JP2016002009A - Tagged antibody - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a technology that improves the efficiency of Fab antibody formation and uses therefor.SOLUTION: A Fab antibody is obtained by coexpressing an antibody H chain gene that encodes a VH region and a CH1 region and an antibody L chain gene that encodes a VL region and a CL region. Alternatively, a Fab antibody is obtained by individually expressing an antibody H chain gene that encodes a VH region and a CH1 region and an antibody L chain gene that encodes a VL region and a CL region, and subsequently mixing the expression products. A first tag sequence that encodes one of a pair of peptides that constitute a leucine zipper is added to the antibody H chain gene, and a second tag sequence that encodes the other of said pair is added to the antibody L chain gene.

Description

  The present invention relates to a method for preparing antibodies. Specifically, the present invention relates to a method for preparing a Fab antibody with a tag attached and its use.

  A monoclonal antibody is an antibody obtained from a clone derived from a single B cell and exhibits high specificity. Taking advantage of this feature, monoclonal antibodies are used as clinical diagnostics and therapeutics. In addition, the utility value of monoclonal antibodies is also high as a research tool (analysis, quantification, separation, purification, etc.). In recent years, a technique has been developed that reduces antigenicity to humans by converting monoclonal antibodies into mouse-human chimeric antibodies or humanized antibodies. Accordingly, development of monoclonal antibodies as pharmaceuticals has been developed. In fact, the advancement of antibody drugs is remarkable, and it has begun to shine in the medical field where there are no fundamental therapeutics or preventives.

  Various methods using genetic engineering techniques such as a phage display method, a yeast surface display method, a ribosome display method, as a method for producing a monoclonal antibody molecule and its derivative Fab antibody and scFv antibody (single chain antibody), An mRNA display method has been developed. When producing antibody molecules using genetic engineering techniques, animal cells, yeast, E. coli, etc. are used.

  The method using animal cells requires a lot of time and a great amount of money in order to find efficient synthesis conditions. In addition, the methods using E. coli and yeast have problems that the efficiency of protein folding is poor and the efficiency of forming active molecules is low. On the other hand, a cell-free synthesis system (cell-free protein synthesis system) has been developed and used for antibody production. In fact, our research group uses the cell-free protein synthesis system of SICREX (Single Cell RT-PCR Linked in Vitro Expression), which is a method that enables efficient and rapid preparation of Fab antibodies. Development has been successful (Patent Document 1, Non-Patent Document 1).

Japanese Patent No. 4686682

Biotechnol Prog. 2006 Jul-Aug; 22 (4): 979-88. J. Pestic. Sci. 28, 301-309, 2003

The scFv antibody is obtained by linking only the variable regions of the H chain and L chain with a short linker, and its molecular weight is about 30 kDa. Since it has a low molecular weight, it has many advantages such as smooth transition from blood vessels to tissues and the expectation of mass production at low cost. However, the scFv antibody has a problem that it is easily affected by the order of connecting the H chain and the L chain and the linker sequence, and the affinity is decreased (Non-patent Document 2). In addition, when expressed in E. coli, refolding is required, and sufficient activity may not be exhibited. In contrast, Fab antibody is excellent in stability because of its structure, and can be prepared in a short time when newly prepared from B cells (Non-patent Document 1). On the other hand, Fab formation efficiency differs depending on the type of antibody, and a desired activity may not be obtained. When preparing a Fab antibody in E. coli, the association between molecules is not successful, and an antibody exhibiting activity may not be obtained.
An object of the present invention is to provide a technique for increasing the efficiency of Fab antibody formation (association of H chain and L chain), its use, etc., paying attention to the usefulness of Fab antibody.

In consideration of the above problems, the present inventors have conceived of using a leucine zipper to assist the formation of Fab antibodies, that is, the folding of the Fd portion of the H chain and L chain. In other words, we considered a strategy to add a pair of tag peptides that form leucine zippers to the H chain (Hc) and L chain (Lc) to increase the efficiency of heterodimer formation between Hc and Lc. We decided to investigate the protein synthesis system and the expression system using E. coli. As a result of studies, it has been clarified that in any of the expression systems, the activity of forming an active Fab has been dramatically increased, and an effect exceeding expectations can be obtained. The following invention is mainly based on these results.
[1] The following steps:
(A) co-expressing antibody H chain gene encoding VH region and CH1 region and antibody L chain gene encoding VL region and CL region, or (B) antibody H chain encoding VH region and CH1 region A gene and an antibody L chain gene encoding a VL region and a CL region, respectively, and then mixing the expression product,
Including
A first tag sequence encoding one of a pair of peptides constituting a leucine zipper is added to the antibody H chain gene, and a second tag sequence encoding the other is added to the antibody L chain gene. Preparation of Fab antibody.
[2] The addition position of the first tag sequence is the 3 ′ end of the antibody H chain gene, and the addition position of the second tag sequence is the 3 ′ end of the antibody L chain gene. Preparation method.
[3] The preparation according to [1] or [2], wherein the leucine zipper exhibits a binding force by electrostatic interaction between a positively charged amino acid and a negatively charged amino acid in addition to a hydrophobic bond between leucine and leucine. Law.
[4] The first tag sequence is added to the antibody H chain gene via a linker sequence, and the second tag sequence is added to the antibody L chain gene via a linker sequence. [1] -The preparation method as described in any one of [3].
[5] The preparation method according to any one of [1] to [4], wherein the step is performed using an expression system using a host cell or a cell-free protein synthesis system.
[6] The preparation method according to any one of [1] to [5], wherein the antibody H chain gene and the antibody L chain gene are prepared by the following steps (i) to (viii):
(i) providing mRNA derived from a single B cell;
(ii) preparing cDNA by reverse transcription PCR using the mRNA as a template;
(iii) PCR is performed using a primer set consisting of multiple primers containing the same third tag sequence at the 5 ′ end and capable of amplifying the antibody H chain gene encoding the VH region and CH1 region, and using the cDNA as a template. Step to do;
(iv) PCR is performed using a primer set consisting of multiple primers containing the same fourth tag sequence at the 5 'end and capable of amplifying the antibody L chain gene encoding the VL region and CL region, and using the cDNA as a template Step to do;
(v) performing PCR using a single primer containing the third tag sequence and using the amplification product of step (iii) as a template;
(vi) performing PCR using a single primer containing the fourth tag sequence and using the amplification product of step (iv) as a template;
(vii) adding the first tag sequence to the antibody heavy chain gene that is the amplification product of step (v);
(Viii) A step of adding the second tag sequence to the antibody L chain gene that is the amplification product of step (vi).
[7] The preparation method according to any one of [1] to [5], wherein the antibody H chain gene and the antibody L chain gene are prepared by the following steps (I) to (IV):
(I) providing mRNA derived from a single B cell;
(II) preparing cDNA by reverse transcription PCR using the mRNA as a template;
(III) amplifying the antibody H chain gene by a nested PCR method using the cDNA as a template,
(IV) Amplifying the antibody L chain gene by a nested PCR method using the cDNA as a template.
[8] A tagged Fab antibody in which one of a pair of peptides constituting a leucine zipper is added to the H chain and the other is added to the L chain.
[9] The tagged Fab antibody according to [8], wherein the addition position of the one peptide is the C terminus of the H chain, and the addition position of the other peptide is the C terminus of the L chain.
[10] The tag according to [8] or [9], wherein the leucine zipper exhibits a binding force by electrostatic interaction between a positively charged amino acid and a negatively charged amino acid in addition to a hydrophobic bond between leucine and leucine. Attached Fab antibody.
[11] Any one of [8] to [10], wherein the one peptide is added to the H chain via a linker, and the other peptide is added to the L chain via a linker. The tagged Fab antibody according to Item.
[12] The tagged Fab antibody according to [11], wherein the linker includes a protease cleavage site.
[13] A Fab antibody obtained by removing a tag from the tagged Fab antibody according to any one of [8] to [12].

Outline of SICREX method (example). List of primers used. List of primers used (continued). Elements that make up the cell-free protein synthesis system. Configuration of Fab-LZ (leucine zipper) complex. Results of sandwich ELISA analysis of rabbit IgG Fab-LZ synthesized by cell-free protein synthesis system. For comparison, a negative control in which cell-free protein synthesis was performed without template DNA (no template) and a negative control in which no antigen was immobilized on the plate (no antigen coat) were used. Results of Western blot analysis of rabbit IgG Fab-LZ. Results of non-reducing SDS-PAGE analysis of mouse Fab (No. 6) and mouse Fab (No. 23). S is culture supernatant, P is precipitation. Antigen binding activity of anti-O-157 mouse Fab-LZ complex (by ELISA). For comparison, a negative control in which cell-free protein synthesis was performed without template DNA (no template) and a negative control in which no antigen was immobilized on the plate (no antigen coat) were used. Antigen binding activity of anti-Listeria rabbit Fab-LZ complex (by ELISA). Results of ELISA analysis of Fab-LZ complex and Fab expressed in cell-free protein synthesis system. Fab-LZ complex and Fab were synthesized in a cell-free protein synthesis system using a PCR product amplified under the condition of 1 cell per well as a template, and the binding activity was measured. For comparison, a negative control in which cell-free protein synthesis was performed without template DNA (no template) and a negative control in which no antigen was immobilized on the plate (no antigen coat) were used. Results of non-reducing SDS-PAGE analysis of rabbit Fab-LZ. S is culture supernatant, P is precipitation. List of primers used. List of primers used (continued). List of primers used (continued). List of primers used (continued). List of primers used (continued). List of primers used (continued). Construction of Fab-LZ complex using cell-free protein synthesis system. List of primers used. Amplification of antibody genes from a single cell. SICREX was performed under the condition of 1 cell / well using the peripheral blood of rabbits immunized with L. monocytegenes. The heavy chain and light chain genes derived from the same cells where gene amplification was confirmed were used as templates in a cell-free protein synthesis system. Lanes 1-13 are gene amplifications derived from a single cell collected using a micromanipulator, and lanes 14 are gene amplifications using a B cell concentrated solution diluted to 1 cell / well as a template. Similarly, lane 15 was subjected to gene amplification using a template diluted to 5 cells / well as a template. Lane 16 is a negative control performed without cells. An example of a base sequence encoding a Fab-LZ complex. In the upper sequence (SEQ ID NO: 139), in order from the 5 ′ end to the 3 ′ end, a sequence encoding IgG type VH and CH1, a sequence encoding a linker, a sequence encoding LZA, and an HA tag The sequence which codes is arranged. In the lower sequence (SEQ ID NO: 140), in order from the 5 ′ end to the 3 ′ end, a sequence encoding IgG-type VL and CL, a sequence encoding a linker, a sequence encoding LZB, and a FLAG tag The sequence which codes is arranged. Results of SDS-PAGE analysis of Fab-LZ complex and Fab expressed in a cell-free protein synthesis system. The Fab-LZ complex and Fab expressed by the cell-free protein synthesis system were analyzed by non-reducing SDS-PAGE. “P.C.” is a Fab of mouse catalytic antibody 6D9 and is a positive control, and “N.C.” is a sample without a template. The arrow on the right side indicates the position of the Fab band, and the arrow near the center indicates the position where the band is expected to appear when the disulfide bond of the Fab-LZ complex is formed. Results of SDS-PAGE analysis of Fab-LZ complex and Fab expressed in a cell-free protein synthesis system. The Fab-LZ complex and Fab expressed by the cell-free protein synthesis system were analyzed by reducing SDS-PAGE. “P.C.” is a Fab of mouse catalytic antibody 6D9 and is a positive control, and “N.C.” is a sample without a template. The right arrow indicates the band position of Hc or Lc, and the arrow near the center indicates the position of the Hc or Lc band to which LZ is added. Results of ELISA analysis of mouse Fab-LZ complex and Fab expressed in E. coli. It was expressed in E. coli, and the cell disruption solution was calculated as the activity per culture volume. ELISA result when LZ is added to the V region.

  The first aspect of the present invention relates to a method for preparing a Fab antibody. The preparation method of the present invention comprises antibody H chain gene encoding VH region (heavy chain variable region) and CH1 region (heavy chain constant region 1), VL region (light chain variable region) and CL region (light chain constant region). And expressing an antibody L chain gene encoding). In one embodiment, the antibody H chain gene and the antibody L chain gene are coexpressed (step (A), hereinafter referred to as “coexpression step”). That is, the antibody H chain gene and the antibody L chain gene are expressed in the same expression system. On the other hand, in another embodiment, the antibody H chain gene and the antibody L chain gene are each expressed. In this embodiment, the expression product is mixed after expression, and the antibody H chain and the antibody L chain are associated.

  The Fab antibody is a fragment antibody composed of an H chain having a VH region and a CH1 region and an L chain having a VL region and a CL region, and does not contain an Fc region. In the following description, the H chain constituting the Fab antibody may be referred to as Hc and the gene encoding it may be referred to as the Hc gene, respectively, according to common practice. Similarly, the L chain constituting the Fab antibody may be referred to as Lc, and the gene encoding it may be referred to as Lc gene.

  In the present invention, a leucine zipper is used to improve the formation rate of Fab antibody. Specifically, a Fab antibody to which a leucine zipper has been added (in the present invention, referred to as “tagged Fab”) is prepared. By adding a leucine zipper, the binding force unique to the leucine zipper assists the association of Hc and Lc, and the Fab formation efficiency is improved.

  A leucine zipper is a characteristic structure found as a secondary structure motif of a protein (Science. 1988 Jun 24; 240 (4860): 1759-64.). The structure of the leucine zipper is based on the basic skeleton in which leucine residues are arranged 4 to 5 in every 7 in an amino acid sequence that tends to have an α-helix structure. By this skeleton, leucine residues are arranged in almost one row in the axial direction of the α-helix, and are hydrophobically bonded to the leucine residue sequence in another leucine zipper structure. In the present invention, a pair of peptides (referred to as leucine zipper peptide A and leucine zipper peptide B) containing such a characteristic motif is used. Leucine zipper peptide A and leucine zipper peptide B have high affinity and form leucine zippers. Leucine zipper peptide A contains leucine every 7 residues so that a leucine zipper can be formed. Similarly, leucine zipper peptide B contains leucine every 7 residues. These leucines are arranged so as to correspond to leucine in leucine zipper peptide A (those constituting leucine zipper motif). The lengths of leucine zipper peptide A and leucine zipper peptide B are not particularly limited. May affect association and antibody binding (antigen recognition). Therefore, the length of leucine zipper peptide A and leucine zipper peptide B is, for example, 25 to 50 residues, preferably 28 to 35 residues. The lengths of leucine zipper peptide A and leucine zipper peptide B are basically the same, but may be different in length as long as a leucine zipper structure can be formed.

Various configurations of leucine zippers can be used. Preferably, leucine zippers that exert binding force through electrostatic interaction between positively charged amino acids and negatively charged amino acids in addition to hydrophobic bonds between leucine and leucine are employed. To do. Such leucine zippers (referred to as “charged leucine zippers” for convenience of description) exhibit high binding forces. When a charge-holding leucine zipper is used, leucine zipper peptide A and leucine zipper peptide B have the following structural features (a) or (b).
(a) Leucine zipper peptide A contains a positively charged amino acid (basic amino acid). Leucine zipper peptide B contains a negatively charged amino acid (acidic amino acid) at a position corresponding to the positively charged amino acid of leucine zipper peptide A.
(b) Leucine zipper peptide A contains an acidic amino acid. Leucine zipper peptide B contains a basic amino acid at a position corresponding to the acidic amino acid of leucine zipper peptide A.

  Examples of basic amino acids are lysine (K), arginine (R), and histidine (H). Among these, K or R may be selected for reasons of charge strength. Similarly, examples of acidic amino acids are aspartic acid (D) and glutamic acid (E). Increasing the number of charged amino acids in the leucine zipper peptide increases the electrostatic interaction, which can be expected to improve the binding power of the leucine zipper. Therefore, the proportion of charged amino acids in the leucine zipper peptide is, for example, 15% to 50%, preferably 20% to 40%.

1993 O'shea et al. Designed peptides called ACID-p1 (LZA) and BASE-p2 (LZB) with modified GCN4 leucine zipper (Oshea, EK, KJ Lumb, and PS Kim, 1993, PEPTIDE VELCRO -DESIGN OF A HETERODIMERIC COILED-COIL: Current Biology, v. 3, p. 658-667.). LZA and LZB are not affected by physical conditions such as pH, ionic strength, and temperature, and form heterodimers with high specificity and affinity (Kd = 3 × 10 ^-8 M). LZA and LZB can be used as a pair of leucine zipper peptides rich in charged amino acids. The sequences of LZA and LZB are shown below.
(1) LZA (Leucine zipper peptide that retains negative charge)
AQLEKELQALEKENAQLEWELQALEKELAQK (SEQ ID NO: 1)
Note that glutamic acid (E) is arranged at the 4th, 6th, 11th, 13th, 18th, 20th, 25th, and 27th positions for electrostatic interaction.
(2) LZB (Leucine zipper peptide that retains positive charge)
AQLKKKLQALKKKNAQLKWKLQALKKKLAQK (SEQ ID NO: 2)
For electrostatic interaction, lysine (K) is arranged at the 4th, 6th, 11th, 13th, 18th, 20th, 25th, and 27th positions.

  In the preparation method of the present invention, in order to obtain a Fab antibody to which a leucine zipper has been added, the Hc gene and Lc gene having a characteristic structure are used for expression. That is, an Hc gene to which a nucleotide sequence (referred to as “first tag sequence”) encoding one (leucine zipper peptide A) of a pair of peptides constituting a leucine zipper is added as an antibody gene used in the expression step. And an Lc gene to which a base sequence encoding the other (leucine zipper peptide B) (referred to as “second tag sequence”) is prepared. By expressing such characteristic Hc gene and Lc gene, a Fab antibody to which a leucine zipper has been added is obtained.

  The addition position of the first tag sequence is the 5 ′ end or 3 ′ end of the Hc gene. The addition position of the second tag sequence depends on the addition position of the first tag sequence. That is, when the first tag sequence is added to the 5 ′ end of the Hc gene, the second tag sequence is added to the 5 ′ end of the Lc gene so as to form a leucine zipper that assists in the formation of a correctly associated Fab antibody. Append to Similarly, when the first tag sequence is added to the 3 ′ end of the Hc gene, the second tag sequence is added to the 3 ′ end of the Lc gene.

  Preferably, the addition position of the first tag sequence and the second tag sequence is the 3 ′ end of the antibody gene. In this way, a Fab antibody in which a leucine zipper is added to the C terminus, that is, the constant region side, is obtained. Even when the leucine zipper is added, the antibody exhibits specific binding properties depending on the variable region, and can be used for various applications without removing the leucine zipper portion. However, you may use for various uses, after removing a leucine zipper part.

  On the other hand, when the addition position of the first tag sequence and the second tag sequence is the 5 ′ end of the antibody gene, the resulting tagged Fab antibody has an N-terminus, ie, a leucine zipper added to the variable region side. Become. Therefore, for normal use, the leucine zipper is removed beforehand. Proteases can be used to remove leucine zippers. For example, if a protease cleavage site is included in the below-mentioned linker, the leucine zipper is removed by prosthesis treatment of the tagged Fab antibody obtained by carrying out the preparation method of the present invention, and an untagged Fab antibody is obtained. It is done. In addition to protease treatment, leucine zipper may be removed using intein.

  The first tag sequence and the second tag sequence are linked to the antibody gene directly or via a linker sequence (sequence encoding the linker). In the latter case, a tagged Fab antibody in which leucine zippers are linked by a linker is obtained. By using a linker, the Fab antibody portion and the tag portion (leucine zipper) are linked with appropriate flexibility, so that it is possible to improve the association efficiency of Hc and Lc and the formation efficiency of the leucine zipper structure. For example, a peptide linker is used as the linker. A peptide linker is a linker consisting of a peptide in which amino acids are linked in a straight chain. A typical example of a peptide linker is a linker composed of glycine and serine (GGS linker or GS linker). The GGS linker consists of a sequence in which GGS is repeated one to several times. The number of repetitions is not particularly limited, but is preferably 2 to 6 times, more preferably 2 to 4 times. On the other hand, the GS linker is a sequence in which GGGGS (SEQ ID NO: 3) is repeated 1 to several times. The GGS linker and glycine and serine, which are amino acids constituting the GS linker, have a small size per se and are difficult to form higher-order structures in the linker. Therefore, it is unlikely to become an obstacle during the association of Hc and Lc and the formation of the leucine zipper structure.

  The Hc gene and the Lc gene can be prepared by any method. As described above, the research group of the present inventors has developed a method for obtaining a Fab antibody called SICREX method (Single Cell RT-PCR Linked in Vitro Expression). The SICREX method makes it possible to obtain a desired antibody from antibody-producing cells in a short time. In a preferred embodiment of the present invention, by using the SICREX method, the Hc gene and the Lc gene are prepared easily and in a short time, and the series of operations is accelerated. In a typical operation of the SICREX method (Biotechnol Prog. 2006 Jul-Aug; 22 (4): 979-88.), First a non-human animal immunized against a specific antigen (eg, mouse, B cells are isolated from spleen and peripheral blood of rats and rabbits) or human peripheral blood. Dilute the solution containing the isolated B cells so that the cell count is 1 cell / well. Alternatively, B cells are isolated using a micromanipulator or the like. Next, cDNA is synthesized from mRNA in B cells using reverse transcription PCR (RT-PCR). Subsequently, the Hc gene and the Lc gene are amplified separately by two-step PCR. In the first step of the two-step PCR, a plurality of cDNA-specific primers (first primer set) having the same tag sequence added to the 5 ′ end are used. The second stage PCR is performed using the amplification product of the first stage PCR as a template. In the second stage PCR, a single primer in which the same tag sequence as that used in the first primer set is added at the 5 ′ end is used to specifically and efficiently amplify the first stage PCR product. Amplify to. The single primer used for the second stage PCR is complementary to the 5 ′ end part and the 3 ′ end part of the amplification product obtained by the first stage PCR. Therefore, specific amplification with a single primer becomes possible. Elements necessary for expression in the cell-free protein synthesis system (promoter, terminator, etc.) were bound to the Hc gene and Lc gene obtained by the above operation by overlapping PCR, and then necessary reagents were added. In vitro synthesis (transcription and translation) in one container. The binding ability of the Fab antibody thus synthesized to the antigen can be confirmed by ELISA or the like. If necessary, sequence analysis is performed for those with high binding ability. For the procedure, conditions, application, etc. of the SICREX method, Biotechnol Prog. 2006 Jul-Aug; 22 (4): 979-88., J Biosci Bioeng. 2010 Jan; 109 (1): 75-82 etc. You can refer to it.

When the Hc gene and Lc gene used in the present invention are prepared using the SICREX method, for example, the following steps (i) to (viii) are performed.
(i) Step of preparing mRNA derived from a single B cell
(ii) A step of preparing cDNA by reverse transcription PCR using the mRNA as a template
(iii) A primer set comprising a plurality of primers containing the same tag sequence (third tag sequence) at the 5 ′ end and capable of amplifying an antibody H chain gene (Hc gene) encoding a VH region and a CH1 region, Performing PCR using the cDNA as a template
(iv) A primer set comprising a plurality of primers containing the same tag sequence (4th tag sequence) at the 5 ′ end and capable of amplifying an antibody L chain gene (Lc gene) encoding a VL region and a CL region, Performing PCR using the cDNA as a template
(v) performing PCR using a single primer containing the third tag sequence and using the amplification product of step (iii) as a template
(vi) performing PCR using a single primer containing the fourth tag sequence and using the amplification product of step (iv) as a template
(vii) A step of adding a first tag sequence (sequence encoding leucine zipper peptide A) to the antibody heavy chain gene (Hc gene) which is the amplification product of step (v)
(viii) A step of adding a second tag sequence (sequence encoding leucine zipper peptide B) to the antibody L chain gene (Lc gene) which is the amplification product of step (vi)

  Of the above steps, steps (vii) and (viii) are particularly characteristic of the present invention. The tag sequence in steps (vii) and (viii) can be added by overlap PCR in the same manner as the addition of elements necessary for expression in the cell-free protein synthesis system in the SICREX method.

  When a cell-free protein synthesis system is used for co-expression of the Hc gene and the Lc gene, elements necessary for expression in the cell-free protein synthesis system are also added. This operation can be performed before or after steps (vii) and (viii). Alternatively, it may be performed simultaneously with the addition of the first tag sequence / second tag sequence (that is, the elements necessary for expression in the cell-free protein synthesis system and the tag sequence are added together). A promoter is used as “an element necessary for expression in a cell-free protein synthesis system”. Preferably, a promoter and a terminator are used in combination. More preferably, a promoter, a terminator and a ribosome binding site are used in combination. As the promoter, T7 promoter, T3 promoter, SP6 promoter and the like can be used. As the terminator, for example, a T7 terminator can be used.

By the way, an improved SICREX method that performs two-step PCR in one operation (one-step PCR) by simultaneously using the primers used for the first-step PCR and the second-step PCR at a predetermined quantitative ratio. (J. Biosci. Bioeng., Vol. 101, No. 3, 284-286, 2006). According to this report, in another embodiment of the present invention, the antibody gene is amplified by one-step PCR instead of the conventional two-step PCR. In the case of this aspect, the following steps (a) and (b) are performed in place of the above steps (iii) to (vi).
(a) a primer set comprising a plurality of primers containing the same tag sequence (fifth tag sequence) at the 5 ′ end and capable of amplifying an antibody H chain gene (Hc gene) encoding a VH region and a CH1 region; A step of performing PCR using the cDNA as a template with a single primer containing the fifth tag sequence used at a higher concentration than the primer set
(b) a primer set comprising a plurality of primers containing the same tag sequence (sixth tag sequence) at the 5 ′ end and capable of amplifying an antibody L chain gene (Lc gene) encoding a VL region and a CL region; A step of performing PCR using a single primer containing the sixth tag sequence used at a higher concentration than the primer set and using the cDNA as a template.

  The ratio of the primer set to the single primer is, for example, 1: 2 to 1:50, preferably 1: 5 to 1:20, and more preferably 1: 8 to 1:15.

Instead of the above method (steps (i) to (viii)), the antibody cDNA is specifically amplified by a method (nested PCR method) in which two-step PCR is performed using an outer primer and an inner primer. Also good. In this case, for example, the following steps (I) to (IV) are performed.
(I) providing mRNA derived from a single B cell;
(II) preparing cDNA by reverse transcription PCR using the mRNA as a template;
(III) amplifying the antibody H chain gene by a nested PCR method using the cDNA as a template,
(IV) Amplifying the antibody L chain gene by a nested PCR method using the cDNA as a template.

  For the L chain, for example, PCR is performed using the 1st PCR (LC) set shown in FIG. 15, and then PCR is performed using the 2nd PCR (LC) primer set (the same applies to the H chain). A tag sequence is added to the 5 ′ end of each primer, and a T7 promoter and a T7 terminator can be added by overlap PCR.

  By the way, the co-expression step of the Hc gene and the Lc gene can be performed by an expression system using a host cell or a cell-free protein synthesis system. In the former case, an expression vector holding the Hc gene so that it can be expressed and an expression vector holding the Lc gene so that it can be expressed are prepared, and an appropriate host is transformed with these expression vectors. Alternatively, the host is transformed with an expression vector capable of co-expressing the Hc gene and the Lc gene. The obtained transformant is cultured under conditions that allow expression of the antibody gene from the expression vector, and then the tagged Fab antibody that is an aggregate of the expression product is recovered from the transformant or the culture solution.

  In the embodiment in which the expression product is mixed after expressing the Hc gene and the Lc gene, respectively, while transforming an appropriate host with an expression vector that holds the Hc gene so that it can be expressed, the Lc gene An appropriate host is transformed with an expression vector that can be expressed. After each obtained transformant is cultured, the expression product is recovered from the transformant or the culture solution. Thereafter, the expression products are mixed and associated to obtain a tagged Fab antibody.

  Hosts include bacterial cells (eg, E. coli), yeast cells (eg, Saccharomyces cerevisiae, Schizosaccharomyces pombe, Pichia pastoris), filamentous fungi cells (eg, Aspergillus oryzae, Aspergillus niger), mammalian cells (eg, CHO cells, Sp2 / 0 cells, NS0 cells) and the like. Preferably, E. coli is employed as the host. E. coli is suitable for efficient and large-scale preparation of the target protein (in this case, a tagged Fab antibody). The expression vector may be selected in consideration of the relationship with the host. Each operation and conditions such as transformation, culture, and recovery may be in accordance with conventional methods. Alternatively, each operation may be performed according to past reports.

  The cell-free protein synthesis system does not use living cells, but uses ribosomes derived from living cells (or obtained by genetic engineering techniques), transcription / translation factors, etc. It means to synthesize in vitro. In a cell-free protein synthesis system, a cell extract obtained by purifying a cell disruption solution as needed is generally used. Cell extracts generally contain ribosomes necessary for protein synthesis, various factors such as initiation factors, and various enzymes such as tRNA. When protein is synthesized, other substances necessary for protein synthesis such as various amino acids, energy sources such as ATP and GTP, and creatine phosphate are added to the cell extract. Of course, a ribosome, various factors, and / or various enzymes prepared separately may be supplemented as necessary during protein synthesis.

  Development of a transcription / translation system that reconstitutes each molecule (factor) necessary for protein synthesis has also been reported (Shimizu, Y. et al .: Nature Biotech., 19, 751-755, 2001). In this synthesis system, three types of initiation factors constituting bacterial protein synthesis system, three types of elongation factors, four types of factors involved in termination, 20 types of aminoacyl-tRNA synthetases that bind each amino acid to tRNA, and Genes of 31 types of factors consisting of methionyl tRNA formyltransferase are amplified from the Escherichia coli genome, and the protein synthesis system is reconstructed in vitro using these genes. In the present invention, such a reconstructed synthesis system may be used.

  The cell-free protein synthesis system has the following advantages. First, since there is no need to maintain live cells, operability is good and the degree of freedom of the system is high. Therefore, it is possible to design a synthetic system with various modifications and modifications according to the properties of the target protein. Next, in the synthesis of cell systems, it is basically impossible to synthesize proteins that are toxic to the cells used, but in the cell-free system, even such toxic proteins can be produced. In addition, high throughput can be easily achieved because many types of proteins can be synthesized simultaneously and rapidly. It also has the advantage that the produced protein can be easily separated and purified, which is advantageous for high throughput. In addition, it also has the advantage that non-natural proteins can be synthesized by incorporating non-natural amino acids.

  If a cell-free protein synthesis system is adopted, a series of operations of the preparation method of the present invention can be performed according to the SICREX method, and a tagged Fab antibody can be prepared efficiently and rapidly.

  The cell-free protein synthesis systems currently widely used include the following. That is, an E. coli S30 extract system (prokaryotic cell system), a wheat germ extract system (eukaryotic cell system), and a rabbit reticulocyte lysate system (eukaryotic cell system). These systems are also commercially available as kits and can be used easily.

  Historically, the development of the E. coli S30 extract system has been the oldest, and attempts have been made to synthesize various proteins using this system. The E. coli 30S fraction is prepared through steps of E. coli collection, cell disruption, and purification. The preparation of the 30S fraction of E. coli and the cell-free transcription / translation coupling reaction were performed by the method of Pratt et al. (Pratt, JM: Chapter 7, in “Transcription and Translation: A practical approach”, ed. By BD Hames & SJ Higgins, pp. 179-209, IRL Press, New York (1984)) and the method of Ellman et al. (Ellman, J. et al .: Methods Enzymol., 202, 301-336 (1991)).

  The wheat germ extract system has the advantage of efficiently synthesizing high-quality eukaryotic proteins, and is often used to synthesize eukaryotic proteins that are difficult to synthesize using the E. coli S30 extract system. Is done. Recently, it has been reported that a high-efficiency and stable synthetic system is constructed by preparing an extract from germs from which seed endosperm components have been washed away (Madin, K. et al .: Proc. Natl. Acad. Sci. USA, 97: 559-564, 2000). After that, technical developments such as mRNA untranslated sequence with high translation promoting ability, protein synthesis method for multi-item function analysis using PCR, construction of dedicated high expression vector, etc. were carried out (Sawasaki, T. et al .: Proc Natl. Acad. Sci. USA, 99: 14652-14657, 2002), which is expected to be applied in various fields.

  The wheat germ extract can be obtained by grinding and centrifuging wheat germ and then separating the supernatant by gel filtration. Regarding the translation reaction, the method of Anderson et al. (Anderson, C. W. et al .: Methods Enzymol., 101, 638-644 (1983)) can be referred to. Improved methods have also been reported. For example, Kawarazaki et al. (Kawarasaki, Y. et al .: Biotechnol. Prog., 16, 517-521 (2000)) and Madin et al. (Madin, K. et al. : Proc. Natl. Acad. Sci. USA, 97: 559-564, 2000). In addition, for the wheat germ extract system, WO 00/68412 A1, WO 01/27260 A1, WO 2002/024939 A1, WO 2005/063979 A1, JP-A-6-7134, JP-A-2002-529531, Reference can be made to JP-A-2005-355513, JP-A-2006-042601, JP-A-2007-097438, JP-A-2008-029203, and the like.

  The rabbit reticulocyte lysate system is suitable for globulin production. Rabbit reticulocyte lysate is made anemic by injecting phenylhydrazine intravenously into rabbits for several days, blood is collected after a predetermined period (for example, day 8), and then subjected to ultracentrifugation from the hemolyzed solution. can get. A method for preparing a rabbit reticulocyte lysate can be performed with reference to the method of Jackson and Hunt (Jackson, R. J. and Hunt, T .: Methods Enzymol., 96, 50-74 (1983)).

  The cell-free protein synthesis system that can be used in the practice of the present invention is not limited to the above-described ones. For example, bacterial extracts other than E. coli and plant extracts other than wheat, insect-derived extracts, animal cell-derived extracts A liquid or a system constructed based on genome information may be used.

  The produced tagged Fab antibody can be recovered by conventional methods (centrifugation, filtration, affinity chromatography, etc.). If a collection tag sequence (for example, histidine tag) is incorporated into the Hc gene and the Lc gene, the tag sequence can be used for easy and simple collection.

  According to the preparation method of the present invention, a Fab antibody having a characteristic structure in which a leucine zipper is added can be obtained. Therefore, the second aspect of the present invention provides a tagged Fab antibody to which a leucine zipper is added. In the tagged Fab antibody of the present invention, one of a pair of peptides constituting the leucine zipper (leucine zipper peptide A) is added to the H chain (Hc), and the other (leucine zipper peptide B) is the L chain (Lc). Has been added. The addition positions, structures, and other characteristics of leucine zipper peptides A and B are the same as those described in the first aspect. The corresponding explanation in the first aspect is also used for the use of the linker.

Various modifications can be made to the antibody of the present invention (a tagged Fab antibody or a Fab antibody from which a tag has been removed). For example, a low molecular weight compound, a protein (for example, an enzyme), a toxin, a labeling substance, or the like can be fused or bound to add a function or change properties. Examples of the labeling substance include fluorescent dyes such as fluorescein, rhodamine, Texas red, oregon green, enzymes such as horseradish peroxidase, microperoxidase, alkaline phosphatase, β-D-galactosidase, chemical or bioluminescent compounds such as luminol, acridine dye, etc. , ³ H, ¹³ C, ³² P, ¹³¹ I, ¹²⁵ I, and the like, and biotin. On the other hand, when the antibody of the present invention is prepared as an antibody of an animal species other than human, it may be converted into a humanized antibody, a human chimerized antibody or the like.

  The preparation method of the present invention can be used as a means for obtaining an antibody useful as a research tool, a diagnostic agent, a medicine or the like. For example, an antibody obtained using the preparation method of the present invention can be applied to various immunological methods (for example, ELISA method) as a reagent for capturing, detecting or measuring a specific target. It is also possible to prepare an antibody derived from a specific subject (for example, a patient suffering from a specific disease) and make a diagnosis (evaluation of a disease state or a therapeutic effect) using the obtained antibody. Is possible. On the other hand, an antibody obtained using the preparation method of the present invention can also be used as a therapeutic antibody. For example, an antibody prepared from an immune cell of a person resistant to a specific infectious disease may be used as a therapeutic or prophylactic antibody for the infectious disease. In addition, when applying to a medicine, it is preferable to use an antibody from which a tag has been removed.

A. Efficiency improvement of antibody expression using cell-free protein synthesis system Cell-free protein synthesis system does not require complicated operations such as gene transfer and culture because it does not use living cells such as various microorganisms and animal cells. The advantage is that protein can be synthesized in just a few hours. In the SICREX method, Fab antibodies are synthesized by cell-free protein synthesis using the obtained antibody gene as a template, and the synthesized Fab antibodies are screened by ELISA (FIG. 1). However, there is room for improvement in the expression level of the Fab antibody in the cell-free protein synthesis system, and the Fab formation efficiency formed by the disulfide bond between Hc and Lc may be low. This is an obstacle to screening. Therefore, LZA and LZB are added to the C terminus of Hc and Lc constituting the Fab antibody, respectively, and Hc and Lc are paired by the interaction of LZA and LZB (hereinafter referred to as “Fab-LZ complex”). We aimed to improve Fab formation efficiency.

1. Method
1-1. Examination of effectiveness in antibody expression using cell-free protein synthesis system of LZA and LZB
1-1-1. Construction of Rabbit Fab-LZ Fusion Protein Expression Plasmid Plasmid pIDTSMART-KAN: Ra_HcLc carrying the anti-Aβ rabbit IgG Fab antibody gene, RaHc-pRSET-IFC-Fw and RaHc-linker-Rv, RaK-pRSET-IFC-Fw and RaLc-linker-Rv were used as primers to amplify Hc and Lc genes, respectively (25 cycles at 94 ° C for 15 sec, 50 ° C for 15 sec, 68 ° C for 30 sec, Tks Gflex DNA polymerase)). In addition, LZA gene was amplified using pLZA as a template and LZA-Fw and LZA-Rv (25 cycles at 94 ° C. for 15 seconds, 50 ° C. for 15 seconds, 68 ° C. for 15 seconds, using Tks Gflex DNA polymerase). Similarly, LZB gene was amplified using pLZB as a template and LZB-Fw and LZB-Rv. The amplified Hc gene and LZA gene, Lc gene and LZB gene were ligated by overlap PCR using RaHc-pRSET-IFC-Fw and LZA-Rv, RaLc-pRSET-IFC-Fw and LZB-Rv as primers, respectively. (94 ° C for 15 seconds, 50 ° C for 15 seconds, 68 ° C for 90 seconds, 25 cycles, using Tks Gflex DNA polymerase). In addition, inverse PCR was performed using pRSET-B as a template and pRSET-IFC-Fw and pRSET-IFC-Rv to obtain a pRSET linearized vector. The ligated genes were each ligated to the pRSET linearized vector using In-Fusion-Cloning kit (Clontech) to construct pRSET-Ra-Hc-LZA and pRSET-Ra-Lc-LZB. The constructed vector was transformed into Escherichia coli DH5α strain by the heat shock method. This DH5α strain was inoculated into an LB / chloramphenicol plate, a colony was collected, and a plasmid retained by the cell was extracted. The extracted plasmid was subjected to sequence analysis using Big Dye Terminator Ver.3.1 Cycle Sequencing Kit (ABI).

1-1-2. Evaluation of LZ complex formation using sandwich ELISA
Anti-FLAG-tag antibody (Funakoshi) diluted 2000-fold with PBS was dispensed at 50 μl per well, incubated overnight at 4 ° C., and fixed to a Nunc immunoplate (Thermo scientic). After the plate was washed once with PBS, 400 μl of 4% Block Ace solution (snow mark) was dispensed and blocked for 45 minutes. Next, after washing the plate twice with PBST, 50 μl each of the rabbit Fab-LZ complex synthesized by cell-free protein synthesis using pRSET-Ra-Hc-LZA and pRSET-Ra-Lc-LZB template as the primary antibody In addition to the wells, the mixture was reacted at 37 ° C. for 2 hours. After the plate was washed 3 times with PBST, 100 μl of a solution obtained by diluting an anti-HA-biotin-labeled antibody (Cosmo Bio) 2,000 times as a secondary antibody was added to each well and allowed to react at room temperature for 2 hours. After washing with PBST three times, 100 μl of streptavidin-HRP (GE healthcare) diluted 2000 times with PBS was added to each well and incubated at room temperature for 2 hours. After washing with PBST three times, 100 μl of OPD substrate solution (2 mg / ml o-phenylenediamine (Wako Pure Chemical Industries, Ltd.), 0.009% H ₂ O ₂ ) was added and reacted at 37 ° C. for 10 to 30 minutes. 50 μl of 2M H ₂ SO ₄ was added to stop the reaction, and then the absorbance at 492 nm was measured. The measurement was performed using a microplate reader (SPECTRA MAX 250 (Wako)).

1-1-3. Evaluation of Fab formation efficiency using Western blot
Rabbit Fab-LZ complex was synthesized under the same conditions as 1-1-2, the reaction solution was separated by non-reducing SDS-PAGE, and the separated protein was transferred to a nitrocellulose membrane (Advantec) using Trans-blot SD cell ( Bio-Rad). The transferred membrane was blocked overnight using 4% Block Ace solution (snow mark). After washing with PBST, the target protein was labeled using the anti-HA-tag antibody used in 1-1-2 and streptavidin-HRP, and detection was performed using ECL coloring reagent (Amersham) and light capture.

1-1-4. Template DNA Construction for Expression of Anti-O157 Mouse Fab-LZ Complex Using a plasmid encoding an anti-O157 mouse antibody gene as a template, using the primers shown in FIGS. Four types of anti-O157 mouse Fab antibodies No. 16 IgM, No. 16 IgG, and No. 23 were amplified.

  The amplified antibody gene contains the sequences necessary for transcription / translation during cell-free protein synthesis, T7P fragment and T7T-LZA fragment (added to Hc gene), and T7T-LZB fragment (added to Lc gene) as follows: Added in the procedure shown. The T7P and T7T sequences were amplified by PCR using pRSET-LZA and pRSET-LZB as templates (94 ° C for 15 seconds, 50 ° C for 15 seconds, 68 ° C for 30 seconds, 25 cycles, using Tks Gflex DNA polymerase). The T7P fragment was amplified using pRSETb as a template and primers pRSET-T7PFOL-F and pRSET-T7PR. The T7T-LZA fragment and T7T-LZB fragment were amplified using primers pRSET-T7TF-OL-R and LZAFw, pRSET-T7TF-OL-R and LZBFw, respectively. Subsequently, T7P fragment and T7T-LZA fragment or T7T-LZB fragment were added to the antibody gene by overlap PCR (T7T-LZA fragment added to Hc gene, T7T-LZB fragment added to Lc gene), primer OL-F And OL-R (94 ° C. for 15 seconds, 50 ° C. for 15 seconds, 68 ° C. for 15 seconds, 25 cycles, using Tks Gflex DNA polymerase).

1-1-5. Expression and activity evaluation of anti-O157 mouse Fab-LZ complex
Cell-free protein synthesis was performed using the DNA for expression of anti-O157 mouse Fab-LZ complex constructed in 1-1-4 as a template. For cell-free protein synthesis, E. coli A19-derived S30 extract and E. coli BL21Star (DE3) -derived S30 extract were used (FIG. 4). Moreover, ELISA was performed and the binding activity with respect to the antigen was evaluated. As an antigen, O-157 (50 μg / ml) diluted with PBS was used.

1-1-6. Template DNA construction for expression of anti-Listeria rabbit Fab-LZ complex T7P fragment, T7T-LZA fragment or T7T- in the same manner as 1-1-4. An LZB fragment was added. The primers used are shown in FIGS.

1-1-7. Expression and activity evaluation of anti-Listeria rabbit Fab-LZ complex
Cell-free protein synthesis was performed using the DNA for expression of anti-O157 mouse Fab-LZ complex constructed in 1-1-6 as a template. The reaction conditions are the same as in 1-1-5. Moreover, ELISA was performed and the binding activity with respect to the antigen was evaluated. As the antigen, Listeria diluted with PBS (50 μg / ml) was used. Anti-rabbit IgG (H + L) -poly HRP conjugated (Cosmo Bio) was used as the secondary antibody.

2. Results and discussion
2-1. Examination of the effectiveness of LZA and LZB in antibody expression Some of the mouse antibody Fabs, such as the catalytic antibody 6D9, show high Fab formation efficiency when synthesized in a cell-free protein synthesis system derived from E. coli. The formation efficiency of the mouse antibody Fab is not high. In addition, there has not yet been reported an example in which the active rabbit antibody Fab is expressed in a cell-free protein synthesis system. Therefore, by adding positively and negatively charged leucine zippers LZA and LZB to the C-terminals of Hc and Lc, respectively (FIG. 5), heterodimers are formed by the interaction between LZA and LZB, and Fab formation efficiency is improved. Expected to be improved. In this section, we evaluated the effects of LZA and LZB on the formation efficiency of rabbit Fab and the amount of rabbit and mouse active Fab synthesized.

2-1-1. Evaluation of LZ complex formation using sandwich ELISA
HA tags and FLAG tags were added to the C-terminals of LZA and LZB, respectively, and the formation of rabbit IgGFab-LZ complex was evaluated using sandwich ELISA. When the signals were compared with those obtained by adding the HA tag and FLAG tag to the C-terminals of rabbit IgG Fab Hc and Lc, respectively, the rabbit IgG Fab-LZ complex showed a higher signal (FIG. 6). Therefore, it was suggested that a rabbit IgGFab-LZ complex was formed.

2-1-2. Evaluation of Fab Formation Efficiency Using Western Blot Rabbit IgG Fab has a very low Fab formation efficiency due to low binding efficiency of disulfide bonds between Hc and Lc. Therefore, it was examined whether a disulfide bond between Hc and Lc was formed in the rabbit IgGFab-LZ complex. First, a rabbit IgGFab-LZ complex was synthesized in a cell-free protein synthesis system, and then a cell-free protein synthesis product was analyzed by non-reducing SDS-PAGE and Western blot (FIG. 7). In rabbit IgGFab, a disulfide bond between Hc and Lc could not be detected, but in a rabbit IgGFab-LZ complex, a disulfide bond between Hc and Lc was detected. This is because LZA and LZB formed heterodimers, so that the state where Hc and Lc were located in the vicinity of each other was maintained, and the disulfide bond between Hc and Lc was more likely to form. It is thought that.

2-1-3. Expression and activity evaluation of anti-O157 mouse Fab-LZ complex As described above, mouse Fab synthesized using a cell-free protein synthesis system also has low Fab formation efficiency. The amount of synthesis may be low. Therefore, anti-O157 mouse Fab-LZ complex and anti-mouse Fab were synthesized using a cell-free protein synthesis system, and the expression level and activity were compared using SDS-PAGE and ELISA. Fab formation was observed in No. 6 IgMFab and No. 6 IgMFab-LZ complex (FIG. 8). Moreover, compared with No.6 Fab, although the expression level of No. 6 Fab-LZ complex became low, the high signal was shown in ELISA (FIG. 9). From this, it is considered that the Fab formation efficiency was improved and the synthesis amount of the active Fab was increased by expressing it as a Fab-LZ complex. On the other hand, No. 16 IgM, No. 16 IgG, and No. 23 IgM did not retain the antigen-binding activity in any of the Fab and Fab-LZ complexes. Moreover, Fab formation was not seen in any of these.

2-1-4. Expression and activity evaluation of anti-Listeria rabbit Fab-LZ complex Rabbit Fab is expressed as Fab-LZ complex in the same way as mouse Fab, and it is investigated whether the amount of active Fab synthesis increases. It was. The results of ELISA and SDS-PAGE are shown in FIGS. 10 and 11, respectively. SDS-PAGE analysis showed almost no disulfide bond between Hc and Lc in either Fab or Fab-LZ complex, but ELISA showed a higher signal for Fab-LZ in all clones. . From this result, it is considered that by introducing LZ, the rabbit Fab could be heterodimerized regardless of the presence or absence of disulfide bond formation between Hc and Lc, and could retain the binding activity to the antigen.

3. Conclusion By expressing mouse Fab and rabbit Fab as a Fab-LZ complex, we succeeded in improving Fab formation efficiency and increasing the amount of active Fab synthesized.

B. Obtaining Fab-LZ Complex from Rabbit Peripheral Blood Rabbit antibodies have abundant variations in antigen-determining sites compared to mice, and rabbit immunization and blood collection are much easier than in humans and mice. The following studies were conducted with the aim of establishing the SICREX method using rabbit peripheral blood. In addition, by establishing a system using rabbits as target animals, it is possible to acquire antibody genes having high binding activity, and it is considered that experiments and the like can be advanced more efficiently.

1. Method
1-1. Immunization of rabbits
Rabbits (NZW) were immunized with dead cells of Listeria monocytogenes (hereinafter L. monocytogenes) as an antigen. 1.5 ml of complete adjuvant was added to 1 ml of L. monocytegenes (5 × 10 ⁸ CFU) / PBS solution per mouse, and after sonication, the whole volume was injected by subcutaneous injection. Two weeks later, 1.5 ml of incomplete adjuvant was added to 1 ml of antigen 5 × 10 ⁸ CFU / PBS, sonicated, and the whole volume was injected subcutaneously. After another 10 days, 2.5 ml of antigen 5 × 10 ⁸ CFU / PBS solution was injected subcutaneously. The above experiments were conducted in accordance with the handling rules for animal experiments at Nagoya University.

  L. monocytogenes is a gram-positive bacillus that is widely inhabited by humans and animals, and is known as a causative bacterium that causes listeriosis as a zoonotic disease. Listeriosis can progress to encephalomyelitis and sepsis in infants, the elderly, immunocompromised people, and people with underlying diseases, and it has been reported to have a high fatality rate. In addition, since many cases of infection using food as a route of infection have been reported, it has come to be regarded as important in food hygiene monitoring. L. monocytogenes from food is usually cultured, but it takes a week to test, so there is an immunochromatography kit that can quickly check for the presence of L. monocytogenes just by running the sample. It is starting to be used. Therefore, the demand for anti-L. Monocytogenes antibodies in the food industry is expected to increase in the future, so establishing a method for producing anti-L. It will bring great benefits in ensuring food safety for companies.

1-2. Isolation of Lymphocytes from Rabbit Peripheral Blood From an individual whose antibody titer was confirmed to be increased, blood was collected from the ear vein in accordance with the handling rules for animal experiments at Nagoya University. The obtained 16 ml blood sample was divided into 4 ml portions, and 2 ml PBS was added and suspended. Thereafter, 4.5 ml of Pancoll (Funakoshi Co., Ltd.) was placed in a new sample tube, and a suspended blood sample was added on top of it. The sample tube was centrifuged (400 × g, 40 minutes, RT). The sample after centrifugation was separated into several layers. The uppermost layer was a blood plasma layer (serum layer), which was collected for antibody titer measurement and stored at 4 ° C. Then, 8 ml of the B cell cluster in the lower layer was collected in a new sample tube. Three times the amount of PBS was added to the collected B cell solution, centrifuged at 400 g for 10 minutes, the supernatant was discarded and resuspended in 1 ml of PBS. This was used as a lymphocyte solution.

1-3. Removal of nonspecifically bound lymphocytes To remove lymphocytes that nonspecifically bind to magnetic beads, nonspecifically bound lymphocytes were removed using magnetic beads. The magnetic beads are NH beads Sepa-Max (registered trademark), which are magnetic beads bound with a goat polyclonal antibody against E. coli O157. O157 (hereinafter referred to as NH beads) (Cosmo Bio Inc.) or DynaBeads M-280 Streptavidin (hereinafter referred to as SA beads) (Invitogen) in which streptavidin was bound to the surface of the magnetic beads was used. 1-2. Mix 1 ml of the prepared lymphocyte cells and 5 μl of NH beads or SA beads and let stand at room temperature for 2 minutes, then set on a magnetic stand and collect the supernatant, which was used in the subsequent experiments .

1-4. Concentration of antibody-presenting B cells (IgM-presenting B cells) The cells that present an antibody that specifically binds to the antigen on the cell surface were concentrated. After forming a complex of an antigen and a magnetic bead, an antigen-specific IgM-presenting B cell was isolated by recovering the B cell bound to the antigen and the bead complex using a magnetic stand. SA beads were used as magnetic beads, and live L. monocytogenes cells were used as antigens.

1-4 (a). Preparation of Bacterial Solution L. monocytogenes used as an antigen was cultured by shaking with Brain Heart Infusion (Bacto) for 15 hours. The culture was centrifuged at 3,000 rpm for 10 minutes to remove the supernatant, and washed with PBS. After performing the same operation again, it was suspended in 100 μl of PBS and used for the following operation.

1-4 (b). Biotinylation of antigen L. monocytogenes 50 μl (2.0 × 10 ⁹ ) of antigen L. monocytogenes and 1 μl of 100 mM biotin (final concentration 1 mM) are added, and 100 μl is added with 50 mM MES buffer (pH = 5.0). Then, the mixture was stirred for 15 minutes at room temperature (about 7 to 8 rotations per minute) using a rotating disk (Microtube Rotator MTR-103 (As One Co., Ltd.)). Further, 3 mg of EDC was added and stirred at room temperature for 2 hours using a rotating disk. Thereafter, the mixture was centrifuged (3000 rpm, 5 minutes, RT), the supernatant was discarded, and the precipitate was suspended in 100 μl of PBS. This was used as a biotinylated antigen solution.

1-4 (c). Complex formation of biotinylated antigen and SA beads 100 μl of biotinylated antigen solution and 100 μl of SA beads (6 × 10 ⁷ beads) were mixed and stirred at room temperature for 1 hour using a rotating plate. The plate was washed with 200 μl of PBS solution and suspended in 100 μl of PBS solution. The solution containing the antigen / bead complex was set on a magnetic stand and allowed to stand on ice for 10 minutes, the supernatant was removed, and the beads were washed with 100 μl of PBS solution. It was set on a magnetic stand again and allowed to stand on ice for 5 minutes. The supernatant was removed and suspended in 100 μl of PBS. The formation of a complex of antigen and beads was confirmed using ordinary staining.

1-4 (d). Isolation of antigen-specific antibody-presenting B cells (IgM-presenting B cells)
100 μl of the solution containing the antigen-bead complex obtained in 1-4 (c) and 100 μl of the solution containing B cells were mixed and stirred at room temperature for 1 hour using a rotating disk. It was set on a magnetic stand and allowed to stand on ice for 10 minutes, and the supernatant was removed and washed with 200 μl of PBS solution. It was set on the magnetic stand again and allowed to stand on ice for 5 minutes. The supernatant was removed and suspended in 200 μl of PBS. The cell concentration of the solution containing these cells was measured using a Bürkerturk hemocytometer (Nippon Clinical Instrument Co., Ltd.) and a microscope (OLYMPUS M021).

1-5. Isolation of one cell using a micromanipulator
Antigen-specific IgM-presenting B cells were isolated one by one from the lymphocyte cell solution obtained in 1-4 (d) using a micromanipulator under a microscope. The lymphocyte cell solution was diluted with PBS so as to be 1.0 × 10 ⁴ cells / ml, and 100 μl was spread on a petri dish. Confirm the bead-antigen-B cell complex with a microscope, isolate by aspiration using a Pasteur filled with 2.5 μl of PBS at the tip, and DEPC water (Invitrogen) and RNase OUT (Invitrogen) The tip of the Pasteur was folded into the contained microtube and the cells were collected.

1-6. Primer Redesign To further improve the efficiency of the SICREX method using rabbit peripheral blood, the primer associated with the rabbit antibody genetic sequence was redesigned. These primers were collected from “Sequences of Proteins of Immunological Interest” (Kabat et al., 1991) and IMGT database, all sequences were rearranged using Multalin and compared, and antibody sequences were compared. Primers that can be covered were designed.

1-7. Amplification of antibody gene by single-cell reverse transcription PCR and two-step PCR The sequences of the primers used are shown in FIGS. For PCR, Veriti ^™ (Applied Biosystem, USA) or C1000 ™ Thermal Cycler (Bio-Rad) was used. cDNA was prepared using SUPERSCRIPT III First-Strand Synthesis System for RT-PCR (Invitrogen, USA) according to the product protocol (47 ° C. 90 minutes, 70 ° C. 15 minutes, left at 4 ° C.). At that time, in order to confirm the presence or absence of contamination, a well containing no cells was used as a control. Next, in order to amplify the H chain and L chain genes separately, two-step PCR was performed using the synthesized cDNA as a template. After 1 ^st PCR in LA Taq HS ^TM DNA polymerase (Takara Bio Inc.) was used (94 ° C. 3 min, 94 ° C. 30 seconds, 55 ° C. 45 seconds, 25 cycles at 72 ° C. 45 seconds, 72 ° C. 7 minutes , Left at 4 ℃). Then, 1 ^st PCR product as a template, after the performed Tks Gflex DNA polymerase 2 ^nd PCR using (Takara Bio (Ltd.)) (94 ° C. 1 min, 98 ° C. 10 seconds, 50 ° C. 15 seconds, 68 25 cycles at 30 ° C, 68 ° C for 7 minutes, left at 4 ° C). All the PCR operations described above were performed using 96-well plates.

1-8. Sequence analysis
To perform the TA cloning, by PCR using LA Taq ^TM DNA polymerase (Takara Bio Inc.) was added to A at the end of the sequence of 2 ^nd PCR product. Subsequently, the PCR product was subjected to TA cloning using pGEM-T easy vector and DNA Ligation Kit (Mighty Mix) (Takara Bio Inc.). E. coli DH5α competent cells were transformed by heat shock and applied to LB plates aseptically added with final concentrations of ampicillin 50 μl / ml, IPTG 40 μl / ml, and 4% X-gal for 15 hours at 37 ° C. Cultured. The obtained white colonies were collected with a toothpick, suspended in 20 μl of NaOH and subjected to alkali melting, and PCR was performed using 1 μl of the template as a template (94 ° C. for 5 minutes, 94 ° C. for 10 seconds, 50 ° C. for 20 seconds). , 72 ° C 1 minute 30 seconds, 25 cycles, 72 ° C 7 minutes, 4 ° C standing). In this PCR, the primers shown in FIG. 16 were used. The solution after PCR was purified by Fast Gene gel / PCR extraction kit (Fast Gene). Of these, 1 μl was used as a template, and Big Dye Terminator Ver.3.1 Cycle Sequencing Kit (Applied Biosystems) was used to perform a sequencing reaction according to the protocol attached to the kit. After the reaction, ethanol precipitation was performed to collect DNA. 15 μl of Hi-Di Formamide (Applied Biosystems) was added to the collected DNA, and sequence analysis was performed with ABI PRISM 3100 Genetic Analyzer (Applied Biosystems) at the Nagoya University Genetic Experiment Facility.

1-9. DNA construction for Fab expression
T7P and T7T, which are sequences necessary for transcription / translation reaction during cell-free protein synthesis, were added to the antibody gene obtained in 1-7 according to the following procedure. The T7P and T7T sequences were each amplified by PCR using pRSET-B vector (Invitrogen) as a template (94 ° C for 5 minutes, 96 ° C for 30 seconds, 55 ° C for 30 seconds, 72 ° C for 30 seconds, 25 cycles, 72 ° C for 7 minutes, left at 4 ° C). The T7P sequence was amplified using primers pRSET-T7PF and pRSET-T7PR. The T7T sequence was amplified using primers pRSET-T7TF-OL-R and pRSET-T7TR. Subsequently, the gene fragment containing the promoter and terminator was amplified by overlap PCR using In-F and In-R (94 ° C for 1 minute, 98 ° C for 10 seconds, 50 ° C for 15 seconds, 68 ° C for 45 seconds. 25 cycles, 68 ° C 7 minutes, 4 ° C standing). The primers used for these PCRs are shown in FIG.

1-10. Synthesis of antibody molecules in cell-free protein synthesis system Cell-free protein synthesis reaction was previously developed by Jiang et al. (Jiang, XP, Y. Ookubo, I. Fujii, H. Nakano, and T. Yamane) , 2002, Expression of Fab fragment of catalytic antibody 6D9 in an Escherichia coli in vitro coupled transcription / translation system: Febs Letters, v. 514, p. 290-294.). The cell-free protein synthesis reaction solution shown in FIG. 4 was added using the overlap PCR product as a template, and reacted at 30 ° C. for 1 hour. At this time, a cell-free protein synthesis reaction solution containing no template was incubated as a control. After the reaction, the cell-free protein synthesis reaction solution was transferred onto ice to stop the reaction.

1-11. Enzyme-linked immunosorbent assay (ELISA)
First, 50 μl of L. monocytogenes dead cell solution diluted to 10 μg / ml with PBS was dispensed and incubated overnight at 4 ° C. to fix the antigen to the plate. After the plate was washed once with PBS, 400 μl of 4% skim milk solution was dispensed and blocked for 45 minutes. Next, after the plate was washed twice with PBST, 50 μl of the antibody molecule prepared in 1-10. (Cell-free reaction solution diluted with PBS) was added to each well and reacted at 37 ° C. for 2 hours. After washing the plate 3 times with PBST, add 2,000-fold diluted secondary antibody Anti-rabbit IgM + IgG (H + L) -poly HRP conjugate (Funakoshi Co., Ltd.) to 100 μl well and react at room temperature for 2 hours I let you. After washing with PBST three times, 100 μl of OPD substrate solution (2 mg / ml o-phenylenediamine (Wako Pure Chemical Industries, Ltd.), 0.009% H ₂ O ₂ ) was added and reacted at 37 ° C. for 10 to 30 minutes. 50 μl of 2 MH ₂ SO ₄ was added to stop the reaction, and then the absorbance at 492 nm was measured. The measurement was performed using a microplate reader (SPECTRA MAX 250 (Wako)).

1-12. Construction of DNA for expression of anti-L. Monocytogenes rabbit Fab-LZ complex
The DNA construction for expressing the antibody gene obtained in 1-7 as a Fab-LZ complex was performed according to the following procedure (FIG. 18). Amplified with primer raV-Lc-1F and a primer that specifically binds to the C-terminus of the H and L chain constant regions (94 ° C for 1 minute, then 98 ° C for 10 seconds, 55 ° C for 15 seconds, 68 ° C for 30 seconds) 25 cycles, 68 ° C 7 minutes, 4 ° C standing). The primers used for these PCRs are shown in FIG. Using the amplified gene fragment as a template, T7P and LZ-T7T were added by overlap PCR in the same manner as described in 1-1-4. (TcT7-LZA fragment for Hc gene, T7T-LZB for Lc gene) Fragments were added) and expressed by a cell-free protein synthesis system.

2. Results and discussion
2-1. Examination of enrichment of antibody-presenting B cells (IgM-presenting B cells) using magnetic beads
Cells presenting antibodies specific for the antigen were enriched using a complex of SA beads and L. monocytogenes and a magnetic stand. As a result, about 10,000 cells could be obtained. In addition, when observed under a microscope, it was possible to observe that the SA beads and B cells were bound via the antigen L. monocytogenes. In this enrichment, since the antigen L. monocytogenes and magnetic bead complex are selected, in principle, cells presenting antibodies that recognize L. monocytogenes are specifically selected. In addition, since an operation for removing B cells that non-specifically bind to the magnetic beads was performed in advance, it was determined that cells presenting an antibody specific for the antigen could be concentrated using this method. A total of 13 cells were isolated using a micromanipulator while confirming the magnetic bead-antigen-B cell complex in the concentrated B cell solution under a microscope. Single-cell RT-PCR was performed using the 13 isolated cells as a template for RT-PCR.

2-2. Amplification of one-cell-derived antibody gene by RT-PCR and two-step PCR
Using the antigen-specific antibody-presenting B cell isolated in 1-5, we attempted to amplify the antibody gene derived from one cell. Using 13 cells isolated by a micromanipulator, the antibody gene was amplified by reverse transcription and two-step PCR, and electrophoresis was performed (FIG. 20). As a result, in the L chain, a band was confirmed at about 700 bp in 6 out of 13 cells. This suggested that in the case of the L chain, the designed primer could not completely cover the antibody gene sequence of the rabbit L chain. Therefore, it is considered necessary to further improve primer design, PCR conditions, etc., for L chain gene amplification. On the other hand, in the H chain, an IgM type antibody gene was amplified in a band around 700 bp in all cells. This suggested that the designed primers were able to cover the IgM-type antibody gene sequence. In addition, it was confirmed that the IgG type H chain was amplified in 2 cells out of all cells. No. 16 was a negative control in which cells were not used as a template, but antibody gene amplification in the well could not be confirmed. This suggests that the possibility of contamination is low. Six pairs (IgM: No.1, No.6, No.9, No.12 IgG: No.4, No.9) in which amplification was confirmed for both the H chain and L chain genes were sequenced (experimental). Method: 1-8.).

2-3. Sequence analysis
Sequence analysis was performed on 6 pairs (IgM: No.1, No.6, No.9, No.12 IgG: No.4, No.9) in which amplification was confirmed in both the H chain and L chain genes. . As a result of searching for similar base sequences using the data bank of BLAST (http://blast.ncbi.nlm.nih.gov/Blast.cgi), the obtained base sequences were No. 1, No. 6, No. .9, No. 12 were confirmed to be IgM type antibody genes, and No. 4, No, 9 were confirmed to be IgG type antibody genes. We thought that the cells used as RT-PCR templates were antibody-presenting B cells, but we were able to amplify IgG-type antibody genes. This is probably because the memory cells presenting IgG-type antibodies were also present in the concentrated lymphocyte solution, and thus the antibody gene derived from the memory cells was amplified.

2-4. Expression and activity measurement of rabbit Fab using cell-free protein synthesis system
Of the antibody genes of H chain and L chain obtained by RT-PCR and two-step PCR performed under the condition of 1 cell / well, well No. was subjected to gene amplification and sequence analysis in both H chain and L chain. Overlapping PCR was performed using 6 pairs of No. 1, No. 4, No. 6, No. 9M, No. 9G and No. 12 as templates, and sequences of promoters and terminators necessary for the cell-free protein synthesis system were added. When ELISA was performed to confirm the binding ability of Fab synthesized using cell-free protein synthesis system to L. monocytogenes using overlapping PCR product as a template, no significant binding activity could be confirmed in any sample. It was. As a cause of this, it was thought that the low Fab formation efficiency due to the disulfide bond between the H chain and the L chain might affect the binding activity. Therefore, analysis of Fab expression on SDS-PAGE was performed.

2-5. Analysis of rabbit Fab expression on SDS-PAGE Overlapping antibody genes of 6 pairs (well No.1, No.4, No.6, No.9M, No.9G, No.12) Using the PCR product as a template, the antibody was expressed in a cell-free protein synthesis system, and SDS-PAGE using fluorescent lysine was performed to examine the presence or absence of Fab expression. Although antibody expression was confirmed for both H and L chains, Fab formation was not observed. As a factor of this result, the intramolecular structure of rabbit antibody and the disulfide bond between H chain and L chain are complicated by the positional relationship of cysteine. Therefore, in the expression using cell-free protein synthesis system, the efficiency of Fab formation by disulfide bond Was thought to be low. When disulfide bonds are not formed, the binding activity can be measured, so cell-free proteins as single-chain antibodies (scFv) in which the variable regions of H and L chains are linked via a polylinker instead of Fab It was decided to use a synthetic system to examine its binding activity.

2-6. Examination of effectiveness based on expression and activity measurement of rabbit Fab-LZ complex Leucine zipper (hereinafter referred to as LZ) is known to have a function of forming a protein dimer. It was hypothesized that the H chain and L chain might contribute to the formation efficiency of disulfide bonds by the function of LZ. In order to examine its effectiveness, the following experiment was conducted. First, in addition to wells No.1 and No.4 that were able to confirm the binding activity when expressed as a single chain antibody (scFv), the H chain and L of the antibody genes No.9M and No.9G The promoter, terminator, and LZ sequences necessary for the cell-free protein synthesis system were added to the chain using overlap PCR. An ELISA was performed to confirm the binding ability of Fab and Fab-LZ complexes synthesized in a cell-free protein synthesis system to L. monocytogenes. As a result, all Fab-LZ complex samples bound about 5 times the Fab. It was confirmed to have activity. In order to confirm whether this increase in binding activity was due to an increase in Fab formation efficiency due to the adhesion of α-helix of LZ, the expression of Fab-LZ complex was analyzed by SDS-PAGE using fluorescent lysine. . A representative example of the nucleotide sequence encoding the Fab-LZ complex (clone No. 4) is shown in FIG.

2-7. Expression analysis of rabbit Fab-LZ complex by SDS-PAGE. Express the Fab-LZ complex in a cell-free protein synthesis system, perform SDS-PAGE using fluorescent lysine, and evaluate the effectiveness of LZ. It was investigated. As a result of non-reduced SDS-PAGE (FIG. 22) and reduced SDS-PAGE (FIG. 23), expression of both H chain and L chain was confirmed, but Fab formation was not observed. From this, it was found that the association of H chain and L chain by LZ does not contribute to the increase of disulfide bond formation efficiency. However, even if the formation of disulfide bonds is insufficient, the H-chain and L-chain are adjacent to each other due to the adhesive force of α-helix between LZ, and the binding activity is increased by forming the original conformation. It is thought that there is not. This suggested that fusing LZ to the C-terminus of Fab contributes to an increase in Fab binding activity.

3. Summary By using a microscope and a micromanipulator, it became possible to isolate one cell at a time from the concentrated antibody-presenting B cells. In addition, binding activity that could not be measured with Fab could be confirmed by expressing it as a Fab-LZ complex.

C. Recombinant expression in E. coli
In order to examine whether the interaction between LZA and LZB is also effective in in vivo antibody preparation, Fab and mouse anti-E. Coli O157 antibody No. 6 (similar to the experiment in 1-1-4.) Fab-LZ was expressed in E. coli for protein expression Shuffle T7 express E. coli (New England Biorabs) and evaluated by ELISA.

1. Construction of expression plasmid An expression plasmid was constructed as follows. First, in the construction of the Fab expression vector, the Hc and Lc Fab regions of the anti-O157 antibody No. 6 were used as primers 1F (TTAAGAAGGAGAtatacatATGGAGGTCCAGCTGCAACAGTC (SEQ ID NO: 125)) and 17R (TCCTTCTAGATTATTAAGCGTAATCTGGAACATCGTATGGGTACATGGTACCGCCTGGAATGGGCACATGCTGGAATGGGCAGC Amplified with a set of TAATAATCTAGAAGGAGATATCATATGGATGTTTTGATGACCCAAAC (SEQ ID NO: 127) and 18R (CATCGTCGTCCTTGTAGTCGGAACCGCCACACTCTTTCCTGTTGAAGCTC (SEQ ID NO: 128)) (94 ° C for 30 seconds, 55 ° C for 30 seconds, 72 ° C for 2 minutes, using KOD plus) Similarly, the pET22b vector (Novagen) was amplified with a set of primers pET22b-F (ccGACTACAAGGACGACGATGACAAATAATAAGATCCGGCTGCTAACAAAGC (SEQ ID NO: 129)) and pET22b-R (CATATGTATATCTCCTTCTTAA (SEQ ID NO: 130)) (94 ° C 30 seconds, 55 ° C 30 Seconds, 25 cycles at 72 ° C for 4 minutes, using KOD plus). These were treated with the restriction enzyme DpnI (Takara Bio), purified with a DNA purification kit FastGene Gel / PCR Extraction Kit (Nippon Genetics), and ligated using a Gibson Assembly system (New England Biorabs). Thus, DH5alpha heat shock competent cells were transformed and applied to an LB agar medium containing 50 μg / mL ampicillin to obtain colonies having the target plasmid.

  In the construction of the Fab-LZ expression vector, the Hc and Lc Fab forming regions of anti-O157 antibody No. 6 were set as primers 1F and 19R (AGCTGGGCGCTCCCACCACCGCCTGGAATGGGCACATGCAGATCTTTG (SEQ ID NO: 131)) and 2F and 20R (same as above). Amplified with a set of CTGGGCGCTCCCACCACCGCCACACTCTTTCCTGTTGAAGCTC (SEQ ID NO: 132) (94 ° C for 30 seconds, 55 ° C for 30 seconds, 72 ° C for 2 minutes, 25 cycles, using KOD plus). In PCR which amplifies LZA and LZB regions using pRSET-LZA and pRSET-LZB as templates, primer sets 15F (GGCGGTGGTGGGAGCGCCCAGCTCGAAAAGGAG (SEQ ID NO: 133)) and 16R (TGATATCTCCTTCTAGATTATTAAGCGTAATCTGGAACATC (SEQ ID NO: 134)) and TGGGAGAGGAGGGC )) And r9R (ATCGTCGTCCTTGTAGTCGGAACCGCCCTTCTGGGCCAGCTTCTTCTTC (SEQ ID NO: 136)) were used (94 ° C. for 30 seconds, 55 ° C. for 30 seconds, 72 ° C. for 20 seconds, using KOD plus). Amplified Hc and LZA were ligated by overlap PCR, and Lc and LZB were also ligated in the same manner (94 ° C for 30 seconds, 55 ° C for 30 seconds, 72 ° C for 1 minute, 25 cycles, using KOD plus). The overlapping PCR product and linear pET22b amplified with the same set of pET22b-F and pET22b-R as described above were ligated by the Gibson Assembly system to obtain the target plasmid.

  Shuffle T7 express E. coli was transformed by the heat shock method using the Fab expression vector (hereinafter, pET22b-m6Fab) and Fab-LZ expression vector (hereinafter, pET22b-m6Fab-LZ) obtained by the above method. In addition, what was similarly added with pET22b was used as a negative control.

2. Antibody Expression Experiment The transformant was inoculated into 3 mL of LB medium (hereinafter, LBA medium) containing 50 μg / mL ampicillin and cultured overnight at 37 ° C. with shaking. 100 μL of this was inoculated into 20 mL of LBA medium and cultured with shaking at 30 ° C. until OD600 = 0.5. To this, 1M IPTG was aseptically added to a final concentration of 1 mM, ice-cooled, and cultured with shaking at 16 ° C. for 24 hours. The cells were collected by centrifugation at 8000 G for 10 minutes, suspended in PBS, and centrifuged again to remove the medium components. Add tens of mg of 1.5 mL of PBS and 0.1 mm zirconia beads to the cells, transfer them to a 2 mL tube, and crush the cells with a bead crusher (Tomy Seiko Micro Smash, MS-100R) under ice cooling (5000 Repeat rpm and 30 seconds 5 times). This was centrifuged at 13000 rpm for 5 minutes, and the supernatant was used as a cell disruption soluble fraction. Each portion was stored at 4 ° C. and used for the subsequent experiments.

3. ELISA
Except for the following changes, the method shown in 1-1-5. Was followed. First, a heat-killed cell suspension of E. coli O157 (GTC 03904, obtained from National BioResource Project) suspended in PBS so that OD600 = 0.1 on a Nunc polysoap 96 well plate or 0.4% BSA (in PBS) 50 μL was added dropwise and allowed to stand at 4 ° C. overnight to coat each. The above-mentioned cell disruption soluble fraction was used as the primary antibody, and HRP-labeled anti-mouse Fab antibody (BET A90-100P) was used as the secondary antibody. Further, 0.4% BSA was used as a blocking agent. In the detection reaction, 50 μL of BM blue POD substrate / soluble (Roche) was added and reacted at room temperature for 10 minutes, and then the reaction was stopped by adding 50 μL of 1 M sulfuric acid solution. Absorbance at 450 nm was measured with a plate reader (Tecan, M200). By this method, the antibody activity per E. coli culture solution can be known.

  As a result, as shown in FIG. 24, Fab-LZ showed a signal about 7.5 times higher than Fab when O157 was used as an antigen. From this, it was found that Fab-LZ is produced in an active state even in vivo, and shows a significantly higher signal compared to Fab as in the case of preparation in a cell-free protein synthesis system. From the above, it was shown that LZ addition is effective not only in vitro (cell-free system) but also in vitro.

D. Comparative Experiment As a comparative control, HZA and Lc variable regions (V regions) added with LZA and LZB were recombinantly produced by E. coli as described above and evaluated by ELISA. First, the Hc and V regions were amplified by a set of primers 1F and 21R (CTGGGCGCTCCCACCACCGCCGTAAGCAAACCAGTCCTCGTC (SEQ ID NO: 137)) and 2F and 12R (GCTCCCACCACCGCCAGCATCAGCCCGTTTCAGCTCC (SEQ ID NO: 138)). This was ligated to the LZA and LZB fragments by overlap PCR in the same manner as when the Fab-LZ expression plasmid was prepared. Finally, the VH-LZA and VL-LZB fragments and the linear pET22b were ligated by the Gibson Assembly system. Ligated (constructed plasmid is hereinafter referred to as pET22b-m6V-LZ). Expression conditions and ELISA conditions were the same as above, but as a negative control for the primary antibody, only the soluble fraction of pET22b transformant and PBS alone were used. In addition to HRP-labeled anti-mouse Fab antibody, antibodies against FLAG tag (HRP-labeled anti-FLAG tag antibody: GTX77454, GeneTex) were used as secondary antibodies. In all the expression plasmids of m6Fab, m6Fab-LZ and m6V-LZ, a Flag tag sequence is added to the C-terminal side of Lc.

  The result of ELISA is shown in FIG. A is a case where an HRP-labeled anti-mouse Fab antibody is used as a secondary antibody, and B is a case where an HRP-labeled anti-FLAG tag antibody is used as a secondary antibody. Compared with the negative control, m6Fab, and m6V-LZ, m6Fab-LZ showed the highest signal. m6V-LZ was not different from the negative control, and it was considered that it did not function as an antibody. This suggests that the effect of LZ may not be obtained even if LZ is added to the V region, confirming the effectiveness of adding LZ to the end of the Fab.

  According to the preparation method of the present invention, an active Fab antibody can be efficiently prepared. In particular, when a cell-free protein synthesis system is used as an expression system, the operation can be simplified and speeded up, and the Fab antibody can be prepared in a short time. The antibodies obtained by the preparation method of the present invention are expected to be used for various purposes such as research tools, diagnostic agents, and pharmaceuticals.

  The present invention is not limited to the description of the embodiments and examples of the invention described above. Various modifications may be included in the present invention as long as those skilled in the art can easily conceive without departing from the description of the scope of claims. The contents of papers, published patent gazettes, patent gazettes, and the like specified in this specification are incorporated by reference in their entirety.

Sequence number 1: Description of artificial sequence: LZA
Sequence number 2: Description of artificial sequence: LZB
SEQ ID NO: 3: Description of artificial sequence: Linker SEQ ID NO: 4-138: Description of artificial sequence: Primer SEQ ID NO: 139: Description of artificial sequence: Hc-LZA complex SEQ ID NO: 140: Description of artificial sequence: Lc-LZB complex

Claims (13)

The following steps:
(A) co-expressing antibody H chain gene encoding VH region and CH1 region and antibody L chain gene encoding VL region and CL region, or (B) antibody H chain encoding VH region and CH1 region A gene and an antibody L chain gene encoding a VL region and a CL region, respectively, and then mixing the expression product,
Including
A first tag sequence encoding one of a pair of peptides constituting a leucine zipper is added to the antibody H chain gene, and a second tag sequence encoding the other is added to the antibody L chain gene. Preparation of Fab antibody.   The preparation method according to claim 1, wherein the addition position of the first tag sequence is the 3 'end of the antibody H chain gene, and the addition position of the second tag sequence is the 3' end of the antibody L chain gene. .   The preparation method according to claim 1, wherein the leucine zipper exhibits binding force by electrostatic interaction between a positively charged amino acid and a negatively charged amino acid in addition to a hydrophobic bond between leucine and leucine.   The first tag sequence is added to the antibody H chain gene via a linker sequence, and the second tag sequence is added to the antibody L chain gene via a linker sequence. The preparation method according to any one of the above.   The preparation method according to any one of claims 1 to 4, wherein the step is performed using an expression system using a host cell or a cell-free protein synthesis system. The preparation method according to any one of claims 1 to 5, wherein the antibody H chain gene and the antibody L chain gene are prepared by the following steps (i) to (viii):
(i) providing mRNA derived from a single B cell;
(ii) preparing cDNA by reverse transcription PCR using the mRNA as a template;
(iii) PCR is performed using a primer set consisting of multiple primers containing the same third tag sequence at the 5 ′ end and capable of amplifying the antibody H chain gene encoding the VH region and CH1 region, and using the cDNA as a template. Step to do;
(iv) PCR is performed using a primer set consisting of multiple primers containing the same fourth tag sequence at the 5 'end and capable of amplifying the antibody L chain gene encoding the VL region and CL region, and using the cDNA as a template Step to do;
(v) performing PCR using a single primer containing the third tag sequence and using the amplification product of step (iii) as a template;
(vi) performing PCR using a single primer containing the fourth tag sequence and using the amplification product of step (iv) as a template;
(vii) adding the first tag sequence to the antibody heavy chain gene that is the amplification product of step (v);
(viii) A step of adding the second tag sequence to the antibody L chain gene that is the amplification product of step (vi). The preparation method according to any one of claims 1 to 5, wherein the antibody H chain gene and the antibody L chain gene are prepared by the following steps (I) to (IV):
(I) providing mRNA derived from a single B cell;
(II) preparing cDNA by reverse transcription PCR using the mRNA as a template;
(III) amplifying the antibody H chain gene by a nested PCR method using the cDNA as a template,
(IV) Amplifying the antibody L chain gene by a nested PCR method using the cDNA as a template.   A tagged Fab antibody in which one of a pair of peptides constituting a leucine zipper is added to the H chain and the other is added to the L chain.   The tagged Fab antibody according to claim 8, wherein the addition position of the one peptide is the C-terminus of the H chain, and the addition position of the other peptide is the C-terminus of the L chain.   The tagged Fab antibody according to claim 8 or 9, wherein the leucine zipper exhibits a binding force by electrostatic interaction between a positively charged amino acid and a negatively charged amino acid in addition to a hydrophobic bond between leucine and leucine.   The tag according to any one of claims 8 to 10, wherein the one peptide is added to the H chain via a linker, and the other peptide is added to the L chain via a linker. Attached Fab antibody.   The tagged Fab antibody of claim 11, wherein the linker comprises a protease cleavage site.   A Fab antibody obtained by removing a tag from the tagged Fab antibody according to any one of claims 8 to 12.

Images