KR20170053500A - Expression Vector for Producing Target Protein and Producing Method of Target Protein Using the Same - Google Patents

Abstract

The present invention relates to vector capable of improving production efficiency of a target protein, and to a method for production of the target protein using the same. The vector of the present invention comprises: 1) a gene fragment for RNA interference targeting 3-UTR of mRNA of an endogenous amplifiable gene of a host cell; and 2) a construct comprising a gene of the target protein and an exogenous amplifiable gene. When the vector is introduced into the host cell, it is possible to produce the target protein, thereby being usefully used for producing proteins necessary in a food field, and a medical field.

Description

[0001] The present invention relates to an expression vector for producing a target protein and a method for overexpressing the target protein using the expression vector.

The present invention relates to an expression vector for producing a target protein and a method for overexpressing the target protein using the same.

Production of recombinant proteins using animal cells has been difficult due to low productivity, but the development of gene amplification technology has made it possible to produce animal cell lines with high productivity. The gene amplification technology utilizes the amplifiable gene of the cell, that is, the amplifiable gene. An amplifiable gene is a gene that is essentially expressed in a cell. If the expression of the amplifiable gene is inhibited, the cell does not grow normally. Conventionally, the target protein was increased using the characteristics of the amplifiable gene.

For example, an expression vector containing the amplifiable gene and the target protein gene is introduced into a cell line lacking the amplifiable gene dihydrofolate reductase (dhfr), glutamine synthetase (gs), etc. And methotrexate (MTX), methionine sulfoximine (MSX) or the like, which are inhibitors of these genes, to thereby increase the copy number of the expression vector. As the number of copies of the expression vector per unit cell increases, the expression amount of the target protein increases.

Gene amplification technology has become possible by producing mutations in a portion of CHO (Chinese hamster ovary) cell lines using radioactivity in the 1980s to produce DXB11 and DG44 cell lines lacking the dhfr gene. The tissue plasminogen activator, the first recombinant protein drug produced in animal cells, was produced in this DXB11 cell line. Production of cell lines capable of gene amplification technology overcomes the limited production of recombinant proteins in animal cells . In this way, CHOK1SV and NS0 cell lines with low expression of gs gene in addition to DXB11 and DG44 are known as cell lines capable of gene amplification.

Although recombinant protein drugs are being produced in various cell lines other than CHO cell lines, the types of cell lines capable of gene amplification are limited. Recently, it has been reported that cell lines capable of gene amplification have been produced by using the zinc-finger nuclease technique to eliminate the dhfr and gs genes in the CHO-K1 cell line.

On the other hand, RNA interference (RNAi) technology is closely related to the post-transcriptional gene silencing mechanism, and small non-coding RNAs are used to regulate intracellular homologous gene sequences And cause decomposition. microRNA (miRNA), small interference RNA (siRNA) are a kind of representative noncoding RNA and there are differences according to the path of occurrence. It is known that siRNAs are synthesized or externally introduced molecules that temporarily inhibit the gene of interest while also inducing the formation of heterochromatin (heterochromatin). miRNAs are known to affect the stability and expression of messenger RNA (mRNA) by targeting in the 3'-untranslated region (3'UTR) of the gene to be regulated, which is generated in the genome of the host cell . The target gene of miRNA is broad, so it is advantageous to control the whole cell function, but there is a limit to the regulation of the expression of a specific gene. The use of siRNA to inhibit the expression of a specific gene is transient, so a short hairpin RNA (shRNA) capable of sustained expression in a plasmid vector can be used.

As described above, a technique for producing a recombinant protein by introducing a vector containing an exogenous amplifiable gene and a gene of a desired protein into a cell line deficient in the amplifiable gene has been studied. However, The expression vector that can induce the production of the recombinant protein and the cell line lacking the amplifiable gene can be produced by combining the interference technology and the recombinant protein expression method using the exogenous amplifiable gene and the gene of the target protein .

The present inventors have established a cell line in which the expression of an amplifiable gene has been inhibited in the past and have introduced a recombinant vector expressing an amplifiable gene and a target protein into an established cell line to simplify the process of producing a recombinant protein, . ShRNAs that inhibit the expression of endogenous amplifiable genes of cells in general host cells without separately establishing a cell line in which the expression of the amplifiable gene is inhibited are not studied. A recombinant vector comprising a gene of a target protein and a construct of an exogenous amplifiable gene bound thereto, and an inhibitor of the amplifiable gene protein is treated to select the transformed cell line to efficiently produce the target protein .

Korean Patent Application No. 2013-0094885

It is an object of the present invention to provide an expression vector for producing a target protein and a method for overexpressing the target protein using the same, in producing a target protein.

In order to accomplish the above object, one aspect of the present invention provides a gene fragment for RNA interference targeting 3'-UTR of mRNA of an endogenous amplifiable gene of a host cell; And a gene construct comprising a cloning site and an exogenous amplifiable gene capable of cloning a gene of a target protein.

In order to achieve the above object, another aspect of the present invention provides a transformant wherein the expression vector for producing the target protein is introduced into a host cell.

Further, in order to achieve the above object, another aspect of the present invention provides a method comprising the steps of:

According to another aspect of the present invention, there is provided a method for cloning a gene of interest in a cloning site of a gene construct of the expression vector, Introducing an expression vector in which a gene of the target protein is cloned into a host cell; Culturing the host cell into which the expression vector has been introduced; And treating the host cell under culturing with an inhibitor for a protein expressed by the amplifiable gene.

An shRNA which inhibits the expression of an endogenous amplifiable gene according to the present invention; And a vector containing a target protein gene and an exogenous amplifiable gene, it is possible to produce a target protein, and thus can be usefully used for producing a protein necessary for the food field and the medical field.

However, the effects of the present invention are not limited to the above-mentioned effects, and other effects not mentioned can be clearly understood by those skilled in the art from the following description.

Figure 1 shows the expression of shRNA targeting 3'-UTR of dhfr, an endogenous amplifiable gene, and a vector having a gene construct containing a gene of interest (EPO) and an exogenous dhfr is then transfected with methotrexate (MTX) FIG. 1 is a schematic diagram showing the principle of the present invention in which a gene is amplified by the treatment of FIG.
FIG. 2 is a graph comparing mRNA expression levels of endogenous dhfr in the CHO-K1 cell line by shRNA / pSUPER vector.
Fig. 3 (a) is an EPO-IRES-dhfr / pcDNA5 f rt vector, Fig. 3 (b) is a shRNA / EPO-IRES -dhfr / pcDNA5frt vector.
FIG. 4A is a graph showing fluorescence analysis of F-MTX treated with a vector (shRNA (-) vector) of FIG. 3A and a vector (shRNA (+) vector) Is a graph comparing FITC fluorescence values of fluorescence analysis results.
FIG. 5 is a graph comparing the sensitivity of the cell line transduced with the vector (shRNA (-) vector) of FIG. 3a and the vector of FIG. 3b (shRNA (+) vector) to MTX.
FIG. 6 shows the results of RT-PCR for the effect of shRNA-2 on endogenous dhfr, 3'-UTR of intrinsic dhfr, and exogenous dhfr gene in vector.
Figure 7 is a graph comparing the effect of shRNA on gene amplification by MTX treatment. shRNA (-) is the vector of FIG. 3c, and shRNA (+) is the cell group transfected with the vector of FIG.
FIG. 8A is a graph showing the expression amount of dhfr mRNA, FIG. 8B is a graph showing the number of dhfr gene copies, FIG. 8C is a graph showing mRNA expression levels of dhfr 3'-UTR, This is a graph comparing the number of gene copies.

First, terms used in the present invention will be described.

An "endogenous" substance referred to in the present invention refers to a substance naturally occurring or originating naturally in the cell of an organism.

The term "exogenous" substance referred to in the present invention refers to a substance that is not naturally present in a cell, and a substance derived from the outside is introduced into the cell by a genetic or biochemical method.

&Quot; Nucleic acid ", "polynucleotide ", and" oligonucleotide ", used interchangeably herein, refer to deoxyribonucleotides or ribonucleotide polymers in linear or cyclic structure and single or double stranded form.

The term "amplifiable gene" referred to in the present invention refers to a gene encoding a protein necessary for a cell. When the expression of the amplifiable gene is inhibited, the cell is not normally grown. Means a gene that, when an expressed protein is exposed to an inhibitor thereto, increases the expression of the amplifiable gene for normal growth.

Hereinafter, the present invention will be described in detail.

 One. Expression vector for overexpression of the target protein

One aspect of the present invention relates to a gene fragment for RNA interference targeting 3'-UTR of mRNA of an endogenous amplifiable gene of a host cell; And a gene construct comprising a cloning site and an exogenous amplifiable gene capable of cloning a gene of a target protein.

First, the expression vector of the present invention comprises a gene fragment for RNA interference targeting the 3'-UTR of the mRNA of the endogenous amplifiable gene of the host cell.

The amplifiable gene may be selected from the group consisting of dihydrofolate reductase (DHFR), glutamine synthetase (GS), adenosine deaminase (ADA), aspartate transcarbamylase ) And ornithine decarboxylase (ODC), but is not limited thereto, and may be a gene coding for a protein that is essential for cell growth Any gene can be applied without limitation.

The gene fragment for RNA interference is a sequence complementary to the 3'-UTR of the mRNA of the amplifiable gene, which is complementary to the 3'-UTR of the mRNA of the amplifiable gene after being transcribed in the host cell, It plays a role in reducing the expression of genes.

The gene fragment for the RNA interference may be single stranded or double stranded. The base sequence for single-stranded RNA interference can have a double-stranded region, and the base sequence for double-stranded RNA interference can have a single-stranded region. The gene fragment for the RNA interference may be a double stranded RNA (dsRNA), a microRNA (miRNA), a short interfering RNA (siRNA), an antisense RNA, a promoter- The present invention relates to a method for screening a target cell for the production of an RNA molecule comprising a promoter-directed RNA (pdRNA), a Piwi-interacting RNA (piRNA), an expressed interfering RNA (eiRNA), a short hairpin RNA but are not limited to, antagomirs, decoy RNA, DNA, plasmids and aptamers.

The gene fragment for the RNA interference may be short-hairpin RNA (shRNA) having the nucleotide sequence of SEQ ID NO: 2 or SEQ ID NO: 3. The present invention includes a gene consisting of a nucleotide sequence substantially identical to a gene comprising the nucleotide sequence of SEQ ID NO: 2 or SEQ ID NO: 3 and a fragment of the gene. The term "gene comprising substantially the same base sequence" as used herein refers to those having 80% or more, preferably 90% or more, and most preferably 95% or more of sequence homology, but is not limited thereto, and 80% or more of the sequence homology And is not limited as long as it is complementary to the 3'-UTR of the mRNA of the amplifiable gene and retains the function of reducing the expression of the amplifiable gene.

The stem-loop structure of the shRNA molecule may be about 45 to 62 nucleotides in length, or preferably about 45 to 49 nucleotides in length. The stem region may be about 18 to 24 nucleotides in length (or more) or more preferably about 18 to 20 nucleotides in length. Stems may include perfectly complementary duplexes (but not for any 3 'tail), but there may be protrusions or inner loops. The number of such protrusions and asymmetric inner loops is preferably a prime number (e.g., 1, 2, or 3) and is about 3 nucleotides or less in size. The terminal loop portion may comprise about two or more nucleotides, but preferably it may comprise no more than about eight nucleotides. More specifically, the loop portion may preferably be between 6 and 15 nucleotides in size.

The expression vector of the present invention includes, in addition to a gene fragment for RNA interference as described above, a gene construct comprising a cloning site capable of cloning a gene of a target protein and an exogenous amplifiable gene.

The cloning site is a site into which a target protein to be overexpressed through the expression vector of the present invention is inserted, and is a part containing many restriction sites, and can be generally used during a process including cloning or subcloning. The restriction enzyme site in the cloning site can be variously configured according to the purpose, and the flexibility of the restriction element site makes it possible to clone the target gene for various applications.

The exogenous amplifiable gene is preferably derived from a host cell. However, any source derived from the exogenous amplifiable gene may be used as long as it can maintain the growth of the host cell in an environment in which the expression of the endogenous amplifiable gene is inhibited.

The gene construct may further include an internal ribosome entry site (IRES) between the cloning site and the exogenous amplifiable gene. The IRES is a specific region existing in the mRNA, and is a region in which the ribosome binds directly to the IRES region and does not depend on the 5 'cap (cap) to initiate translation. Therefore, when the IRES is interposed between the cloning site and the exogenous amplifiable gene, a gene located on one side of the IRES is translated from the cap structure at the 5 'end and a gene located on the other side of the IRES Since the ribosome subunit is attached to the IRES and translation is performed, the target protein cloned in the cloning site and the exogenous amplifiable gene can be separately obtained. Therefore, the use of IRES eliminates the additional step of separating the over-expressed target protein from the exogenous amplifiable gene.

In addition, a nucleotide sequence encoding the 2A peptide may be included between the cloning site of the gene construct and the exogenous amplifiable gene. 2A peptide sequences impair normal peptide bond formation during the ribosomal skipping mechanism, so that the genes contained in the gene construct are expressed as separate proteins. For this function, in addition to the nucleotide sequence encoding the 2A peptide, a nucleotide sequence encoding a 2A-like peptide, a ribozyme-degrading site, and a protease-degrading site are encoded between the cloning site of the gene construct and the exogenous amplifiable gene Base sequences, and the like.

In addition, the gene construct may include a promoter capable of initiating the expression of an exogenous amplifiable gene in addition to the internal ribosome entry site (IRES) between the cloning site and the exogenous amplifiable gene, but is not limited thereto. Wherein the promoter is selected from the group consisting of a promoter selected from the group consisting of simian virus 40 early promoter, mouse mammary tumor virus LTR promoter, cytomegalovirus Pol-II promoter, herpes thymidine kinase promoter and phosphoglycerate kinase I (PGK) promoter Lt; / RTI >

In addition, the gene construct may further include a gene encoding a tag for separation and purification in order to facilitate the purification of the expressed target protein. As the tag for separation and purification, GST, poly-Arg, FLAG, histidine tag, c-myc, or the like can be used. The expression vector of the present invention is transformed into a suitable host cell, Can be cloned and functioned independently of the genome of the genome, or, in some cases, integrated into the genome itself. Particularly, in the present invention, a plasmid vector can be used, which comprises (a) a cloning start point for efficiently making replication so as to include several hundred plasmid vectors per host cell, (b) a plasmid vector transformed with a plasmid vector And (c) a restriction enzyme cleavage site into which a foreign DNA fragment can be inserted. Even if an appropriate restriction enzyme cleavage site is not present, using a synthetic oligonucleotide adapter or a linker according to a conventional method can easily ligate the vector and the foreign DNA.

The host cell may be an animal cell, more preferably a mammalian cell, and the mammalian cell may be a human cell.

The mammalian cells may be selected from the group consisting of BHK21 cell line, BHK T-cell line, NS0 cell line, Sp2 / 0 cell line, EL4 cell line, CHO cell line, CHO cell derivatives, U293 cell line, NIH / 3T3 cell line, 3T3 LI cell line, ES- But are not limited to, any one rodent cell selected from the D3 cell line, the H9c2 cell line, the C2C12 cell line, and the miMCD-3 cell line.

The CHO-inducing cell line may be any one selected from CHO-Kl cell line, CHO-DUKX, CHO-DUKX Bl and CHO-DG44 cell line, but is not limited thereto.

The human cells include SH-SY5Y, IMR32 cell line, LAN5 cell line, HeLa cell line, MCFIOA cell line, 293T cell line, SK-BR3 cell line, U293 cell line, HEK 293 cell line, PER.C6® cell line, Jurkat cell line, HT- The present invention is not limited thereto and can be one selected from the group consisting of FGC cell line, A549 cell line, MDA MB453 cell line, HepG2 cell line, THP-I cell line, MCF7 cell line, BxPC-3 cell line, Capan-1 cell line, DU145 cell line and PC- But not limited to this. On the other hand, the human cell may be any primary cell selected from the group consisting of HuVEC cell line, HuASMC cell line, HKB-I1 cell line and hMSC cell line, but is not limited thereto.

At this time, an appropriate culture method and medium conditions depending on the kind of the host cell can be easily selected by those skilled in the art from the known art.

The target protein may be erythropoietin (EPO), and the vector system of the present invention may be applied to a target protein requiring high productivity.

The use of an expression vector according to the present invention inhibits the expression of an endogenous amplifiable gene of a host cell so that the host cell expresses an exogenous amplifiable gene contained in the expression vector of the present invention to maintain its own growth. When the host cell is exposed to the inhibitor for the exogenous amplifiable gene in this state, the host cell further overexpresses the exogenous amplifiable gene to maintain its growth, wherein the exogenous amplifiable gene is linked to the exogenous amplifiable gene Since the target protein cloned in the cloning site is also overexpressed, a large amount of the target protein can be obtained by using the expression vector of the present invention.

 2. Transformants and over-expression of target proteins for over-expression of target proteins

Another aspect of the present invention provides a transformant into which an expression vector for producing the desired protein has been introduced into a host cell.

As a method of introducing the recombinant expression vector for the production of the transformant of the present invention, known techniques such as heat shock method, electric shock method and the like can be used.

Another aspect of the present invention provides a method of overexpressing a target protein comprising the steps of:

Cloning a gene of the target protein in the cloning site of the gene construct of the expression vector; Introducing an expression vector in which a gene of the target protein is cloned into a host cell; Culturing the host cell into which the expression vector has been introduced; And treating the host cell under culture with an inhibitor of a protein expressed by the amplifiable gene.

The protein expressed by the amplifiable gene and the inhibitor for the protein are dihydrofolate reductase (DHFR) and methotrexate (MTX); Glutamine synthetase (GS) and methionine sulfoximine (MSX); Adenosine deaminase (ADA) and deoxycoformycin (dCF); Aspartate transcarbamylase (CAD) and N-phosphonacetyl-L-aspartate (PALA); And a combination of ornithine decarboxylase (ODC) and? -Difluoromethyl-ornithine (DFMO).

The treatment concentration of MTX may be from 10 nm to 1000 nm and may be used without limitation as long as the growth of the cells is maintained and the concentration capable of increasing the production of the target protein is increased.

Culturing of such transformants may be carried out according to appropriate culture media and culture conditions known in the art. As long as it is conventional, the medium and culture conditions can be easily adjusted depending on the type of the host cell of the transformant to be selected.

Mediums that can be used in the present invention include, for example, Ham's F10 (Sigma), minimal essential medium ([MEM], Sigma), RPMI-1640 (Sigma) and Dulbecco's modified Eagle's medium But are not limited to, commercially available media. (Such as insulin, transferrin or epithelial growth factor), salts (such as sodium chloride, calcium, magnesium and phosphate), buffers (such as HEPES), novel (Such as adenosine and thymidine), antibiotics (such as gentamycin TM drugs), trace elements (usually defined as inorganic compounds present in a final concentration in the micromolar range), lipids (such as linoleic acid or other Fatty acids) and suitable carriers thereof, and glucose or equivalent energy sources. Other necessary supplements may also be included at appropriate concentrations known in the art. In addition, bubble formation can be suppressed by using a defoaming agent such as fatty acid polyglycol ester during the culture.

The target protein produced by the above method can be recovered using separation and purification methods known in the art. The recovery may be by centrifugation, ion exchange chromatography, filtration, precipitation, or a combination thereof.

In a specific embodiment of the present invention, a gene fragment for RNA interference targeting the 3'-UTR of mRNA of an endogenous amplifiable gene of a host cell and a construct containing a gene of a target protein and an exogenous amplifiable gene are included (ShRNA / EID / pcDNA5frt) was prepared and transfected into CHO cells. In the transformant thus prepared, the expression of the endogenous amplifiable gene (dhfr) was decreased by gene fragmentation for the RNA interference, and when the MTX concentration was gradually increased, the expression of the exogenous amplifiable gene was increased And the expression of the target protein was also increased (see FIG. 7).

More specifically, the Flp-In system was used in the example of the present invention, the Flp-In CHO cell line (cell line containing the single inserted FRT site), the Flp-In system, A pcDNA5 / FRT vector expressing a target protein or the like upon introduction (a plasmid having an FRT site, which is a recognition and degradation site for Flp recombinase); And the pOG44 Flp recombinant expression plasmid. Specifically, an shRNA / EID / pcDNA5frt containing a shRNA for inhibiting the expression of an endogenous amplifiable gene and a construct containing a gene of a desired protein and an exogenous amplifiable gene was prepared and ligated to a pOG44 Flp recombinase expression plasmid Into a Flp-In CHO cell line to prepare a transformant. The EPO gene, which is a target protein contained in the shRNA / EID / pcDNA5frt, is inserted into the genome of the cell line in a Flp recombinase-dependent manner, and the expression of the target protein is amplified by stepwise treatment of the transfected Flp-In CHO cell line with MTX (See FIG. 7).

Hereinafter, the present invention will be described in detail with reference to Examples and Experimental Examples.

However, the following examples and experimental examples are provided only for illustrating the present invention, and the content of the present invention is not limited by the following examples and experimental examples.

[ Example  And Experimental Example ]

For the inhibition of endogenous amplifiable genes shRNA  making

[1-1] Construction of shRNA expression vector for inhibition of endogenous amplifiable gene

The base sequence of the shRNA targeting the 3'-UTR of the internal amplification gene dhfr was requested by Bioneer, and the three nucleotide sequences shown in Table 1 were provided. These three nucleotide sequences were cloned into the pSUPER vector (Clontech) An shRNA expression vector for the inhibition of the endogenous amplifiable gene was constructed.

SEQ ID NO: Name of sequence The sequence (5 '- > 3') One shRNA-1 CUGAUUGACUUCAACUUCU 2 shRNA-2 UGUGUUGGCUUUAGAUCUA 3 shRNA-3 GAUAGUUAGGAAGAUGUAU

[1-2] Confirmation of DHFR expression inhibition effect of shRNAs

PSUPER vectors containing the gene fragments of Table 1 among the pSUPER vectors prepared in Example 1-1 were transformed into CHO-K1 cell lines (ATCC  CCL-61 ^TM ), and the amount of mRNA of the dhfr gene was confirmed by quantitative Real-Time PCR (qPCR) method. As a negative control, CHO-K1 cell line without pSUPER vector was used. CHO-K1 cell line and CHO-K1 cell line into which the prepared pSUPER vector was introduced were cultured in 10% fetal bovine serum (FBS, Gibco) And cultured in RPMI1640 (Gibco) medium. As a positive control, DG44 cell line (CHO-DG44 cell (Invitrogen)), which is a dfhr deficient cell, was used and the DG44 cell was treated with IMDM (Hyclone) medium containing 5% dialyzed FBS (Gibco) and 1x HT supplement Lt; / RTI >

DNA extraction for transfection in Example 1-1 was performed using the PureYield Plasmid Midiprep system (Promega), and transfection was performed according to the manufacturer's instructions using Lipofectamine 2000 (Invitrogen) Respectively. After transfection, the transfected cells were cultured for 14 days in RPMI 1640 (Gibco) medium containing 10% FBS. RNA from the cell line or control cell line into which the cultured shRNA expression vector was introduced was purified with MiniBEST Universal RNA Extraction Kit (Takara) (SEQ ID NO: 18) of Table 2 below, and the extracted RNA was synthesized as cDNA by using PrimeScript 1 ^st strand cDNA Synthesis Kit (Takara) and then qPCR was performed using the primer dhfr- And dhfr-R (SEQ ID NO: 19), and the gapdh gene, an internal standard gene, was amplified using primers gapdh-F (SEQ ID NO: 22) and gapdh-R (SEQ ID NO: 23).

SEQ ID NO: Name of sequence Primer direction The sequence (5 '- > 3') 18 dhfr-F Forward CAGGCCACCTCAGACTCTTTG 19 dHFr-R Reverse TGGGAAAAACGTGTCACTTTCA 22 gapDH-F Forward CATGGCCTTCCGTGTTCCTA 23 gapDH-R Reverse CAGGCGACATGTCAGATCCA

qPCR was performed using Power SYBR Green PCR Master mix (Applied Biosystems) and according to the manufacturer's instructions. PCR was carried out 40 times at 95 ° C for 10 min, 95 ° C for 15 sec and 60 ° C for 1 min. The genes were amplified and the relative gene expression level was determined using the comparative Ct (ΔΔCt) method Respectively.

As a result, dfhr was not expressed in the control DG44 cell line lacking dhfr, and in the case of the CHO cell line introduced with the shRNAs named SEQ ID NOs: 1 to 3, the cell line into which the shRNAs of SEQ ID NO: 2 or 3 introduced the SEQ ID NO: The expression of endogenous dhfr in the CHO cell line was decreased in the case of the CHO cell line into which the shRNA-2 of SEQ ID NO: 2 was introduced, and the expression of the dhfr gene in the cell was suppressed by 80% (Fig. 2). Therefore, shRNA-2 of SEQ ID NO: 2, which was the most effective, was selected as an endogenous dhfr gene-targeting shRNA in the CHO cell line, and further experiments were conducted.

From the above results, it has been found that dhfr deficiency is effectively achieved even when shRNA which suppresses 3'-UTR of dhfr is introduced into CHO cells without irradiating the cells with radioactivity like the DG44 cell line conventionally.

Preparation of expression vector containing target protein and shRNA for inhibition of endogenous amplifiable gene

The promoter and shRNA gene of the vector prepared in Example 1 were inserted into an expression vector capable of expressing the target protein, and a cell line was constructed for stable expression. In order to precisely confirm the gene amplification efficiency and the production of the target protein, the Flp-In system (Invitrogen), which is a position-specific insertion method, was used. The Flp-In system was constructed by transfecting a pcDNA5 / FRT vector (FIG. 3A) expressing a target protein and the like in a Flp-In CHO cell line together with a pOG44 vector expressing a Flp recombinase, followed by hybridization with hygromycin B B) (invitrogen).

[2-1] Construction of shRNA / pcDNA5frt

shRNA / pcDNA5frt was constructed using the In-fusion HD cloning kit (Clontech). Specifically, the pSUPER vector containing shRNA-2 of SEQ ID NO: 2 prepared in Example 1 was used as a template to include the shRNA-2 and the H1 promoter. First, the pSUPER vector was subjected to PCR using pD5-shRNA F (SEQ ID NO: 4) and pD5-shRNA R (SEQ ID NO: 5) primers shown in Table 3 below. PcDNA5frt was digested with restriction enzyme BglII. 2 μl of the In-fusion enzyme premix was added to a mixture of 50 ng of the obtained PCR product, 10 ng of the restriction enzyme-treated pcDNA5frt fragment and 8 μl of DW, and the reaction was carried out at 50 ° C. for 15 minutes to obtain the BglII restriction enzyme site of the pcDNA5 / FRT vector shRNA was inserted to prepare shRNA / pcDNA5frt (Fig. 3B).

[2-2] Production of EID / pcDNA5frt

In order to express the erythropoietin (EPO) gene, which is one of the target proteins, together with the DHFR, the IRES-dhfr gene of the pOptiVEC vector (Invitrogen) was added to the NheI restriction enzyme site of the pcDNA5 / FRT vector multi- -fusion method to construct an EID / pcDNA5frt vector (FIG. 3C). Specifically, the EPO gene, IRES-dhfr gene, and pcDNA5 / FRT vector required for EID / pcDNA5frt vector production were amplified by PCR, respectively. 26, which has the amino acid sequence of SEQ ID NO: 26 and the nucleotide sequence of SEQ ID NO: 27 at the time of EPO gene amplification. Primers EPO F (SEQ ID NO: 6) and EPO R (SEQ ID NO: 7) in Table 3 were used as the template for mRNA of NM_000799. For IRES-dhfr gene amplification, the pOptiVEC vector was used as a template and IRES F (SEQ ID NO: 8) and dhfr R (SEQ ID NO: 9) in Table 3 were used. pcDNA5frt was digested with restriction enzymes NheI and XhoI. The PCR product obtained and the restriction enzyme-treated pcDNA5frt were reacted under the same conditions as in Example 2-1 to prepare an EID / pcDNA5frt vector.

[2-3] Production of shRNA / EID / pcDNA5frt

ShRNA / EID / pcDNA5frt, in which the shRNA which inhibits the expression of the endogenous amplifiable gene dfhr was expressed, and the target protein EPO and the exogenous amplifiable gene dfhr, respectively, were expressed. The shRNA / EID / pcDNA5frt was prepared by inserting the EPO sequence and the IRES-dhfr gene in the same sequence and manner as in Example 2-2 into the NheI and XhoI restriction sites of the shRNA / pcDNA5frt vector prepared in Example 2-1.

SEQ ID NO: Name of sequence Primer direction The sequence (5 '- > 3') 4 pD5-shRNA F Forward GACGGATCGGGAGATCTGAATTCGAACGCTGACGT 5 pD5-shRNA R Reverse AGGGGATCGGGAGATCTAACAGCTATGACCATGAT 6 EPO F Forward ACCCAAGCTGGCTAGCGCCACCATGGGGGTGCACGAATGT 7 EPO R Reverse GGGGGAGGGAGAGGGGCGGCTCATCTGTCCCCTGTCCTGC 8 IRES F Forward GCAGGACAGGGGACAGATGAGCCGCCCCTCTCCCTCCCCC 9 dhfr R Reverse AAGTTTAAACGCTAGCTTAGTCTTTCTTCTCGTA

The amount of dhfr expression and MTX sensitivity in the cell line constructed in Example 2

In order to confirm the effect of shRNA-2 on the cell group constructed in Example 2, the expression of dhfr protein in the cell and the sensitivity to MTX were measured and the expression of dhfr in the vector was confirmed.

[3-1] pcDNA5 / FRT vector, shRNA / pcDNA5frt vector, EID / pcDNA5frt vector, and shRNA / EID / pcDNA5frt

pcDNA5frt and the three kinds of vectors prepared in Examples 2-1 to 2-3 were transfected into Flp-In CHO cell line using lipofectamine 2000 (Invitrogen). At the time of transfection, each vector was transfected with a pOG44 vector expressing the Flp recombinase (ricombinase). After 24 hours, cells were transferred to medium supplemented with hygromycin B without HT supplement, cultured for 2 weeks, and cell groups were formed. (Fig. 3B) shRNA / EID / pcDNA5frt (Fig. 3B), which is a vector having genes including shRNA-2 and H1 promoter (Fig. 3a) and EID / pcDNA5frt vector (Fig. 3c) were labeled with shRNA (-) and shRNA Respectively.

[3-2] Identify intracellular dhfr protein levels

The amount of intracellular DHFR was confirmed by using FITC fluorescence-labeled MTX (Fluorescent methotrexate, F-MTX; Invitrogen) to confirm that shRNA-2 exhibits the same effect in the Flp-In system. DHFR is an essential enzyme in eukaryotic and prokaryotic cells and catalyzes NADPH-dependent reduction of dihydrofolate to tetrahydrofolate. MTX is a competitive inhibitor of dihydrofolate, which can bind DHFR instead of dihydrofolate. Therefore, when F-MTX is treated, fluorescent F-MTX binds to DHFR, so that the degree of expression of DHFR can be indirectly confirmed through fluorescence intensity.

Treatment of F-MTX was performed by incubating the adhered cells in a medium containing 10 μM F-MTX for 24 hours at 37 ° C. After 24 hours, the cells were exchanged for media containing no F-MTX. After 2 hours, the fluorescence values of the cells were analyzed by FITC fluorescence using Guava Easy Cyte apparatus.

As a result, the expression level of the dhfr protein was found to be 80% lower than that of the shRNA (+) (vector of FIG. 3B) cells compared to shRNA (-) (vector of FIG. 3A) via F-MTX (FIGS. 4A and 4B) . This was confirmed to be similar to the introduction of the pSUPER vector into the CHO-K1 cell line in Example 1 (Fig. 2).

These results indicate that the expression of dhfr in the cells is significantly reduced as in the pSUPER vector even when the shRNA-2 sequence is applied to the Flp-In system.

[3-3] Sensitivity of cells to MTX

MTX is known as an inhibitor that inhibits the activity of DHFR. When shRNA-2, which inhibits the expression of DHFR according to the present invention, is transduced, the expression of DHFR in the cell is decreased by the action of shRNA-2, The sensitivity to MTX is also expected to increase as the expression of essential DHFR decreases. Specifically, in order to measure the sensitivity of the cells to MTX of the shRNA (+) (vector of FIG. 3B) cell group prepared in Example 2, the cell growth with increasing MTX concentration was compared with the shRNA (-) of Example 2 Vector) cells. MTX was treated with each concentration, and the number of cells after 4 days was compared with the number of MTX - untreated cells.

As a result, it was confirmed that the sensitivity of the cells to MTX was about five times as sensitive as that of the shRNA (-) cell group (Fig. 5).

From the above results, it was found that the shRNA (+) cell group was highly sensitive to MTX, and DHFR deficiency status was effectively achieved.

[3-4] Whether shRNA-2 affects the exogenous dhfr gene in the cell line transfected with the shRNA / EID / pcDNA5frt vector prepared in Example 2

Reverse transcription-polymerase chain reaction (RT-PCR) was performed to determine whether shRNA-2 affects the exogenous dhfr gene. Preparation of RNA and cDNA for performing RT-PCR was the same as described in Example 1 above. RT-PCR was performed using Ex Taq DNA polymerase (Takara) and the primers shown in Table 3 below. The intracellular dhfr sequence is derived from CHO cells and shRNA / EID / pcDNA5frt The dhfr sequence inserted into the vector is almost the same as that derived from the mouse, but the portion of the nucleotide sequence that differs from the CHO cell-derived dhfr (SEQ ID NO: 28) and the mouse-derived dhfr (SEQ ID NO: 29) Primers were prepared and PCR was performed for each primer. Specifically, the primers Endo-dhfr-F (SEQ ID NO: 10) and Endo-dhfr-R (SEQ ID NO: 11) in Table 4 were used to amplify dhfr (endogenous) derived from CHO cells, and mouse-derived dhfr Exo-dhfr-F (SEQ ID NO: 12) and Exo-dhfr-R (SEQ ID NO: 13) in Table 4 below were used for amplification. In order to confirm the expression of 3'-UTR of CHO cell-derived dhfr (endogenous), 3'-UTR was amplified and the 3'-UTR-F (SEQ ID NO: 14) and 3'- UTR-R (SEQ ID NO: 15) was used. The primers ActB-F (SEQ ID NO: 16) and ActB-R (SEQ ID NO: 17) shown in Table 4 below were used to amplify beta-actin. Were used.

SEQ ID NO: Name of sequence Primer direction The sequence (5 '- > 3') 10 Endo-DHFR-F Forward GATTTTCCCTGGCCAATG 11 Endo-DHFR-R Reverse CCACTTTATCTGCTAACTCTGGTTG 12 Exo-DHFr-F Forward GACCTACCCTGGCCTCCG 13 Exo-dhfr-R Reverse CTACTTTACTTGCCAATTCCGGTTG 14 3'-UTR-F Forward CAAGACCATGGGACTTGT 15 3'-UTR-R Reverse GCCACTTGAGGCTGCATG 16 ActB-F Forward CATTCAGGCTGTGCTGTCC 17 ActB-R Reverse GCCATCTCCTGCTCGAAG

 As a result of RT-PCR, mRNA levels of intracellular dhfr and dhfr 3'-UTR genes were decreased by shRNA-2, but the expression of exogenous dhfr gene contained in the vector was constant regardless of presence or absence of shRNA-2 (Fig. 6).

From the above results, the introduced shRNA-2 showed an inhibitory effect on the dhfr regulated by the dhfr 3'-UTR in the cell, but the exogenous dhfr was not regulated by the 3'-UTR , It was found that the same amount of expression was expressed regardless of the presence or absence of shRNA-2.

Analysis of amplification efficiency and EPO expression enhancement of exogenous amplified gene

The cell lines constructed in Example 2 were treated with MTX in a stepwise manner to amplify the gene and the production amount per unit cell of the target protein EPO was confirmed. MTX at concentrations of 50, 250, and 500 nM was added to Flp-In CHO cell line selected by hygromycin B after transfection of two kinds of vector EID / pcDNA5frt and shRNA / EID / pcDNA5frt (FIGS. 3c and 3d respectively) Lt; / RTI > Three different cell groups were formed for each concentration. For each increase in MTX concentration, MTX was used to amplify MTX by treating the cells with 2-3 times of subculture after waiting for the formation of colonies. To measure their EPO production, the cells were cultured on a plate at a concentration of 1 × 10 ⁵ cells / ml. After 4 days, the culture medium was collected and the number of cells was measured. After centrifugation, the supernatant was stored at 20 ° C and the amount of EPO was measured by enzyme-linked immunosorbent assay (ELISA). Enzyme-linked immunoassays were performed using the Quantikine IVD ELISA kit (R & D Systems) and performed according to the manufacturer's instructions.

As a result, it was confirmed that the EPO production amount in the shRNA expression cell line (shRNA / EID / pcDNA5frt vector introduction cell line) was increased at a high rate according to the gene amplification, compared with the shRNA-free cell line (EID / pcDNA5frt vector introduction cell line) It was confirmed that the production per unit cell of EPO was 2.5 times higher in the final 500 nM MTX (Fig. 7).

From these results, shRNAs inhibiting the expression of endogenous amplifiable genes; In the case of using a vector system comprising constructs containing an exogenous amplifiable gene and a target protein gene, it is possible to produce a cell state deficient in the amplifiable gene, while simultaneously producing a mutant lacking the amplifiable gene It was found that the expression of the protein can be efficiently induced.

Determination of mRNA quantity and gene copy number

The mRNA level and the gene copy number of the intracellular dhfr-related gene of the cell lines constructed in Example 4 were examined.

[5-1] Check the amount of mRNA

CDNA was synthesized using the RNA extracted from each cell in order to measure mRNA expression level by using the same method as in Example 1. The synthesized cDNA was used as a sample for qPCR, and dhfr-F and dhfr-R (SEQ ID NOs: 18 and 19), 3 (SEQ ID NOS: 20 and 21), gapdh-F and gapdh-R (SEQ ID NOS: 22 and 23), ActB-F and ActB-R Respectively.

SEQ ID NO: Name of sequence Primer direction The sequence (5 '- > 3') 18 dhfr-F Forward CAGGCCACCTCAGACTCTTTG 19 dHFr-R Reverse TGGGAAAAACGTGTCACTTTCA 20 3'-UTR-F Forward GGGATAGTTAGGAAGATGTATTTGTTTTG 21 3'-UTR-R Reverse AACAGTTGCCCAGGATGCA 22 gapDH-F Forward CATGGCCTTCCGTGTTCCTA 23 gapDH-R Reverse CAGGCGACATGTCAGATCCA 24 ActB-F Forward CTGGACTTCGAGCAGGAGATG 25 ActB-R Reverse CATAGCTCTTCTCCAGGGAGGAA

qPCR was performed using Power SYBR Green PCR Master mix (Applied Biosystems) and according to the manufacturer's instructions. PCR was carried out 40 times at 95 ° C for 10 min, 95 ° C for 15 sec and 60 ° C for 1 min. The genes were amplified and the relative gene expression level was determined using the comparative Ct (ΔΔCt) method Respectively.

[5-2] Identification of gene copy number

Genomic DNA was extracted from each cell using MiniBEST Universal Genomic DNA extraction kit (Takara) and used as a sample for qPCR. The mRNA expression level and gene copy number of the entire dhfr gene, i.e., intracellular dhfr and exogenous dhfr, were confirmed using dhfr-F (SEQ ID NO: 18) and dhfr-R 'UTR-F (SEQ ID NO: 20) and 3'-UTR-R (SEQ ID NO: 21) were used to confirm the mRNA expression level and gene copy number of the 3'-UTR gene in the intracellular dhfr gene. gapdh and beta-actin were used as internal standard genes for mRNA expression and gene copy number, respectively. qPCR was performed using Power SYBR Green PCR Master mix (Applied Biosystems) and according to the manufacturer's instructions. PCR was carried out 40 times at 95 ° C for 10 min, 95 ° C for 15 sec and 60 ° C for 1 min. The genes were amplified and the relative gene expression level was determined using the comparative Ct (ΔΔCt) method Respectively.

In the examples 5-1 and 5-2, the expression of dhfr mRNA was significantly increased in the shRNA (+) cell group by MTX-induced gene amplification, but the shRNA (-) cell group showed a large change (Fig. 8A). and the number of dhfr gene copies was significantly different depending on the presence or absence of shRNA (FIG. 8B). It was confirmed that mRNA expression level of intracellular dhfr 3'-UTR gene was greatly reduced by shRNA (FIG. 8c), but it was confirmed that the copy number of intracellular dhfr 3'-UTR gene was the same regardless of shRNA (Fig. 8D).

From the above results, in the case of the cell line into which the shRNA, the exogenous amplifiable gene and the gene of the target protein are introduced, the mRNA expression amount and the gene copy number of dhfr increase with increasing MTX treatment concentration, but the exogenous amplifiable gene and target In the case of the cell line into which only the protein gene was introduced, the effect of amplification of dhfr by MTX was not observed. In addition, it was found that, in the case of the cell line into which the shRNA was introduced, mRNA expression amount of the dhfr 3'-UTR gene was affected by the amount of mRNA expression, but it did not affect the gene copy number of dhfr 3'-UTR .

While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is to be understood that the scope of the invention is not limited to the disclosed exemplary embodiments. It will be possible to change it appropriately.

<110> Korea Research Institute Bioscience and Biotechnology <120> Expression Vector for Producing Target Protein and Producing          Method of Target Protein Using the Same <130> 2015-DPA-1091 <160> 29 <170> Kopatentin 2.0 <210> 1 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> shRNA-1 <400> 1 cugauugacu ucaacuucu 19 <210> 2 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> shRNA-2 <400> 2 uguguuggcu uuagaucua 19 <210> 3 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> shRNA-3 <400> 3 gauaguuagg aagauguau 19 <210> 4 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> pD5-shRNA F <400> 4 gacggatcgg gagatctgaa ttcgaacgct gacgt 35 <210> 5 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> pD5-shRNA R <400> 5 aggggatcgg gagatctaac agctatgacc atgat 35 <210> 6 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> EPO F <400> 6 acccaagctg gctagcgcca ccatgggggt gcacgaatgt 40 <210> 7 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> EPO R <400> 7 gggggaggga gaggggcggc tcatctgtcc cctgtcctgc 40 <210> 8 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> IRES F <400> 8 gcaggacagg ggacagatga gccgcccctc tccctccccc 40 <210> 9 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> dhfr R <400> 9 aagtttaaac gctagcttag tctttcttct cgta 34 <210> 10 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Endo-dhfr-F <400> 10 gattttccct ggccaatg 18 <210> 11 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Endo-DHFR-R <400> 11 ccactttatc tgctaactct ggttg 25 <210> 12 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Exo-dhfr-F <400> 12 gacctaccct ggcctccg 18 <210> 13 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Exo-dhfr-R <400> 13 ctactttact tgccaattcc ggttg 25 <210> 14 <211> 18 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > 3 prime-UTR-F <400> 14 caagaccatg ggacttgt 18 <210> 15 <211> 18 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > 3 prime-UTR-R <400> 15 gccacttgag gctgcatg 18 <210> 16 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> ActB-F <400> 16 cattcaggct gtgctgtcc 19 <210> 17 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> ActB-R <400> 17 gccatctcct gctcgaag 18 <210> 18 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> dhfr-F <400> 18 caggccacct cagactcttt g 21 <210> 19 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> dhfr-R <400> 19 tgggaaaaac gtgtcacttt ca 22 <210> 20 <211> 29 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > 3 prime-UTR-F <400> 20 gggatagtta ggaagatgta tttgttttg 29 <210> 21 <211> 19 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > 3 prime-UTR-R <400> 21 aacagttgcc caggatgca 19 <210> 22 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> gapDH-F <400> 22 catggccttc cgtgttccta 20 <210> 23 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> gapDH-R <400> 23 caggcgacat gtcagatcca 20 <210> 24 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> ActB-F <400> 24 ctggacttcg agcaggagat g 21 <210> 25 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> ActB-R <400> 25 catagctctt ctccagggag gaa 23 <210> 26 <211> 193 <212> PRT <213> Artificial Sequence <220> <223> EPO <400> 26 Met Gly Val His Glu Cys Pro Ala Trp Leu Trp Leu Leu Leu Ser Leu   1 5 10 15 Leu Ser Leu Pro Leu Gly Leu Pro Val Leu Gly Ala Pro Pro Arg Leu              20 25 30 Ile Cys Asp Ser Arg Val Leu Glu Arg Tyr Leu Leu Glu Ala Lys Glu          35 40 45 Ala Glu Asn Ile Thr Thr Gly Cys Ala Glu His Cys Ser Leu Asn Glu      50 55 60 Asn Ile Thr Val Asp Thr Lys Val Asn Phe Tyr Ala Trp Lys Arg  65 70 75 80 Met Glu Val Gly Gln Gln Ala Val Glu Val Trp Gln Gly Leu Ala Leu                  85 90 95 Leu Ser Glu Ala Val Leu Arg Gly Gln Ala Leu Leu Val Asn Ser Ser             100 105 110 Gln Pro Trp Glu Pro Leu Gln Leu His Val Asp Lys Ala Val Ser Gly         115 120 125 Leu Arg Ser Leu Thr Thr Leu Leu Arg Ala Leu Arg Ala Gln Lys Glu     130 135 140 Ala Ile Ser Pro Ala Ala Ala Pro Ala Ala Pro Thu Ile 145 150 155 160 Thr Ala Asp Thr Phe Arg Lys Leu Phe Arg Val Tyr Ser Asn Phe Leu                 165 170 175 Arg Gly Lys Leu Lys Leu Tyr Thr Gly Glu Ala Cys Arg Thr Gly Asp             180 185 190 Arg     <210> 27 <211> 582 <212> DNA <213> Artificial Sequence <220> <223> EPO <400> 27 atgggggtgc acgaatgtcc tgcctggctg tggcttctcc tgtccctgct gtcgctccct 60 ctgggcctcc cagtcctggg cgccccacca cgcctcatct gtgacagccg agtcctggag 120 aggtacctct tggaggccaa ggaggccgag aatatcacga cgggctgtgc tgaacactgc 180 agcttgaatg agaatatcac tgtcccagac accaaagtta atttctatgc ctggaagagg 240 atggaggtcg ggcagcaggc cgtagaagtc tggcagggcc tggccctgct gtcggaagct 300 gtcctgcggg gccaggccct gttggtcaac tcttcccagc cgtgggagcc cctgcagctg 360 catgtggata aagccgtcag tggccttcgc agcctcacca ctctgcttcg ggctctgcga 420 gcccagaagg aagccatctc ccctccagat gcggcctcag ctgctccact ccgaacaatc 480 actgctgaca ctttccgcaa actcttccga gtctactcca atttcctccg gggaaagctg 540 aagctgtaca caggggaggc ctgcaggaca ggggacagat ga 582 <210> 28 <211> 564 <212> DNA <213> Artificial Sequence <220> <223> Chinese hamster dhfr <400> 28 atggttcgac cgctgaactg catcgtggcc gtgtcccaga atatgggcat cggcaagaac 60 ggagattttc cctggccaat gctcaggaac gaattcaagt acttccaaag aatgaccacc 120 acctcctcag tggaaggtaa acagaacttg gtgattatgg gccggaaaac ttggttctcc 180 attcctgaga agaatcgacc tttaaaggac agaattaata tagttctcag tagagagctc 240 aaggaaccac cacaaggagc tcattttctt gccaaaagtc tggacgatgc cttaaaactt 300 attgaacaac cagagttagc agataaagtg gacatggttt ggatagttgg aggcagttcc 360 gtttacaagg aagccatgaa tcagccaggc catctcagac tctttgtgac aaggatcatg 420 caggaatttg aaactgacac gttcttccca gaaattgatt tggagaaata taaacttctc 480 ccagagtacc caagggtcct tcctgaagtc caagaggaaa aaggcatcaa gtataaattt 540 gaagtctatg agaagaaagg ctaa 564 <210> 29 <211> 564 <212> DNA <213> Artificial Sequence <220> <223> Mouse dhfr <400> 29 atggttcgac cattgaactg catcgtcgcc gtgtcccaaa atatggggat tggcaagaac 60 ggagacctac cctggcctcc gctcaggaac gagttcaagt acttccaaag aatgaccaca 120 acctcttcag tggaaggtaa acagaatctg gtgattatgg gtaggaaaac ctggttctcc 180 attcctgaga agaatcgacc tttaaaggac agaattaata tagttctcag tagagaactc 240 aaagaaccac cacgaggagc tcattttctt gccaaaagtt tggatgatgc cttaagactt 300 attgaacaac cggaattggc aagtaaagta gacatggttt ggatagtcgg aggcagttct 360 gtttaccagg aagccatgaa tcaaccaggc cacctcagac tctttgtgac aaggatcatg 420 caggaatttg aaagtgacac gtttttccca gaaattgatt tggggaaata taaacttctc 480 ccagaatacc caggcgtcct ctctgaggtc caggaggaaa aaggcatcaa gtataagttt 540 gaagtctacg agaagaaaga ctaa 564

Claims (13)

A gene fragment for RNA interference targeting 3'-UTR of the mRNA of an endogenous amplifiable gene of a host cell; And
A gene construct containing a cloning site and an exogenous amplifiable gene capable of cloning a gene of a target protein;
Lt; RTI ID = 0.0 &gt; a &lt; / RTI &gt; target protein. The method according to claim 1,
The amplifiable gene may be selected from the group consisting of dihydrofolate reductase (DHFR), glutamine synthetase (GS), adenosine deaminase (ADA), aspartate transcarbamylase ) And ornithine decarboxylase (ODC). &Lt; / RTI &gt; The method according to claim 1,
The gene fragment for RNA interference is a sequence complementary to the 3'-UTR of the mRNA of the amplifiable gene, which is a base sequence that reduces the expression of the amplifiable gene. The method according to claim 1,
Wherein the gene fragment for the RNA interference is a short hairpin RNA (shRNA) comprising the nucleotide sequence of SEQ ID NO: 2 or SEQ ID NO: 3. The method according to claim 1,
Wherein said gene construct comprises a promoter capable of initiating expression of an internal ribosome entry site (IRES), a nucleotide sequence encoding 2A peptide, and an exogenous amplifiable gene between said cloning site and said exogenous amplifiable gene An expression vector containing any one selected. The method of claim 5,
Promoters capable of initiating expression of the exogenous amplifiable gene include the promoter of Simian Virus 40, the mouse mammary tumor virus LTR promoter, the cytomegalovirus Pol-II promoter, the herpes thymidine kinase promoter and the phosphoglycerate kinase I (PGK) Wherein the expression vector is any one selected from the group consisting of promoters. The method according to claim 1,
Wherein said host cell is a mammalian cell. The method of claim 7,
The mammalian cells may be selected from the group consisting of COS cells, CHO cells, VERO cells, MDCK cells, WI38 cells, V79 cells, B14AF28-G3 cells, BHK cells, HaK cells, NS0 cells, SP2 / 0- Ag14 cells, HeLa cells, HEK293 cells PER.C6 cells. A transformant comprising an expression vector according to any one of claims 1 to 8. Cloning a gene of the desired protein in the cloning site of the gene construct of the expression vector of claim 1;
Introducing an expression vector in which a gene of the target protein is cloned into a host cell;
Culturing the host cell into which the expression vector has been introduced; And
Treating an inhibitor for a protein expressed by the amplifiable gene in the cultured host cell;
/ RTI &gt; of the target protein. The method of claim 10,
The host cells were COS cells, CHO cells, VERO cells, MDCK cells, WI38 cells, V79 cells, B14AF28-G3 cells, BHK cells, HaK cells, NS0 cells, SP2 / 0-Ag14 cells, HeLa cells, HEK293 cells and PER. C6 cells in a mammalian cell. The method of claim 10,
The protein expressed by the amplifiable gene and the inhibitor for the protein are dihydrofolate reductase (DHFR) and methotrexate (MTX); Glutamine synthetase (GS) and methionine sulfoximine (MSX); Adenosine deaminase (ADA) and deoxycoformycin (dCF); Aspartate transcarbamylase (CAD) and N-phosphonacetyl-L-aspartate (PALA); And an over-expression method of a target protein selected from the group consisting of a combination of ornithine decarboxylase (ODC) and? -Difluoromethyl-ornithine (DFMO) . The method of claim 12,
Wherein the protein expressed by the amplifiable gene and the inhibitor for the protein are dihydrofolate reductase (DHFR) and methotrexate (MTX), respectively.

Images