WO2018017998A1 - Protéines recombinantes de borrelia et leurs procédés d'utilisation - Google Patents

Protéines recombinantes de borrelia et leurs procédés d'utilisation Download PDF

Info

Publication number
WO2018017998A1
WO2018017998A1 PCT/US2017/043366 US2017043366W WO2018017998A1 WO 2018017998 A1 WO2018017998 A1 WO 2018017998A1 US 2017043366 W US2017043366 W US 2017043366W WO 2018017998 A1 WO2018017998 A1 WO 2018017998A1
Authority
WO
WIPO (PCT)
Prior art keywords
protein
recombinant borrelia
borrelia
ospc
recombinant
Prior art date
Application number
PCT/US2017/043366
Other languages
English (en)
Inventor
Benjamin J. Luft
John F. Bruno
Yun Xu
Original Assignee
The Research Foundation For The State University Of New York
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The Research Foundation For The State University Of New York filed Critical The Research Foundation For The State University Of New York
Publication of WO2018017998A1 publication Critical patent/WO2018017998A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/20—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Spirochaetales (O), e.g. Treponema, Leptospira
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/195—Assays involving biological materials from specific organisms or of a specific nature from bacteria
    • G01N2333/20—Assays involving biological materials from specific organisms or of a specific nature from bacteria from Spirochaetales (O), e.g. Treponema, Leptospira

Definitions

  • Lyme disease is the most common vector-borne disease in North America and Europe, and its range and incidence are increasing. Human Lyme disease is caused by several members of a group of closely related spirochetes belonging to the Borrelia burgdorferi sensu lato species complex. The spirochete is transmitted to humans via ticks of the genus Ixodes (Steere, A. C, N. Engl. J.Med. 1989; 321 :586-96). It is a progressive multisystem disorder characterized by an initial cutaneous infection that can spread early in infection to secondary sites that include the nervous system, heart and joints (Masuzawa, T. et al, Microbiol. Immunol.
  • the present invention encompasses novel recombinant Borrelia burgdorferi proteins and their use in highly sensitive and specific methods of diagnosing Lyme disease in a subject.
  • the present invention is drawn to recombinant Borrelia fusion protein constructs comprising more than one ⁇ e.g., two or three) single recombinant Borrelia protein antigens, such as those described herein.
  • These constructs are also referred to herein as Borrelia chimeric proteins, or chimeric Borrelia proteins, or Borrelia chimeras, or recombinant Borrelia burgdorferi fusion protein constructs, or recombinant Borrelia fusion protein constructs, or recombinant Borrelia fusion proteins, or recombinant Borrelia proteins, or fusion proteins, or chimeric proteins.
  • Examples of recombinant Borrelia fusion protein constructs are described in Tables 2 and 3 herein.
  • the recombinant Borrelia fusion protein constructs of the present invention can have only one single recombinant Borrelia protein antigen described herein ⁇ e.g., any one of the single recombinant Borrelia protein antigens listed in Table 1, Table 2 or Table 3).
  • the present invention is also drawn to methods of using one or more or all of these recombinant Borrelia fusion protein constructs in assays for assessing test samples for detecting the presence of antibodies to Borrelia burgdorferi in the test sample.
  • the Borrelia fusion protein constructs described herein ⁇ e.g., Tables 2 and 3
  • protein arrays ⁇ e.g., microarrays, Q-Plex Arrays
  • ELISA enzyme-Plex Arrays
  • one or more additional single recombinant Borrelia antigens can be included in such assays ⁇ e.g., microarrays, Q-Plex Array), such as the single recombinant Borrelia antigens listed in Table 1 (see PCT Publication WO 2016/057562, the entire teachings of which are incorporated herein by reference).
  • the microarray and/or Q-Plex Array comprises the 6 recombinant Borrelia fusion protein constructs selected from Table 2.
  • the microarray and/or Q-Plex Array comprises the 5 recombinant Borrelia fusion protein constructs selected from Table 3.
  • the microarray and/or Q-Plex Array comprises the 11 recombinant Borrelia fusion protein constructs of Tables 2 and 3 (e.g., SEQ ID NOS 6-16), and/or subsets thereof.
  • the microarray and/or Q- Plex Array comprises 3 single recombinant Borrelia protein antigens described in Table 2 (e.g., Decorin binding protein A (dbpA), Decorin binding protein B (dbpB) and ABC transporter substrate binding protein (OppA)).
  • the microarray and/or Q-Plex Array comprises recombinant Borrelia fusion protein constructs comprising the three single recombinant Borrelia protein antigens described in Table 2 (e.g., SEQ ID NOS 6-11).
  • the microarray and/or Q-Plex Array comprises 8 single recombinant Borrelia protein antigens described in Table 3 (e.g., Outer surface protein A (OspA), purine-binding chemotaxis protein, VMP-like sequence protein VlsE(Vls), p83/100 antigen, surface lipoprotein P27, Outer surface protein C (OspC) typeB, Outer surface protein C (OspC) typeK and BapA protein).
  • OspA Outer surface protein A
  • VlsE(Vls) VMP-like sequence protein
  • p83/100 antigen e.g., surface lipoprotein P27
  • OspC Outer surface protein C
  • OspC Outer surface protein C
  • BapA protein BapA protein
  • the microarray and/or Q-Plex Array comprises recombinant Borrelia fusion protein constructs comprising the 8 single recombinant Borrelia protein antigens described in Table 3 (e.g., SEQ ID NOS 6-11).
  • a subject such as a mammal, including a human
  • methods of diagnosing Lyme disease in a subject by assessing a test sample obtained from the subject for antibodies reactive with one or more of the recombinant Borrelia
  • burgdorferi fusion protein constructs selected from Tables 2 or 3, or, additionally one or more of the single recombinant Borrelia antigens listed in Table 1, wherein the detection of antibody- antigen reactions (such as antibody-antigen bound complexes, also referred to herein as antibody-antigen reaction products) is indicative of Lyme disease in the individual.
  • antibody- antigen reactions such as antibody-antigen bound complexes, also referred to herein as antibody-antigen reaction products
  • microarrays and/or Q-Plex Arrays are used in the detection/diagnostic assays, wherein the microarrays and/or Q-Plex Arrays comprise the recombinant Borrelia fusion protein constructs described herein as in Tables 2 and 3, and/or subsets thereof, and also one or more single recombinant Borrelia antigens described in Table 1.
  • microarrays and/or Q-Plex Arrays are used in the detection/diagnostic assays, wherein the microarrays and/or Q-Plex Arrays comprise the 6 recombinant Borrelia fusion protein constructs selected from Table 2.
  • microarrays and/or Q-Plex Arrays are used in the detection/diagnostic assays, wherein the microarrays and/or Q-Plex Arrays comprise 5 recombinant Borrelia fusion protein constructs selected from Table 3.
  • microarrays and/or Q-Plex Arrays are used in the detection/diagnostic assays, wherein the microarrays and/or Q-Plex Arrays comprise 11 recombinant Borrelia fusion protein constructs of Tables 2 and 3 ⁇ e.g., SEQ ID NOS 6-16), and/or subsets thereof.
  • microarrays and/or Q-Plex Arrays are used in the detection/diagnostic assays, wherein the microarrays and/or Q-Plex Arrays comprise 3 single recombinant Borrelia protein antigens described in Table 2 ⁇ e.g., Decorin binding protein A (dbpA), Decorin binding protein B (dbpB).and ABC transporter substrate binding protein (OppA)).
  • dbpA Decorin binding protein A
  • dbpB Decorin binding protein B
  • OppA ABC transporter substrate binding protein
  • microarrays and/or Q-Plex Arrays are used in the detection/diagnostic assays, wherein the microarrays and/or Q- Plex Arrays comprise recombinant Borrelia fusion protein constructs comprising the 3 single recombinant Borrelia protein antigens described in Table 2 ⁇ e.g., SEQ ID NOS 6-11).
  • microarrays and/or Q-Plex Arrays are used in the detection/diagnostic assays, wherein the microarrays and/or Q-Plex Arrays comprise 8 single recombinant Borrelia protein antigens described in Table 3 (e.g., Outer surface protein A
  • microarrays and/or Q-Plex Arrays are used in the detection/diagnostic assays, wherein the microarrays and/or Q-Plex Arrays comprise recombinant Borrelia fusion protein constructs comprising the 8 single recombinant Borrelia protein antigens described in Table 3 (e.g., SEQ ID NOS 6-11).
  • a highly antigenic Borrelia protein an ABC transporter substrate-binding protein (OppA) (Signorino G et.al.,) that is recognized by approximately 50% of all sera samples analyzed including sera from patients with early Lyme disease, was used to create recombinant Borrelia fusion protein constructs.
  • OppA ABC transporter substrate-binding protein
  • OppA along with the library of 48 other highly antigenic single recombinant Borrelia protein antigens shown in Table 1, was used to develop a set of recombinant Borrelia fusion protein constructs as shown in Tables 2 and 3 and a highly sensitive and specific recombinant protein-based assay containing the 11 recombinant Borrelia fusion protein constructs selected from Table 2 and/or 3 and/or subsets thereof, as described herein.
  • the multiplex ELISA array measures multiple proteins simultaneously within a single tissue sample.
  • the Q-PlexTM technology using the Q-Plex Array is a multiplex ELISA platform that can be used to develop a simple yet accurate tool to quantitate a panel of diagnostic proteins in biologic specimens that can be readily implemented into a clinical laboratory setting.
  • Q-Plex Arrays containing proteins encoded by recombinant Borrelia fusion protein constructs (for, example, those described in Tables 2 and 3) were prepared.
  • the assay using Q-Plex technology and the use of Q-Plex Array for improving Lyme disease diagnosis are described in Example 3 of this application.
  • the Q-Plex Array was exposed to sera from individuals previously diagnosed with disseminated Lyme disease. Results indicated that the sera of individuals with Lyme disease reacted with the highly immunogenic recombinant Borrelia fusion protein constructs, shown in Tables 2 and 3. The overall sensitivity and specificity of the assay using the Q-Plex Array are also described in Example 3 of this application.
  • one or more single recombinant Borrelia protein antigens are used.
  • single recombinant Borrelia protein antigens including but not limited to, cell envelope protein antigens, recombinant lipoprotein antigens, extracellular protein antigens, recombinant antigens described herein (for, example, those described in Tables 1, 2 and 3) can be used.
  • a set of two or more ⁇ e.g., three) single recombinant Borrelia protein antigens are used.
  • sets include the set of single recombinant Borrelia protein antigens shown in Table 1, Table 2 and/or Table 3. In certain embodiments, a set of two or more ⁇ e.g., three) single recombinant Borrelia protein antigens are used.
  • Other example sets of single recombinant Borrelia protein antigens include the set of all known and putative cell envelope proteins and /or lipoproteins of B. burgdorferi. Such a set can further include homologs and paralogs of cell envelope lipoproteins and extra-cellular proteins.
  • sets include sets of two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, or other groups of cell envelope proteins ⁇ e.g., selected from those set forth in Table 2 and/or 3 and additional proteins in Table 1).
  • the set consists essentially of the single recombinant Borrelia protein antigens set forth in Table 1.
  • the set consists essentially of the single recombinant Borrelia protein antigens set forth in Table 2 (for, example, those described under column "gene locus” in Table 2).
  • the set consists essentially of the single recombinant Borrelia protein antigens set forth in Table 3 (for, example, those described under column "gene locus” in Table 3).
  • one or more recombinant Borrelia fusion protein constructs were used.
  • recombinant Borrelia fusion protein constructs including but not limited to, SEQ ID NOS: 6-16 described herein ⁇ e.g., in Tables 2 and 3) can be used.
  • Representative sets include the recombinant Borrelia fusion protein constructs shown in Table 2, and/or Table 3, and subsets thereof. In certain embodiments, only one recombinant Borrelia fusion protein construct was used.
  • two or more ⁇ e.g., three) recombinant Borrelia fusion protein constructs are used.
  • Other example sets of recombinant Borrelia fusion protein constructs include the set of all possible combinations of recombinant Borrelia fusion protein constructs shown in Table 2, and/or Table 3, and subsets thereof.
  • Such a set can further include recombinant Borrelia fusion protein constructs further comprising one or more single recombinant Borrelia protein antigens shown in Table 1.
  • sets include sets of two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, or other groups of recombinant Borrelia fusion protein constructs ⁇ e.g., selected from those set forth in Table 2 and/or 3 and optionally can include one or more single recombinant Borrelia protein antigens shown in Table 1).
  • the set consists essentially of the recombinant Borrelia fusion protein constructs set forth in Table 2.
  • the set consists essentially of the recombinant Borrelia fusion protein constructs set forth in Table 3.
  • one or more single recombinant Borrelia protein antigens and recombinant Borrelia fusion protein constructs as identified herein are used, and/or combinations of single recombinant Borrelia protein antigens and recombinant Borrelia fusion protein constructs are used ⁇ e.g., combinations of proteins selected from any of Tables 1, 2 and/or 3).
  • Such combinations include sets of two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, or other groups of single recombinant Borrelia protein antigens and/or recombinant Borrelia fusion protein constructs ⁇ e.g., with one or more selected from Table 1, Table 2 and/or Table 3).
  • a test sample from an individual ⁇ e.g., a human
  • the "test sample” can be a sample of blood, serum, cerebrospinal fluid, or other appropriate biological fluid from the individual.
  • the test sample can be assessed for the presence of antibodies to one or more single recombinant Borrelia protein antigens and/or recombinant Borrelia fusion protein constructs using routine methods established in the art.
  • the assessment is performed using a microarray of single recombinant Borrelia protein antigens. In another embodiment, the assessment is performed using a microarray of recombinant Borrelia fusion protein constructs. In certain examples, a microarray as described herein, or a protein or set of proteins as described herein, is exposed to the test sample from the individual, and any resultant binding of antibodies (if present in the test sample) to the single recombinant Borrelia protein antigens and/or recombinant Borrelia fusion protein constructs was determined.
  • the assessment is performed using an ELISA array, such as a multiples ELISA array (e.g., Q-Plex Array) of single recombinant Borrelia protein antigens.
  • the assessment is performed using a Q-Plex Array of recombinant Borrelia fusion protein constructs.
  • a Q-Plex Array as described herein, or a protein or set of proteins as described herein is exposed to the test sample from the individual or multiple samples from the same and/or multiple individuals, and any resultant binding of antibodies (if present in the test sample (s)) to the single recombinant Borrelia protein antigens and/or recombinant Borrelia fusion protein constructs is determined.
  • antibodies bound to also referred to herein as "reactive with” one or more single recombinant Borrelia protein antigens and/or recombinant Borrelia fusion protein constructs is indicative of antibodies specific to those proteins of B. burgdorferi.
  • the presence of such antibodies is diagnostic for Lyme disease in the individual from whom the test sample was obtained.
  • the assay methods described herein use protein arrays of B. burgdorferi antigens.
  • the protein array comprises a subset of single recombinant Borrelia protein antigens and/or recombinant Borrelia fusion protein constructs of B. burgdorferi, such as the set of proteins set forth in Tables 1, 2 or 3.
  • other protein arrays include various subsets of single recombinant Borrelia protein antigens and/or recombinant Borrelia fusion protein constructs of B.
  • the microarray consists essentially of all of the recombinant Borrelia fusion protein constructs set forth in Table 2, or consists of all of the recombinant Borrelia fusion protein constructs set forth in Table 2.
  • the microarray consists essentially of all of the recombinant Borrelia fusion protein constructs set forth in Table 3, or consists of all of the recombinant Borrelia fusion protein constructs of Table 3.
  • other microarrays include various subsets of single recombinant Borrelia protein antigens and/or recombinant Borrelia fusion protein constructs of B. burgdorferi, such as subsets of the proteins set forth in Table 1, 2 and 3 (e.g., sets of two or more, four or more, six or more, eight or more, or other combinations of proteins).
  • the Q-Plex Array consists essentially of all of the recombinant Borrelia fusion protein constructs set forth in Table 2, or consists of all of the recombinant Borrelia fusion protein constructs set forth in Table 2.
  • the Q-Plex Array consists essentially of all of the recombinant Borrelia fusion protein constructs set forth in Table 3, or consists of all of the recombinant Borrelia fusion protein constructs of Table 3.
  • other Q-Plex Arrays include various subsets of single recombinant Borrelia protein antigens and/or recombinant Borrelia fusion protein constructs of B. burgdorferi, such as subsets of the proteins set forth in Table 1, 2 and 3 (e.g., sets of two or more, four or more, six or more, eight or more, or other combinations of proteins).
  • one or more proteins for example, one or more recombinant Borrelia fusion protein constructs of B.
  • burgdorferi such as described herein in Table 2 or Table 3 (e.g., in a microarray and /or Q-Plex Array as described above), are exposed to sera from one or more individuals known to have Lyme disease, and the proteins to which antibodies from the sera bind are then determined.
  • the proteins to which antibodies from the sera bind are then determined.
  • Cy5 intensity/Cy3 intensity ratio of fluorescence as described in the Examples described herein, can be used.
  • the ratio of any proteins greater than the mean ratio of the reactivity of the Lyme sera to a negative control plus three times the standard deviation indicates significant interactions between antibodies present in the Lyme sera and the proteins (e.g., single recombinant Borrelia protein antigens and/or recombinant Borrelia fusion protein constructs).
  • the proteins identified by such methods are useful in diagnostic tests for Lyme disease (e.g., in the methods described herein), as well as in protein arrays (for, e.g., microarrays, Q-Plex Arrays) as described herein.
  • the present invention is also drawn to diagnostic kits which comprise the proteins described herein (e.g., in a microarray and /or in a Q-Plex Array as described herein).
  • the kit optionally can include reagents for detecting antibody-antigen complexes that are formed between the protein and antibodies that are present in a sample, e.g., a user-supplied host sample.
  • EXAMPLE 1 Discovery of 48 highly antigenic single recombinant Borrelia protein antigens.
  • expressed proteins were purified using IDA resin and printed onto nitrocellulose-coated FAST slides (see, for example, US Serial No. 12/784,584 corresponding to published US Application No. US 20100292096 Aland US Serial No. 12/989,003 corresponding to published US
  • OspC Outer surface protein
  • Arrays were probed with sera from Lyme disease patients, and antibodies were visualized with Cy5-conjugated goat antihuman lgG or Cy5-conjugated goat anti-human lgM to determine antibody isotype (Xu Y et al., 2008).
  • Microarray For protein array ⁇ e.g., microarray), each of the individual 48 single recombinant Borrelia protein antigens ⁇ e.g., in Table 1) were printed onto nitrocellulose-coated FAST glass slides. In addition, recombinant proteins OspB-OspC-Flagellin (B-C-Fia), OspA- p39-p93 (A-39-93) and an OspC dimer comprised of OspC Type B and Type H (OC2/9) from an early study were also printed (Gomes Solecki et al., 2000). Each slide in the arrays also contained 10 immobilized bovine serum albumin (BSA) spots for background determination.
  • BSA bovine serum albumin
  • Proteome chips were probed with serum from patients with untreated early Lyme disease and sick non-Lyme patients using the Fast Pak protein array kit. Briefly, slides were first blocked overnight at 4°C in protein array -blocking buffer before incubation in primary antibody (human sera and mouse anti His-Tag for quantitation) for 2 h. Antibodies were visualized with Cy5- conjugated goat anti-human lgG or Cy 5 -conjugated goat anti-human lgM (to detect bound human antibodies) and Cy 3 -conjugated goat anti mouse lgG (to quantify the amount of recombinant protein in each spot).
  • the slides were stringently washed and then scanned with an Axon GenePix 4200A microarray scanner.
  • the raw data was captured and analyzed with Gene Pix Pro image analysis software.
  • the PMT gain was adjusted to equal 1.0 in all the arrays with power setting at 50%.
  • a global background subtraction method was used to subtract the background from each spot using the average mean intensity value of BSA from each slide (Xu et al., 2008).
  • Table 1 48 highly antigenic single recombinant Borrelia protein antigens.
  • EXAMPLE 2 Recombinant Borrelia fusion protein constructs.
  • Recombinant Borrelia fusion protein constructs From the library of 48 highly antigenic single recombinant Borrelia protein antigens and a representative lipoprotein, OppA, 11 sets of recombinant Borrelia fusion protein constructs each containing at least two of the Borrelia antigens were constructed (Tables 2 and 3). Chimeras of at least two ⁇ e.g., three) single recombinant Borrelia protein antigens in most constructs were chosen to keep the molecular mass of the fusion protein at or less than (below) about 100 kDa to optimize protein yield, which can be significantly affected by protein size.
  • the 5' primer (5'-AATTGGTACCCCAGGATCCCATATG + 15mer ORF specific sequence) (SEQ ID NO: 1) contains Kpnl (underlined), BamHI (bold) and Ndel (italics) recognition sequence.
  • the 3' primer (5'GCGGGATCCGGTACCGTCGAC +15mer ORF specific sequence) (SEQ ID NO:2) contains BamHI, Kpnl and Sail (dashed underline) recognition sequences. GGATCC is bolded in the 5' and 3' primers described above.
  • ten ng of genomic DNA was used as a template in a 50- ⁇ PCR reaction containing two ORF-specific primer pairs (SEQ ID NOS: 1&2).
  • the primer sets were designed to amplify coding regions without a membrane anchoring signal sequence (Dunn et al., 1990). PCR amplification was performed under stringent conditions with Platinum Taq DNA polymerase High Fidelity (Invitrogen) using conditions previously described (Xu et al., 2003). The PCR products were visualized using agarose gel electrophoresis. For quantification, the products were purified (PCR purification kit, Qiagen) and quantified by UV absorbance.
  • the 1 st position fragments were directionally cloned into the unique Ndel and BamHI sites of the T7- based expression vector pET-28 (Novagen).
  • This vector provides an N-terminal poly (His) affinity tag fused to the expressed proteins to aid in purification on nickel-Sepharose columns.
  • Ligation reactions were transformed into E. coli GC5 competent cells and plasmids were purified using Eppendorf Perfectprep Plasmid 96 VAC Direct Bind Kit and verified by sequencing across the inserts. Plasmids containing fragment 1 now served as vectors for all subsequent cloning.
  • vectors were digested with BamHI/XhoIl, and restriction digested amplicons of fragment two and three were ligated simultaneously into the digested vector. Following transformation, plasmids were purified and sequenced.
  • Protein concentration was determined by the measurement of the absorbance shift when Coomassie brilliant blue G-250 reacted with protein (Bio-Rad). Protein purity was checked by SDS-PAGE.
  • EXAMPLE 3 Protein arrays using recombinant Borrelia fusion protein constructs and Diagnostic Test for Lyme Disease.
  • Lyme sera and a number of the control sera were used in previous studies described in Example 1 and the array studies ⁇ e.g., Q-Plex Arrays) described below. All serological assays involving human serum were performed on coded specimens with all investigators blinded to clinical information pertaining to individual samples. No patient identifying information was available to the investigators or technician testing the samples.
  • Q-Plex technology The multiplex assay using Q-Plex technology involves the micro-spotting of individual groups of capture proteins on the bottom of a 96-well plate with each spot being its own 'micro ELISA' assay. Standard ELISA incubation steps including sample incubation, washing, and secondary antibody incubation were employed. The labeling and reporting system used in the Q-Plex Array was chemiluminescent. The binding of secondary antibody was measured via the chemiluminescence produced by streptavidin horseradish peroxidase in the presence of a luminol-based substrate. Chemiluminescent ELISAs have been shown to be more sensitive than colorimetric detection systems. The intensity of
  • Q-Plex Arrays Protein arrays ⁇ e.g., Q-Plex Arrays) comprising the 11 highly antigenic recombinant Borrelia proteins described in Table 2 and 3, were constructed. The sensitivity of Q-Plex Array was tested by screening arrays with sera from patients with early and late Lyme disease using buffers and methods provided by Quansys Biosciences. In addition, specificity was determined using sera from patients with diseases associated with serological responses that are known to produce cross-reactivity in Lyme disease tests. The results of Q- Plex arrays were compared with the results obtained with the standard two-tier assay for the same set of 11 recombinant Borrelia fusion protein constructs.
  • the sensitivity of the Q-Plex Arrays was determined using sera from 97 Lyme disease patients. Of 41 acute-phase sera from patients presenting with erythema migrans, 83% (34/41) were positive with the Q-Plex Arrays while 37% (15/41) were positive by the two- tier test. Testing 40 serum samples from EM patients, convalescent at 3 weeks post-presentation, 90%) (36/40) were positive by the Q-Plex Arrays while 78% (31/40) were positive by the two-tier assay. Assaying 16 late Lyme serum samples, 100 % (16/16) were positive by the Q-Plex Arrays while 94%) (15/16) were positive by two-tier testing. Overall, the sensitivity of the Q-Plex Arrays was 89% (86/97) compared to 63% (60/97) for the two-tier test.
  • results described above demonstrate that Q-Plex Arrays offer superior sensitivity and specificity in detecting antibodies against B. burgdorferi for not only early stages of the disease, but show equivalent or better sensitivity for the late stages of the disease as well.
  • the recombinant Borrelia fusion protein constructs described herein represent strong candidates for the development of diagnostic tests.
  • These variants, as well as variants of the other recombinant Borrelia fusion protein constructs described herein can be used to develop a standardized sensitive and specific single-tier Lyme disease assay of recombinant Borrelia fusion protein constructs that will have a wide range of coverage and specificity against Lyme disease. Furthermore, these assays will have significant potential for the development of a next-generation rapid, single-tier point of care assay.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Peptides Or Proteins (AREA)

Abstract

La présente invention concerne de nouvelles protéines recombinantes de Borrelia burgdoferi et des procédés d'évaluation d'un échantillon pour la présence d'anticorps à des protéines de Borrelia burgdorferi, ainsi que des procédés de diagnostic de la maladie de Lyme. L'invention concerne également des tableaux de protéines comprenant des protéines de Borrelia burgdorferi.
PCT/US2017/043366 2016-07-22 2017-07-21 Protéines recombinantes de borrelia et leurs procédés d'utilisation WO2018017998A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201662365937P 2016-07-22 2016-07-22
US62/365,937 2016-07-22

Publications (1)

Publication Number Publication Date
WO2018017998A1 true WO2018017998A1 (fr) 2018-01-25

Family

ID=59579911

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2017/043366 WO2018017998A1 (fr) 2016-07-22 2017-07-21 Protéines recombinantes de borrelia et leurs procédés d'utilisation

Country Status (1)

Country Link
WO (1) WO2018017998A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2020041360A1 (fr) * 2018-08-21 2020-02-27 Quidel Corporation Anticorps dbpa et leurs utilisations

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100292096A1 (en) 2008-04-22 2010-11-18 Research Foundation Of State University Of New York Strain and species-specific borrelia protein array
WO2011023909A1 (fr) * 2009-08-28 2011-03-03 bioMérieux Proteines utilisees pour le diagnostic d'une borreliose de lyme
WO2015054319A1 (fr) * 2013-10-07 2015-04-16 University Of Central Florida Research Foundation, Inc. Procédé, kits et matériaux pour la détection d'une infection par borrelia sp. conférant la maladie de lyme
WO2016057562A1 (fr) 2014-10-07 2016-04-14 The Research Foundation For The State University Of New York Protéines de borrelia recombinantes et procédé d'utilisation de celles-ci

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100292096A1 (en) 2008-04-22 2010-11-18 Research Foundation Of State University Of New York Strain and species-specific borrelia protein array
US20110105355A1 (en) 2008-04-22 2011-05-05 Research Foundation Of State University Of New York Borrelia burgdorferi cell envelope protein array
WO2011023909A1 (fr) * 2009-08-28 2011-03-03 bioMérieux Proteines utilisees pour le diagnostic d'une borreliose de lyme
WO2015054319A1 (fr) * 2013-10-07 2015-04-16 University Of Central Florida Research Foundation, Inc. Procédé, kits et matériaux pour la détection d'une infection par borrelia sp. conférant la maladie de lyme
WO2016057562A1 (fr) 2014-10-07 2016-04-14 The Research Foundation For The State University Of New York Protéines de borrelia recombinantes et procédé d'utilisation de celles-ci

Non-Patent Citations (13)

* Cited by examiner, † Cited by third party
Title
ARNABOLDI PAUL M ET AL: "Decorin Binding Proteins A and B in the Serodiagnosis of Lyme Disease in North America", CLINICAL AND VACCINE IMMUNOLOGY, vol. 21, no. 10, October 2014 (2014-10-01), pages 1426 - 1436, XP002775068 *
CASJENS, S.; PALMER, N.; VAN VUGT, R.; HUANG, W.G.; STEVENSON, B.; ROSA, P. ET AL.: "A bacterial genome in flux: the twelve linear and nine circular extrachromosomal DNAs in an infectious isolate of the Lyme disease spirochete Borrelia burgdorferi", MOL. MICROBIOL., vol. 35, 2000, pages 490 - 516, XP055267667
DUNN, J.J.; LADE, B.N.; BARBOUR, A.G.: "Outer surface protein A (OspA) from the Lyme disease spirochete, Borrelia burgdorferi: high level expression and purification of a soluble recombinant form of OspA Protein", EXPR. PURIF., vol. 1, 1990, pages 159 - 68, XP024868138, DOI: doi:10.1016/1046-5928(90)90011-M
EMBERS MONICA E ET AL: "Five-Antigen Fluorescent Bead-Based Assay for Diagnosis of Lyme Disease", CLINICAL AND VACCINE IMMUNOLOGY, vol. 23, no. 4, April 2016 (2016-04-01), pages 294 - 303, XP002775066 *
GOMES-SOLECKI, M.J.C.; DUNN, J.J.; LUFT, B.J. ET AL.: "Recombinant chimeric Borrelia proteins for diagnosis of Lyme disease", J. CLIN. MICROBIAL., vol. 38, 2000, pages 2530 - 2535, XP002205998
LAHEY LAUREN J ET AL: "Development of a Multiantigen Panel for Improved Detection of Borrelia burgdorferi Infection in Early Lyme Disease.", JOURNAL OF CLINICAL MICROBIOLOGY DEC 2015, vol. 53, no. 12, December 2015 (2015-12-01), pages 3834 - 3841, XP002775067, ISSN: 1098-660X *
MASUZAWA, T. ET AL., MICROBIOL. IMMUNOL., vol. 40, 1996, pages 539 - 45
SIGNORINO G; ARNABOLDI PM; PETZKE MM; DATTWYLER RJ: "Identification of OppA2 linear epitopes as serodiagnostic markers for Lyme disease", CLIN VACCINE IMMUNOL, vol. 21, 2014, pages 704 - 711
STANEK, G., INFECTION, vol. 19, 1991, pages 263 - 7
STEERE, A. C., N. ENGL. J.MED., vol. 321, 1989, pages 586 - 96
XU Y ET AL: "Profiling the humoral immune response to Borrelia burgdorferi infection with protein microarrays", MICROBIAL PATHOGENESIS, ACADEMIC PRESS LIMITED, NEW YORK, NY, US, vol. 45, no. 5-6, 1 November 2008 (2008-11-01), pages 403 - 407, XP025693260, ISSN: 0882-4010, [retrieved on 20081011], DOI: 10.1016/J.MICPATH.2008.09.006 *
XU, Y.; BRUNO, J.F.; LUFT, B.J.: "Detection of Genetic Diversity in Linear Plasm ids 28-3 and 36 in Borrelia burgdorfesensu stricto isolates by Subtractive Hybridization", MICROB. PATH., vol. 35, 2003, pages 269 - 78
XU, Y.; BRUNO, J.F.; LUFT, B.J.: "Profiling the humoral immune response to Borrelia burgdorferi infection with protein microarrays", MICROB. PATH., vol. 45, 2008, pages 403 - 407, XP025693260, DOI: doi:10.1016/j.micpath.2008.09.006

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2020041360A1 (fr) * 2018-08-21 2020-02-27 Quidel Corporation Anticorps dbpa et leurs utilisations
US11548938B2 (en) 2018-08-21 2023-01-10 Quidel Corporation DbpA antibodies and uses thereof

Similar Documents

Publication Publication Date Title
US7776341B2 (en) Biomarkers of tuberculosis that distinguish disease categories: use as serodiagnostic antigens
US8946393B2 (en) Methods for diagnosing lyme disease
JP2009185037A (ja) ＥｈｒｌｉｃｈｉａｃａｎｉｓおよびＥｈｒｌｉｃｈｉａｃｈａｆｆｅｅｎｓｉｓ抗体の検出のための組成物および方法
US20100292096A1 (en) Strain and species-specific borrelia protein array
Xu et al. Profiling the humoral immune response to Borrelia burgdorferi infection with protein microarrays
CA2963643A1 (fr) Proteines de borrelia recombinantes et procede d'utilisation de celles-ci
EP4136251A1 (fr) Détection de la maladie de lyme
WO2018017998A1 (fr) Protéines recombinantes de borrelia et leurs procédés d'utilisation
Hansen Laboratory diagnostic methods in Lyme borreliosis
US7201902B2 (en) Production of recombinant protein pap 31 for the diagnosis and prevention of Bartonella bacilliformis infection
SE541618C2 (en) Novel peptides and their use in diagnosis
US20170212114A1 (en) Recombinant Borrelia Proteins And Methods Of Use Thereof
Yang et al. Screening and identification of immunoactive peptide mimotopes for the enhanced serodiagnosis of tuberculosis
US20060034862A1 (en) Method for diagnosing early and late lyme borreliosis
WO2014093619A1 (fr) Procédés et compositions d'antigènes de protéine pour le diagnostic et le traitement de la leptospirose
Grazlewska et al. Rudzi nska, M.; Holec-Gasior, L. Borrelia burgdorferi BmpA-BBK32 and BmpA-BBA64: New Recombinant Chimeric Proteins with Potential Diagnostic Value. Pathogens 2021, 10, 767
WO2012088125A2 (fr) Procédés et compositions faisant appel à des antigènes protéiques en vue du diagnostic et du traitement des infections par toxoplasma gondii et de la toxoplasmose
Ding et al. A high efficiency cloning and expression system for proteomic analysis
Jumat et al. Determination of the immunogenic region in the lipL32 protein of Leptospira
Ribeiro Identification of seroreactive proteins of Leptospira interrogans Serovar Copenhageni using a high-density protein microarray approach.
WO2010021849A2 (fr) Fragments de recombinaison et peptides synthétiques de polypeptide de 17-kda utilisés dans la détection de bartonella henselae
Aquino et al. Identification of seroreactive proteins of Leptospira interrogans serovar copenhageni using a high-density protein microarray approach
Bunk et al. 4 Immunoproteomic identification of novel Chlamydia pneumoniae antigens enables serological determination of persistent Chlamydia pneumoniae infections
Ranka et al. Analysis of Seroreactivity to Recombinant B. burgdorferi Antigens BBA65 and BBA73
Lessa-Aquino et al. Identification of Seroreactive Proteins of Leptospira interrogans Serovar

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17751167

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 17751167

Country of ref document: EP

Kind code of ref document: A1