WO2018025826A1

WO2018025826A1 - Antibody fused with labeling protein

Info

Publication number: WO2018025826A1
Application number: PCT/JP2017/027791
Authority: WO
Inventors: 秀雄中野; 昭博森; 晃代加藤
Original assignee: 国立大学法人名古屋大学
Priority date: 2016-08-03
Filing date: 2017-08-01
Publication date: 2018-02-08
Also published as: JPWO2018025826A1

Abstract

The present invention addresses the problem of providing a novel antibody that has excellent properties inherent to antibodies and enables a labeling protein fused therewith to sufficiently function. Provided is an Fab antibody fused with a labeling protein, wherein one of a pair of peptides that constitute a leucine zipper is added to the C-terminus of the H-chain and the other of said pair is added to the C-terminus of the L-chain respectively and the labeling protein is attached to the H-chain and/or the L-chain via the peptide(s).

Description

Antibody fused with labeled protein

The present invention relates to an antibody fused with a labeled protein. Specifically, the present invention relates to a labeled protein fusion Fab antibody and its use. This application claims priority based on Japanese Patent Application No. 2016-152447 filed on August 3, 2016, the entire contents of which are incorporated by reference.

Antibody-enzyme fusions (enzyme-fused antibodies) are used for ELISA, Western blotting, cell staining, in vivo substance imaging, cancer treatment, and the like (Non-Patent Documents 1 to 5). Conventionally, enzyme modification of an antibody has been mainly carried out by chemical modification, but has the disadvantages that “the amount of enzyme to be modified cannot be quantitatively controlled” and “experiment of chemical modification is required”. As a solution to these disadvantages, an example in which an antibody in which an enzyme is genetically fused is prepared has been reported (Non-patent Documents 6 and 7), but most are related to scFv antibodies (single-chain Fv antibodies). In general, the interaction between the V region of the L chain and the H chain is weak, and it is often impossible to form a stable antigen-binding site, resulting in a decrease in antigen affinity or a sufficient enzymatic activity.

International Publication No. 2015/190262

An antibody fused with a labeled protein such as an enzyme can be used not only for various detection methods but also for medical applications such as diagnosis and treatment. However, a labeled protein fusion antibody having a sufficient function suitable for use in various applications has not been developed. Therefore, an object of the present invention is to provide a novel antibody that is excellent in the original characteristics of an antibody (that is, recognition of an antigen) and that the fused labeled protein exhibits a sufficient function.

As described above, although there have been attempts to genetically prepare an antibody fused with an enzyme, most of them have been related to scFv antibodies. There is a Fab antibody as another form of the antibody. Although there are reports that a labeled protein such as an enzyme is fused to the Fab antibody by a genetic engineering technique, the number is not large. In Non-Patent Document 6, which is one of the few reports, alkaline phosphatase (PhoA) is genetically fused to an anti-human tumor necrosis factor α (TNF) Fab antibody and produced in a secretory expression system of Escherichia coli. Furthermore, as a recent report, there is an example in which a divided nanoluciferase gene is fused to an anti-HER2 Fab antibody and expressed in Escherichia coli (Non-patent Document 9). The common point of these reports is that they use only one kind of antibody gene that is most manageable in each research environment. In the first place, Fab antibodies have been studied under conditions that can be stably produced in E. coli, and their versatility has not been shown. In recent years, it has become clear that secretory expression of Fab antibodies is very difficult, but Fab antibody expression technology with excellent versatility and practicality has not been realized. In fact, since Non-Patent Document 6 has been reported, there has been no report on a technique for fusing Fab antibodies and enzymes.

Fab antibodies have light chain and heavy chain interactions in their constant regions (CL and CH1), which makes them more stable than scFv and can be used for a short time when newly prepared from B cells. (Non-patent Document 8). On the other hand, Fab formation efficiency differs depending on the type of antibody, and a desired activity may not be obtained. When preparing a Fab antibody in E. coli, the association between molecules is not successful, and an antibody exhibiting activity may not be obtained. In addition, in our research group, by adding a leucine zipper (LZ) to Hc and Lc of Fab antibody, it is possible to efficiently fold in E. coli cell-free protein synthesis system and E. coli intracellular expression system. An antibody molecule is developed and named Zipbody (Patent Document 1 and Non-Patent Document 10).

In addition to focusing on the advantages of Fab antibodies (particularly in terms of stability), the present inventors considered the effectiveness of Zipbody and genetically fused a labeled protein (for example, an enzyme) to the C-terminus of Zipbody. It was thought that the presence of LZ could produce a Fab antibody-labeled protein fusion with a stable structure. Based on this idea, a detailed experiment was planned using the knowledge and experience accumulated so far, and a detailed study was conducted. As a result, it was found that the above-mentioned strategy is extremely effective, and a fusion antibody that can achieve both recognition of the antigen and expression of the function of the labeled protein at a high level can be obtained (see Examples described later). That is, the present inventors succeeded in providing labeled protein fusion antibodies that are extremely effective for various detection methods. One thing that should be noted is that the effects were demonstrated in both mouse-derived antibodies and rabbit-derived antibodies, and in a plurality of labeled proteins (specifically, GFP and luciferase), and high versatility was confirmed. is there. Also, during the study, important and interesting findings related to practicality were obtained. Furthermore, when another enzyme (alkaline phosphatase) was fused, the desired effect was obtained, confirming the high versatility.
The following invention is mainly based on the above results and considerations.
[1] One of a pair of peptides constituting a leucine zipper is added to the end of the H chain, and the other is added to the C terminus of the L chain,
A labeled protein is linked to the H chain and / or the L chain via the peptide,
Labeled protein fusion Fab antibody.
[2] The labeled protein fusion Fab antibody according to [1], wherein the labeled protein is linked only to the H chain.
[3] The labeled protein fusion Fab antibody according to [1] or [2], wherein the labeled protein is a fluorescent protein or a luminescent enzyme.
[4] The labeled protein-fused Fab antibody according to [3], wherein the fluorescent protein is GFP and the luminescent enzyme is luciferase.
[5] A peptide tag consisting of an amino acid sequence of SK, SKX, SKXX, AKXX or KKXX (where X represents any amino acid residue) is linked to the N-terminus of the H chain and L chain, respectively. [1] The labeled protein-fused Fab antibody according to any one of [4].
[6] The labeled protein-fused Fab antibody according to any one of [1] to [5], which is refolded.
[7] The labeled protein-fused Fab antibody according to any one of [1] to [5], which is synthesized in the cytoplasm of E. coli.
[8] A detection reagent comprising the labeled protein-fused Fab antibody according to any one of [1] to [7].
[9] A detection kit comprising the detection reagent according to [8].
[10] The following steps:
(A) co-expressing antibody H chain gene encoding VH region and CH1 region and antibody L chain gene encoding VL region and CL region, or (B) antibody H chain encoding VH region and CH1 region A gene and an antibody L chain gene encoding a VL region and a CL region, respectively, and then mixing the expression product,
Including
Of the pair of peptides constituting the leucine zipper, the first tag sequence encoding one of them is at the 3 ′ end of the antibody H chain gene, and the second tag sequence encoding the other is at the 3 ′ end of the antibody L chain gene. Each has been added,
A labeled protein gene is linked to the antibody H chain gene and / or the antibody L chain gene via the first or second tag sequence,
Preparation method of labeled protein fusion Fab antibody.
[11] The preparation method according to [10], wherein the marker protein gene is linked only to the antibody H chain gene.
[12] The preparation method according to [10] or [11], wherein the step is performed using an expression system using a host cell or a cell-free protein synthesis system.
[13] The expression system is an expression system using E. coli, and an amino acid sequence of SK, SKX, SKXX, AKXX or KKXX is provided at the 5 ′ end side of the antibody H chain gene and the antibody L chain gene (provided that , X represents an arbitrary amino acid residue), and a sequence encoding a peptide tag is added,
The preparation method according to [12], wherein the labeled protein fusion Fab antibody is expressed as a tagged protein in which the peptide tag is linked to the N-terminus.
[14] The preparation method according to [13], wherein the peptide tag consists of an amino acid sequence of SKI, SKIK, SKKK, SKII, AKIK, AKII or KKKK.
[15] A protease recognition sequence is interposed between the sequence encoding the peptide tag and the antibody H chain gene, and between the sequence encoding the peptide tag and the antibody L chain gene, [13] or [14 ] The preparation method as described in.
[16] The preparation method according to any one of [13] to [15], wherein the expression system using E. coli is an expression system using a T7 promoter or an expression system using a low-temperature expression promoter.
[17] The preparation method according to any one of [13] to [15], wherein the expression system using E. coli is a cell-free protein synthesis system using E. coli-derived components.
[18] The preparation method according to any one of [10] to [17], wherein the antibody H chain gene and the antibody L chain gene are prepared by the following steps (i) to (viii):
(i) providing mRNA derived from a single B cell;
(ii) preparing cDNA by reverse transcription PCR using the mRNA as a template;
(iii) PCR is performed using a primer set consisting of multiple primers containing the same third tag sequence at the 5 ′ end and capable of amplifying the antibody H chain gene encoding the VH region and CH1 region, and using the cDNA as a template. Step to do;
(iv) PCR is performed using a primer set consisting of multiple primers containing the same fourth tag sequence at the 5 'end and capable of amplifying the antibody L chain gene encoding the VL region and CL region, and using the cDNA as a template Step to do;
(v) performing PCR using a single primer containing the third tag sequence and using the amplification product of step (iii) as a template;
(vi) performing PCR using a single primer containing the fourth tag sequence and using the amplification product of step (iv) as a template;
(vii) adding the first tag sequence to the antibody heavy chain gene that is the amplification product of step (v);
(viii) A step of adding the second tag sequence to the antibody L chain gene that is the amplification product of step (vi).
[19] The preparation method according to any one of [10] to [17], wherein the antibody H chain gene and the antibody L chain gene are prepared by the following steps (I) to (IV):
(I) providing mRNA derived from a single B cell;
(II) preparing cDNA by reverse transcription PCR using the mRNA as a template;
(III) amplifying the antibody H chain gene by a nested PCR method using the cDNA as a template,
(IV) Amplifying the antibody L chain gene by a nested PCR method using the cDNA as a template.
[20] a promoter;
A first cloning site for a gene encoding one of the antibody chains constituting the Fab antibody;
A first leucine zipper sequence encoding one of a pair of leucine zipper peptides;
A second cloning site for a gene encoding the other antibody chain constituting the Fab antibody;
A second leucine zipper sequence encoding the other of the pair of leucine zipper peptides, and
A sequence encoding a labeled protein is arranged downstream of the first leucine zipper sequence and / or the second leucine zipper sequence.
Vector for preparing labeled protein fusion Fab antibody.
[21] The promoter is a promoter that functions in E. coli,
The vector according to [20], wherein a ribosome binding site is disposed between the promoter and the first cloning site.
[22] Immediately before the first cloning site and immediately before the second cloning site,
A sequence encoding a peptide tag consisting of an amino acid sequence of SK, SKX, SKXX, AKXX or KKXX (X represents an arbitrary amino acid residue) arranged immediately after the initiation codon is arranged. The vector according to [20] or [21].
[23] a promoter;
A first antibody gene encoding one of the antibody chains constituting the Fab antibody;
A first leucine zipper sequence encoding one of a pair of leucine zipper peptides;
A second antibody gene encoding the other antibody chain constituting the Fab antibody;
A second leucine zipper sequence encoding the other of the pair of leucine zipper peptides, and
A sequence encoding a labeled protein is arranged downstream of the first leucine zipper sequence and / or the second leucine zipper sequence.
Vector for preparing labeled protein fusion Fab antibody.
[24] The promoter is a promoter that functions in E. coli,
The vector according to [23], wherein a ribosome binding site is arranged between the promoter and the first antibody gene.
[25] Immediately before the first antibody gene and immediately before the second antibody gene,
A sequence encoding a peptide tag consisting of an amino acid sequence of SK, SKX, SKXX, AKXX or KKXX (X represents an arbitrary amino acid residue) arranged immediately after the initiation codon is arranged. The vector according to [23] or [24].
[26] a promoter;
A first cloning site for a gene encoding one of the antibody chains constituting the Fab antibody;
A first vector having a first leucine zipper sequence encoding one of a pair of leucine zipper peptides;
A promoter,
A second cloning site for a gene encoding one of the antibody chains constituting the Fab antibody;
A second vector having a second leucine zipper sequence encoding the other of the pair of leucine zipper peptides,
A sequence encoding a labeled protein is arranged downstream of the first leucine zipper sequence and / or the second leucine zipper sequence.
A vector set for preparing a labeled protein-fused Fab antibody.
[27] a promoter;
A first antibody gene encoding one of the antibody chains constituting the Fab antibody;
A first vector having a first leucine zipper sequence encoding one of a pair of leucine zipper peptides;
A promoter,
A second antibody gene encoding one of the antibody chains constituting the Fab antibody;
A second vector having a second leucine zipper sequence encoding the other of the pair of leucine zipper peptides,
A sequence encoding a labeled protein is arranged downstream of the first leucine zipper sequence and / or the second leucine zipper sequence.
A vector set for preparing a labeled protein-fused Fab antibody.

Zipbody, Zipbody-Luc and Zipbody-GFP structures. A leucine zipper (LZ) was fused to the C-terminus of Hc and Lc to facilitate the association of Hc and Lc. Luc and GFP were genetically fused to the C-terminus of Zipbody Hc. Comparison of a conventional ELISA using a secondary antibody and an ELISA using a Fab-fluorescent protein fusion. In conventional ELISA, a secondary antibody that recognizes the primary antibody is used, and an antigen is detected by a signal from the secondary antibody. In ELISA using a Fab-fluorescent protein fusion, fluorescence from the fluorescent protein is detected, and a secondary antibody is not required. Plasmid structure for expressing Zipbody-Luc and Zipbody-GFP. Plasmids were constructed to express mouse-derived anti-E. Coli O157 Fab antibody m6Fab, mouse-derived anti-E. Coli O157 Zipbody, and rabbit-derived anti-L. Monocytogenes Zipbody. Luc gene is m6Fab Hc (pET22 m6Fab Hc-Luc), m6Fab LZ Hc (pET22 m6Fab LZ Hc-Luc), m6Fab LZ Lc (pET22 m6Fab LZ Lc-Luc), m6Fab Lc Hc (both m6Fab LZ W-Luc) and r4Fab LZ Hc (pET22 r4Fab LZ Hc-Luc). The GFP gene was fused to m6Fab LZ Hc (pET22 m6Fab LZ Hc-GFP) and r4Fab LZ Hc (pET22 r4Fab LZ Hc-GFP). The sequence of pET22 m6Fab LZ Hc-Luc is SEQ ID NO.1, the sequence of pET22 r4Fab LZ Hc-Luc is SEQ ID NO.2, the sequence of pET22 m6Fab LZ Hc-GFP is SEQ ID NO.3, and pET22 r4Fab LZ Hc-GFP. Is shown in SEQ ID NO: 4. Selection of host for expression of Zipbody-fluorescent protein fusion. By Western blotting (A) and ELISA (B), the binding affinity and expression of m6Fab LZ were expressed in E. coli SHuffle (registered trademark) T7 express, E. coli BL21 (DE3) pLysS and E. coli Rosetta-gamiTM 2 (DE3 ). S T7 E: E. coli SHuffle (registered trademark) T7 express, BL21: E. coli BL21 (DE3) pLysS, RG2: E. coli Rosetta-gamiTM 2 (DE3), LZ: m6Fab LZ, V: pET22b, S: Soluble fraction, I: Insoluble fraction. Western blotting of Zipbody-Luc and Zipbody-GFP. After SDS-PAGE of the soluble fraction containing each fusion protein, it was transferred to a nitrocellulose membrane. In order to detect Hc (including HA tag) of each fusion protein, an HRP-labeled anti-HA antibody was used. On the other hand, in order to detect Lc (including Flag tag) of each fusion protein, an HRP-labeled anti-Flag antibody was used. Zipbody-Luc Luc activity. The Luc activity of each fusion protein was evaluated. Average values of three experiments are shown. The bar in the graph represents standard error (S.E.). ELISA using anti-E.coli-O157-Zipbody-Luc or anti-E.coli-O157-Zipbody-GFP. The affinity of each fusion protein for E.coli O157 was evaluated. Average values of three experiments are shown. The bar in the graph represents standard error (S.E.). Luminescent ELISA using anti-E. Coli O157 Zipbody-Luc. An immunoassay was performed using the Luc molecule of the fusion protein. Average values of three experiments are shown. The bar in the graph represents standard error (S.E.). ELISA using anti-L. Monocytogenes Zipbody-Luc or anti-L. Monocytogenes Zipbody-GFP. The affinity of each fusion protein for L. monocytogenes was evaluated. Average values of three experiments are shown. The bar in the graph represents standard error (S.E.). Luminescent ELISA using anti-L. Monocytogenes Zipbody-Luc. An immunoassay was performed using the Luc molecule of the fusion protein. Average values of three experiments are shown. The bar in the graph represents standard error (S.E.). Zipbody-GFP fluorescence. The GFP activity of each soluble fusion protein was evaluated. Average values of three experiments are shown. The bar in the graph represents standard error (S.E.). Fluorescence ELISA using Zipbody-GFP. An immunoassay using the GFP molecule of the fusion protein was performed. (A) Anti-E. Coli O157, (B) Anti-L.Lmonocytogenes. Average values of three experiments are shown. The bar in the graph represents standard error (S.E.). A list of primers. Bold letters indicate homologous sequences with the plasmid. Results of fluorescence ELISA. SDS-PAGE analysis of SKIK m6FabLZ-AP expression product. M: size marker. Arrows indicate the desired size (30 kDa [light chain] and 80 kDa [heavy chain-AP fusion]). A) cell lysate S: soluble fraction, I: insoluble fraction. B) Purified fraction by Ni-NTA chromatography and gel filtration. B is a fraction collected by Ni-NTA chromatography. 9 to 12 are fractions collected by gel filtration chromatography. Evaluation of purified SKIK m6FabLZ-AP. A) AP activity. B) ELISA. C) AP-ELISA.

1. Labeled Protein Fusion Fab Antibody The first aspect of the present invention relates to a labeled protein fusion Fab antibody (hereinafter, sometimes referred to as “the antibody of the present invention” for convenience of explanation). The labeled protein-fused Fab antibody is a Fab antibody fused with a labeled protein, and has a function as an antibody that specifically recognizes a specific antigen, and also has a function of the labeled protein (in the case of an enzyme, a specific protein). Enzyme activity of catalyzing the reaction). The Fab antibody is a fragment antibody composed of an H chain having a VH region and a CH1 region and an L chain having a VL region and a CL region, and does not contain an Fc region. In the following description, the H chain constituting the Fab antibody may be referred to as Hc and the gene encoding it may be referred to as the Hc gene, respectively, according to common practice. Similarly, the L chain constituting the Fab antibody may be referred to as Lc, and the gene encoding it may be referred to as Lc gene.

The antibody of the present invention contains a leucine zipper as part of its structure. Leucine zippers are used to improve the rate of Fab antibody formation. By adding a leucine zipper, the binding force unique to the leucine zipper assists the association of Hc and Lc, and the Fab formation efficiency is improved. On the other hand, stabilization of the structure of the Fab antibody can be expected by using a leucine zipper. Stabilization of the structure leads to improvement of antigen recognition ability or specificity.

Leucine zipper is a characteristic structure found as a secondary structure motif of proteins (Science. 1988 Jun 24; 240 (4860): 1759-64.). The leucine zipper has a basic skeleton in which 4 to 5 leucine residues are arranged every 7 in an amino acid sequence that tends to have an α-helix structure. By this skeleton, leucine residues are arranged in almost one row in the α-helix axis direction, and are hydrophobically linked to the leucine residue sequence in another leucine zipper structure. In the present invention, a pair of peptides (referred to as leucine zipper peptide A and leucine zipper peptide B) containing such a characteristic motif is used. Leucine zipper peptide A and leucine zipper peptide B have high affinity and form leucine zippers. Leucine zipper peptide A contains leucine every 7 residues so that a leucine zipper can be formed. Similarly, leucine zipper peptide B contains leucine every 7 residues. These leucines are arranged so as to correspond to leucine in leucine zipper peptide A (those constituting leucine zipper motif). The length of leucine zipper peptide A and leucine zipper peptide B is not particularly limited, but if it is too short, the desired effect, i.e., the binding force due to the leucine zipper structure, cannot be fully exerted, and if it is too long, the length of Hc and Lc may be reduced due to steric hindrance, etc. May affect association and antibody binding (antigen recognition). Therefore, the length of leucine zipper peptide A and leucine zipper peptide B is, for example, 25 to 50 residues, preferably 28 to 35 residues. The lengths of leucine zipper peptide A and leucine zipper peptide B are basically the same, but may be different in length as long as a leucine zipper structure can be formed.

Various configurations of leucine zippers can be used. Preferably, leucine zippers that exert binding force by electrostatic interaction between positively charged amino acids and negatively charged amino acids in addition to hydrophobic bonds between leucine and leucine are adopted. To do. Such leucine zippers (referred to as “charged leucine zippers” for convenience of description) exhibit high binding forces. When a charge-holding leucine zipper is used, leucine zipper peptide A and leucine zipper peptide B have the following structural features (a) or (b).
(a) Leucine zipper peptide A contains a positively charged amino acid (basic amino acid). Leucine zipper peptide B contains a negatively charged amino acid (acidic amino acid) at a position corresponding to the positively charged amino acid of leucine zipper peptide A.
(b) Leucine zipper peptide A contains an acidic amino acid. Leucine zipper peptide B contains a basic amino acid at a position corresponding to the acidic amino acid of leucine zipper peptide A.

Examples of basic amino acids are lysine (K), arginine (R), and histidine (H). Among these, K or R may be selected for reasons of charge strength. Similarly, examples of acidic amino acids are aspartic acid (D) and glutamic acid (E). Increasing the number of charged amino acids in the leucine zipper peptide increases the electrostatic interaction, which can be expected to improve the binding power of the leucine zipper. Therefore, the proportion of charged amino acids in the leucine zipper peptide is, for example, 15% to 50%, preferably 20% to 40%.

1993 O'shea et al. Designed peptides called ACID-p1 (LZA) and BASE-p2 (LZB) with modified GCN4 leucine zipper (Oshea, EK, KJ Lumb, and PS Kim, 1993, PEPTIDE VELCRO -DESIGN OF A HETERODIMERIC COILED-COIL: Current Biology, v. 3, p. 658-667.). LZA and LZB are not affected by physical conditions such as pH, ionic strength, and temperature, and form heterodimers with high specificity and affinity (Kd = 3 × 10 ^-8 M). LZA and LZB can be used as a pair of leucine zipper peptides rich in charged amino acids. The sequences of LZA and LZB are shown below.
(1) LZA (Leucine zipper peptide that retains negative charge)
AQLEKELQALEKENAQLEWELQALEKELAQK (SEQ ID NO: 5)
Note that glutamic acid (E) is arranged at the 4th, 6th, 11th, 13th, 18th, 20th, 25th, and 27th positions for electrostatic interaction.
(2) LZB (Leucine zipper peptide that retains positive charge)
AQLKKKLQALKKKNAQLKWKLQALKKKLAQK (SEQ ID NO: 6)
For electrostatic interaction, lysine (K) is arranged at the 4th, 6th, 11th, 13th, 18th, 20th, 25th, and 27th positions.

In the antibody of the present invention, one of a pair of peptides constituting a leucine zipper (leucine zipper peptide A) is added in a state linked to the C terminus of the H chain (Hc), that is, CH1, and the other (leucine zipper peptide B) is added in a state of being linked to the C terminus of the L chain (Lc), that is, CL. Thus, the antibody of the present invention is a Fab antibody in which a leucine zipper is added to the C-terminal, that is, the constant region side. The antibody exhibits specific binding properties depending on the variable region, with the leucine zipper added. The leucine zipper peptide is linked to the H chain and L chain directly or via a linker sequence. By using the linker, the Fab antibody portion and the leucine zipper are linked with appropriate flexibility, and it is possible to improve the association efficiency of Hc and Lc and the formation efficiency of the leucine zipper structure. For example, a peptide linker is used as the linker. A peptide linker is a linker consisting of a peptide in which amino acids are linked in a straight chain. A typical example of a peptide linker is a linker composed of glycine and serine (GGS linker or GS linker). A GGS linker consists of a sequence in which GGS is repeated one to several times. The number of repetitions is not particularly limited, but is preferably 2 to 6 times, more preferably 2 to 4 times. On the other hand, the GS linker is a sequence in which GGGGS (SEQ ID NO: 7) is repeated one to several times. The GGS linker and glycine and serine, which are amino acids constituting the GS linker, have a small size per se and are difficult to form higher-order structures in the linker. Therefore, it is unlikely to become an obstacle during the association of Hc and Lc and the formation of the leucine zipper structure.

A labeled protein is linked to the H chain, L chain, or both via a leucine zipper peptide. Therefore, the antibody of the present invention can take the following three forms.
(1) H chain with a structure in which Hc, leucine zipper peptide and labeled protein are linked from the N-terminal side to the C-terminal side, and a structure in which Lc and leucine zipper peptide are linked from the N-terminal side to the C-terminal side Fab antibody containing L chain (2) H chain in which Hc and leucine zipper peptide are linked from N-terminal side to C-terminal side, and Lc, leucine zipper peptide and label from N-terminal side to C-terminal side Fab antibody containing L chain with protein structure (3) H chain with structure of Hc, leucine zipper peptide and labeled protein from N terminal side to C terminal side, and N terminal side to C terminal side Fab antibody containing L chain of Lc, leucine zipper peptide and labeled protein

The form (1) is particularly preferred because high expression efficiency and high antigen affinity were observed when the labeled protein was linked only to the H chain (see Examples below). In the case of (3), the labeled protein linked to the H chain and the labeled protein linked to the L chain may not be the same.

The labeled protein is not particularly limited. That is, various labeled proteins can be employed as a component of the antibody of the present invention. A labeled protein is a protein whose label is its own luminescence or fluorescence, or an enzyme reaction product. Antibodies fused with labeled proteins are (1) detection and measurement of specific antigens (qualitative or quantitative), (2) labeling, staining or visualization of cells, tissues or organs / organs (eg in vivo imaging), Used for treatment. Examples of labeled proteins include GFP (green fluorescent protein), EGFP, GFP2, ECFP, EBFP, YFP, mBanana, mOrange, DsRed2, mStrawberry, mCherry, mRasberry, mPlum, Kaede, and other fluorescent proteins, luciferase (Luc), nano Luminescent enzymes such as lanthanum, peroxidase (for example, HRP), alkaline phosphatase, β-galactosidase, glucose oxidase, and hydrolase.

Proteins such as luciferase and GFP are widely used for monitoring gene translation control (Ghim CM, Lee SK, Takayama S, Mitchell RJ. 2010. The art of reporter proteins in science: past, present and future applications. Bmb Reports 43 (7): 451-460.). These proteins can be genetically fused to the protein to be monitored and their behavior detected as a luminescent signal. Luciferase is a general term for enzymes that generate luminescence by oxidizing a substrate (Hastings JW. 1996. Chemistries and colors of bioluminescent reactions: A review. Gene 173 (1): 5-11.). Known from a variety of species, including the common firefly Luciola cruciata, Heike firefly Luciola lateralis, North American firefly Photinus pyralis, Pennsylvania firefly Photuris pennsylvanica, click beetle Pyrophorus plagiophthalamus, It has been reported (Masuda T, Tatsumi H, Nakano E. 1989. Cloning and sequence-analysis of cdna for luciferase of a japanese firefly, Luciola cruciata. Gene 77 (2): 265-270 .; Tatsumi H , Kajiyama N, Nakano E. 1992. Molecular-cloning and expression in escherichia-coli of a cdna clone encoding luciferase of a firefly, luciola-lateralis. Biochimica Et Biophysica Acta 1131 (2) hornle 1165 J, Auldl DS. 2010. Illuminating Insights into Firefly Luciferase and Other Bioluminescent Reporters Used in Chemical B iology. Chemistry & Biology 17 (6): 646-657.). Luciferase from L. cruciata was first reported in 1989 as an enzyme that catalyzes the oxidation of luciferin in the presence of ATP and oxygen molecules (MasudasT, Tatsumi H, Nakano E. 1989. Cloning and sequence-analysis of cdna for luciferase of a japanese firefly, Luciola cruciata. Gene 77 (2): 265-270.). Mutant Thr217Ile is known to have improved heat resistance (Kajiyama N, Nakano E. 1993. Thermostabilization of firefly luciferase by a single amino-acid substitution at position-217. Biochemistry 32 (50): 13795-13799 .). 257 Tyr is known to affect the emission wavelength, and it is yellow-green in the wild type (WT), but Y257F, Y257A, Y257E, Y257R show yellow, orange, red, and yellow, respectively (Wang Y , Akiyama H, Terakado K, Nakatsu T. 2013. Impact of Site-Directed Mutant Luciferase on Quantitative Green and Orange / Red Emission Intensities in Firefly Bioluminescence. Scientific Reports 3.). In addition, it is known that substitution of 286erSer with other residues shifts the emission wavelength to the super-wavelength side (Kato D, Kubo T, Maenaka M, Niwa K, Ohmiya Y, Takeo M, Negoro S. 2013 . Confirmation of color determination factors for Ser286 derivatives of firefly luciferase from Luciola cruciata (LUC-G). Journal of Molecular Catalysis B-Enzymatic 87: 18-23.).

GFP is a protein that emits green fluorescence. It has been discovered from Aequorea aequorea, etc., and is frequently used for protein expression monitoring (Zimmer M. 2002. Green fluorescent protein (GFP): Applications, structure, and related photophysical behavior. Chemical Reviews 102 (3): 759-781.). Moreover, it is known that misfolding is likely to occur when GFP is expressed in E. coli (Tsien RY. 1998. The green fluorescent protein. Annual Review of Biochemistry 67: 509-544.). Pedelacq and others have developed super folder GFP with high folding efficiency by introducing cycle-3 'mutation (F99S, M153T, V163A) and enhanced GFP mutateon (F64L, S65T) into GFP derived from Pyrobaculum aerophilum (Pedelacq JD, Cabantous S, Tran T, Terwilliger TC, Waldo GS. 2006. Engineering and characterization of a superfolder green fluorescent protein. Nature Biotechnology 24 (1): 79-88.).

In one embodiment of the antibody of the present invention, a peptide tag consisting of an amino acid sequence of SK, SKX, SKXX, AKXX or KKXX (where X represents any amino acid residue) is linked to the N-terminus of the H chain and L chain, respectively. is doing. In other words, the antibody of the present invention is prepared as a protein (tag added protein) in which a specific peptide tag is linked to each antibody chain.

The peptide tag used in the present invention is composed of an amino acid sequence of SK, SKX, SKXX (SEQ ID NO: 8), AKXX (SEQ ID NO: 9) or KKXX (SEQ ID NO: 10). X represents any amino acid residue. As X following SK, for example, I (Ile), K (Lys), S (Ser), A (Ala) or the like is used. Similarly, as X following SKX, for example, K (Lys), I (Ile) or the like is used. X following AK is preferably I (Ile). X following AKX is preferably I (Ile) or K (Lys). X following KK is preferably K (Lys). X following KKX is preferably K (Lys).

SK is a peptide (Ser-Lys) in which serine (Ser) and lysine (Lys) are linked in this order from the N-terminal side to the C-terminal side. SKX is a peptide in which one amino acid residue is added to SK, and SKXX (SEQ ID NO: 8) is a peptide in which two amino acid residues are added to SK. A specific example of the peptide represented by SKX is SKI (Ser-Lys-Ile). SKXX (SEQ ID NO: 8) is preferably SKIX (SEQ ID NO: 11), that is, contains SKI. Specific examples of the peptide represented by SKIX (SEQ ID NO: 11) are SKIK (Ser-Lys-Ile-Lys) (SEQ ID NO: 12) and SKII (Ser-Lys-Ile-Ile) (SEQ ID NO: 13). SKKK (Ser-Lys-Lys -Lys) (SEQ ID NO: 14) is also a preferred specific example.

AKXX (SEQ ID NO: 9) is a peptide in which two amino acid residues are added to a peptide (Ala-Lys) in which alanine (Ala) and lysine (Lys) are linked in this order from the N-terminal side to the C-terminal side. It is. Specific examples of the peptide represented by AKXX (SEQ ID NO: 9) are AKIK (Ala-Lys-Ile-Lys) (SEQ ID NO: 15) and AKII (Ala-Lys-Ile-Ile) (SEQ ID NO: 16).

KKXX (SEQ ID NO: 10) is a peptide in which two amino acid residues are added to a peptide (LysL-Lys) in which lysine (Lys) and lysine (Lys) are linked in this order from the N-terminal side to the C-terminal side. It is. A specific example of the peptide represented by KKXX (SEQ ID NO: 10) is KKKK (Lys-Lys-Lys -Lys) (SEQ ID NO: 17).

The peptide tag used in the present invention is composed of the amino acid sequence of SK, SKX, SKXX (SEQ ID NO: 8), AKXX (SEQ ID NO: 9) or KKXX (SEQ ID NO: 10) as described above, and typically 2-4 Consists of amino acid residues. However, other amino acid residues may be added to the N-terminal side and / or C-terminal side as long as the function (improving the expression level of the target protein) is not affected. In this embodiment, the total length is 5 to 13 amino acid residues, preferably 5 to 10 amino acid residues, more preferably 5 to 7 amino acid residues.

A plurality of the above peptide tags (SK, SKX, SKXX (SEQ ID NO: 8), AKXX (SEQ ID NO: 9) or KKXX (SEQ ID NO: 10)) may be used. As an example, there can be mentioned an embodiment in which 2 to 5 peptide tags are linked in tandem. Further, the above peptide tag and other tags (for example, His tag, HA tag, FLAG tag, etc.) may be used in combination (linked).

2. Preparation method of labeled protein fusion Fab antibody The second aspect of the present invention provides a preparation method of the labeled protein fusion Fab antibody. The preparation method of the present invention comprises antibody H chain gene encoding VH region (heavy chain variable region) and CH1 region (heavy chain constant region 1), VL region (light chain variable region) and CL region (light chain constant region). And expressing an antibody L chain gene encoding). In one embodiment, the antibody H chain gene and the antibody L chain gene are coexpressed (step (A), hereinafter referred to as “coexpression step”). That is, the antibody H chain gene and the antibody L chain gene are expressed in the same expression system. On the other hand, in another embodiment, the antibody H chain gene and the antibody L chain gene are each expressed. In this embodiment, the expression product is mixed after expression, and the antibody H chain and the antibody L chain are associated.

In the preparation method of the present invention, in order to obtain a Fab antibody to which a leucine zipper is added and a labeled protein is fused, a characteristic antibody H chain gene and antibody L chain gene are subjected to expression. That is, as an antibody gene used in the expression step, an Hc gene to which a base sequence (first tag sequence) encoding one (leucine zipper peptide A) of a pair of peptides constituting leucine zipper is added, and the other (leucine) An Lc gene to which a base sequence (second tag sequence) encoding zipper peptide B) has been added is used. The Hc gene and / or Lc gene, or both, encodes a labeled protein via a base sequence encoding a leucine zipper peptide (first tag sequence in the case of Hc gene, second tag sequence in the case of Lc gene) Keep the genes linked. Such a characteristic Hc gene expression construct and Lc gene expression construct are expressed, and a leucine zipper is added, and a Fab antibody in which a labeled protein is fused to the H chain, the L chain, or both is obtained.

The addition position of the first tag sequence is the 3 ′ end of the Hc gene. The addition position of the second tag sequence is the same, and is added to the 3 ′ end of the Lc gene.

The first tag sequence and the second tag sequence are linked to the antibody gene directly or via a linker sequence (sequence encoding the linker). In the latter case, a Fab antibody in which leucine zippers are linked by a linker is obtained.

The gene encoding the tag protein is a base sequence encoding the leucine zipper peptide (first tag sequence in the case of the Hc gene, second tag in the case of the Lc gene), either directly or via a linker sequence (sequence encoding the linker). Array).

When preparing a labeled protein fusion Fab antibody in which a peptide tag is linked to the N-terminus of the H chain and L chain, the antibody gene (Hc gene, Lc gene) can be directly or via a sequence encoding the peptide tag. An expression construct comprising a structure linked to is used. As long as it encodes a peptide tag, various sequences can be employed. For example, if the peptide tag is SK, tctaaa or tcg aag sequence, etc. If the peptide tag is SKI, tct など aaa ata or tcg aag atc sequence, etc., if the peptide tag is SKIK If the peptide tag is SKKK, such as the sequence of tct aaa ata aaa (SEQ ID NO: 18) or tcg aag atc aag (SEQ ID NO: 19), the sequence of tct aaa aaa aaa (SEQ ID NO: 20), the peptide tag is SKII In the case of tct aaa att att (SEQ ID NO: 21), if the peptide tag is AKIK, if gca aaa att aaa (SEQ ID NO: 22), if the peptide tag is AKII, The sequence of gca の aaa att att (SEQ ID NO: 23) and the sequence of aaa aaa aaa aaa (SEQ ID NO: 24) can be used when the peptide tag is KKKK.

Examples of “other sequences” that can intervene between a sequence encoding a peptide tag and an antibody gene include a sequence encoding a protease recognition sequence. The protease recognition sequence is an amino acid sequence that is recognized by a specific protease and necessary for cleavage of the protein by the protease. For example, a sortase recognition sequence, an HRV3C recognition sequence, or a TEV protease recognition sequence can be used. Instead of a functional sequence such as a sequence encoding a protease recognition sequence, a sequence not having a specific function may be interposed between the sequence encoding the peptide tag and the antibody gene.

Hc gene and Lc gene can be prepared by any method. Our research group has developed a method for obtaining Fab antibodies called the SICREX method (Single-Cell RT-PCR Linked In Vitro Expression). The SICREX method makes it possible to obtain a desired antibody from antibody-producing cells in a short time. In a preferred embodiment of the present invention, by using the SICREX method, the Hc gene and the Lc gene are prepared easily and in a short time, and the series of operations is accelerated. In a typical operation of the SICREX method (Biotechnol Prog. 2006 Jul-Aug; 22 (4): 979-88.), First a non-human animal immunized against a particular antigen (eg, a mouse, B cells are isolated from spleen and peripheral blood of rats and rabbits) or human peripheral blood. Dilute the solution containing the isolated B cells so that the cell count is 1 cell / well. Alternatively, B cells are isolated using a micromanipulator or the like. Next, cDNA is synthesized from mRNA in B cells using reverse transcription PCR (RT-PCR). Subsequently, the Hc gene and the Lc gene are amplified separately by two-step PCR. In the first step of the two-step PCR, a plurality of cDNA-specific primers (first primer set) having the same tag sequence added to the 5 ′ end are used. The second stage PCR is performed using the amplification product of the first stage PCR as a template. In the second stage PCR, a single primer with the same tag sequence added to the 5 'end as the tag sequence used for the first primer set is used, and the amplification product of the first stage PCR is specifically and efficiently used. Amplify to. The single primer used for the second stage PCR is complementary to the 5 ′ end part and the 3 ′ end part of the amplification product obtained by the first stage PCR. Therefore, specific amplification with a single primer becomes possible. Elements necessary for expression in the cell-free protein synthesis system (promoter, terminator, etc.) were combined by overlap PCR to the Hc gene and Lc gene obtained by the above operation, and then necessary reagents were added. In vitro synthesis (transcription and translation) in one container. The binding ability of the Fab antibody thus synthesized to the antigen can be confirmed by ELISA or the like. If necessary, sequence analysis is performed for those with high binding ability. For the procedure, conditions, application, etc. of SICREX method, Biotechnol Prog. 2006 Jul-Aug; 22 (4): 979-88., J Biosci Bioeng. 2010 Jan; 109 (1): 75-82 etc. You can refer to it. For details of each step shown below (steps (i) to (viii), steps (a) and (b), steps (I) to (IV)), Patent Document 1 can be referred to. .

When the Hc gene and Lc gene used in the present invention are prepared using the SICREX method, for example, the following steps (i) to (viii) are performed.
(i) Step of preparing mRNA derived from a single B cell (ii) Step of preparing cDNA by reverse transcription PCR using said mRNA as a template (iii) Tag sequence identical to the 5 ′ end (third tag) (Iv) performing PCR using a primer set that can amplify an antibody H chain gene (Hc gene) encoding a VH region and a CH1 region, and using the cDNA as a template. A primer set consisting of a plurality of primers containing the same tag sequence (4th tag sequence) at the end and capable of amplifying an antibody L chain gene (Lc gene) encoding VL region and CL region, and using the cDNA as a template (V) performing PCR using a single primer including the third tag sequence and using the amplification product of step (iii) as a template (vi) performing a single step including the fourth tag sequence Using the primers, the amplification product of step (iv) A step of performing PCR using as a template (vii) a step of adding a first tag sequence (sequence encoding leucine zipper peptide A) to the antibody H chain gene (Hc gene) which is an amplification product of step (v) (viii) A step of adding a second tag sequence (sequence encoding leucine zipper peptide B) to the antibody L chain gene (Lc gene) which is an amplification product of step (vi)

Of these steps, steps (vii) and (viii) are particularly characteristic of the present invention. The tag sequence in steps (vii) and (viii) can be added by overlap PCR in the same manner as the addition of elements necessary for expression in the cell-free protein synthesis system in the SICREX method.

When using a cell-free protein synthesis system for co-expression of Hc gene and Lc gene, elements necessary for expression in the cell-free protein synthesis system are also added. This operation can be performed before or after steps (vii) and (viii). Alternatively, it may be performed simultaneously with the addition of the first tag sequence / second tag sequence (that is, the elements necessary for expression in the cell-free protein synthesis system and the tag sequence are added together). A promoter is used as “an element necessary for expression in a cell-free protein synthesis system”. Preferably, a promoter and a terminator are used in combination. More preferably, a promoter, a terminator and a ribosome binding site are used in combination. As the promoter, T7 promoter, T3 promoter, SP6 promoter and the like can be used. As the terminator, for example, a T7 terminator can be used.

By the way, an improved technique of SICREX method that uses two-step PCR in one operation (one-step PCR) by simultaneously using the primers used for the first-step PCR and the second-step PCR at a predetermined quantitative ratio. (J. Biosci. Bioeng., Vol. 101, No. 3, 284-286, 2006). In accordance with this report, in another embodiment of the present invention, the antibody gene is amplified by one-step PCR instead of the conventional two-step PCR. In this embodiment, the following steps (a) and (b) are performed in place of the steps (iii) to (vi).
(a) a primer set comprising a plurality of primers containing the same tag sequence (fifth tag sequence) at the 5 ′ end and capable of amplifying an antibody H chain gene (Hc gene) encoding a VH region and a CH1 region; (B) performing PCR using a single primer containing the fifth tag sequence used at a higher concentration than the primer set and using the cDNA as a template (b) A primer set that can amplify an antibody L chain gene (Lc gene) encoding a VL region and a CL region, and a primer set that is used at a higher concentration than the primer set. A step of performing PCR using a single primer including a tag sequence and using the cDNA as a template.

The amount ratio of the primer set to the single primer is, for example, 1: 2 to 1:50, preferably 1: 5 to 1:20, more preferably 1: 8 to 1:15.

Instead of the above method (steps (i) to (viii)), the antibody cDNA is specifically amplified by a two-step PCR method (nested PCR method) using an outer primer and an inner primer. Also good. In this case, for example, the following steps (I) to (IV) are performed.
(I) providing mRNA derived from a single B cell;
(II) preparing cDNA by reverse transcription PCR using the mRNA as a template;
(III) amplifying the antibody H chain gene by a nested PCR method using the cDNA as a template,
(IV) Amplifying the antibody L chain gene by a nested PCR method using the cDNA as a template.

By the way, the Hc gene (the first tag sequence is added. In some embodiments, the tag protein gene is also linked.) And the Lc gene (the first tag sequence is added. The co-expression step of the labeled protein gene is also performed in an expression system using a host cell or a cell-free protein synthesis system. In the former case, an expression vector holding the Hc gene so that it can be expressed and an expression vector holding the Lc gene so that it can be expressed are prepared, and an appropriate host is transformed with these expression vectors. Alternatively, the host is transformed with an expression vector capable of co-expressing the Hc gene and the Lc gene. The obtained transformant is cultured under conditions that allow expression of the antibody gene from the expression vector, and then the labeled protein-fused Fab antibody, which is an aggregate of expression products, is recovered from the transformant or culture medium .

In the embodiment in which the expression product is mixed after expressing each of the Hc gene and the Lc gene, an appropriate host is transformed with an expression vector that holds the Hc gene so that the Lc gene can be expressed. An appropriate host is transformed with an expression vector retained so as to allow expression. After each obtained transformant is cultured, the expression product is recovered from the transformant or the culture solution. Thereafter, the expression products are mixed and associated to obtain a labeled protein fusion Fab antibody.

As a host, bacterial cells (for example, E. coli), yeast cells (for example, Saccharomyces cerevisiae, Schizosaccharomyces pombe, Pichia pastoris), filamentous fungi cells (for example, Aspergillus oryzae, Aspergillus niger), mammalian cells (for example, CHO cells, Sp2 / 0 cells, NS0 cells) and the like. Preferably, E. coli is employed as the host. E. coli is suitable for the efficient and large-scale preparation of the target protein. Various expression systems using T7 promoter, lac promoter, tac promoter, trp promoter, T3 promoter, SP6 promoter, low-temperature expression promoter (cold shock gene cspA promoter) and the like can be used. However, the T7 promoter and the low-temperature expression promoter are particularly preferred promoters because they have the advantages of being easily induced and capable of strong expression control. Therefore, it is preferable to use an expression system using a T7 promoter or a low temperature expression promoter. In this specification, the expression system using E. coli as a host (according to convention, called “E. coli expression system”) and the cell-free protein synthesis system using E. coli-derived components (described later) are comprehensively used. Expression system ".

The expression vector may be selected in consideration of the relationship with the host. Each operation and conditions such as transformation, culture, and recovery may be in accordance with conventional methods. Alternatively, each operation may be performed according to past reports.

The cell-free protein synthesis system does not use living cells, but uses ribosomes derived from living cells (or obtained by genetic engineering techniques), transcription / translation factors, etc. It means to synthesize in vitro. In a cell-free protein synthesis system, a cell extract obtained by purifying a cell disruption solution as needed is generally used. Cell extracts generally contain ribosomes necessary for protein synthesis, various factors such as initiation factors, and various enzymes such as tRNA. When protein is synthesized, other substances necessary for protein synthesis such as various amino acids, energy sources such as ATP and GTP, and creatine phosphate are added to the cell extract. Of course, a ribosome, various factors, and / or various enzymes prepared separately may be supplemented as necessary during protein synthesis.

Development of a transcription / translation system that reconstitutes each molecule (factor) necessary for protein synthesis has also been reported (Shimizu, Y. et al .: Nature Biotech., 19, 751-755, 2001). In this synthesis system, three types of initiation factors constituting bacterial protein synthesis system, three types of elongation factors, four types of factors involved in termination, 20 types of aminoacyl-tRNA synthetases that bind each amino acid to tRNA, and Genes of 31 kinds of factors consisting of methionyl tRNA formyltransferase are amplified from the Escherichia coli genome, and the protein synthesis system is reconstructed in vitro using these genes. In the present invention, such a reconstructed synthesis system may be used.

The cell-free protein synthesis system has the following advantages. First, since there is no need to maintain live cells, operability is good and the degree of freedom of the system is high. Therefore, it is possible to design a synthetic system with various modifications and modifications according to the properties of the target protein. Next, in the synthesis of cell systems, it is basically impossible to synthesize proteins that are toxic to the cells used, but in the cell-free system, even such toxic proteins can be produced. In addition, high throughput can be easily achieved because many types of proteins can be synthesized simultaneously and rapidly. It also has the advantage that the produced protein can be easily separated and purified, which is advantageous for high throughput. In addition, it also has the advantage that non-natural proteins can be synthesized by incorporating non-natural amino acids.

If a cell-free protein synthesis system is adopted, a series of operations of the preparation method of the present invention can be performed according to the SICREX method, and a labeled protein-fused Fab antibody can be prepared efficiently and rapidly.

Currently, the following cell-free protein synthesis systems are widely used. That is, an E. coli S30 extract system (prokaryotic cell system), a wheat germ extract system (eukaryotic cell system), and a rabbit reticulocyte lysate system (eukaryotic cell system). These systems are also commercially available as kits and can be used easily.

Historically, the development of the E. coli S30 extract system has been the oldest, and attempts have been made to synthesize various proteins using this system. The E. coli 30S fraction is prepared through steps of E. coli collection, cell disruption, and purification. The preparation of the 30S fraction of E. coli and the cell-free transcription / translation coupling reaction were performed by the method of Pratt et al. (Pratt, J. M .: Chapter 7, in “Transcription and Translation: A practical approach”, ed. By B. D. Hames & S. J. Higgins, pp. 179-209, IRL Press, New York (1984)) and Ellman et al. (Ellman, llJ. Et al .: Methods Enzymol., 202, 301-336 (1991)) This can be done with reference.

The wheat germ extract system has the advantage of efficiently synthesizing high-quality eukaryotic proteins, and is often used to synthesize eukaryotic proteins that are difficult to synthesize using the E. coli S30 extract system. Is done. Recently, it has been reported that a highly efficient and stable synthetic system is constructed by preparing an extract from germs from which seed endosperm components have been washed away (Madin, K. et al .: Proc. Natl. Acad. Sci. USA, 97: 559-564, 2000). After that, technical developments such as mRNA untranslated sequence with high translation promoting ability, protein synthesis method for multi-item function analysis using PCR, construction of dedicated high expression vector, etc. were carried out (Sawasaki, T. et al .: Proc Natl. Acad. Sci. USA, 99: 14652-14657, 2002), is expected to be applied in various fields.

The wheat germ extract can be obtained by grinding and centrifuging wheat germ and then separating the supernatant by gel filtration. Regarding the translation reaction, the method of Anderson et al. (Anderson, C. W. et al .: Methods Enzymol., 101, 638-644 (1983)) can be referred to. Improved methods have also been reported, such as the method of Kawarazaki et al. (Kawarasaki, Y. et al .: Biotechnol. Prog., 16, 517-521 (2000)) and the method of Madin et al. (Madin, K. et al. : Proc. Natl. Acad. Sci. USA, 97: -559-564, 2000). In addition, for wheat germ extract system, WO 00 / 68412684A1, WO 01/27260 A1, WO 2002/024939 A1, WO 2005/063979 A1, JP-A-6-7134, JP-A-2002-529531, Reference can be made to JP-A-2005-355513, JP-A-2006-042601, JP-A-2007-097438, JP-A-2008-029203, and the like.

Rabbit reticulocyte lysate system is suitable for globulin production. Rabbit reticulocyte lysate is made anemic by injecting phenylhydrazine intravenously into rabbits for several days, blood is collected after a predetermined period (for example, day 8), and then subjected to ultracentrifugation from the hemolyzed solution. can get. The preparation of rabbit reticulocyte lysate can be performed with reference to the method of Jackson and Hunt (Jackson, R. J. and Hunt, T .: Methods Enzymol., 96, 50-74 (1983)). .

The cell-free protein synthesis system that can be used in the practice of the present invention is not limited to the above-described ones, for example, bacterial extracts other than E. coli and plant extracts other than wheat, insect-derived extracts, animal cell-derived extracts, Alternatively, a system constructed based on genome information may be used. Preferably, an E. coli S30 extract system (prokaryotic cell system) or a system reconstituted based on the E. coli genome as described above is used. These systems are also commercially available as kits and can be used easily.

The expressed or synthesized labeled protein-fused Fab antibody can be recovered by conventional methods (centrifugation, filtration, affinity chromatography, etc.). If a collection tag sequence (for example, histidine tag) is incorporated into the Hc gene and the Lc gene, the tag sequence can be used for easy and simple collection.

Refolding operation may be performed after expression. Refolding is an operation of rewinding to an active natural structure, and is roughly divided into a dilution method and a dialysis method. In the dilution method, the expression product is solubilized with a denaturing agent such as guanidine hydrochloride (in combination with a reducing agent such as DDT or β-mercaptoethanol to form a disulfide bond), and then diluted in a refolding buffer. On the other hand, in the dialysis method, after treatment with a denaturant, dialysis is performed using a dialysis solution in which the concentration of the denaturant is reduced stepwise to remove the denaturant.

When expressing or synthesizing a labeled protein fusion Fab antibody in which the peptide tag is linked to the N-terminus of the H chain and L chain with the protease recognition sequence interposed, the peptide tag is cleaved by prosthesis treatment ( It is possible to obtain a labeled protein-fused Fab antibody that has been separated.

3. Vector for preparing labeled protein-fused Fab antibody The present invention also provides a vector for preparing labeled protein-fused Fab antibody. In the first aspect of the vector of the present invention, a promoter, a first cloning site for a gene encoding one antibody chain constituting a Fab antibody, and a first leucine zipper sequence encoding one of a pair of leucine zipper peptides, A second cloning site for a gene encoding the other antibody chain constituting the Fab antibody, and a second leucine zipper sequence encoding the other of the pair of leucine zipper peptides, and the first leucine zipper A sequence encoding a labeled protein is arranged downstream of the sequence and / or the second leucine zipper sequence. In this embodiment, the Hc gene and the Lc gene are inserted into the first cloning site and the second cloning site (the antibody gene that has not been inserted into the first cloning site is inserted into the second cloning site). ), A vector expressing the desired labeled protein-fused Fab antibody is completed. Therefore, it can be said that it is a versatile vector.

In the second embodiment of the vector of the present invention, a promoter, a first antibody gene encoding one antibody chain constituting a Fab antibody, a first leucine zipper sequence encoding one of a pair of leucine zipper peptides, and the Fab A second antibody gene encoding the other antibody chain constituting the antibody and a second leucine zipper sequence encoding the other of the pair of leucine zipper peptides, and the first leucine zipper sequence and / or the first leucine zipper sequence A sequence encoding a labeled protein is arranged downstream of the 2 leucine zipper sequence. In this embodiment, a pair of antibody genes (Hc gene and Lc gene) corresponding to the Fab antibody are incorporated. For example, the antibody gene is obtained by inserting a pair of antibody genes into the vector of the first embodiment. Can do.

The vector of the present invention can be constructed, for example, as a vector using E. coli as a host or a vector using yeast as a host. When Escherichia coli is used as a host, a promoter that functions in Escherichia coli, such as T7 promoter, lac promoter, tac promoter, trp promoter, T3 promoter, SP6 promoter, cold expression promoter ( Cold shock gene cspA promoter) and the like. Further, a ribosome binding site is usually incorporated downstream of the promoter (between the promoter and the first cloning site in the first embodiment and between the promoter and the first antibody gene in the second embodiment). The ribosome binding site contains a sequence (SD sequence) to which the liposome binds. The SD sequence is a sequence rich in adenine and guanine, and consists of, for example, the AGGAGG sequence. Typically, the expression vector is in the form of a plasmid.

When constructing the vector of the present invention as a vector using yeast as a host, it typically takes the form of a plasmid. A shuttle vector having an origin of replication capable of replicating in E. coli may be used. Examples of promoters that can be used include GAL1, GAL10, AOX1, pTEF1, pADH1, pTPI1, pHXT7, pTDH3, pPGK1, or pPYK1. Nutritional complement genes (eg, URA3 gene, HIS3 gene, LYS2 gene, LEU2 gene, etc.) can also be incorporated into the vector.

The vector of the present invention may contain, in addition to the above-described elements, elements necessary for propagation in host E. coli, elements necessary or useful for expression of antibody genes, elements useful for detection and identification, and the like. Examples of elements that can be incorporated into the vector of the present invention include replication origin, terminator (eg, T7 terminator), drug resistance gene (ampicillin resistance gene, kanamycin resistance gene, chloramphenicol resistance gene, streptomycin resistance gene, etc.) It is.

A sequence encoding a peptide tag may be incorporated in the vector so that the antibody is expressed as a protein (tag added protein) in which a peptide tag is linked to each antibody chain. In this case, in the vector of the first aspect, the amino acid sequence of SK, SKX, SKXX, AKXX, or KKXX arranged immediately before the first cloning site and immediately before the second cloning site and immediately after the start codon. A sequence encoding a peptide tag consisting of (wherein X represents any amino acid residue) is arranged. In the vector of the second aspect, similar sequences are arranged immediately before the first antibody gene and immediately before the second antibody gene. The sequence encoding the peptide tag and the first and second cloning sites (in the first embodiment), or the sequences encoding the first and second antibody genes (in the second embodiment) are directly or other sequences. It is connected via.

In the case of the first aspect and the second aspect described above, Hc and Lc are expressed by one vector, but Hc and Lc can also be expressed by separate vectors. Further aspects of the invention (third and fourth aspects) provide a set of vectors used for such expression. In addition, about the matter which is not demonstrated especially, the corresponding description of a 1st aspect or a 2nd aspect is used.

Specifically, in the third aspect of the present invention, a promoter, a first cloning site for a gene encoding one antibody chain constituting a Fab antibody, and a first leucine zipper encoding one of a pair of leucine zipper peptides are provided. A first vector having a sequence, a promoter, a second cloning site for a gene encoding one antibody chain constituting a Fab antibody, and a second leucine zipper sequence encoding the other of the pair of leucine zipper peptides And a sequence encoding a labeled protein is arranged downstream of the first leucine zipper sequence and / or the second leucine zipper sequence. In a fourth embodiment, a first vector having a promoter, a first antibody gene encoding one antibody chain constituting a Fab antibody, and a first leucine zipper sequence encoding one of a pair of leucine zipper peptides, A vector set comprising a second vector having a promoter, a second antibody gene encoding one of the antibody chains constituting the Fab antibody, and a second leucine zipper sequence encoding the other of the pair of leucine zipper peptides In addition, a sequence encoding a labeled protein is disposed downstream of the first leucine zipper sequence and / or the second leucine zipper sequence.

In the third and fourth aspects, a sequence encoding a peptide tag can be incorporated as in the first and second aspects.

4). Use of Labeled Protein Fusion Fab Antibody A further aspect of the present invention relates to use of the labeled protein fusion Fab antibody. The labeled protein-fused Fab antibody of the present invention has a function as an antibody, that is, an affinity for a specific antigen, and also has a labeling ability due to fusion of the labeled protein, and a specific target (antigen) It is useful as a reagent for specific detection or measurement. For example, it can be applied to various immunological methods (for example, ELISA method), labeling, staining or visualization (for example, in vivo imaging) of cells, tissues or organs / organs. On the other hand, in the case of a labeled protein-fused Fab antibody derived from a specific subject (for example, a patient suffering from a specific disease), it can also be applied to diagnosis (evaluation of disease state and therapeutic effect). In addition, when a protein capable of exerting a therapeutic effect, such as an enzyme exhibiting anticancer activity, is used as a labeled protein, the labeled protein-fused Fab antibody can be used as a therapeutic antibody.

The present invention further provides a detection kit containing the reagent of the present invention. According to the kit, detection and measurement using the reagent of the present invention can be performed more easily. The kit of the present invention contains the reagent of the present invention as a main component. Other reagents, reaction solutions, containers / equipment necessary for detection and measurement may be included in the kit of the present invention. Usually, an instruction manual is attached to the kit of the present invention.

In our research group, antibodies that efficiently fold in E.Lcoli cell-free protein synthesis system and E. coli intracellular expression system by adding leucine zipper (LZ) to Hc and Lc of Fab antibody We have developed a molecule and named it Zipbody. LZ is thought to play a role in facilitating the association between Fab antibody Hc and Lc. If a labeled protein (eg, an enzyme) is genetically fused to the C-terminus of Zipbody, the presence of LZ may produce a Fab antibody-labeled protein fusion with a stable structure. Therefore, LZ was added to the mouse-derived anti-E. 由来 coli O157 Fab antibody and rabbit-derived anti-L.cytomonocytogenes Fab antibody to form Zipbody (m6Fab LZ, r4Fab LZ), and L. cruciata-derived Green Luc (Kajiyama N, Nakano E. 1993. Thermostabilization of firefly luciferase by a single amino-acid substitution at position-217. Biochemistry 32 (50): 13795-13799.) Was attempted to express in the E. coli cytoplasm. (FIG. 1). Subsequently, it was examined whether ELISA using the light emission of the Luc part of the fusion protein as an index could be performed. (Figure 2) Furthermore, superfolder GFP (Pedelacq JD, CabantousabS, Tran T, Terwilliger TC, Waldo GS. 2006. Engineering and characterization of a superfolder green fluorescent protein. Nature Biotechnology 24 (1): 79-88 We also tried to express Zipbody-GFP fused with.

1. Materials and methods
(1) Strain and culture conditions E. coli DH5α was used as a host strain for gene manipulation. E. coli SHuffle (registered trademark) T7 express (New England biolabs, fhuA2 lacZ :: T7 gene1 [lon] ompT ahpC gal λatt :: pNEB3-r1-cDsbC (Spec ^R , lacI ^q ) ΔtrxB sulA11 R (mcr-73 :: miniTn10--Tet ^S ) 2 [dcm] R (zgb-210 :: Tn10 --Tet ^S ) endA1 Δgor Δ (mcrC-mrr) 114 :: IS10), E. coli BL21 ( ^{DE3) pLysS (Promega, F -} , ompT, hsdS (r B -, m B -)., dcm, gal, λ (DE3), pLysS, Cm r), E coli Rosetta-gami TM 2 (DE3) pLysS ( Merck Millipore, Δ (ara-leu) 7697 ΔlacX74 ΔphoA PvuII phoR araD139 ahpC galE galK rpsL (DE3) F ′ [lac + lacIq pro] gor522 :: Tn10 trxB pLysSRARE2 (CamR, StrR, TetR)) was used. E. coli was cultured at 37 ° C. or 16 ° C. using LB medium. Ampicillin was appropriately added as a selection marker so as to be 100 μg / mL.

(2) Construction of expression plasmid
(2-1) Orange Luc sequence and cloning into expression vector With reference to L. cruciata-derived Luc gene reported by Masuda et al., 217 Thr related to heat resistance was changed to Ile, and 257 Tyr related to emission wavelength was changed to Arg. The gene for Orange Luc was replaced by the artificial gene synthesis service of IDT (Masuda T, Tatsumi H, Nakano E. 1989. Cloning and sequence-analysis of cdna for luciferase of a japanese firefly, Luciola cruciata. Gene 77 (2): 265-270 .; Kajiyama N, Nakano E. 1993.Thermostabilization of firefly luciferase by a single amino-acid substitution at position-217. Biochemistry 32 (50): 13795-1379 .; Wang Y, Akiyama H, Terakado K, Nakatsu T. 2013. Impact of Site-Directed Mutant Luciferase on Quantitative Green and Orange / Red Emission Intensities in Firefly Bioluminescence. Scientific Reports 3.). The synthesized gene sequence and pCold I were subjected to restriction enzyme treatment with Nde I (Takara Bio) and Xba I (Takara Bio), and the resulting DNA fragment was fused with Takara DNA ligation kit ver. 2 (Takara Bio). It was introduced into E. coli DH5α. Plasmids were extracted from the generated colonies, and DNA sequence analysis was performed using BigDye Terminator v3.1 cycle sequencing kit and ABI PRISM 3100 genetic analyzer. The prepared plasmid was designated as pCold orange Luc.

(2-2) Construction of Green Luc expression plasmid The 257 Arg of the Orange Luc gene of the plasmid pCold Orange Luc prepared in (2-1) was replaced with Tyr by the Quickchange method. Using the primers 257th Y Luc for QC F (GGCATGTTCACCACTCTGGGTTATCTGATCTGCGGCTTCC: SEQ ID NO: 25) and 257th Y Luc for QC R (GGAAGCCGCAGATCAGATAACCCAGAGTGGTGAACATGCC: SEQ ID NO: 26), the pCold orange Luc plasmid was amplified as a template [95 ° C. for 2 minutes; 95 20 cycles of 10 seconds at ℃, 15 seconds at 55 ℃, 6 minutes at 72 ℃; 20 minutes at 72 ℃; Pfu turbo DNA polymerase (Agilent technologies)] and Dpn I treatment. After introducing into E. coli DH5α and extracting the plasmid from the generated colonies, the sequence was confirmed. The prepared plasmid was designated as pCold green Luc.

(2-3) pET22 m6Fab LZ Hc-Luc
Plasmid pET22m6Fab LZ Hc-Luc for expressing the protein m6Fab LZ Hc-Luc in which Luc was fused to the C-terminus of Hc of m6Fab LZ was prepared (FIG. 3). Using the plasmid pCold Green Luc constructed in (2-2) as a template, primers L. cruciata Luc F and L. cruciata Luc R (FIG. 13) were used for PCR [2 minutes at 94 ° C. ; 94 ° C for 10 seconds, 55 ° C for 30 seconds, 68 ° C for 1 minute 40 seconds 25 cycles; 68 ° C for 8 minutes 20 seconds; Amplified by KOD plus ver. 2] Primers Vector for Hc-Luc F and Vector for Hc-Luc for annealing the plasmid pET22 m6Fab LZ (see Patent Document 1) before and after the stop codon of Hc to prepare a linearized vector containing the gene of m6Fab LZ Inverse PCR using R (Fig. 13) [94 ° C for 2 minutes; 94 ° C for 10 seconds, 50 ° C for 30 seconds, 68 ° C for 7 minutes 40 seconds 25 cycles; 68 ° C for 40 minutes; KOD plus ver. 2]. Each DNA amplification product was treated with Dpn I (Takara), then purified with FastGene Gel / PCR Extraction Kit (Nippon Genetics Co., Ltd.), and Luc gene was converted to Hc C of m6Fab LZ with Gibson Assembly (New England BioLabs). Fused to the ends. Each fused DNA was introduced into E. coli DH5α, the generated colonies were cultured overnight in LB medium, and the plasmid was extracted with FastGene Plasmid Mini Kit] (Nippon Genetics). The sequence of each plasmid was confirmed by a DNA sequence analysis service (Fusmac Co., Ltd.). The operation after amplification of the DNA fragment was carried out in the same manner in the subsequent plasmid construction experiments (2-4) to (2-9).

(2-4) pET22 m6Fab Hc-Luc
In order to examine the effect of LZ, a plasmid pET22 m6Fab Hc-Luc for expressing a protein Fab Hc-Luc in which Luc was fused to Hc of m6 Fab antibody without LZ was prepared. The Luc gene was amplified as in (2-3). In order to prepare a linearized vector containing the gene of m6Fab, primers Vector for Hc-Luc F and Vector for Hc-Luc R that anneal before and after the stop codon of Hc of plasmid pET22 m6Fab (see Patent Document 1) (FIG. 13). ) Using inverse PCR [94 ° C for 2 minutes; 94 ° C for 10 seconds, 50 ° C for 30 seconds, 68 ° C for 7 minutes and 40 seconds for 25 cycles; 68 ° C for 40 minutes; KOD plus ver. 2] did. Thereafter, the two DNA fragments were fused in the same manner as in (2-3).

(2-5) pET22 m6Fab LZ Lc-Luc
Plasmid pET22m6Fab LZ Lc-Luc for expressing the protein m6Fab LZ Lc-Luc in which Luc was fused to Lc of m6Fab LZ was prepared (FIG. 3). PCR of L. cruciata-derived Luc gene using the same template DNA and primers as in (2-3) [94 ° C for 2 minutes; 94 ° C for 10 seconds, 55 ° C for 15 seconds, 68 ° C for 50 seconds for 20 cycles Amplified at 68 ° C. for 4 minutes and 10 seconds; tks Gflex DNA polymerase]. In order to prepare a linearized vector containing the gene of m6Fab LZ, primers Vector for Lc-Luc F and Vector for Lc-Luc R (FIG. 13) that anneal the plasmid pET22 m6Fab LZ before and after the Lc stop codon were used. Inverse PCR [94 ° C. for 2 minutes; 94 ° C. for 10 seconds, 50 ° C. for 15 seconds, 68 ° C. for 3 minutes 50 seconds for 20 cycles; 68 ° C. for 20 minutes; tks Gflex DNA polymerase] was amplified. Thereafter, the two DNA fragments were fused in the same manner as in (2-3).

(2-6) pET22 m6Fab LZ W-Luc
Plasmid pET22 m6Fab LZ W-Luc for expressing the protein m6Fab LZ W-Luc in which Luc was fused to both Hc and Lc of m6Fab LZ was prepared. The Luc gene was amplified as in (2-3). In order to prepare a linearized vector containing the m6Fab LZ Hc-Luc gene, primers Vector for Lc-Luc F and Vector for Lc- that anneal before and after the start codon of Lc using plasmid pET22 m6Fab LZ Hc-Luc as a template Inverse PCR using Luc R (Fig. 13) [94 ° C for 2 minutes; 94 ° C for 10 seconds, 53 ° C for 30 seconds, 68 ° C for 9 minutes 20 seconds 25 cycles; 68 ° C for 50 minutes; KOD plus ver Amplified by 2]. Thereafter, the two DNA fragments were fused in the same manner as in (2-3).

(2-7) pET22 m6Fab LZ Hc-GFP
Plasmid pET22 m6Fab LZ Hc-GFP for expressing a protein (m6Fab LZ Hc-GFP) in which GFP was fused to Hc of m6Fab LZ was prepared. PCR using the GFP gene reported by Pedelacq et al. With sfGFP F and sfGFP R (Fig. 13) as primers [94 ° C for 2 minutes; 94 ° C for 10 seconds, 50 ° C for 15 seconds, 68 ° C for 20 seconds For 25 cycles; 68 ° C. for 1 minute 40 seconds; tks Gflex DNA polymerase]. In order to construct a linearized vector containing the gene for m6Fab LZ, inverse PCR using primers Vector for Hc-GFP F and Vector for Hc-GFP R that anneal the plasmid pET22 m6Fab LZ before and after the stop codon of Hc [ 94 ° C for 2 minutes; 94 ° C for 10 seconds, 50 ° C for 30 seconds, 68 ° C for 7 minutes and 40 seconds for 25 cycles; 68 ° C for 40 minutes; KOD plus ver. 2] Thereafter, the two DNA fragments were fused in the same manner as in (2-3).

(2-8) pET22 r4Fab LZ Hc-Luc
Plasmid pET22 r4Fab LZ Hc-Luc for expressing a protein (r4Fab LZ Hc-Luc) in which Luc was fused to Hc at the C-terminus of r4Fab LZ was prepared. The Luc gene was amplified as in (2-3). Primer Vector for Hc-Luc F and Vector for Hc-Luc R that anneal before and after the stop codon of Hc using plasmid pET22 r4Fab LZ as a template to prepare a linearized vector containing the r4Fab LZ gene (FIG. 13) Amplified by inverse PCR [94 ° C for 2 minutes; 94 ° C for 10 seconds, 50 ° C for 30 seconds, 68 ° C for 7 minutes 40 seconds; 68 ° C for 40 minutes; KOD plus ver. 2] . Thereafter, the two DNA fragments were fused in the same manner as in (2-3).

(2-9) pET22 r4Fab LZ Hc-GFP
Plasmid pET22 r4Fab LZ Hc-GFP for expressing a protein (r4Fab LZ Hc-GFP) in which GFP was fused to Hc at the C-terminus of r4Fab LZ was prepared. The GFP gene was amplified as in (2-7). In order to prepare a linearized vector containing the r4Fab LZ gene, primers Vector for Hc-GFP F and Vector for Hc-GFP R that anneal before and after the stop codon of Hc using plasmid pET22 r4Fab LZ as a template (FIG. 13) Amplified by inverse PCR [94 ° C for 2 minutes; 94 ° C for 10 seconds, 50 ° C for 30 seconds, 68 ° C for 7 minutes 40 seconds; 68 ° C for 40 minutes; KOD plus ver. 2] . Thereafter, the two DNA fragments were fused in the same manner as in (2-3).

(3) Expression conditions of each Zipbody, Zipbody-Luc, Zipbody-GFP SHuffle (registered trademark) T7 express retaining each plasmid was pre-cultured overnight at 37 ° C. 500 μL of the preculture was added to 20 mL of LB medium and cultured at 37 ° C. until the OD ₆₀₀ reached 0.4 to 0.5, and left on ice for 30 minutes. Isopropyl-β-D-thiogalactopyranoside (IPTG) (Wako Pure Chemical Industries, Ltd.) was added to 1 mM, and the cells were cultured at 16 ° C. for 24 hours. After completion of the culture, the cells were collected by centrifugation at 8000 × g and washed twice with 5 mL of PBS. The cells were suspended in 2 mL of PBS, and the cells were crushed with zirconia / silica beads 0.1 mm (Ieda Trading Co., Ltd.) and a bead-type cell crusher Micro Smash ^™ MS 100R. Centrifuged at 14,000 x g for 10 minutes at 4 ° C. The obtained supernatant was used as a soluble fraction. The precipitate was suspended in 2 mL of PBS to obtain an insoluble fraction.

(4) Western Blotting Samples, 4X Bolt (registered trademark) LDS Sample Buffer (Thermo Fisher Scientific Inc.) and 10X Bolt (registered trademark) Sample Reducing Agent (Thermo Fisher Scientific Inc.), each 1/4 volume The mixture was denatured by heating at 95 ° C. for 3 minutes and rapidly cooled on ice. Electrophoresis was performed at 20 mA for 70 minutes using a 12.5% polyacrylamide gel (ATTO) and a rapidus mini slab electrophoresis tank (ATTO). Precision Plus Protein 2 Color Standard (BioRad) was used as a molecular weight marker. The polyacrylamide gel after electrophoresis was transferred to a nitrocellulose membrane using iBlot (registered trademark) Dry Blotting System (Thermo Fisher Scientific Inc.) and iBlot (registered trademark) Gel Transfer Stacks Nitrocellulose, Mini (Thermo Fisher Scientific Inc.) . After blocking with 0.4% BSA for 30 minutes or more, the plate was washed with PBS-T for 5 minutes. 2,000-fold diluted anti-hemagglutinin, monoclonal antibody, peroxidase binding (Wako Pure Chemical Industries) or 5,000-fold diluted Anti-Flag, chicken-Poly, HRP (GeneTex, Inc.) were added and shaken for 30 minutes. Washing with PBS-T for 5 minutes was repeated 4 times, and color was developed with Pierce 1-Step ^™ Ultra TMB Blotting Solution (Thermo Fisher scientific Inc.). After washing with miliQ water, the nitrocellulose membrane was photographed with ChemiDoc ^™ XRS + (BioRad).

(5) ELISA
50 μL of E. coli O157 GTC03904 (OD ₆₀₀ = 0.1) or L. monocytogenes (OD ₆₀₀ = 1.0) was added to each well of nunc immunoplate maxi soap (Thermo Fisher Scientific Inc.) and incubated overnight at 4 ° C. Each well was blocked overnight with 0.4% BSA (diluted in PBS). Each well was washed twice with 400 μL of PBS-T, 25 μL of each sample was added and incubated for 1 hour at room temperature. Wash each well 3 times with PBS-T 400μL and dilute 10,000 times with Can Get Signal ^™ Immunoreaction Enhancer Solution Solution 2 as secondary antibody Anti-Fab, Mouse, Goat-poly, HRP (Bethyl Laboratories, Inc) or 2,000 Double diluted ANTI RABBIT IG (G + M) -HRP (Sothern Biotechnology Associates Inc.) was added and incubated for 1 hour at room temperature. Washing each well three times with ^{PBS-T 400μL, SureBlue TM TMB} Microwell Peroxidase Substrate (1-component) (Kirkegaard & Perry Laboratories, Inc.) was added each 25 [mu] L, and incubated for 5 minutes at room temperature, 1M H ₂ SO After adding 25 μL of ₄ , the absorbance at 450 nm was measured with a microplate reader infinite 200 PRO (TECAN).

(6) a white microplate Luc activity measurement 96-well (Greiner Bio-One International GmbH) , and each sample 25 [mu] L, the ^{ONE-Glo TM Luciferase Assay System (} Promega) 25μL reacted by mixing at room temperature, infinite 200 Luminescence per second was measured by PRO (TECAN).

(7) Emission-ELISA
Zipbody-Luc was used as a primary antibody, and its luminescence was used as an index, and ELISA was performed without using a secondary antibody. In the same manner as in (5), 96-well nunc white immunoplate maxi soap (Thermo scientific, Inc.) was coated with antigen, blocked, washed wells, and each sample was added. After further washing the wells, 20 μL of an equal volume of PBS and ONE-Glo ^™ Luciferase Assay System was added. Luminescence was measured per second with a microplate reader.

(8) Measurement of GFP activity To a 96-well black microplate (Greiner Bio-One International GmbH)), add 25 μL of sample mixed with 25 μL of PBS, and measure fluorescence per 20 μs of 530 nm against excitation light of 488 nm using a microplate reader did.

(9) Fluorescence-ELISA
Zipbody-GFP was used as a primary antibody, and its luminescence was used as an index, and ELISA was performed without using a secondary antibody. In the same manner as in (5), 96-well nunc black immunoplate maxisorp (Thermo Fisher Scientific Inc.) was coated with antigen, blocked, washed wells, and each sample was added. After further washing the wells, 20 μL of PBS was added. The fluorescence per 20 μs at 530 nm with respect to the excitation light at 488 nm was measured with a microplate reader.

(10) Zipbodyzyme refolding
E. coli SHuffle T7 express transformed with the plasmid pET22 m6 Fab Hc-GFP was pre-cultured at 37 ° C. The preculture was inoculated into 200 mL LB medium and cultured at 37 ° C. until OD ₆₀₀ reached 0.4 to 0.5. After adding IPTG to 1 mM, the cells were cultured at 37 ° C. for 3 hours. After completion of the culture, the bacteria were collected by centrifugation at 8000 × g and 4 ° C. The suspension was suspended in 2 mL PBS, and the bacteria were crushed with a bead shocker. Centrifugation was performed at 3000 × g and 4 ° C. for 5 minutes to remove undisrupted bacteria, and the insoluble fraction was recovered by further centrifuging at 14,000 g for 5 minutes.

The insoluble fraction was dissolved in 100 mM Tris HCl (pH 7.5) containing 1 mL of 6 M GuHCl and 10 mM mercaptoethanol, and incubated overnight at 4 ° C. Subsequently, the mixture was transferred to a dialysis tube and dialyzed for 12 hours using 100 mM Tris HCl (pH 7.5) containing 6M GuHCl as a dialysis buffer. Thereafter, every 12 hours, the dialysis buffer was replaced with 100 mM Tris HCl (pH 7.5) containing GuHCl at concentrations of 3, 2, 1, 0.5, and 0 M (pH 7.5) only (1M dialysis contains 375 μM のみ GSSG). The supernatant was collected at 14,000 μg for 5 minutes, and the retention of activity was confirmed by fluorescence ELISA.

The refolded Zipbodyzyme was purified using Ni-sepharose 6 Fast Flow (GE Health care) according to the manual. Subsequently, the antibody titer of m6Fab LZ Hc-GFP after purification was examined by BLitz using an Aminopropylsilane sensor. The program is as follows: Initial Baseline 30 seconds, Loading 120 seconds, Baseline 30 seconds, Association 120 seconds, Dissociation 120 seconds.

2. result
(1) Selection of host strain The host used for expression of the fusion protein was selected from E. coli SHuffle (registered trademark) T7 express, E. coli BL21 (DE3) pLysS, E. coli Rosetta-gami ^TM 2 (DE3) pLysS . As a fusion protein model, m6Fab LZ was expressed in each strain, and the expression level was analyzed by Western blotting (FIG. 4A). As a result, expression of Hc (30.5 kDa) and Lc (29.5 kDa) was confirmed in the soluble fraction and the insoluble fraction of E. coli SHuffle (registered trademark) T7 express and E. coli BL21 (DE3) pLysS, In particular, high expression was observed in both fractions in E. coli SHuffle (registered trademark) T7 express. On the other hand, expression was not confirmed from E. coli Rosetta-gami ^TM 2 (DE3).

Subsequently, the antigen affinity of the soluble fraction of each strain was measured by ELISA (FIG. 4B). When E. coli SHuffle (registered trademark) T7 express was used, a signal 18.4 times as high as that of the clone into which pET22b, which was a negative control, was introduced. When E. coli BL21 (DE3) pLysS and E. coli Rosetta-gami ^™ 2 (DE3) were used, the activity was only as high as that of the clone into which the negative control pET22b was introduced. From this result, E. coli SHuffle (registered trademark) T7 express was used for the subsequent experiments.

(2) Comparison of antigen affinity and Luc activity of fusion protein with and without LZ m6Fab, a mouse-derived anti-E. Coli O157 Fab antibody, m6Fab, a Zipbody, m6Fab Hc- Luc, m6Fab LZ Hc-Luc was expressed in E. coli SHuffle (registered trademark) T7 express. In m6Fab Hc-Luc, Luc is fused directly to Hc, whereas in m6Fab LZ Hc-Luc, Luc is fused to Hc via LZ.

The expression of the fusion protein in each soluble fraction was examined by Western blotting (FIG. 5). As a result, it was confirmed that m6Fab Hc-Luc (Hc 87.3 kDa, Lc 25.6 kDa) and m6Fab LZ Hc-Luc (Hc 91.3 kDa, Lc 29.5 kDa) were expressed as fusion proteins regardless of the presence or absence of LZ.

When the Luc activity of each soluble fraction of the fusion protein was examined, m6Fab Hc-Luc showed a significant signal of 1.7 × 10 ⁶ and m6Fab LZ Hc-Luc showed a significant signal of 2.4 × 10 ⁶ (FIG. 6). Subsequently, in order to examine the presence or absence of antigen-binding activity of the antibody portion of the fusion protein, each soluble fraction of these fusion proteins was subjected to ELISA, and m6Fab LZ, m6Fab LZ Hc-Luc, and m6Fab Hc not fused with Luc. -Luc showed almost the same signal (FIG. 7). From these results, it was found that the Luc activity and the antigen binding activity were retained regardless of the presence or absence of LZ addition.

Subsequently, using m6Fab LZ ず Hc-Luc as the primary antibody, it was investigated whether antigen detection could be performed without using the secondary antibody by luminescence ELISA using Luc luminescence as an index (FIG. 8). As a result, m6Fab Hc-Luc with LZ showed 14 times as much signal as m6Fab Hc-Luc without LZ. The S / N ratio calculated from the signal intensity of each well coated with antigen and BSA was 41 for m6Fab LZ Hc-Luc, 7.2 for m6Fab Hc-Luc, and m6Fab LZ Hc-Luc with Luc added to the Zipbody. It was found that the detection sensitivity was superior.

(3) Examination of the fusion site of Luc to Zipbody m6Fab LZ with Luc added to Lc Lc-Luc, m6Fab LZ W with Luc added to both Hc and Lc to optimize the fusion site to Luc Zipbody Plasmids pET22 m6Fab Lc-Luc and pET22 m6Fab W-Luc encoding -Luc were prepared and expressed in E. coli SHuffle (registered trademark) T7 express (FIG. 3).

As a result of subjecting the soluble fraction to Western blotting, expression of m6Fab LZ Lc-Luc Hc (30.5 kDa) was confirmed, whereas expression of Lc fused with Luc (90.4 kDa) was not confirmed ( (Figure 5). In addition, Hc (91.3 kDa) of m6Fab LZ W-Luc was faintly detected, whereas Lc (90.4 kDa) was not expressed.

As a result of investigating the Luc luminescence activity of these fusion proteins, although significant activity was observed from any of the fusions, m6Fab LZ Lc-Luc was 0.36 times that of m6Fab LZ Hc-Luc, and m6Fab LZ W-Luc was It was 0.39 times, and both were lower than the value of m6Fab LZ Hc-Luc (FIG. 5). As a result of a general ELISA using color development as an index, m6Fab LZ not fused with Luc had Abs.A450 nm of 0.75 and m6Fab Hc-Luc of 0.80, whereas m6Fab LZ Lc-Luc was 0.13, m6Fab LZ W-Luc was 0.19, and the antigen affinity was significantly reduced in the clones in which Luc was fused to Lc (FIG. 7). In the luminescence ELISA, the luminescence signals of m6Fab Lc- LZ Luc and m6Fab LZ W-Luc were 3.3% and 14% compared to m6Fab Hc-Luc (FIG. 8). The fusion of Luc to m6Fab mLZ was found to be most efficient when fused only to Hc compared to fused to Lc alone, both Hc and Lc.

(4) Fusion of Luc to a rabbit-derived Zipbody Plasmid pET22 r4Fab LZ in which Luc is genetically fused to the C-terminal of the Hc of a rabbit-derived Zipbody in order to investigate whether Luc can be fused to a Zipbody derived from a species other than a mouse. Hc-Luc was prepared and expressed in E. coli SHuffle (registered trademark) T7 express (FIG. 3).

As a result of subjecting the soluble fraction to Western blotting, expression of Hc (90.2 kDa) and Lc (28.4 kDa) to which Luc was added was confirmed (Fig. 5). Subsequently, the Luc activity of the soluble fraction was measured, and a significant signal could be detected (FIG. 6). Furthermore, the antigen affinity of the soluble fraction was examined by ELISA. R4Fab LZ and r4Fab LZ Hc-Luc to which Luc was not fused did not show a superior signal compared to pET22b which is a negative control (FIG. 9). However, when the soluble fraction was subjected to luminescence ELISA to detect the antigen using both the activity of the Luc part and the antigen affinity of the antibody part, when r4Fab LZ Hc-Luc was used, the antigen was a negative control. The signal was 2.5 times that of the case using BSA (FIG. 10).

(5) Fusion of GFP to Zipbody m6Fab LZ Hc-GFP and r4Fab LZ Hc, in which GFP was genetically fused to Hc of m6Fab LZ and r4Fab LZ to examine the fusion of proteins other than Luc to Zipbody. -GFP was expressed in E. coli SHuffle (registered trademark) T7 express.

As a result of examining the expression in the soluble fraction by Western blotting, Hc (58.1 kDa) and Lc (29.5 kDa) of m6Fab Hc-GFP, Hc (56.9 kDa) and Lc (28.4 kDa) of r4Fab Hc-GFP Was confirmed (FIG. 5). When the GFP activity of the soluble fraction was examined, m6Fab LZ Hc-GFP showed a significant fluorescent signal of 1.2 × 10 ³ and r4Fab LZ Hc-GFP showed a significant fluorescent signal of 1.1 × 10 ³ (FIG. 11). When ELISA was conducted to examine the antigen affinity of the antibody, m6Fab LZ Hc-GFP showed a signal equivalent to m6FabLZ, but r4Fab LZ Hc-GFP showed no significant signal (FIGS. 7 and 11). .

As a result of subjecting the soluble fraction to a fluorescence ELISA using the fluorescence of GFP as an indicator, the fluorescence detected from m6FabcHc-GFP showed a signal 3.0 times that of the negative control using BSA as an antigen. Similar to Luc, it was shown that immunoassay is possible with GFP-fused Zipbody (FIG. 12). On the other hand, the r4FabFLZ Hc-GFP signal remained at the same level as that of the negative control r4Fab LZ.

(6) Zipbodyzyme refolding
As a result of performing fluorescence ELISA on E. coli O157 using m6Fab LZ Hc-GFP after refolding, a signal 5.6 times higher than that without antigen was obtained (FIG. 14). From this result, it was found that a Zipbodyzyme retaining the activity could be produced by refolding. The antibody titer of m6Fab LZ Hc-GFP after purification was measured by BLitz and found to be 19 nM, which almost coincided with 20 nM of m6Fab LZ. It was found that the antibody titer was not impaired by the fusion of GFP to Zipbody.

3. Discussion If an enzyme can be genetically fused to an antibody, chemical modification experiments are not necessary, and the enzyme modifying the antibody can be quantitatively controlled. However, there are few reports. In this study, Lucbody was further fused to Zipbody, which had been stabilized by adding LZ to Hc and Lc of Fab antibody, and it was examined whether immunological detection was possible by this (Fig. 1). .

First, in order to select a suitable host for the expression of Zipbody-Luc, Zipbody was analyzed using E. coli SHuffle (registered trademark) T7 express, E. coli BL21 (DE3) pLysS, E. coli Rosetta-gami ^TM 2 (DE3) pLysS. The productivity was compared (Fig. 4). E. coli SHuffle (registered trademark) T7 express is characterized in that the chaperone DsbC that optimizes the disulfide bond originally present in the periplasm is highly expressed in the cytoplasm and the cytoplasm is in a reduced state. BL21 (DE3) pLysS holds a plasmid pLysS encoding a T7 lysozyme gene that inhibits transcription of T7 RNA polymerase, and is a strain capable of strict expression control by IPTG. In addition to retaining plasmid pLysS, Rosetta-gami ^™ 2 (DE3) pLysS can enhance disulfide bond formation due to the cytoplasm being oxidized by two types of reductase mutations. In addition, E. coli has a tRNA corresponding to a codon having a small abundance and is a host capable of expressing a protein regardless of species differences.

As a result of evaluation of the expression level by Western blotting and antigen affinity by ELISA, E. coli SHuffle (registered trademark) T7 express had the highest expression level and the antigen affinity of the soluble fraction was high. On the other hand, E. coli Rosetta-gami ^™ 2 (DE3) was also oxidative in the cytoplasm and suitable for disulfide bond formation, but both the expression level and ELISA signal were low. From this result, it is considered that DsbC expressed in the cytoplasm of E. coli SHuffle (registered trademark) T7 express is important for correct folding of m6Fab LZ. E. coli SHuffle (registered trademark) T7 express has been reported by Robinson et al. To express full-length antibodies in the cytoplasm, suggesting that various antibodies can be expressed (Robinson MP, Ke N, Lobstein J, Peterson C. Szkodny A, Mansell TJ, Tuckey C, Riggs PD, Colussi PA, Noren CJ and others. 2015. Efficient expression of full-length antibodies in the cytoplasm of engineered bacteria. Nature Communications 6.).

Next, m6Fab LZ Hc-Luc, in which Luc was genetically fused to the Hc of Zipbody m6Fab ある LZ, was expressed in the cytoplasm of E. coli SHuffle (registered trademark) T7 express. At this time, in order to confirm the necessity of LZ added to m6Fab LZ Hc-Luc, m6Fab Hc-Luc in which Luc was fused to Hc of m6Fab without LZ was also compared. As a result of examination of the soluble fraction, the expression of each fusion protein was confirmed by Western blotting and retained almost the same Luc activity and antigen affinity (FIGS. 5 to 7). However, when the fusion protein was used as a primary antibody and subjected to luminescence ELISA for antigen detection, m6Fab LZ Hc-Luc showed a signal about 15 times higher than m6Fab Hc-Luc (FIG. 8). From this result, it was found that a complex in which an enzyme is fused to a Zipbody having LZ can be detected by highly sensitive antigen detection using the Luc moiety. The main factor is that the fusion protein is stabilized by the presence of LZ.

In addition to m6FabLLZ Hc-Luc, m6Fab LZ Lc-Luc fused to Lc and m6Fab LZ W-Luc fused to both Hc and Lc were examined in order to optimize the fusion site of Luc to Zipbody. In Western blotting, m6Fab LZ Lc-Luc and m6Fab LZ W-Luc were not detected in any of the Lc bands fused to Luc, and m6Fab LZ W-Luc had a band corresponding to the Hc-Luc fusion. Only a small amount was detected (FIG. 5). From this, it was found that the expression level was decreased by fusion of Luc to Lc. The activity, antigen affinity, and detection value of the luminescence ELISA of the Luc part of m6Fab LZ Lc-Luc and m6Fab LZ W-Luc were all lower than those of m6Fab LZ Hc-Luc (FIGS. 6 to 8).

To date, Fab antibodies have been reported to produce fusion proteins with alkaline phosphatase (Weiss E, Orfanoudakis G. 1994. Application of an alkaline-phosphatase fusion protein system suitable for efficient screening and production of fab-enzyme conjugates in Escherichia coli. Journal of Biotechnology 33 (1): 43-53 .; Carrier A, Ducancel F, Settiawan NB, Cattolico L, Maillere B, Lreonetti M, Drevet P, Menez A, Boulain Jcomant conjugates for diagnosis of human iggs-application to anti-hbsag detection. Journal of Immunological Methods 181 (2): 177-186.), both reports were added to the C-terminus of Hc, and fusion to Lc was examined. Not. In this study, only when Luc was added to Hc, a fusion protein could be produced while retaining both antibody and enzyme activities. This result experimentally suggested for the first time that Hc may be more suitable than Lc for genetic enzyme fusion to LZ-added Fab antibodies.

R4Fab か LZ Hc-Luc, in which Luc was added to the Hc of r4Fab LZ, a rabbit-derived anti-L. Monocytogenes antibody, was expressed in order to investigate whether a fusion protein with Luc could be produced using a Zipbody other than m6Fab LZ. According to prior studies by the inventors, it has been known that r4Fab LZ requires purification in order to perform ELISA. Also in this study, a significant signal could not be detected by ELISA before the soluble fraction before purification, but a significant signal could be detected by luminescence ELISA using the same fraction (FIGS. 9 and 10). From this, it was found that a luminescence ELISA can be performed even with a Zipbdy-Luc fusion produced from a rabbit-derived Zibpdoy. Moreover, it means that the sensitivity of the luminescence ELISA is higher than that of a general ELISA using a secondary antibody. Because of the successful production of Zipbody-Luc that retains activity from both mouse-derived antibody m6Fab LZ and rabbit-derived antibody r4Fab LZ, Luc can be fused universally to Zipbody derived from various species. The possibility is suggested.

Similarly, m6Fab に LZ の Hc-GFP and r4Fab LZ Hc-GFP were prepared by fusing GFP with mouse and rabbit-derived Zipbody Hc. When fluorescent ELISA was performed using the soluble fraction, a significant signal was obtained with m6Fab LZ Hc-GFP (FIG. 11). On the other hand, no significant signal was obtained with r4Fab LZ Hc-GFP. Western blotting analysis shows the expression of r4Fab LZ Hc-GFP in Hc-LZ-GFP and Lc-LZ (Fig. 5). Consideration is necessary. Unlike Luc, HRP, and alkaline phosphatase, GFP-ELISA has the merit that it can be detected without the need for a substrate, and an assay at a low running cost is expected. Since GFP and Zipbody were successfully genetically fused not only with Luc, it is considered that Zipbody can be genetically fused with various enzymes and expressed in E. coli.

On the other hand, insoluble m6Fab LZ Hc-GFP expressed at 37 ° C was refolded to successfully prepare a fusion that retained both antibody and GFP activity. The antibody titer of this molecule was equivalent to that without GFP fusion.

In this study, it was shown that an enzyme fusion can be produced using a Zipbody derived from mouse and rabbit. Based on the above, it is considered that fusion proteins can be produced in the future by combining Zipbody derived from various biological species (human, goat, rat, etc.) and various types of enzymes (horseradish peroxidase, alkaline phosphatase, etc.). It is done.

<Verification of versatility>
The versatility of the enzyme fusion using Zipbody was verified by an experiment in which another enzyme (alkaline phosphatase) was fused.

(1) Preparation of plasmid First, the amino acid Ser-Lys-Ile immediately after the start codon of heavy chain and light chain of pET22 m6Fab LZ (plasmid 1) in which the gene of m6Fab LZ was introduced into the NdeI site of the expression vector pET22b PET22 SKIKm6Fab LZ (plasmid 2) into which the DNA sequence 5′-TCTAAAATAAAA-3 ′ (SEQ ID NO: 18) encoding -Lys (SKIK) was inserted was prepared. Next, an alkaline phosphatase (AP) gene derived from E. coli was fused to the C-terminus of the heavy chain side antibody gene of plasmid 2 by the in-fusion cloning method, and a Zipbodyzyme (SKIK m6 FabLZ consisting of mouse-derived anti-E. Coli O157 antibody and AP was used. An expression plasmid pET22b SKIK m6FabLZ-AP (plasmid 3) was prepared. Plasmid 3 includes a heavy chain-LZA-AP-His tag (amino acid sequence shown in SEQ ID NO: 35) and a light chain-LZB-FLAG tag (amino acid sequence shown in SEQ ID NO: 36) between the T7 promoter and T7 terminator. These genes are located in series so that both polypeptide chains can be expressed. The sequence of the gene coding region of pET22b SKIK m6FabLZ-AP (plasmid 3) is shown in SEQ ID NO: 37.

(2) Expression and purification Escherichia coli Shuffle T7 Express was transformed with plasmid 3 and used for the expression experiment of Zipbodyzyme. The expression conditions were the same as those for Zipbody, Zipbody-Luc and Zipbody-GFP, and the conditions for induction were culture at 16 ° C. for 20 hours using 250 mL of ampicillin-containing LB medium. The cells were collected and washed, disrupted by ultrasonic disruption, and then separated into a soluble fraction and an insoluble fraction by centrifugation and used for subsequent evaluation.

As a result of SDS-PAGE analysis of the crushed material, protein bands of the desired size (heavy chain-AP [about 80 kDa], light chain [about 30 kDa]) were clearly detected in both the soluble and insoluble fractions ( FIG. 15A). Since AP activity and antibody activity were observed in the soluble fraction (data not shown), the Zipbodyzyme (sometimes referred to as SKIK m6FabLZ-AP) contained in this fraction was purified as follows. First, Ni-NTA affinity chromatography (Wako Pure Chemicals, binding buffer: 50 mM TrisHCl (pH 8.0), 500 mM NaCl, 20 mM Imidazole, washing solution: 50 mM TrisHCl (pH 8.0), 500 mM NaCl, 50 mM Imidazole, eluent: 50 The collected fraction was applied to mM TrisHCl (pH 8.0), 500 mM NaCl, 500 mM Imidazole), and the collected fraction was concentrated by ultrafiltration Amicon centrifugal filter (10 KDa cut-off) to obtain 1.2 liter of a solution having a protein concentration of 0.13 mg / mL. This was purified by gel filtration chromatography (carrier: Superdex200 10/30 GL, eluent: 50 mM TrisHCl (pH 8.0), 500mM NaCl, flow rate: 0.5mL / min), and 1.5mL of a solution with a protein concentration of 0.032 mg / mL Obtained (FIG. 15B). This product was used for the subsequent experiments.

(3) AP activity measurement The AP activity measurement method is as follows. A substrate solution containing paranitrophenyl phosphate (pNPP) (0.1 M Tris-HCl (pH 8.0), 5 mM pNPP) was dispensed in 500 μL aliquots, 5 μL of enzyme solution was added thereto, and incubated at 37 ° C. for 30 minutes. . After 50 μL of 2 M NaOH was added to stop the reaction, absorbance at 410 nm was measured. An enzyme solution containing 1% BSA was used as a negative control.

As a result of serially diluting the SKIK 6FabLZ-AP purified product and measuring AP activity, activity was recognized as shown in FIG. 16A.

(4) ELISA and AP-ELISA
In order to examine whether SKIK m6FabLZ-AP functions as an antibody, a purified protein sample diluted serially was used to perform normal ELISA and AP-ELISA using AP activity as an index. In normal ELISA, anti-HIS-HRP (MBL) is used as the secondary antibody, and the TMB solution (41 mM TMB (in DMSO) 62.5 μL, 30% hydrogen peroxide 0.875 μL, SolutionI (0.2M citrate buffer, pH 4.0) mixed with 5 mL was used.

AP-ELISA is the same method as the light-emitting ELISA except that a transparent Maxisorp plate is used and color development is used as an index. Specifically, after washing the Zipbodyzyme solution, 350 μL of a substrate solution containing pNPP was added and reacted at 37 ° C. for 30 minutes. After 35 μL of 2M NaOH was added to stop the reaction, the absorbance at 410 nm was measured.

The results of normal ELISA and AP-ELISA are shown in FIGS. 16B and 16C, respectively. In general ELISA, a specific ELISA signal for the antigen E. coli O157 was detected at a sample concentration of 320 通常 ng / mL or more and in AP-ELISA at a concentration of 32000 ng / mL.

(5) Summary The Zipbodyzyme fused with AP was expressed in a large amount in the soluble fraction of Escherichia coli and purified. Using the purified product, normal ELISA and AP-ELISA could be performed.

The antibody of the present invention has a stable structure and exhibits high affinity for an antigen. Moreover, the fused labeled protein (for example, an enzyme) exhibits a sufficient function. The antibody of the present invention having such excellent characteristics includes various detection methods represented by ELISA, staining of cells or tissues, use for in vivo imaging, and further use / application for diagnosis and treatment of diseases. There is expected.

The present invention is not limited to the description of the embodiments and examples of the above invention. Various modifications may be included in the present invention as long as those skilled in the art can easily conceive without departing from the description of the scope of claims. The contents of papers, published patent gazettes, patent gazettes, and the like specified in this specification are incorporated by reference in their entirety.

SEQ ID NO: 1 Description of artificial sequence: pET22 m6Fab LZ Hc-Luc
SEQ ID NO: 2 Description of artificial sequence: pET22 r4Fab LZ Hc-Luc
SEQ ID NO: 3 Description of artificial sequence: pET22 m6Fab LZ Hc-GFP
SEQ ID NO: 4: Description of artificial sequence: pET22 r4Fab LZ Hc-GFP
Sequence number 5: Description of artificial sequence: LZA
Sequence number 6: Description of artificial sequence: LZB
SEQ ID NO: 7: description of artificial sequence: linker SEQ ID NO: 8-24: description of artificial sequence: tag sequence SEQ ID NO: 25-34: description of artificial sequence: primer SEQ ID NO: 35: description of artificial sequence: heavy chain-LZA-AP -His tag
SEQ ID NO: 36: Description of artificial sequence: light chain-LZB-FLAG tag
SEQ ID NO: 37: Description of artificial sequence: gene coding region of pET22b SKIK m6FabLZ-AP

Claims

One of the pair of peptides constituting the leucine zipper is added to the C terminus of the H chain, and the other is added to the C terminus of the L chain,
A labeled protein is linked to the H chain and / or the L chain via the peptide,
Labeled protein fusion Fab antibody.
The labeled protein fusion Fab antibody according to claim 1, wherein the labeled protein is linked only to the H chain.
The labeled protein-fused Fab antibody according to claim 1 or 2, wherein the labeled protein is a fluorescent protein or a luminescent enzyme.
The labeled protein-fused Fab antibody according to claim 3, wherein the fluorescent protein is GFP and the luminescent enzyme is luciferase.
The peptide tag which consists of an amino acid sequence of SK, SKX, SKXX, AKXX or KKXX (where X represents any amino acid residue) is linked to the N-terminus of the H chain and the L chain, respectively. 5. The labeled protein fusion Fab antibody according to any one of 1 to 4.
The labeled protein-fused Fab antibody according to any one of claims 1 to 5, wherein the antibody is a refolded antibody.
The labeled protein-fused Fab antibody according to any one of claims 1 to 5, which is synthesized in the cytoplasm of E. coli.
A detection reagent comprising the labeled protein-fused Fab antibody according to any one of claims 1 to 7.
A detection kit comprising the detection reagent according to claim 8.
The following steps:
(A) co-expressing antibody H chain gene encoding VH region and CH1 region and antibody L chain gene encoding VL region and CL region, or (B) antibody H chain encoding VH region and CH1 region A gene and an antibody L chain gene encoding a VL region and a CL region, respectively, and then mixing the expression product,
Including
Of the pair of peptides constituting the leucine zipper, the first tag sequence encoding one of them is at the 3 ′ end of the antibody H chain gene, and the second tag sequence encoding the other is at the 3 ′ end of the antibody L chain gene. Each has been added,
A labeled protein gene is linked to the antibody H chain gene and / or the antibody L chain gene via the first or second tag sequence,
Preparation method of labeled protein fusion Fab antibody.
The preparation method according to claim 10, wherein the marker protein gene is linked only to the antibody H chain gene.
The preparation method according to claim 10 or 11, wherein the step is performed using an expression system using a host cell or a cell-free protein synthesis system.
The expression system is an expression system using E. coli, and the amino acid sequence of SK, SKX, SKXX, AKXX or KKXX is provided on the 5 ′ end side of the antibody H chain gene and the antibody L chain gene (where X is A sequence encoding a peptide tag consisting of any amino acid residue) is added,
The preparation method according to claim 12, wherein the labeled protein fusion Fab antibody is expressed as a tagged protein in which the peptide tag is linked to the N-terminus.
The preparation method according to claim 13, wherein the peptide tag consists of an amino acid sequence of SKI, SKIK, SKKK, SKII, AKIK, AKII or KKKK.
The preparation according to claim 13 or 14, wherein a protease recognition sequence is interposed between the sequence encoding the peptide tag and the antibody heavy chain gene, and between the sequence encoding the peptide tag and the antibody light chain gene. Law.
The preparation method according to any one of claims 13 to 15, wherein the expression system using E. coli is an expression system using a T7 promoter or an expression system using a low-temperature expression promoter.
The preparation method according to any one of claims 13 to 15, wherein the expression system using E. coli is a cell-free protein synthesis system using E. coli-derived components.
The preparation method according to any one of claims 10 to 17, wherein the antibody H chain gene and the antibody L chain gene are prepared by the following steps (i) to (viii):
(i) providing mRNA derived from a single B cell;
(ii) preparing cDNA by reverse transcription PCR using the mRNA as a template;
(iii) PCR is performed using a primer set consisting of multiple primers containing the same third tag sequence at the 5 ′ end and capable of amplifying the antibody H chain gene encoding the VH region and CH1 region, and using the cDNA as a template. Step to do;
(iv) PCR is performed using a primer set consisting of multiple primers containing the same fourth tag sequence at the 5 'end and capable of amplifying the antibody L chain gene encoding the VL region and CL region, and using the cDNA as a template Step to do;
(v) performing PCR using a single primer containing the third tag sequence and using the amplification product of step (iii) as a template;
(vi) performing PCR using a single primer containing the fourth tag sequence and using the amplification product of step (iv) as a template;
(vii) adding the first tag sequence to the antibody heavy chain gene that is the amplification product of step (v);
(viii) A step of adding the second tag sequence to the antibody L chain gene that is the amplification product of step (vi).
The preparation method according to any one of claims 10 to 17, wherein the antibody H chain gene and the antibody L chain gene are prepared by the following steps (I) to (IV):
(I) providing mRNA derived from a single B cell;
(II) preparing cDNA by reverse transcription PCR using the mRNA as a template;
(III) amplifying the antibody H chain gene by a nested PCR method using the cDNA as a template,
(IV) Amplifying the antibody L chain gene by a nested PCR method using the cDNA as a template.
A promoter,
A first cloning site for a gene encoding one of the antibody chains constituting the Fab antibody;
A first leucine zipper sequence encoding one of a pair of leucine zipper peptides;
A second cloning site for a gene encoding the other antibody chain constituting the Fab antibody;
A second leucine zipper sequence encoding the other of the pair of leucine zipper peptides, and
A sequence encoding a labeled protein is arranged downstream of the first leucine zipper sequence and / or the second leucine zipper sequence.
Vector for preparing labeled protein fusion Fab antibody.
The promoter is a promoter that functions in E. coli;
21. The vector of claim 20, wherein a ribosome binding site is disposed between the promoter and the first cloning site.
Immediately before the first cloning site and immediately before the second cloning site,
A sequence encoding a peptide tag consisting of an amino acid sequence of SK, SKX, SKXX, AKXX or KKXX (X represents an arbitrary amino acid residue) arranged immediately after the initiation codon is arranged. The vector according to claim 20 or 21, wherein
A promoter,
A first antibody gene encoding one of the antibody chains constituting the Fab antibody;
A first leucine zipper sequence encoding one of a pair of leucine zipper peptides;
A second antibody gene encoding the other antibody chain constituting the Fab antibody;
A second leucine zipper sequence encoding the other of the pair of leucine zipper peptides, and
A sequence encoding a labeled protein is arranged downstream of the first leucine zipper sequence and / or the second leucine zipper sequence.
Vector for preparing labeled protein fusion Fab antibody.
The promoter is a promoter that functions in E. coli;
24. The vector according to claim 23, wherein a ribosome binding site is disposed between the promoter and the first antibody gene.
Immediately before the first antibody gene and immediately before the second antibody gene,
A sequence encoding a peptide tag consisting of an amino acid sequence of SK, SKX, SKXX, AKXX or KKXX (X represents an arbitrary amino acid residue) arranged immediately after the initiation codon is arranged. The vector according to claim 23 or 24.
A promoter,
A first cloning site for a gene encoding one of the antibody chains constituting the Fab antibody;
A first vector having a first leucine zipper sequence encoding one of a pair of leucine zipper peptides;
A promoter,
A second cloning site for a gene encoding one of the antibody chains constituting the Fab antibody;
A second vector having a second leucine zipper sequence encoding the other of the pair of leucine zipper peptides,
A sequence encoding a labeled protein is arranged downstream of the first leucine zipper sequence and / or the second leucine zipper sequence.
A vector set for preparing a labeled protein-fused Fab antibody.
A promoter,
A first antibody gene encoding one of the antibody chains constituting the Fab antibody;
A first vector having a first leucine zipper sequence encoding one of a pair of leucine zipper peptides;
A promoter,
A second antibody gene encoding one of the antibody chains constituting the Fab antibody;
A second vector having a second leucine zipper sequence encoding the other of the pair of leucine zipper peptides,
A sequence encoding a labeled protein is arranged downstream of the first leucine zipper sequence and / or the second leucine zipper sequence.
A vector set for preparing a labeled protein-fused Fab antibody.