expression vector for producing a target protein and a method of overexpressing the target protein using the same in producing the target protein.

In order to achieve the above object, one aspect of the present invention is a gene fragment for RNA interference targeting the 3'-UTR of the mRNA of the endogenous amplifiable gene of the host cell; And a gene construct comprising a cloning site capable of cloning a gene of a target protein and an exogenous amplifiable gene.

In addition, in order to achieve the above object, another aspect of the present invention provides a transformant in which the expression vector for producing the target protein is introduced into a host cell.

In addition, to achieve the above object, another aspect of the present invention provides a method comprising the following steps:

In addition, to achieve the above object, another aspect of the present invention comprises the steps of cloning the gene of the target protein in the cloning site of the gene construct of the expression vector; Introducing an expression vector cloned with the gene of the protein of interest into a host cell; Culturing the host cell into which the expression vector is introduced; It provides a method of overexpression of the target protein comprising a; and processing the inhibitor for the protein expressed by the amplifiable gene in the host cell in the culture.

ShRNA that inhibits the expression of an endogenous amplifiable gene according to the present invention; And by using a vector containing the gene of the target protein and the exogenous amplifiable gene, the target protein can be produced, so it can be usefully used to produce the protein required in the food field, medical field.

However, the effects of the present invention are not limited to the above-mentioned effects, and other effects not mentioned will be clearly understood by those skilled in the art from the following description.

1 is a vector expressing a shRNA targeting the 3'-UTR of the endogenous amplifiable gene dhfr, while having a gene construct comprising the gene of the target protein (EPO) and an exogenous dhfr, then methotrexate (MTX) A schematic diagram illustrating the principle of the present invention in which a gene is amplified by the treatment of.

Figure 2 is a graph comparing the mRNA expression changes of endogenous dhfr in the CHO-K1 cell line by shRNA / pSUPER vector.

Figure 3a shows a pcDNA5 / FRT vector (shRNA (-) vector), Figure 3b shows a shRNA / pcDNA5frt vector (shRNA (+) vector), Figure 3c shows an EPO-IRES-dhfr / pcDNA5frt vector, Figure 3d shows a shRNA / EPO-IRES Schematic of the -dhfr / pcDNA5frt vector.

FIG. 4A is a graph of F-MTX-treated fluorescence analysis of the cell line and the DG44 cell line transduced with the vector of FIG. 3A (shRNA (−) vector) and the vector of FIG. 3B (shRNA (+) vector), and FIG. 4B. Is a graph comparing the FITC fluorescence value of the fluorescence analysis results.

FIG. 5 is a graph comparing sensitivity to MTX of a cell line transduced with the vector of FIG. 3A (shRNA (−) vector) and the vector of FIG. 3B (shRNA (+) vector).

FIG. 6 shows the effect of shRNA-2 on endogenous dhfr, 3'-UTR of endogenous dhfr, mRNA expression level of exogenous dhfr gene in vector by RT-PCR.

7 is a graph comparing the effect of shRNA on gene amplification according to MTX treatment. shRNA (-) is the vector of FIG. 3c, shRNA (+) is the cell group transduced with the vector of FIG. 3d, respectively.

FIG. 8A is a graph showing dhfr mRNA expression level, FIG. 8B is a graph showing dhfr gene copy number, FIG. 8C is a graph showing mRNA expression level of dhfr 3'-UTR, and FIG. 8D is a graph showing dhfr 3'-UTR expression. It is a graph comparing gene copy number.

First, terms used in the present invention will be described.

As used herein, an "endogenous" substance refers to a substance naturally present in or derived from a cell of an organism.

In the present invention, the "exogenous" substance refers to a substance which does not exist naturally in a cell, and is a substance in which an externally-derived substance is introduced into the cell by a genetic or biochemical method.

As used herein, "nucleic acid", "polynucleotide" and "oligonucleotide" are used interchangeably and refer to deoxyribonucleotide or ribonucleotide polymers in linear or cyclic structure and in single- or double-stranded form.

The term "amplifiable gene" as used herein refers to a gene encoding a protein necessary in a cell. When expression of the amplifiable gene is inhibited, cell growth does not occur normally. When an expressed protein is exposed to an inhibitor thereto, it refers to a gene in which cells increase the expression of the amplifiable gene for normal growth.

Hereinafter, the present invention will be described in detail.

 One. Expression vector for overexpression of target protein

One aspect of the present invention provides a gene fragment for RNA interference targeting the 3'-UTR of the mRNA of the endogenous amplifiable gene of the host cell; And a gene construct comprising a cloning site capable of cloning a gene of a target protein and an exogenous amplifiable gene.

First, the expression vector of the present invention comprises a gene segment for RNA interference targeting the 3'-UTR of the mRNA of the endogenous amplifiable gene of the host cell.

The amplifiable gene is dihydrofolate reductase (DHFR), glutamine synthetase (GS), adenosine deaminase (ADA), aspartic acid carbamyl transferase (aspartate transcarbamylase, CAD) ) And ornithine decarboxylase (ODC) may be a gene encoding any one selected from the group consisting of, but not limited to, encoding a protein that must be expressed essential for cell growth. Genes can be applied without limitation.

The gene fragment for RNA interference is a sequence complementary to the 3'-UTR of the mRNA of the amplifiable gene, and after being transcribed in a host cell, binds to the 3'-UTR of the mRNA of the amplifiable gene and binds to the amplification. Serves to reduce the expression of genes.

The gene segment for RNA interference may be single stranded or double stranded. The base sequence for RNA interference that is single stranded may have a double stranded region, and the base sequence for double stranded RNA interference may have a single stranded region. The gene segments for RNA interference may be double stranded RNA (dsRNA), microRNA (microRNA, miRNA), short interfering RNA (siRNA), antisense RNA, promoter-directed. Promoter-directed RNA (pdRNA), Piwi-interacting RNA (piRNA), expressed interfering RNA (eiRNA), short hairpin RNA (shRNA), antagomir ( It may include any one selected from the group consisting of antagomirs, decoy RNA (decoy RNA), DNA, plasmid and aptamer, but is not limited thereto.

The gene segment for RNA interference may be short-hairpin RNA (shRNA) having a nucleotide sequence of SEQ ID NO: 2 or SEQ ID NO: 3. The present invention includes a gene consisting of a base sequence substantially the same as a gene comprising the nucleotide sequence of SEQ ID NO: 2 or SEQ ID NO: 3 and fragments of the gene. Genes consisting of the same base sequence means those having sequence homology of at least 80%, preferably at least 90%, most preferably at least 95%, but are not limited thereto, and at least 80% sequence homology. And is complementary to the 3'-UTR of the mRNA of the amplifiable gene and is not limited so long as it maintains a function of reducing the expression of the amplifiable gene.

The stem-loop structure of the shRNA molecule may be about 45 to 62 nucleotides in length, or preferably about 45 to 49 nucleotides in length. The stem region may be about 18 to 24 nucleotides in length (or more) or more preferably about 18 to 20 nucleotides in length. The stem may comprise two completely complementary duplexes (but not for any 3 'tail), but there may be protrusions or inner loops. The number of such overhangs and asymmetrical inner loops is preferably a minor number ( eg 1, 2 or 3) and is about 3 nucleotides or less in size. The terminal loop portion may comprise about 2 or more nucleotides, but may preferably comprise about 8 or less nucleotides. More specifically, the loop portion may preferably be 6-15 nucleotides in size.

In addition to the gene fragment for RNA interference as described above, the expression vector of the present invention includes a gene construct including a cloning site capable of cloning a gene of a target protein and an exogenous amplifiable gene.

The cloning site is a site where the target protein to be overexpressed through the expression vector of the present invention is inserted, and is a portion containing many restriction sites, and can be generally used during a process including cloning or subcloning. Restriction enzyme sites in the cloning site can be configured in various ways depending on the purpose, and the flexibility of such restriction element sites may allow cloning of the gene of interest for a variety of applications.

The exogenous amplifiable gene is preferably derived from a host cell, but any one derived from the host cell may be used without particular limitation as long as the exogenous amplifiable gene is capable of maintaining the growth of the host cell in an environment in which the expression of the endogenous amplifiable gene is suppressed.

The gene construct may further include an internal ribosome entry site (IRS) between the cloning site and the exogenous amplifiable gene. The IRES is a specific region present inside the mRNA, and is a region where ribosomes bind directly to the IRES region to initiate translation without depending on the 5 'cap. Therefore, if an IRES is interposed between the cloning site and the exogenous amplifiable gene, the gene located on one side of the IRES is translated from the cap structure at the 5 'end in the process of translation and the gene located on the other side of the IRES. Since the translation is performed by attaching a ribosomal subunit to the IRES, the target protein cloned into the cloning site and the exogenous amplifiable gene can be obtained separately. Therefore, the use of the IRES as described above has the effect that the additional process of separating the overexpressed target protein from the exogenous amplifiable gene is omitted.

In addition, a base sequence encoding a 2A peptide may be included between the cloning site of the gene construct and the exogenous amplifiable gene. Since the 2A peptide sequence impairs normal peptide bond formation during the ribosomal skipping mechanism, genes contained in the gene construct are expressed as separate proteins. For this function, between the cloning site of the gene construct and the exogenous amplifiable gene, in addition to the base sequence encoding a 2A peptide, a base sequence encoding a 2A-like peptide, a ribozyme cleavage site, and a protease cleavage site are encoded. Base sequences and the like may be included, respectively.

In addition, the gene construct may include a promoter capable of initiating expression of an exogenous amplifiable gene in addition to an internal ribosomal inlet site (IRES) between the cloning site and the exogenous amplifiable gene, but is not limited thereto. The promoter is any one selected from the group consisting of Simian virus 40 early promoter, mouse mammary cancer virus LTR promoter, cytomegalovirus Pol-II promoter, herpes thymidine kinase promoter and phosphoglycerate kinase I (PGK) promoter. Can be.

In addition, the gene construct may further include a gene encoding a tag for separation and purification to facilitate the purification of the expressed target protein. As the tag for separation and purification, GST, poly-Arg, FLAG, histidine-tag (His-tag) or c-myc may be used. The expression vector of the present invention can be transformed into a suitable host cell to replicate and function independently of the genome of the host cell, or in some cases can be integrated into the genome itself. In particular, in the present invention, a plasmid vector may be used, wherein the plasmid vector is transformed into (a) a replication initiation point so that replication is efficiently carried out to include several hundred plasmid vectors per host cell, and (b) a plasmid vector. It has a structure comprising a selection marker gene that allows a host cell to be selected and (c) a restriction enzyme cleavage site into which foreign DNA fragments can be inserted. Although no appropriate restriction enzyme cleavage site is present, the use of synthetic oligonucleotide adapters or linkers according to conventional methods facilitates ligation of the vector and foreign DNA.

The host cell may be an animal cell, more preferably a mammalian cell, and the mammalian cell may be a human cell.

The mammalian cells are BHK21 cell line, BHK T- cell line, NS0 cell line, Sp2 / 0 cell line, EL4 cell line, CHO cell line, CHO cell derivatives, U293 cell line, NIH / 3T3 cell line, 3T3 LI cell line, ES- It may be any one rodent cell selected from D3 cell line, H9c2 cell line, C2C12 cell line, and miMCD-3 cell line, but is not limited thereto.

The CHO induced cell line may be any one selected from CHO-Kl cell line, CHO-DUKX, CHO-DUKX Bl, and CHO-DG44 cell lines, but is not limited thereto.

The human cells are SH-SY5Y, IMR32 cell line, LAN5 cell line, HeLa cell line, MCFIOA cell line, 293T cell line, SK-BR3 cell line, U293 cell line, HEK 293 cell line, PER.C6® cell line, Jurkat cell line, HT-29 cell line, LNCap .FGC cell line, A549 cell line, MDA MB453 cell line, HepG2 cell line, THP-I cell line, MCF7 cell line, BxPC-3 cell line, Capan-1 cell line, DU145 cell line and PC-3 cell line, It is not limited to this. On the other hand, the human cell may be any one primary cell selected from the group consisting of HuVEC cell line, HuASMC cell line, HKB-I1 cell line and hMSC cell line, but is not limited thereto.

At this time, appropriate culture methods, media conditions and the like according to the type of host cell can be easily selected by those skilled in the art from the known art.

The target protein may be erythropoietin (EPO), and if the target protein requires high productivity, the vector system of the present invention may be applied.

When the expression vector according to the present invention is used, the expression of the endogenous amplifiable gene of the host cell is suppressed, so that the host cell expresses the exogenous amplifiable gene included in the expression vector of the present invention to maintain its growth. In this state, when the host cell is exposed to an inhibitor of the exogenous amplifiable gene, the host cell again overexpresses the exogenous amplifiable gene in order to maintain its growth, wherein the host cell is linked to the exogenous amplifiable gene. Since the target protein cloned at the cloning site is also overexpressed, the target protein can be obtained in large quantities using the expression vector of the present invention.

 2. Transformants and Overexpression Methods for Overexpression of Target Proteins

Another aspect of the present invention provides a transformant in which the expression vector for producing the target protein is introduced into a host cell.

As a method of introducing a recombinant expression vector for producing a transformant of the present invention, a known technique, that is, a heat shock method, an electric shock method, or the like may be used.

Another aspect of the invention provides a method of overexpressing a protein of interest comprising the following steps:

Cloning the gene of the protein of interest in the cloning site of the gene construct of the expression vector; Introducing an expression vector cloned with the gene of the protein of interest into a host cell; Culturing the host cell into which the expression vector is introduced; And treating the inhibitor against the protein expressed by the amplifiable gene in the host cell in culture.

The protein expressed by the amplifiable gene and the inhibitor for the protein are dihydrofolate reductase (DHFR) and methotrexate (methotrexate, MTX), respectively; Glutamine synthetase (GS) and methionine sulfoximine (MSX); Adenosine deaminase (ADA) and deoxycoformycin (dCF); Aspartate transcarbamylase (CAD) and N-phosphonacetyl-L-aspartic acid (N-phosphonacetyl-L-aspartate, PALA); And ornithine decarboxylase (ornithine decarboxylase, ODC) and α-difluoromethyl-ornithine (α-difluoromethyl-ornithine, DFMO); may be any one selected from the group consisting of.

The treatment concentration of MTX may be 10nm to 1000nm, and may be used without limitation as long as the growth of the cell is maintained, a concentration capable of increasing the production of the target protein.

Cultivation of such a transformant can be made according to suitable media and culture conditions known in the art. Those skilled in the art can easily use the medium and culture conditions according to the type of host cell of the transformant to be selected.

Mediums that can be used in the present invention may include, for example, commercially available mediums such as Ham's F10 (Sigma), minimum essential medium ([MEM], Sigma), RPMI-1640 (Sigma) and DMEM (Sigma), It is not limited to this. Any of these media can be used as needed, such as hormones or other growth factors (such as insulin, transferrin or epidermal growth factor), salts (such as sodium chloride, calcium, magnesium and phosphate), buffers (such as HEPES), nu Cleosides (such as adenosine and thymidine), antibiotics (such as gentamicin®) drugs, trace elements (usually defined as inorganic compounds present in final concentrations in the micromolar range), lipids (linoleic acid or others) Such as fatty acids) and their appropriate carriers, and glucose or equivalent energy sources. Other necessary supplements may also be included at appropriate concentrations known in the art. In addition, anti-foaming agents such as fatty acid polyglycol esters can be used during the culture to suppress bubble generation.

The desired protein produced by the method can be recovered using separation and purification methods known in the art. The recovery may be by centrifugation, ion exchange chromatography, filtration, precipitation, or a combination thereof.

Specific embodiments of the present invention include a gene segment for RNA interference targeting the 3'-UTR of the mRNA of the endogenous amplifiable gene of the host cell, and a construct comprising a gene of the target protein and an exogenous amplifiable gene. A vector (shRNA / EID / pcDNA5frt) was prepared and introduced into CHO cells to prepare a transformant. In the transformant prepared as described above, the expression of the endogenous amplifiable gene (dhfr) was reduced by the gene fragment for RNA interference, and the expression of the exogenous amplifiable gene was increased when the MTX concentration was increased in steps. As it was confirmed that the expression of the target protein also increased (see Figure 7).

More specifically, in the embodiment of the present invention, the Flp-In system was used, and the Flp-In system includes a Flp-In CHO cell line (a cell line containing a single insertion FRT site); PcDNA5 / FRT vector (plasmid having an FRT site, which is a recognition and degradation site for Flp recombinase) expressing a target protein or the like upon introduction; And pOG44 Flp recombinase expression plasmids. Specifically, shRNA / EID / pcDNA5frt comprising a shRNA that inhibits the expression of endogenous amplifiable genes and a construct comprising a gene of the protein of interest and an exogenous amplifiable gene are prepared, and the pOG44 Flp recombinase expression plasmid The transformants were prepared by introducing them into the Flp-In CHO cell line together. The gene of EPO, which is the target protein contained in the shRNA / EID / pcDNA5frt, is inserted into the genome of the cell line depending on the Flp recombinase, and the expression of the target protein is amplified by stepwise MTX treatment of the transduced Flp-In CHO cell line. It was confirmed (see FIG. 7).

Hereinafter, the present invention will be described in detail by Examples and Experimental Examples.

However, the following Examples and Experimental Examples are only for illustrating the present invention, and the content of the present invention is not limited by the following Examples and Experimental Examples.

[Examples and Experimental Examples]

[ Example  1] for the inhibition of endogenous amplifiable genes shRNA  making

[1-1] for Inhibition of Endogenous Amplifiable Genes shRNA  Construction of Expression Vectors

The base sequence of shRNA targeting 3'-UTR of dhfr, an internal amplification gene, was submitted to Bioneer, and provided three base sequences as shown in Table 1 below. These three base sequences were cloned into a pSUPER vector (Clontech). An shRNA expression vector was constructed for the inhibition of endogenous amplifiable genes.

SEQ ID NO:	Sequence name	Sequence (5 '→ 3')
One	shRNA-1	CUGAUUGACUUCAACUUCU
2	shRNA-2	UGUGUUGGCUUUAGAUCUA
3	shRNA-3	GAUAGUUAGGAAGAUGUAU

[1-2] above shRNAs DHFR  Confirmation of expression inhibition effect

Among the pSUPER vectors prepared in Example 1-1, pSUPER vectors each containing the gene fragments of Table 1 above were each CHO-K1 cell line (ATCC).  CCL-61 ^TM ) was used to confirm the mRNA amount of the dhfr gene by quantitative real-time PCR (qPCR). As a negative control, a CHO-K1 cell line without a pSUPER vector was used, and a CHO-K1 cell line and a CHO-K1 cell line into which a manufactured pSUPER vector were introduced were 10% fetal vobine serum (FBS, Gibco). Cultured in a RPMI1640 (Gibco) medium containing. As a positive control, dfhr-deficient DG44 cell line (CHO-DG44 cells (Invitrogen)) was used, and the DG44 cells were IMDM (Hyclone) medium containing 5% dialyzed FBS (Gibco) and 1x HT supplement (Gibco). Incubated at.

Extraction of DNA for transduction in Example 1-1 was prepared using PureYield Plasmid Midiprep system (Promega), and transduction was performed according to the manufacturer's instructions using Lipofectamine 2000 (Invitrogen). It was. After transduction, the transduced cells were cultured for 14 days in RPMI1640 (Gibco) medium containing 10% FBS. RNA of the cell line or control cell line into which the cultured shRNA expression vector was introduced was miniBEST Universal RNA Extraction Kit (Takara). The extracted RNA was synthesized into cDNA using PrimeScript 1 ^st strand cDNA Synthesis Kit (Takara), and then subjected to qPCR using the template as shown in Table 2. Primer dhfr-F (SEQ ID NO: 18) And dhfr-R (SEQ ID NO: 19) were used to amplify the dhfr gene, and primer gapdh-F (SEQ ID NO: 22) and gapdh-R (SEQ ID NO: 23) were used to amplify the internal standard gene gapdh gene.

SEQ ID NO:	Sequence name	primer  direction	Sequence (5 '→ 3')
18	dhfr-F	Forward direction	CAGGCCACCTCAGACTCTTTG
19	dhfr-R	Reverse	TGGGAAAAACGTGTCACTTTCA
22	gapdh-F	Forward direction	CATGGCCTTCCGTGTTCCTA
23	gapdh-R	Reverse	CAGGCGACATGTCAGATCCA

qPCR was performed using a Power SYBR Green PCR Master mix (Applied Biosystems) and was performed according to the manufacturer's instructions. The PCR reaction was performed a total of 40 times under conditions of 10 minutes at 95 ° C, 15 seconds at 95 ° C, and 1 minute at 60 ° C to amplify the genes and confirm the relative gene expression using comparative Ct (△△ Ct) method. It was.

As a result, in the case of the control DG44 cell line lacking dhfr, dfhr was not expressed, and in the case of the CHO cell line into which the shRNAs designated by SEQ ID NOS: 1 to 3 were introduced, the cell line into which the shRNAs of SEQ ID NO: 2 or 3 were introduced was SEQ ID NO: 1 The expression of endogenous dhfr in CHO cells was reduced compared to the cell lines into which shRNA was introduced. Especially, in the CHO cell line into which shRNA-2 of SEQ ID NO: 2 was introduced, the expression of intracellular dhfr gene was suppressed by 80% compared to the control group. It was confirmed that the efficiency (Fig. 2). Therefore, the most effective shRNA-2 of SEQ ID NO: 2 was selected as an endogenous dhfr gene targeting shRNA in the CHO cell line, and further experiments were performed.

From the above results, it was found that dhfr deficiency is effectively achieved even when a shRNA that inhibits 3'-UTR of dhfr is introduced into CHO cells without irradiating the cells as in the conventional DG44 cell line.

[ Example  2] for the inhibition of endogenous amplifiable genes with shRNA  Preparation of Expression Vectors Containing Target Proteins

The promoter and shRNA gene of the vector prepared in Example 1 were inserted into an expression vector capable of expressing a target protein, and a cell line was constructed for stable expression. The Flp-In system (Invitrogen), a site-specific insertion method, was used to accurately identify gene amplification efficiency and the production of the target protein, excluding the influence of the vector's genomic insertion site. The Flp-In system transduces a pcDNA5 / FRT vector (FIG. 3A) and a pOG44 vector expressing Flp recombinase, which express a protein of interest in the Flp-In CHO cell line, and then hygromycin B (hygromycin B). B) (invitrogen) was applied by the method.

[2-1] shRNA Of pcDNA5frt  making

shRNA / pcDNA5frt was prepared using an In-fusion HD cloning kit (Clontech). Specifically, the pSUPER vector containing the shRNA-2 of SEQ ID NO: 2 prepared in Example 1 was used as a template to include the shRNA-2 and H1 promoters. First, the pSUPER vector was subjected to PCR using pD5-shRNA F (SEQ ID NO: 4) and pD5-shRNA R (SEQ ID NO: 5) primers of Table 3, and pcDNA5frt was made by treating restriction enzyme BglII. 50 μl of the obtained PCR product, 10 ng of the restriction enzyme-treated pcDNA5frt fragment, and 8 μl of the DW mixture were added with 2 μl of In-fusion enzyme premix and reacted at 50 ° C. for 15 minutes at the BglII restriction site of the pcDNA5 / FRT vector. shRNA was inserted to prepare shRNA / pcDNA5frt (FIG. 3B).

[2-2] EID Of pcDNA5frt  making

One of the target protein types, erythropoietin (EPO) gene, is expressed in the NheI restriction enzyme position of the multicloning site (MCS) of the pcDNA5 / FRT vector together with the IRES-dhfr gene of the pOptiVEC vector (Invitrogen) for expression with DHFR. EID / pcDNA5frt vector was prepared by inserting in a -fusion method (FIG. 3C). Specifically, the EPO gene, IRES-dhfr gene, and pcDNA5 / FRT vector required for the preparation of EID / pcDNA5frt vector were amplified by PCR, respectively. When amplifying the EPO gene, GenBank accession no. Having the amino acid sequence of SEQ ID NO: 26 and consisting of the nucleotide sequence of SEQ ID NO: 27. Using mRNA of NM_000799 as a template, primers EPO F (SEQ ID NO: 6) and EPO R (SEQ ID NO: 7) shown in Table 3 were used. When amplifying the IRES-dhfr gene, pOptiVEC vector was used as a template, and IRES F (SEQ ID NO: 8) and dhfr R (SEQ ID NO: 9) shown in Table 3 were used. pcDNA5frt was processed by restriction enzymes NheI, XhoI to make a fragment. The obtained PCR product was reacted with the restriction enzyme treated pcDNA5frt under the same conditions as in Example 2-1 to prepare an EID / pcDNA5frt vector.

[2-3] shRNA Of EID Of pcDNA5frt  making

A shRNA that suppresses the expression of the endogenous amplifiable gene dfhr is expressed, and a shRNA / EID / pcDNA5frt expressing the target protein EPO and the exogenous amplifiable gene dfhr, respectively, was prepared. The shRNA / EID / pcDNA5frt was prepared by inserting the EPO sequence and the IRES-dhfr gene in the same sequence and manner as in Example 2-2 at the NheI and XhoI restriction enzyme positions of the shRNA / pcDNA5frt vector prepared in Example 2-1.

SEQ ID NO:	Sequence name	primer  direction	Sequence (5 '→ 3')
4	pD5-shRNA F	Forward direction		GACGGATCGGGAGATCTGAATTCGAACGCTGACGT
5	pD5-shRNA R	Reverse		AGGGGATCGGGAGATCTAACAGCTATGACCATGAT
6	EPO F	Forward direction	ACCCAAGCTGGCTAGCGCCACCATGGGGGTGCACGAATGT
7	EPO R	Reverse		GGGGGAGGGAGAGGGGCGGCTCATCTGTCCCCTGTCCTGC
8	IRES F	Forward direction	GCAGGACAGGGGACAGATGAGCCGCCCCTCTCCCTCCCCC
9	dhfr R	Reverse	AAGTTTAAACGCTAGCTTAGTCTTTCTTCTCGTA

[ Example  3] Example  In the cell line constructed at 2 dhfr  Expression level and MTX sensitivity check

In order to confirm the effect of shRNA-2 on the cell population constructed in Example 2, the expression of dhfr protein in cells and the sensitivity to MTX were measured, and the expression of dhfr in the vector was confirmed.

[3-1] pcDNA5 Of FRT  vector, shRNA Of pcDNA5frt  vector, EID Of pcDNA5frt  Construction of cell lines transduced with vector and shRNA / EID / pcDNA5frt, respectively

pcDNA5frt and three types of vectors prepared in Examples 2-1 to 2-3 were transduced into the Flp-In CHO cell line using lipofectamine 2000 (Invitrogen), respectively. At the time of transfection, each vector and a pOG44 vector expressing Flp ribase were transduced together. After 24 hours, HT supplement was not included and transferred to medium containing hygromycin B. The cells were cultured for 2 weeks and selected to form a cell population. Three cell groups transduced with EPO-expressing vectors were formed, and in subsequent experiments, shRNA / pcDNA5frt vectors (FIG. 3B) and shRNA / EID / pcDNA5frt (FIG. 3D), which are genes containing genes containing shRNA-2 and H1 promoters, were used. ) Transduced cell line is shRNA (+), and cell lines transduced with pcDNA5 / FRT vector (FIG. 3A) and EID / pcDNA5frt vector (FIG. 3C) which do not include these are shRNA (-). It was.

[3-2] Intracellular dhfr Protein amount  Confirm

In order to confirm that shRNA-2 has the same effect in the Flp-In system, FITC fluorescence-labeled MTX (Fluorescent methotrexate, F-MTX; Invitrogen) was used to confirm the amount of DHFR in cells. DHFR is an essential enzyme in eukaryotic and prokaryotic cells and catalyzes NADPH-dependent reduction of dihydrofolate to tetrahydrofolate. MTX is a competitive inhibitor of dihydrofolate and can bind to DHFR instead of dihydrofolate. Therefore, when F-MTX is treated, the fluorescent F-MTX binds to DHFR, so it is possible to indirectly confirm the expression level of DHFR through fluorescence intensity.

Treatment of F-MTX was performed by adding a medium containing 10μM F-MTX to the attached cells and incubated at 37 ℃ for 24 hours. After 24 hours, the FITC fluorescence value was measured by using a Guava Easy Cyte instrument for fluorescence values of cells removed by F-MTX-free medium and 2 hours after trypsin treatment.

As a result, it was confirmed that the expression level of dhfr protein was about 80% lower in the shRNA (+) (vector of FIG. 3B) cell population compared to shRNA (-) (vector of FIG. 3A) through F-MTX (FIGS. 4A and 4B). . This was confirmed by the result similar to the introduction of the pSUPER vector into the CHO-K1 cell line in Example 1 (FIG. 2).

These results show that the application of shRNA-2 sequence to the Flp-In system significantly reduces the amount of dhfr expression in cells as in the pSUPER vector.

[3-3] Confirmation of Cell Sensitivity to MTX

MTX is known as an inhibitor that inhibits the activity of DHFR, and when transducing shRNA-2 which inhibits the expression of DHFR according to the present invention, the expression of DHFR in the cell is reduced according to the action of shRNA-2, and intracellular As the expression of essential DHFR decreases, sensitivity to MTX is also expected to increase. Specifically, in order to measure the sensitivity of the cells to the MTX of the shRNA (+) (vector of Figure 3b) cell group prepared in Example 2, the growth of cells according to the increase in MTX concentration of the shRNA (-) of Example 2 (Fig. 3a Vector) cell population. MTX was treated to each cell by concentration, and after 4 days, the cell number was measured and compared with the number of cells not treated with MTX.

As a result, the sensitivity of the cells to MTX was confirmed that the shRNA (+) cell group is five times more sensitive than the shRNA (-) cell group (Fig. 5).

Through the above results, the shRNA (+) cell group has a high sensitivity to MTX, it was found that the DHFR deficiency state was effectively achieved.

[3-4] Example  Manufactured in 2 shRNA Of EID Of pcDNA5frt  Determine whether shRNA-2 affects exogenous dhfr gene in cell lines transduced with vectors

Reverse transcriptase polymerase PCR (RT-PCR) was performed to determine whether shRNA-2 affects the exogenous dhfr gene. Preparation of RNA and cDNA to perform RT-PCR is the same as described in Example 1 above. RT-PCR was performed using Ex Taq DNA polymerase (Takara) and the primers of Table 3 below. Intracellular dhfr sequences are from CHO cells and shRNA / EID / pcDNA5frt The dhfr sequence inserted into the vector is almost identical to that derived from a mouse, but the nucleotide sequence of the dhfr (SEQ ID NO: 28) derived from CHO cells and the dhfr (SEQ ID NO: 29) derived from a mouse is identified through a blast of NCBI. Primers were prepared and PCR was performed for each. Specifically, in order to amplify CHO cell-derived dhfr (endogenous), primers Endo-dhfr-F (SEQ ID NO: 10) and Endo-dhfr-R (SEQ ID NO: 11) shown in Table 4 were used, and mouse-derived dhfr (exogenous) was used. Exo-dhfr-F (SEQ ID NO: 12) and Exo-dhfr-R (SEQ ID NO: 13) of Table 4 were used to amplify. In addition, 3'-UTR was amplified to confirm the expression of 3'-UTR of CHO cell-derived dhfr (endogenous), and when amplified, 3'-UTR-F (SEQ ID NO: 14) and 3'- of Table 4 below. UTR-R (SEQ ID NO: 15) was used. In addition, beta-actin was determined as an internal standard gene, and it was confirmed that the amount of each sample was the same. Was used.

SEQ ID NO:	Sequence name	primer  direction	Sequence (5 '→ 3')
10	Endo-dhfr-f	Forward direction	GATTTTCCCTGGCCAATG
11	Endo-dhfr-r	Reverse		CCACTTTATCTGCTAACTCTGGTTG
12	Exo-dhfr-f	Forward direction	GACCTACCCTGGCCTCCG
13	Exo-dhfr-r	Reverse		CTACTTTACTTGCCAATTCCGGTTG
14	3'-UTR-F	Forward direction	CAAGACCATGGGACTTGT
15	3'-UTR-R	Reverse	GCCACTTGAGGCTGCATG
16	ActB-F	Forward direction	CATTCAGGCTGTGCTGTCC
17	ActB-R	Reverse	GCCATCTCCTGCTCGAAG

 As a result of performing RT-PCR, mRNA levels of the cellular endogenous dhfr and dhfr 3'-UTR genes were reduced by shRNA-2, but the expression of the exogenous dhfr gene contained in the vector was confirmed to be constant with or without shRNA-2. (FIG. 6).

From the above results, the introduced shRNA-2 has an inhibitory effect on dhfr, whose expression is regulated by dhfr 3'-UTR in the cell, but in the case of externally introduced dhfr, expression is not regulated by 3'-UTR. Therefore, it was found that the same expression level was observed regardless of the presence or absence of shRNA-2.

[ Example  4] Amplification Efficiency and EPO Expression Enhancement Analysis of Externally Amplified Genes

The cell lines constructed in Example 2 were treated with MTX step by step to amplify the genes and confirm the yield per unit cell of the target protein EPO. Two types of vector EID / pcDNA5frt and shRNA / EID / pcDNA5frt (Figs. 3c and 3d, respectively) were transduced, followed by stepwise MTX at 50, 250 and 500 nM concentrations in Flp-In CHO cell lines screened with hygromycin B. Treated with. Three cell groups were formed at each concentration, and each time the concentration of MTX was increased, the colony was formed, followed by 2-3 passages and the next step of MTX treatment to perform gene amplification using MTX. In order to measure their EPO production, the plates were incubated at a concentration of 1 × 10 ⁵ cells / ml, and after 4 days, the cultures were collected and the number of cells was measured. After the centrifugation, the supernatant was stored at 20 ° C., and then the amount of EPO was measured by enzyme-linked immunosorbent assay (ELISA). Enzyme-linked immunoassays were performed using the Quantikine IVD ELISA kit (R & D Systems) and according to the manufacturer's instructions.

As a result, it was confirmed that EPO production in the shRNA-expressing cell group (shRNA / EID / pcDNA5frt vector-introducing cell line) was increased at a high rate according to gene amplification, compared to the cell line without the shRNA (EID / pcDNA5frt vector-introducing cell line). In the final 500 nM MTX it was confirmed that the production per unit cell of EPO 2.5 times higher (Fig. 7).

From these results, shRNA inhibits the expression of endogenous amplifiable genes; When using a vector system comprising a construct containing an exogenous amplifiable gene and a target protein gene, a target cell may be created while creating a cell state lacking the amplifiable gene without separately producing a variant lacking the amplifiable gene. It was found that the expression of the protein can be efficiently induced.

[ Example  5] mRNA  Determine amount and gene copy number

To confirm the mRNA amount and gene copy number of the dhfr related gene in the cells of the cell lines constructed in Example 4 was performed.

[5-1] mRNA amount  Confirm

CDNA synthesis was performed using RNA extracted from each cell to measure mRNA expression using the same method as in Example 1. The synthesized cDNA was used as a sample for qPCR, and primer pairs dhfr-F and dhfr-R (SEQ ID NOs: 18 and 19) and 3, respectively, for dhfr, 3'-UTR, gapdh, and beta-actin. '-UTR-F and 3'-UTR-R (SEQ ID NOs: 20, 21), gapdh-F and gapdh-R (SEQ ID NOs: 22, 23), ActB-F and ActB-R (SEQ ID NOs: 24, 25) Amplification was carried out.

SEQ ID NO:	Sequence name	Primer direction	Sequence (5 '→ 3')
18	dhfr-F	Forward direction	CAGGCCACCTCAGACTCTTTG
19	dhfr-R	Reverse		TGGGAAAAACGTGTCACTTTCA
20	3'-UTR-F	Forward direction	GGGATAGTTAGGAAGATGTATTTGTTTTG
21	3'-UTR-R	Reverse	AACAGTTGCCCAGGATGCA
22	gapdh-F	Forward direction	CATGGCCTTCCGTGTTCCTA
23	gapdh-R	Reverse	CAGGCGACATGTCAGATCCA
24	ActB-F	Forward direction	CTGGACTTCGAGCAGGAGATG
25	ActB-R	Reverse	CATAGCTCTTCTCCAGGGAGGAA

qPCR was performed using a Power SYBR Green PCR Master mix (Applied Biosystems) and was performed according to the manufacturer's instructions. The PCR reaction was performed a total of 40 times under conditions of 10 minutes at 95 ° C, 15 seconds at 95 ° C, and 1 minute at 60 ° C to amplify the genes and confirm the relative gene expression using comparative Ct (△△ Ct) method. It was.

[5-2] Gene copy number confirmation

To measure the number of gene copies, genomic DNA was extracted from each cell using MiniBEST Universal Genomic DNA extraction kit (Takara) and used as a sample for qPCR. Using the dhfr-F (SEQ ID NO: 18) and dhfr-R (SEQ ID NO: 19) primers of Table 5, the mRNA expression amount and gene copy number of the entire dhfr gene, ie, dhfr and externally derived dhfr, in the cell were identified. MRNA expression and gene copy number of the 3'-UTR gene of the dhfr gene were confirmed using '-UTR-F (SEQ ID NO: 20) and 3'-UTR-R (SEQ ID NO: 21). gapdh and beta-actin were used as internal standard genes for mRNA expression and gene copy number, respectively. qPCR was performed using a Power SYBR Green PCR Master mix (Applied Biosystems) and was performed according to the manufacturer's instructions. The PCR reaction was performed a total of 40 times under conditions of 10 minutes at 95 ° C, 15 seconds at 95 ° C, and 1 minute at 60 ° C to amplify the genes and confirm the relative gene expression using comparative Ct (△△ Ct) method. It was.

As a result of confirming mRNA amount and gene copy number in Examples 5-1 and 5-2, the expression of dhfr mRNA was significantly increased in shRNA (+) cell group according to gene amplification by MTX, but shRNA (-) cell group was significantly changed. None (FIG. 8A). It was confirmed that there is a large difference depending on the presence or absence of shRNA gene copy number dhfr (Fig. MRNA expression of the dhfr 3'-UTR gene in the cell was significantly reduced by shRNA (Fig. 8c), but the number of copies of the dhfr 3'-UTR gene in the cell was the same regardless of the presence or absence of shRNA. (FIG. 8D).

From the above results, in the cell line into which the shRNA, the exogenous amplifiable gene, and the gene of the target protein were introduced, the mRNA expression amount and the gene copy number of dhfr increased as the concentration of MTX increased, but the exogenous amplifiable gene and the target without shRNA In the case of the cell line in which only the gene of the protein was introduced, it was found that the dhfr amplification effect by MTX did not appear. In addition, the shRNA-induced cell line affects the mRNA expression level of the dhfr 3'-UTR gene in the cell and decreases the mRNA expression level, but does not affect the gene copy number of the dhfr 3'-UTR. .

In the above described exemplary embodiments of the present invention by way of example, the scope of the present invention is not limited only to the specific embodiments as described above, those skilled in the art to the scope described in the claims of the present invention It will be possible to change accordingly.

Claims (13)

1.  Gene segments for RNA interference targeting 3′-UTR of mRNA of endogenous amplifiable genes of host cells; And

    A gene construct comprising a cloning site capable of cloning a gene of a protein of interest and an exogenous amplifiable gene;

   Expression vector for producing a target protein comprising a.
2. The method according to claim 1,

   The amplifiable gene is dihydrofolate reductase (DHFR), glutamine synthetase (GS), adenosine deaminase (ADA), aspartic acid carbamyl transferase (aspartate transcarbamylase, CAD) ) And ornithine decarboxylase (ODC).
3. The method according to claim 1,

   The gene segment for RNA interference is an expression vector complementary to the 3'-UTR of the mRNA of the amplifiable gene, and is a base sequence for reducing the expression of the amplifiable gene.
4. The method according to claim 1,

   The gene segment for RNA interference is an expression vector of short hairpin RNA (shRNA) comprising the nucleotide sequence of SEQ ID NO: 2 or SEQ ID NO: 3.
5. The method according to claim 1,

   The gene construct may comprise an internal ribosomal entry site (IRES) between the cloning site and the exogenous amplifiable gene, a base sequence encoding a 2A peptide, and a promoter capable of initiating expression of the exogenous amplifiable gene. Expression vector containing any one selected.
6. The method according to claim 5,

   Promoters capable of initiating expression of the exogenous amplifiable gene include Simian virus 40 early promoter, mouse mammary cancer virus LTR promoter, cytomegalovirus Pol-II promoter, herpes thymidine kinase promoter and phosphoglycerate kinase I (PGK) An expression vector which is any one promoter selected from the group consisting of promoters.
7. The method according to claim 1,

   The host cell is a mammalian cell expression vector.
8. The method according to claim 7,

   The mammalian cells include COS cells, CHO cells, VERO cells, MDCK cells, WI38 cells, V79 cells, B14AF28-G3 cells, BHK cells, HaK cells, NS0 cells, SP2 / 0-Ag14 cells, HeLa cells, HEK293 cells and An expression vector which is one selected from the group consisting of PER.C6 cells.
9. A transformant comprising the expression vector of any one of claims 1 to 8.
10. Cloning the gene of the protein of interest in the cloning site of the gene construct of the expression vector of claim 1;

    Introducing an expression vector cloned with the gene of the protein of interest into a host cell;

    Culturing the host cell into which the expression vector is introduced; And

    Treating the inhibitor against the protein expressed by the amplifiable gene in the host cell in culture;

    Overexpression method of the target protein comprising a.
11. The method according to claim 10,

    Host cells include COS cells, CHO cells, VERO cells, MDCK cells, WI38 cells, V79 cells, B14AF28-G3 cells, BHK cells, HaK cells, NS0 cells, SP2 / 0-Ag14 cells, HeLa cells, HEK293 cells and PER. A method of overexpressing a protein of interest that is a cell selected from the group consisting of C6 cells.
12. The method according to claim 10,

    The protein expressed by the amplifiable gene and the inhibitor for the protein are dihydrofolate reductase (DHFR) and methotrexate (methotrexate, MTX), respectively; Glutamine synthetase (GS) and methionine sulfoximine (MSX); Adenosine deaminase (ADA) and deoxycoformycin (dCF); Aspartate transcarbamylase (CAD) and N-phosphonacetyl-L-aspartic acid (N-phosphonacetyl-L-aspartate, PALA); And ornithine decarboxylase (ODC) and α-difluoromethyl-ornithine (DFMO); the overexpression method of the desired protein which is any one selected from the group consisting of. .
13. The method according to claim 12,

    The protein expressed by the amplifiable gene and inhibitors to the protein are dihydrofolate reductase (DHFR) and methotrexate (methotrexate, MTX), respectively.

Images