WO2017213249A1

WO2017213249A1 - Method for testing natural killer cell functions

Info

Publication number: WO2017213249A1
Application number: PCT/JP2017/021457
Authority: WO
Inventors: 西村泰光; 大槻剛巳; 李順姫; 武井直子; 松崎秀紀
Original assignee: 学校法人川崎学園
Priority date: 2016-06-09
Filing date: 2017-06-09
Publication date: 2017-12-14
Also published as: JPWO2017213249A1; JP7019188B2

Abstract

[Problem] To provide a simple but accurate method for testing NK cell functions. [Solution] Provided is a method for testing natural killer cell functions, characterized by using, as an index for natural killer cell functions, an NINK score that has been measured in samples collected from a plurality of donor animals, and that is calculated using three or more but a finite number of parameters selected from (a)-(d): (a) the proportion of the number of natural killer cells with respect to the number of peripheral-blood mononuclear cells; (b) the mRNA expression level of a natural killer cell activation receptor in natural killer cells; (c) the mRNA expression level of cytokine in natural killer cells; and (d) the mRNA expression level of a cell-death inducing factor in natural killer cells.

Description

Test method for natural killer cell function

The present invention relates to a method for examining the natural killer cell (hereinafter referred to as “NK cell”) function of a sample collected from a test animal, a reagent kit for testing NK cell function, and a test for testing NK cell function. The present invention relates to a program and an inspection device.

NK cells are large lymphocytes that play an important role in innate immunity in vivo, and are cytotoxic cells. In vivo, NK cells can attack abnormal cells such as tumor cells and virus-infected cells regardless of the partner. So far, it has been reported that a decrease in NK cell function increases the incidence of cancer diseases (Lancet 2000; 356: 1795-9), etc., and NK cell function is widely measured for the purpose of knowing the health condition. It's being used.

NK cells are contained in peripheral blood mononuclear cells (PBMC). As an index of NK cell function, NK activity, which is cytotoxic activity of NK cells in blood, is generally used. The NK activity of blood NK cells is calculated by co-culturing cells (effector cells) such as PBMC with target cells (target cells) such as K562 cells and measuring the dead cell rate of the target cells. The same calculation is performed when measuring the NK cell function contained in immunocompetent cells isolated from tissues other than blood. The dead cell rate can be measured using a radioisotope or a fluorescent dye. When using a radioisotope, the target cell is labeled with radioactive chromium ( ⁵¹ Cr). When target cells are damaged by co-culture with effector cells, ⁵¹ Cr is eluted from the target cells into the culture supernatant. By measuring the radioactivity derived from the eluted ⁵¹ Cr with a gamma counter, the dead cell rate can be measured, and the dead cell rate can be defined as NK activity. When using a fluorescent dye, target cells are fluorescently labeled, dead cells are stained with a dead cell-specific dye such as propidium iodide (PI), the dead cell rate is measured, and the dead cell rate is determined as NK activity. can do.

The above NK activity measurement method by cell culture involves 1) cell culture operation, and 2) careful maintenance and management of target cells. Equipment involved in the cell culture equipment (CO ₂ incubator) or cell culture manipulation in cell culture (clean bench) or the like is required. In addition, it is necessary to prepare and prepare for the activity measurement by culturing and maintaining the target cell and pre-culturing so that the sensitivity to the cytotoxicity of the NK cell becomes constant. Although NK activity measurement by cell culture is regarded as a standard method for measuring NK cell function, the height of the threshold that culture operation is essential and the difficulty of guaranteeing quality because it is based on bioassay (error between measurements) There are essentially two problems.

In Patent Document 1 (Japanese Patent Laid-Open No. 2010-22339), as a method for indirectly evaluating the cytotoxic activity of an established NK cell, a step of causing the established NK cell to act on a target cell is not performed. Disclosed is a method for measuring the expression level of a gene such as IFN-γ that increases or decreases depending on the cytotoxic activity in cultured NK cells. In Patent Document 1, the stronger the cytotoxic activity of a target NK cell against a target cell, the more the gene expression level of INF-γ in the established NK cell tends to increase, and KHYG-1 which is an NK cell line. There is a correlation between the cytotoxic activity of NK cells measured by coculturing K562 cells as target cells and the IFN-γ gene expression level of KHYG-1 cells measured by RT-PCR It is disclosed. However, Non-Patent Document 1 (Cooper MA, et al., Blood 2001; 97 (10): 3146-51) has a high amount of IFN-γ produced by NK cells having low cytotoxicity, while having high cytotoxicity. It has been reported that the amount of IFN-γ produced by NK cells is low. It is not always appropriate to apply the above-mentioned correlation between NK activity and IFN-γ to heterogeneous NK cells such as blood NK cells.

Non-patent document 2 (Yasumitsu Nishimura et al., Abstracts from the 16th Annual Meeting of the Japanese Society for Immunotoxicology: http://www.immunotox.org/immunotoxletter/encourage_award/encourage16.html) Results of analyzing a population of plaque positive and malignant mesothelioma patients are disclosed. Non-patent document 2 confirms NKp46 protein expression level in peripheral blood NK cells, lysis / NK value (cytotoxicity per NK cell) obtained by dividing cytotoxicity to K562 cells by the ratio of NK cells. NKp46 protein expression level and lysis / NK value are disclosed to show a positive correlation. In Non-patent Document 3 and Non-Patent Document 4, the relationship between the cytotoxic activity of isolated NK cells and the expression level of NKp46 protein is reported. The Lysis / NK value in Non-Patent Document 2 is close to the cytotoxic activity of the isolated NK cells of

Non-Patent Documents

3 and 4, and these values indicate the quantitative and qualitative cytotoxic activity of NK cells in the measurement sample. The included value is different from the NK activity.

Although studies on methods for easily testing NK cell function are underway, indicators and methods that can reflect NK activity have not yet been established other than NK activity values obtained by cell culture testing methods. .

JP 2010-22339

An object of the present invention is to provide a method for examining NK cell function with ease and high measurement accuracy.

As a result of intensive studies to solve the above-mentioned problems, the present inventors have found that the NK cell function of a sample collected from a test animal can be examined simply and with high measurement accuracy, and the present invention has been completed. did.

That is, this invention consists of the following.
1. A method for examining natural killer cell function of a sample collected from a test animal, including the following steps (1) to (3) or including the steps (2) to (3):
(1) A step of measuring the ratio of the number of natural killer cells to the number of peripheral blood mononuclear cells in the sample collected from the test animal;
(2) Natural killer cell activation receptor mRNA expression level, natural killer cell cytokine mRNA expression level, and natural killer cell death-inducing factor of natural killer cells in the sample collected from the test animal measuring at least two mRNA expression levels selected from the group consisting of mRNA expression levels;
(3) A step of calculating a NINK score using at least three measurement values obtained in the steps (1) and (2) or the step (2), wherein the NINK score is provided in a plurality of ways. A step calculated by a mathematical expression obtained by multiple regression analysis using three or more finite parameters selected from the following (a) to (d) as independent variables, measured for a sample collected from an animal: :
(A) ratio of the number of natural killer cells to the number of peripheral blood mononuclear cells;
(B) mRNA expression level of natural killer cell activation receptor in natural killer cells;
(C) Natural killer cell cytokine mRNA expression level;
(D) mRNA expression level of a cell death inducing factor in natural killer cells.
2. (B) includes the mRNA expression level of natural killer cell NKp46,
(C) includes natural killer cell IFN-γ mRNA expression level and TNF-α mRNA expression level,
(D) includes a natural killer cell Granzyme B mRNA expression level and a FasL mRNA expression level,
2. The method for examining natural killer cell function according to item 1.
3. 3. The method for examining natural killer cell function according to

item

1 or 2, wherein the three or more finite parameters include the following parameters (a1) to (c1):
(A1) Ratio of the number of natural killer cells to the number of peripheral blood mononuclear cells;
(B1) NKp46 mRNA expression level in natural killer cells;
(C1) IFN-γ mRNA expression level in natural killer cells.
4). 4. The method for examining natural killer cell function according to any one of items 1 to 3, wherein the NINK score is calculated by the following mathematical formula 1:
(Formula 1) NINK score = d + a × [NK cell ratio (%)] + b × [NKp46 mRNA level] + c × [IFN-γ mRNA level]
[However, a, b, c, and d in Formula 1 are arbitrary non-zero real numbers, [NK cell ratio (%)] is the ratio of the number of natural killer cells to the number of peripheral blood mononuclear cells, and [NKp46 mRNA level] is The natural killer cell NKp46 mRNA expression level, [IFN-γ mRNA level], is the natural killer cell IFN-γ mRNA expression level. ]
5). Any of the preceding items 1 to 4, wherein the mathematical formula is an updated mathematical formula that is subjected to multiple regression analysis by adding a measured value obtained from a sample collected from a test animal to an independent variable of a mathematical formula prepared in advance. The method for examining natural killer cell function according to claim 1.
6). 6. The method for examining natural killer cell function according to any one of 1 to 5 above, which comprises the steps (1) to (3).
7). 7. The method for examining natural killer cell function according to item 6, wherein the natural killer cells in the steps (1) and (2) are stored after being separated.
8). 8. The method for examining natural killer cell function according to item 7, wherein the natural killer cell is cryopreserved.
9. 9. The method for examining natural killer cell function according to any one of items 1 to 8, wherein the test animal and the donor animal are human.
10. A program for testing a natural killer cell function, which causes a computer to function as a NINK score calculation means, wherein the NINK score calculation means is measured on samples collected from a plurality of donor animals, the following (a) to (d) A program for testing natural killer cell function, which is calculated by a mathematical expression obtained by multiple regression analysis using three or more finite parameters selected from the above as independent variables:
(A) ratio of the number of natural killer cells to the number of peripheral blood mononuclear cells;
(B) mRNA expression level of natural killer cell activation receptor in natural killer cells;
(C) Natural killer cell cytokine mRNA expression level;
(D) mRNA expression level of a cell death inducing factor in natural killer cells.
11. An apparatus for testing natural killer cell function comprising a NINK score calculation means, wherein the NINK score calculation means was measured on samples collected from a plurality of donor animals from the following (a) to (d) A device for testing natural killer cell function, which is calculated by a mathematical expression obtained by multiple regression analysis using three or more selected finite parameters as independent variables:
(A) ratio of the number of natural killer cells to the number of peripheral blood mononuclear cells;
(B) mRNA expression level of natural killer cell activation receptor in natural killer cells;
(C) Natural killer cell cytokine mRNA expression level;
(D) mRNA expression level of a cell death inducing factor in natural killer cells.
12 Reagent kit for testing natural killer cell function using NINK score as an index, including at least three or more kinds of reagents for obtaining the following measured values (11) and (12) for a sample collected from a test animal :
(11) Ratio of the number of natural killer cells to the number of peripheral blood mononuclear cells;
(12) Natural killer cell activation receptor mRNA expression level in natural killer cells,
At least two mRNA expression levels selected from the group consisting of natural killer cell cytokine mRNA expression levels and natural killer cell death-inducing factor mRNA expression levels.
13. 10. A method of converting a NINK score obtained by the test method according to any one of the preceding items 1 to 9 into NK activity, which is measured using a peripheral blood mononuclear cell and a natural killer cell target cell prepared in advance. A method of converting the NINK score into NK activity, comprising calculating the NK activity by substituting the NINK score obtained for the test animal into a regression linear equation having the NK activity and the NINK score as variables.

By the test method of the present invention, the NK cell function of a sample collected from a test animal can be easily tested. In addition, since the inspection method of the present invention does not require a cell culturing step, the inspection can be performed in a short time and at a low cost, and the measurement accuracy is small and the measurement accuracy is high. The test method of the present invention is a test method using a sample collected from a test animal or NK cells separated from the sample, and can also be tested using cryopreserved NK cells. Therefore, it becomes possible to flexibly select the location where a sample such as peripheral blood is collected from the test animal, the timing for acquiring the measurement value, and the like, and it is possible to perform NK cell function evaluation widely.
In addition, NK cell function can be examined by the test method of the present invention even for animals for which NK activity cannot be measured by cell culture because the target cells are not specified.

It is a figure which shows the result of having confirmed the expression level of NKp46 protein of the NK cell extract | collected from each test subject group. (Reference Example 1) It is a figure which shows the result of having carried out multiple regression analysis by making into a parameter the ratio of the number of NK cells with respect to the number of PBMC in the blood extract | collected from the donor, NKp46 (TM) mRNA expression level, and IFN-gamma (TM) mRNA expression level. (Example 2) It is a figure which shows the result of having confirmed the correlation with NK activity by a cell culture about each parameter which calculates a NINK score and a NINK score. (Example 2) It is a figure which shows the result of having analyzed the relationship between NINK score and NK activity by a cell culture about a healthy person, an asbestos exposure non-carried person, and a malignant mesothelioma patient. (Example 2) It is a figure which shows the result of having created the calibration curve of the measured value by PCR method and QGP method about the amount of mRNA expressed in NK cells. (Example 3) It is a figure which shows the flow of construction | assembly of the numerical formula which calculates a NINK score in the case of using the measured value by QGP method. (Example 3) It is a figure which shows the result which confirmed the correlation with the NINK score computed using the QGP theoretical value, and NK activity by cell culture. (Example 3) It is a figure which shows the result of having confirmed the correlation with the NKp46 protein expression level of a NK cell, and NK activity by cell culture. (Comparative Example 1) It is a figure which shows the result of having verified the measurement error between the same samples at the time of measuring NK activity of a PBMC sample by the conventional biological method. (Comparative Example 2) (Example 4) which is a figure which shows the reproducibility between the same samples of a NINK score compared with the value of NK activity measured by the biological method.

NK cell function is considered to be complicatedly related to various elements such as quantitative elements represented by the number of NK cells and qualitative elements such as functions of many gene products involved in cell death induction. The present invention is based on the finding that this NK cell function test can be evaluated by using an NINK score (Non-Incubating Natural Killer score) calculated using a finite number of parameters of 3 or more as an index. .

The test method, test program, test device, and test reagent kit of the present invention use the NINK score as an index of NK cell function (an index of NK activity). The NINK score was obtained by performing multiple regression analysis using three or more finite parameters selected from the following (a) to (d) as independent variables measured for samples collected from a plurality of donor animals. Calculate by mathematical formula.
(A) Ratio of NK cell number to PBMC number (b) NK cell activation receptor mRNA expression level of NK cell (c) NK cell cytokine mRNA expression level (d) NK cell death inducer mRNA Expression level The NINK score is not an index indicating the function per NK cell, but an index indicating the NK cell function of the entire sample, and includes both quantitative and qualitative elements of the NK cell function. Reflects the activity of NK retained by animals.

The mathematical formula for calculating the index NINK score is derived from the measured values for PBMC in samples taken from multiple donor animals.
The animal provided herein can be any animal. Preferred are mammals including humans. Examples of animals other than humans include, for example, pet animals, animals raised in zoos, laboratory animals, livestock, and the like. Specifically, mice, rats, rabbits, sheep, pigs, cows, horses, cats, dogs, Examples include monkeys and chimpanzees. More preferably, it is a human. The donor animal may be a healthy animal, a health check-up animal (in the case of a human, it may be a person who has received a medical checkup), or a target animal for examination of diseases such as cancer and infectious diseases. It may also be an animal subject to examination for the presence or absence of diseases such as cancer or infectious disease, an animal subject to examination for early diagnosis, or an animal subject to examination such as determination of disease stage, malignancy, therapeutic effect, prognosis. May be. The donor animal may be a test animal.

In this specification, the sample is a sample containing PBMC. For example, blood, tissues obtained for examination, extracted tissues, and the like, and samples obtained by processing or fractionating blood or tissues (for example, PBMC) are also included in the samples in the present invention. A method for preparing PBMC from a sample can be a method known per se, and is not particularly limited. For example, PBMC can be separated from blood by density gradient centrifugation. In density gradient centrifugation, a lymphocyte specific gravity separation solution (Ficoll-Paque) can be used.

In the present specification, the ratio of the number of NK cells to the number of PBMCs is the ratio of the number of NK cells to the number of PBMCs contained in the collected sample. Although it may be measured by any method, it is performed by measuring the number of PBMC cells and the number of NK cells. The number of PBMC cells can be measured by a known method. Examples thereof include a method using a flow cytometer, a method using a hemocytometer, and a method using an automatic cell counter. Moreover, the measurement of the number of NK cells can be performed either after separating NK cells from PBMC or before separating them. The number of NK cells can be measured by staining NK cells with a fluorescent substance, measuring using a hemocytometer, or using an automatic cell counter. When a fluorescent substance is used, it can be performed using a fluorescently labeled antibody and a flow cytometer. As antibodies that stain NK cells, antibodies that recognize cell surface antigens such as CD3, CD4, CD8, and CD56 can be used. In general, by a double staining with fluorescence-labeled antibodies to CD3 antigen and CD56 antigens, CD3-negative CD56-positive cells ^- by distinguished as (CD3 CD56 ⁺ cells), it is possible to detect the NK cells. The measured value as the ratio of NK cells in PBMC is expressed as a percentage (%), and can be calculated by NK cell number / PBMC cell number × 100. More specifically, the ratio of NK cells in PBMC can be expressed as a percentage of CD3 ⁻ CD56 ⁺ cells in PBMC. The ratio of NK cells in PBMC can be directly measured by using a flow cytometer.

Separation (isolation) of NK cells may be done by any method, but in the same way as counting NK cells, PBMCs can be stained with a fluorescently labeled antibody and separated using a flow cytometer. it can. In addition, NK cells can also be rapidly separated from PBMC using magnetic cell separation techniques. The magnetic cell separation method uses magnetic beads, and for example, MACS series (Mitenyi Biotec, Inc.) or EasySep series (StemCell Technologies, Inc.) can be used. NK cells are preferably isolated on the basis of cell surface antigens such as CD3, CD4, CD8, CD16, CD56, and specific examples include those isolated as CD4 ^- CD8 ^- CD56 ⁺ cells.

In the present specification, the NK cell activation receptor of NK cells is an NK cell activation receptor produced by NK cells. The NK cell activation receptor may be any receptor that induces cytotoxic activity of NK cells and is expressed on the surface of NK cells. For example, NKG2 family, signaling lymphocytic activating molecule (SLAM) family, natural cytotoxicity receptor (NCR) family and the like. Preferred NK cell activation receptors include receptors included in the natural cytotoxicity receptor CR (NCR) family, such as NKp46, NKp44 NKp30. More preferably, it is NKp46.

In the present specification, NK cell cytokines are cytokines produced by NK cells, and have the effect of suppressing the growth of abnormal cells such as tumor cells and inducing inflammation. The cytokine also has a positive feedback action that enhances the cytotoxicity of NK cells. In the present invention, examples of cytokines for NK cells include IFN-γ and TNF-α, and IFN-γ is preferred.

In the present specification, the cell death inducer of NK cells is a cell death inducer produced by NK cells, and is a factor that directly attacks target cells and induces cell death such as apoptosis. Examples of cell death inducers include Granzyme B, FasL, and perforin. Granzyme B is a serine esterase, and Granzyme B enters the target cell from the hole where perforin has opened in the target cell, cleaves and activates various procaspases, and induces apoptosis. FasL is known as a factor inducing apoptosis. In the present invention, Granzyme B and FasL are preferable as the NK cell death inducer, and Granzyme B is more preferable.

The mRNA expression level of each NK activity-related molecule produced by the NK cell is preferably determined by measuring the mRNA level in the separated NK cell (in the NK fraction). In the present specification, the NK activity-related molecule is a NK cell activation receptor of NK cells, a cytokine of NK cells, or a cell death inducer of NK cells.
Among NK activity-related molecules, when NKp46 is taken as an example, the protein expression level is negatively correlated with NK activity (Comparative Example 1), and behaves differently from the mRNA level. In the present specification, the mRNA expression level means the amount of mRNA that is a transcription product of a gene of NK cells, and can be measured by any method known to those skilled in the art. Extraction of RNA from NK cells may be performed using a technique usually used in this technical field. In addition, the amount of mRNA can be appropriately selected from known methods and used. RT-PCR method, real-time RT-PCR method, microarray method, Northern blot method, dot blot method, RNase protection assay method, QuantiGene Plex Law (QGP method). With the QGP method, mRNA can be quantified simply by solubilizing cells without extracting the mRNA from NK cells. The measured value of the mRNA expression level can be obtained as the mRNA expression level of each NK activity-related molecular gene relative to the mRNA expression level of the internal standard gene (relative expression level: for example, dCT value in the real-time PCR method). In addition, a value obtained by logarithmically converting the relative expression level (log ₁₀ conversion value) can be used as a measurement value.

In order to calculate the NINK score, three or more finite parameters selected from the above (a) to (d) are used. There are many NK activity-related molecules included in (b) to (d), and the number of parameters is preferably selected to be 3 or more in order to increase sensitivity and specificity. Further, from the viewpoint of complexity of the test, sensitivity, and specificity, the number of parameters is preferably 10 or less, more preferably 8 or less, further preferably 6 or less, and further preferably 5 or less.

The NINK score is obtained by multiple regression analysis using three or more finite parameters selected from (a) to (d) above as independent variables and NK activity measured by conventional cell culture as a dependent variable. Calculated by the following mathematical formula. The formula can be created using free software or commercially available software.

NK activity by conventional cell culture used as a dependent variable can be any method as long as it is a method in which effector cells PBMC and target cells are co-cultured and the change caused by damage to the target cells is measured as cytotoxic activity. It may be measured by. Changes caused by target cell damage include release of L-lactate dehydrogenase (LDH) by target cells and ⁵¹ Cr release. Evaluation of cytotoxic activity by the amount of LDH is known as an LDH assay. ^{In the 51} Cr release method, target cells are labeled with chromium (Na ₂ ⁵¹ CrO ₄ ) in advance, and after co-culture with effector cells, the radioactivity of free chromium released into the culture supernatant is measured with a gamma counter. It is a method to do. In addition, effector cells are added to target cells that have been labeled with a specific fluorescent substance in advance and co-cultured, and then stained with a fluorescent label that is incorporated into dead cells, and the number of dead cells is measured by flow cytometry. Thus, a method for measuring cytotoxic activity can be used.

The target cells used in the measurement of NK activity by cell culture are not particularly limited, and examples thereof include K562 cells, HL-60 cells, and Daudi cells. For example, K562 cells (RCB0027) are human leukemia cells established by Lozzio CB. Et al. (Blood. 1975; 45: 321-334) and available at RIKEN 入手 CELL BANK. HL-60 cells (CCL-240) are a cell line derived from patients with acute promyelocytic leukemia and are available at ATCC. Daudi cell (RCB1640) is a cell line derived from human Burkitt lymphoma and can be obtained from RIKEN CELL BANK. Examples of a method for measuring NK activity in mice include a method using YAC-1 cells as target cells and mouse spleen cells as effector cells. Further, the ratio of effector cells to target cells (E: T ratio) is not particularly limited, but 3: 1 to 40: 1 (E / T ratio corresponds to 3 to 40) is exemplified. The co-culture is preferably performed for 2 to 8 hours.

Also, parameters used for multiple regression analysis can be selected as follows. First, donor animals showing high values of NK activity by conventional cell culture or donor animals predicted to show high values (hereinafter simply referred to as "provider animals having high NK activity"), and donor animals showing low values Alternatively, a donor animal group including donor animals predicted to exhibit low values (hereinafter simply referred to as “donor animals with low NK activity”) is constructed. Examples of donor animals with high NK activity include healthy individuals and autoimmune disease patients. Examples of donor animals with low NK activity include cancer patients and elderly people. With respect to peripheral blood collected from a test animal group including a donor animal having a high NK activity and a donor animal having a low NK activity, the NK activity by cell culture is measured, and the measured values (a) to (d) above are obtained. By performing multiple regression analysis using NK activity as a dependent variable and various measured values as independent variables, the degree of influence of each parameter on NK activity is calculated, and the independent variable having a high degree of influence is selected as a parameter. Select a combination. For the selected parameter, a coefficient and a decision term (constant) in a mathematical formula (hereinafter also referred to as a multiple regression equation) can be set. A cutoff value can also be set for the NINK score obtained by the multiple regression equation. Using the set cut-off value, for example, the healthy subject group can be divided into a high NINK score group and a low NINK score group, and the latter can be discriminated as having a low NK cell function.

Preferred parameters for calculating the NINK score include at least the parameter (a). More preferably, at least the parameters (a) and (b) are included. More preferably, it includes at least the parameters (a) to (c).
Further preferred parameters include at least the following (a1) and (b1). More preferable parameters include at least the following (a1) to (c1).
(A1) Ratio of NK cell number to PBMC number (b1) NK cell mRNA expression level of NK cell (c1) IFN-γ mRNA expression level of NK cell

The mathematical formula (multiple regression equation) for calculating the NINK score is preferably the one represented by the following mathematical formula 1.
(Formula 1) NINK score = d + a × [NK cell ratio (%)] + b × [NKp46 mRNA level] + c × [IFN-γ mRNA level]
[However, a, b, c, d in Formula 1 are arbitrary non-zero real numbers, [NK cell ratio (%)] is the ratio of NK cell number to PBMC number, and [NKp46 mRNA level] is NKp46 of NK cell. The mRNA expression level, [IFN-γ mRNA level] is the mRNA expression level of IFN-γ in NK cells. ]

Specific values of a, b, c, and d in Equation 1 may be those set by multiple regression analysis. For example, the value of Equation 2 below is exemplified.
(Formula 2) NINK score = 52.278 + 0.852 × [NK cell ratio (%)] + 15.072 × [NKp46 mRNA level] + 9.585 × [IFN-γ mRNA level]
Of the above a, b, c, and d, d is considered to vary depending on the specific measurement method of each parameter and the expression method of the measurement value. For example, when the expression level of mRNA in NK cells is not the real-time RT-PCR method but the QGP method, the following formula 3 can be used.
(Formula 3) NINK score = -22.362 + 0.852 × [NK cell ratio (%)] + 15.072 × [NKp46 mRNA level] + 9.585 × [IFN-γ mRNA level]

The test method of the present invention is a test method for NK cell function of a sample collected from a test animal, and includes the following steps (1) to (3) or (2) to (3): .
(1) a step of measuring the ratio of the number of NK cells to the number of PBMCs in a sample collected from a test animal;
(2) In the sample collected from the test animal
NK cell activation receptor mRNA expression level of NK cells,
NK cell cytokine mRNA expression level, and
Measuring at least two mRNA expression levels selected from the group consisting of mRNA expression levels of NK cell death-inducing factors;
(3) A step of calculating a NINK score using at least three measurement values obtained in at least one step selected from (1) and (2)

In this specification, the test animal may be any animal as long as it is an animal to be examined. Preferred are mammals including humans. Examples of animals other than humans include, for example, pet animals, animals raised in zoos, laboratory animals, livestock, and the like. Specifically, mice, rats, rabbits, sheep, pigs, cows, horses, cats, dogs, Examples include monkeys and chimpanzees. More preferably, it is a human. The test animal may be a healthy animal, a health checkup check animal (in the case of a human, it may be a medical checkup recipient), or a target animal for a disease test such as cancer or infectious disease. It may also be an animal subject to examination for the presence or absence of diseases such as cancer or infectious disease, an animal subject to examination for early diagnosis, or an animal subject to examination such as determination of disease stage, malignancy, therapeutic effect, prognosis. May be.
Further, the test animal and the donor animal may be different animal species. Estimate the NINK score by extrapolating the formula for calculating the NINK score obtained in humans and experimental animals for animals that cannot measure NK activity by cell culture because the target cell is not specified. be able to.

In the present invention, a sample collected from a test animal is used as an inspection target. The sample may be a sample containing PBMC. For example, blood, a tissue obtained for examination, a removed tissue, and the like are included, and a sample obtained by processing or fractionating blood or tissue is also included in the sample in the present invention.
The method for preparing PBMC from the sample collected from the test animal is the same as the method for preparing PBMC from the sample collected from the donor animal.
Moreover, the method for separating NK cells from the sample collected from the test animal is the same as the method for preparing PBMC from the sample collected from the donor animal.

When measuring the ratio or mRNA expression level using NK cells separated from the sample, NK cells immediately after separation may be used, or NK cells stored after separation may be used. Good. The storage method of NK cells may be any method as long as it can confirm the mRNA expression level, and is preferably cryopreservation.

The step of measuring the ratio of the number of NK cells to the number of PBMCs in step (1) of the test method of the present invention is a step of measuring the ratio of the number of NK cells to the number of PBMCs contained in the sample collected from the test animal. . The method for measuring the ratio is as described above.

In step (2) of the inspection method of the present invention,
NK cell activation receptor mRNA expression level of NK cells,
NK cell cytokine mRNA expression level, and
The expression levels of at least two mRNAs selected from the group consisting of the expression levels of NK cell death inducer mRNA are measured.

The NK cell activation receptor of NK cells, NK cell cytokines, and NK cell death inducers in the test method of the present invention are as described above.

The mRNA expression level in the test method of the present invention is also as described above, and the method for measuring the mRNA expression level is also as described above.

In step (3) of the inspection method of the present invention, the NINK score is calculated using at least three measured values obtained in at least one step selected from (1) and (2).
When the inspection method of the present invention includes the step (1), the number of measurement values obtained in the step (1) is one. Therefore, the NINK score is calculated by obtaining at least two measurement values from the step (2).
When the inspection method of the present invention does not include the step (1), the NINK score is calculated by obtaining at least three measured values from the step (2).
When a formula for calculating the NINK score is set in advance, the measurement target can be selected in accordance with the parameters of the formula.
When the formula for calculating the NINK score is updated with the measured values of the test animals, at least three measured values are obtained. From the viewpoint of complexity of the test, sensitivity and specificity, it is preferable to obtain a measured value of 3 to 10, more preferably 8 or less, further preferably 6 or less, and further preferably 5 or less.

The inspection method of the present invention preferably includes the step (1). More preferably, it further includes a step of measuring the mRNA expression level of the NK cell activation receptor of the NK cell. More preferably, the method further includes the step of measuring the mRNA expression level of cytokines in NK cells.
The inspection method of the present invention preferably includes at least the following steps (11) and (21). More preferably, at least the following steps (11), (21) and (22) are included.
(11) A step of measuring the ratio of the number of NK cells to the number of PBMCs in a sample collected from the test animal (21) A step of measuring the mRNA expression level of NKp46 of NK cells in the sample collected from the test animal (22 ) Measuring the expression level of IFN-γ mRNA in NK cells in samples collected from test animals

The mathematical formula (multiple regression equation) for calculating the NINK score of the test method of the present invention is a multiple regression obtained by adding the measurement value obtained from the sample collected from the test animal to the independent variable of the mathematical formula prepared in advance. It may be a mathematical expression to be analyzed and updated. At this time, the test animal is a test animal and a donor animal.
Even if a mathematical formula is once created, additionally, NK activity is measured by cell culture using PBMC collected from the test animal, and further, measurement values corresponding to each parameter are obtained, and the obtained measurement values By performing the multiple regression analysis including, the parameters for selecting the parameters, setting the coefficients and decision terms in the multiple regression equation, and the cutoff value can be updated as needed, and the formula for calculating the NINK score can be updated. The renewal may be performed at the same time when the sample collected from the test animal is examined.

The reagent kit for testing NK cell function of the present invention contains at least three or more kinds of reagents for obtaining the following measured values (13) and (23) for PBMC in a sample collected from a test animal. .
(13) The ratio of the number of NK cells to the number of peripheral blood mononuclear cells;
(23) Expression of at least two mRNAs selected from the group consisting of mRNA expression level of NK cell activation receptor of NK cell, mRNA expression level of NK cell cytokine, and mRNA expression level of NK cell death inducer amount.
Measurement values corresponding to three or more parameters for PBMC can be obtained by the at least three or more types of reagents. The at least three or more types of reagents include a reagent for measuring the number of PBMC cells, a reagent for measuring the number of NK cell cells, a reagent for detecting NK cell activation receptor mRNA, and mRNA of NK cell cytokines. It is selected from a reagent for detection and a reagent for mRNA detection of NK cell death inducer.

The reagent for measuring the number of cells in PBMC or the reagent for measuring the number of cells in NK cells contains an antibody that can bind to the cell surface antigen of each cell. The antibody capable of binding to the cell surface marker may be an antibody known per se, or an antibody produced by an existing general production method or a commercially available antibody can be used. The antibody may be a polyclonal antibody or a monoclonal antibody. The antibody may be labeled with a labeling substance. Specifically, an enzyme, a radioisotope, a fluorescent dye, biotin, a dye sol, an insoluble carrier such as a gold colloid or a latex particle can be used as the labeling substance. The labeling can be performed by a known method, but the labeling substance may be bound to the antibody. The above antibody is included in the detection reagent kit of the present invention as a reagent (reagent composition). Examples of the reagent containing the antibody include a reagent that can be stored for a long period of time, such as diluted with physiological saline, a buffer solution, or the like, or lyophilized. The reagent may be prepared by dissolving the antibody in a solution containing an additive (for example, a carrier, an excipient, a diluent, etc.), a stabilizer, and the like, and then lyophilizing the solution. Stabilizers include monosaccharides such as glucose, disaccharides such as saccharose and maltose, sugar alcohols such as mannitol and sorbitol, neutral salts such as sodium chloride, amino acids such as glycine, polyethylene glycol, polyoxyethylene-polyoxy Nonionic surfactants such as propylene copolymer (pluronic) and polyoxyethylene sorbitan fatty acid ester (tween), human albumin and the like are exemplified, and it is preferable that about 1 to 10 w / v% is added. The detection reagent kit of the present invention may contain a blocking solution, a reaction solution, a reaction stop solution and the like as appropriate. A reagent for measuring the number of PBMC cells or a reagent for measuring the number of NK cells can also be used to separate PBMC and NK cells based on the expression of various surface antigens from blood. it can.

NK cell activation receptor mRNA detection reagent, NK cell cytokine mRNA detection reagent, or NK cell death inducer mRNA detection reagent is a polymorphism that can detect the expression of various genes. It contains nucleotides. In the present specification, a polynucleotide refers to a biopolymer in which two or more nucleotides consisting of a base, a sugar, and a phosphate are linked by a phosphate ester, and includes nucleic acids such as DNA and RNA. The polynucleotide of the present invention has a length of 8 nucleotides (bases) or more, 10 nucleotides (bases) or more, 15 nucleotides (bases) or more, 17 nucleotides (bases) or more, or 20 nucleotides (bases) or more. . The polynucleotide functions as a probe that can specifically hybridize to a specific mRNA, a primer that can specifically anneal to a specific mRNA, and a primer that can pair with the primer and amplify a nucleic acid fragment. The base sequence of the polynucleotide need not be 100% complementary to the base sequence of the gene whose expression is to be detected, and is about 1 to 5 bases (preferably about 1 to 4 bases, more preferably about 1 to 2 bases). It may be deleted (as much as the base), or a non-complementary base may be substituted, inserted or added. When the polynucleotide is a primer, it is preferably about 17 to 25 nucleotides, and when the polynucleotide is a probe, it is preferably about 8 to 40 nucleotides, more preferably about 10 to 30 nucleotides. Primers may be included in the detection reagent kit of the present invention as a pair of primer sets.

Primers and probes can be designed using known primer or probe design software. Known software includes, for example, OLIGO Primer Analysis Software (Molecular Biology Insights), Beacon Designer (PREMIER Biosoft), Primer Express Software (Life Technologies), Primer3web version 4.0.0 Pick primers from a DNA sequence (http: / /bioinfo.ut.ee/primer3/) etc. can be used. A polynucleotide can be synthesized by a method known in the art as a method for synthesizing a polynucleotide, for example, a phosphotriethyl method, a phosphodiester method, or the like, using a commonly used automatic DNA synthesizer. The polynucleotide may be used as a solid reagent in a dry state or in an alcohol-precipitated state, or as a reagent dissolved in water, physiological saline, or an appropriate buffer (eg, TE buffer). It can also be included in the detection reagent kit of the invention. The reagent may contain additives (for example, carriers, excipients, diluents, etc.), stabilizers and the like. Specific examples of the stabilizer are as described above. The test reagent kit of the present invention may contain reagents necessary for nucleic acid amplification reaction, such as DNA synthase, buffer solution, dNTP mix, intercalator, magnesium chloride and the like. The intercalator can detect the presence or absence of an amplification product by staining the amplification product by a nucleic acid amplification reaction such as a PCR method. Examples of intercalators include ethidium bromide and Sybergreen. In addition, for detection of amplification products by real-time PCR, a polynucleotide labeled with a fluorescent substance or the like may be included in the test reagent kit of the present invention.

Specific examples of various antibodies or polynucleotides include those described in Examples described later.

The program for testing NK cell function of the present invention causes a computer to function as NINK score calculation means. The NINK score was obtained by multiple regression analysis using three or more finite parameters selected from the above (a) to (d), which were measured for samples collected from a plurality of donor animals, as independent variables. Calculated by mathematical formula. The program of the present invention may have a data analysis means for analyzing a measurement value of PBMC collected from a donor animal. Further, the inspection program of the present invention may have a storage means for storing the measured value. In addition, by analyzing various measured values obtained using PBMC collected from donor animals, it has a selection means for selecting three or more finite parameters to be used as independent variables in the multiple regression equation. Also good. Furthermore, the measurement value obtained from the sample collected from the test animal is added to the measurement value from the provided donor animal as an independent variable for multiple regression analysis, and a mathematical formula (multiple regression equation) is created or updated. You may have a creation means or an update means. Furthermore, a determination unit for determining the level of the NINK score may be provided based on a result obtained using a mathematical expression (multiple regression equation) and a cutoff value.

The apparatus for testing NK cell function of the present invention comprises NINK score calculation means. The NINK score calculation means is obtained by performing multiple regression analysis using three or more finite parameters selected from the above (a) to (d), which are measured for samples collected from a plurality of donor animals, as independent variables. It is calculated by the following mathematical formula. The inspection apparatus of the present invention may be provided with data analysis means for analyzing the measured value of PBMC collected from the donor animal. Moreover, the inspection apparatus of the present invention may include a measuring means for measuring the following (1) or (2) with respect to a sample collected from a test animal.
(1) The ratio of the number of natural killer cells to the number of peripheral blood mononuclear cells in a sample collected from a test animal;
(2) Natural killer cell activation receptor mRNA expression level, natural killer cell cytokine mRNA expression level, and natural killer cell death-inducing factor mRNA expression level in samples collected from test animals. amount.
Furthermore, an input unit for inputting the obtained measurement value and a storage unit for storing the measurement value may be provided. Further, there may be provided sorting means for sorting three or more finite number of parameters used as independent variables in the multiple regression equation. Furthermore, the measurement value obtained from the sample collected from the test animal is added to the measurement value from the provided donor animal as an independent variable for multiple regression analysis, and a mathematical formula (multiple regression equation) is created or updated. Creation means or update means may be provided. Furthermore, based on the result obtained using the mathematical formula (multiple regression equation) and the cutoff value, a determination means for determining the level of the NINK score, or a display means for indicating the determination result based on the determination means You may have. Furthermore, a means for calculating NK activity from the obtained NINK score and a means for displaying NK activity may be provided.

The test method, test reagent, test program, and test apparatus of the present invention are not based on a single biomarker, but are mainly based on a test using a multimarker, and highly measure the NK cell function of a test animal. The accuracy can be reflected well. Thereby, about the test animal, the risk of onset / progress of various diseases, determination of therapeutic effect, prognosis, etc. can be performed. The NINK score of the present invention includes a cytokine gene expression level that is a factor contributing to anti-cancer immunity other than NK cell cytotoxicity, and is considered to appropriately represent NK cell function. Furthermore, the NINK score of the present invention has been confirmed to show a negative correlation with aging. Although the aging index of NK cell function has not been established yet (Immun Ageing 2013; 10 (1): 19), according to the NINK score of the present invention, NK cell function including not only diseases but also those due to aging is also shown. It has the advantage that it can be inspected.

Since the NINK score of the present invention has a high correlation with the conventional NK activity measured using target cells, the NINK score obtained for the test animal is also advantageously converted to NK activity. can do. For example, as shown in Example 2 to be described later, the correlation coefficient was calculated using the NINK score obtained using a plurality of PBMC samples (standard) and the NK activity obtained using the target cells as variables. Using a correlation coefficient, it is possible to prepare a regression linear equation in advance by a conventional method, and substitute the NINK score obtained using the PBMC sample of the test animal into the regression linear equation, and convert it to NK activity. it can. Therefore, the NINK score of the present invention not only shows high measurement accuracy, but can also use the NK activity conversion value obtained from the regression linear equation as an alternative index of NK activity based on the NINK score, and more accurate NK As a cell function index, it can be used as a tool for performing the onset / progression risk of various diseases, determination of therapeutic effects, prognosis, and the like.

In order to help understanding of the present invention, the present invention will be specifically described with reference to the following examples, but the present invention is not limited to the examples.

(Reference Example 1)
A total of 79 patients (20 healthy persons (HV), 13 asbestos-exposed cancer-bearing persons (PL), with approval from the ethics committees of Kawasaki Medical University and its affiliated hospitals, Okayama Industrial Hospital and Hyogo Medical University Hospital, Blood was collected from 24 patients with malignant mesothelioma (MM) and 22 patients with scleroderma (SSc). Using the collected blood, PBMC was isolated by Ficoll density gradient centrifugation. In addition, asbestos-exposed non-cancer-bearing persons are those who have been confirmed to be exposed to asbestos but have not yet confirmed tumor formation.

After staining the obtained PBMC with an antibody according to a conventional method, the fluorescence intensity is measured with a flow cytometer (FACS Calibur, manufactured by BD Biosciences), and cell surface markers for CD3 ^- CD56 ⁺ cells (NK cells) The protein expression of NKp46 (Cell surface markers (Surface molecules)) was confirmed.

For confirmation of CD56 positivity, NK cells were fractionated by staining with a monoclonal antibody against CD56. The antibodies used are as follows.
<Antibody List>
BD Pharmingen FITC Mouse Anti-Human CD3 (anti-CD3 antibody)
BD Pharmingen PE-Cy5 Mouse Anti-Human CD56 (anti-CD56 antibody)
BECKMAN COULTER Anti-CD335 (NKp46) (Human) mAb-PE (anti-NKp46 antibody)

The results are shown in FIG. In healthy subjects and scleroderma patients, NKp46 protein expression levels were high, and in asbestos-exposed cancer-bearing patients and malignant mesothelioma patients, the expression levels tended to be low.

(Example 1) Acquisition of measured values of various parameters As in Reference Example 1, with the approval of the ethics committees of Okayama Industrial Hospital and Hyogo College of Medicine Hospital, 20 healthy subjects, 13 pleural plaque patients, malignant Blood was collected from a total of 4 groups of 24 mesothelioma patient groups and 42 patients with other diseases (scleroderma patients and silicosis patients), and the measured values were obtained and analyzed for the parameters shown below. .
・ NK cell ratio in PBMC (%)
・ NKp46 mRNA level ・ Granzyme B mRNA level ・ FasL mRNA level ・ TNF-α mRNA level ・ IFN-γ mRNA level

Also, using the same blood, peripheral blood mononuclear cells (PBMC) were isolated by Ficoll density gradient centrifugation. After staining the obtained PBMC with an antibody according to a conventional method, CD3 ^- CD56 ⁺ cells (NK cells) in PBMC are detected with a flow cytometer (FACS Calibur, BD Biosciences), and NK cells in PBMC are detected. The ratio (% NK cells) was measured.

The PBMCs obtained in the same manner were stained with an antibody, and the fluorescence intensity was measured with a flow cytometer (FACS Aria, manufactured by BD Biosciences) to identify CD4 ^- CD8 ^- CD56 ⁺ cells (NK cells). The number of cells was counted. Various mRNA expression levels were measured for the fractionated NK cells. The mRNA expression level was measured according to a conventional method using real-time PCR.

Monoclonal antibodies against CD3, CD4, CD8 and CD56 were used for confirmation of CD3 negative, CD4 positive, CD8 positive and CD56 positive, respectively. For RNA extraction, RNeasy mini Kit (Qiagen) was used as an RNA extraction kit, and for cDNA synthesis, cDNA synthesis kit Prime Script ^(R) II 1st strand cDNA Synthesis kit (TaKaRa) was used to observe gene expression. . The antibodies used for the detection of the membrane surface molecules are as follows.
<Antibody List>
BD Pharmingen FITC Mouse Anti-Human CD3 (anti-CD3 antibody)
BD Pharmingen PE Mouse Anti-Human CD56 (anti-CD56 antibody)
BD Pharmingen Anti-CD4 (Human) mAb-FITC (anti-CD4 antibody)
BECKMAN COULTER Anti-CD8beta (Human) mAb-PC5 (anti-CD8 antibody)

Measurement of mRNA expression level was performed using real-time PCR with Mx3000P QPCR System (Agilent Technologies, Inc.) using Sybergreen. Primers used in real-time PCR are designed using the open source net service: Primer3web version 4.0.0 Pick primers from a DNA sequence (http://bioinfo.ut.ee/primer3/) -Prepared by consigning to Science. The base sequence of the primer used is shown below.
NKp46 F (5'-3 ') CAGTGAAGCTCCTGGTCACA (SEQ ID NO: 1)
R (5'-3 ') CTTCCCAAGTGGAAGCTCTG (SEQ ID NO: 2)
Granzyme B F (5'-3 ') TCCCTGTGAAAAGACCCATC (SEQ ID NO: 3)
R (5'-3 ') TTCGCACTTTCGATCTTCCT (SEQ ID NO: 4)
IFN-γ F (5'-3 ') TGACCAGAGCATCCAAAAGA (SEQ ID NO: 5)
R (5'-3 ') CTCTTCGACCTCGAAACAGC (SEQ ID NO: 6)
TNF-α F (5'-3 ') TGTTCCTCAGCCTCTTCTCC (SEQ ID NO: 7)
R (5'-3 ') TTATCTCTCAGCTCCACGCC (SEQ ID NO: 8)
FasL F (5'-3 ') CTGGTTGCCTTGGTAGGATT (SEQ ID NO: 9)
R (5'-3 ') TTCATTGATCACAAGGCCAC (SEQ ID NO: 10)
The mRNA level was expressed as a log ₁₀ conversion value of a relative expression level (dCT value) with the expression level of GAPDH mRNA as a control.

(Example 2) Multiple regression analysis for various parameters The measured values of NK activity-related molecules obtained in Example 1 were comprehensively subjected to multiple regression analysis. Multiple regression analysis was performed using SPSS version 22 (IBM). Analysis for calculating NK activity was performed using the measured values obtained from the test subject group.

(1) Measurement of NK activity using cell culture NK activity was requested from SRL Corporation. The measurement results obtained were measured by ⁵¹ Cr release method using PBMC separated from peripheral blood collected in SRL designated containers with lymphocyte specific gravity solution as an effector, E / T ratio of 20 and K562 cells as target cells. It is a result.

(2) The multiple regression analysis was performed by the stepwise method using the NK activity acquired in (1) above as a dependent variable and the measured values of various parameters acquired in Example 1 as independent variables. Three items were selected as independent variables, and the following Equation 2 was constructed as an equation (multiple regression equation) for calculating the NK activity score (FIG. 2).
[Formula 2] NINK score = 52.278 + 0.852 × [NK cell ratio (%)] + 15.072 × [NKp46 mRNA level] + 9.585 × [IFN-γ mRNA level]

Table 1 shows the correlation coefficient between each parameter and NINK score and NK activity by cell culture. A graph of these results is shown in FIG.

In Table 1 and FIG. 3, “NK” is NK cell ratio (%), “NK_NKp46” is NKp46 mRNA level, “NK_IFNg” is IFN-γ mRNA level, “ET20_NK” is NK activity by cell culture, “PCR_NINK” Means NINK score.

The NINK score calculated by Equation 2 shows a positive correlation with NK activity (correlation coefficient: 0.668, significance probability <0.001). The correlation is based on the measured value of each parameter included in the NINK score and NK It was higher than the correlation with the activity (NK cell%: 0.341, NKp46 mRNA amount: 0.405, IFN-γ mRNA amount: 0.240).
In addition, patients with malignant mesothelioma had a low NINK score, and conversely, those with non-asbestos exposed cancer showed a high NINK score (Fig. 4). The NINK score was negatively correlated with age (correlation coefficient: -0.233, significance <0.05), and each parameter included in the NINK score was not correlated with age.

(Example 3) Multiple regression analysis 2 for various parameters
Whether the NINK score could be calculated even when QuantiGene Plex (QGP method) (Affymetrix eBioscience) was used to measure the amount of mRNA in NK cells was examined.

First, in order to confirm whether the measured value of the QGP method and the measured value of the expression level by the real-time PCR method coincide, a calibration curve was created. To prepare a calibration curve, CD4 ⁺ CD8 ^- cells, CD4 ^- CD8 ⁺ cells, and CD4 ^- CD8 ^- CD56 ⁺ cells isolated from peripheral blood PBMC derived from healthy humans were cultured for 1 day under stimulation with PMA and ionomycin. Using the three cells described above, mRNA expression levels were analyzed using the QGP method and real-time PCR method to obtain measured values. The real-time PCR method was performed in the same manner as in Example 2, and the dCT value was used as the measurement value. In the QGP method, the normalized fluorescence intensity was calculated from the fluorescence intensity derived from the amount of each gene mRNA measured using GAPDH as an internal standard, and this was used as a measurement value. In the QGP method, Affimetrix eBioscience Inc. product code QGP-390000-109 and product name QuantiGene Plex 2.0 Plex Set (MAG), 9 plex were used. The real-time PCR method was performed in the same manner as in Example 2. The PRF1 primer used for the real-time PCR method is as follows.
PRF1 F (5'-3 ') CAACTTTGCAGCCCAGAAGA (SEQ ID NO: 11)
R (5'-3 ') GGGTGCCGTAGTTGGAGATA (SEQ ID NO: 12)

When a calibration curve was created using the measured values by the QGP method and the real-time PCR method, it was found that the calibration curve could be created satisfactorily and the results of both were consistent (FIG. 5). In FIG. 5, the graph labeled “IFNG” represents IFN-γ, the graph labeled “GZMB” represents Granzyme B, and the graph labeled “PRF1” represents a calibration curve for perforin. Using the calibration curve created in FIG. 5, the theoretical value (QGP theoretical value) of the measured QGP value of each parameter of NK cells derived from the subject was calculated from the dCT value obtained by the real-time PCR method in Example 2. did. An attempt was made to construct a mathematical formula for calculating the NINK score using the obtained QGP theoretical values (FIG. 6). The QGP theoretical value was calculated from the dCT value of PCR obtained in Example 2, and the log ₁₀ converted value of the QGP theoretical value was used for calculating the NINK score. As a result, it was found that the NINK score can be calculated by substituting the QGP theoretical value by adjusting the decision term. Formula 3 with the decision term adjusted is shown below.
(Formula 3) NINK score = -22.362 + 0.852 × [NK cell ratio (%)] + 15.072 × [NKp46 mRNA level] + 9.585 × [IFN-γ mRNA level]

When the NINK score obtained by substituting the QGP theoretical value of PBMC into Equation 3 was calculated, as shown in FIG. 7 and Table 2 below, as in the case of using the real-time PCR method, NK activity by cell culture was calculated. And was found to correlate well.

In FIG. 7, “ET20_NK” means the NK activity by cell culture, and “QGP_NINK” means the NINK score calculated by substituting the QGP theoretical value into Equation 3 with the decision term adjusted.

(Comparative Example 1) Confirmation of cell surface expression level of NKp46 protein PBMC obtained in the same manner as in Example 1 was stained with an antibody according to a conventional method, and then fluorescent with a flow cytometer (FACS Calibur, BD Biosciences). The intensity was measured, and the expression level of NKp46 protein of cell surface markers (Surface molecules) was confirmed for CD3 ⁻ CD56 ⁺ cells (NK cells). The antibodies used are as follows.
<Antibody List>
BD Pharmingen FITC Mouse Anti-Human CD3 (anti-CD3 antibody)
BD Pharmingen PE Mouse Anti-Human CD56 (anti-CD56 antibody)
BECKMAN COULTER Anti-CD335 (NKp46) (Human) mAb-PE (anti-NKp46 antibody)

FIG. 8 shows the result of confirming the correlation between the expression level of NKp46 protein in NK cells and NK activity. The NK activity is the result of measurement requested from SRL Co., Ltd. in Example 2 (1). As shown in FIG. 8, it turned out that both show a negative correlation coefficient.

(Comparative Example 2) Verification of measurement error of NK activity measured using target cells Peripheral blood mononuclear cells (PBMC) were isolated from healthy human peripheral blood, and the cell concentration was adjusted, and then equally divided into four tubes A PBMC sample was prepared (PBMC tube ID: Tube-1, Tube-2, Tube-3, Tube-4). A PBMC sample was mixed with K562 cells as target cells (T) as effectors (E) and E / T ratios of 20, 10 and 5. The cells were incubated for 4 hours at 37 ° C. in a 96 well U-bottom culture plate at 5% CO ₂ concentration. For K562 cells, two lines of maintenance culture were prepared from the same dish, and four kinds of dishes were prepared by preparing two cell concentrations at the time of the previous preculture (K562 cell preculture ID: K562-1, K562-2). , K562-3, K562-4). Used for incubation with 4 tubes of PBMC samples. K562 cells were stained with the fluorescent dye DiO and used for incubation. After 4 hours, the cells were collected, propidium iodide (PI) was added and mixed, and using a flow cytometer, PI positive cells in DiO positive cells were determined as K562 dead cells and the ratio was measured. The measurement result was substituted into the following equation, and the ratio (%) of K562 cells killed by PBMC, that is, NK activity was calculated.
NK activity (%) = ([K562 cell dead cell rate] − [K562 cell single dead cell rate]) / (100− [K562 cell single dead cell rate]) × 100
K562 cell dead cell rate: PI positive cell rate in DiO positive cells in each well K562 cell single dead cell rate: PI positive cell rate in DiO positive cells when K562 cells were incubated alone

Each E / T ratio condition was prepared in 3 well, and the average value of 3 well NK activity was evaluated as the NK activity value of each E / T ratio condition. The results are shown in FIG. In FIG. 9, error bars are standard deviations. Despite the same PBMC sample, Tube-1 to Tube-4 showed different NK activity values. The only difference in the experimental conditions is the difference in the preculture conditions for K562 cells. Therefore, NK activity measured by conventional biological measurement methods may cause measurement errors due to differences in target cell preparation conditions, and may be evaluated as different values even for the same sample. Was clearly shown.

(Example 4) Calculation of NINK score Using the PBMC of Tube-2 to Tube-4 of the PBMC sample used in Comparative Example 2 above, measured values of various parameters were obtained in the same manner as in Examples 1 to 3. The NINK score was calculated. Specifically, the CD3 ^- CD56 ⁺ NK cell ratio (%) was measured with a flow cytometer, NK cells were collected from PBMC samples using magnetic beads, and the amount of IFN-γ and NKp46 mRNA in the cells was determined by QGP. Measured by the method. The obtained measured value was substituted into Formula 3 prepared in Example 3, and the NINK score was calculated.

The results are shown in FIG. The right graph of FIG. 10 shows a graph of the NINK score calculated in this example. For comparison, the left figure of FIG. 10 shows the value of NK activity from Tube-2 to Tube-4 when the E / T ratio of Comparative Example 2 is 10. While the NK activity in Comparative Example 2 varies only depending on the state of the target cells even though it is in the same sample, the NINK score shows almost the same value with little difference between the same samples. It was found that the reproducibility was excellent.

The present invention can solve the problems of NK activity measurement by conventional cell culture because it does not require cell culture equipment and target cells for measurement of each parameter that is the basis of NINK score calculation. That is, the present invention enables measurement of NK cell function easily, in a short time, and at low cost. In addition, the NINK score shows a good positive correlation with NK activity by cell culture, can reduce measurement errors between different measurements, and can test NK cell function with high accuracy. The NINK score is promising as a new evaluation method of NK cell function, and is suitable for use in health analysis using big data in the future. Moreover, among immunocompetent cells, it is not thought that the increase or decrease of T cell function is generally related to the improvement of health, but it can be understood that the increase of NK cell function is basically an improvement of health. it can. The NINK score of the present invention has also been confirmed to decrease with aging, and is considered to be related to aging of NK cell function and decreased health, and is expected to be used as a simple immune health index.

Claims

A method for examining natural killer cell function of a sample collected from a test animal, including the following steps (1) to (3) or including the steps (2) to (3):
(1) A step of measuring the ratio of the number of natural killer cells to the number of peripheral blood mononuclear cells in the sample collected from the test animal;
(2) Natural killer cell activation receptor mRNA expression level of natural killer cells in the sample collected from the test animal,
Measuring at least two mRNA expression levels selected from the group consisting of natural killer cell cytokine mRNA expression levels and natural killer cell death-inducing factor mRNA expression levels;
(3) A step of calculating a NINK score using at least three measurement values obtained in the steps (1) and (2) or the step (2), wherein the NINK score is provided in a plurality of ways. A step calculated by a mathematical expression obtained by multiple regression analysis using three or more finite parameters selected from the following (a) to (d) as independent variables, measured for a sample collected from an animal: :
(A) ratio of the number of natural killer cells to the number of peripheral blood mononuclear cells;
(B) mRNA expression level of natural killer cell activation receptor in natural killer cells;
(C) Natural killer cell cytokine mRNA expression level;
(D) mRNA expression level of a cell death inducing factor in natural killer cells.
(B) includes the mRNA expression level of natural killer cell NKp46,
(C) includes natural killer cell IFN-γ mRNA expression level and TNF-α mRNA expression level,
(D) includes a natural killer cell Granzyme B mRNA expression level and a FasL mRNA expression level,
The method for examining natural killer cell function according to claim 1.
The method for examining natural killer cell function according to claim 1, wherein the finite number of parameters of 3 or more includes the following parameters (a1) to (c1):
(A1) Ratio of the number of natural killer cells to the number of peripheral blood mononuclear cells;
(B1) NKp46 mRNA expression level in natural killer cells;
(C1) IFN-γ mRNA expression level in natural killer cells.
The method for examining natural killer cell function according to any one of claims 1 to 3, wherein the NINK score is calculated by the following mathematical formula 1:
(Formula 1) NINK score = d + a × [NK cell ratio (%)] + b × [NKp46 mRNA level] + c × [IFN-γ mRNA level]
[However, a, b, c, and d in Formula 1 are arbitrary non-zero real numbers, [NK cell ratio (%)] is the ratio of the number of natural killer cells to the number of peripheral blood mononuclear cells, and [NKp46 mRNA level] is The natural killer cell NKp46 mRNA expression level, [IFN-γ mRNA level], is the natural killer cell IFN-γ mRNA expression level. ]
The formula according to claim 1, wherein the formula is an updated formula that is subjected to multiple regression analysis by adding a measurement value obtained from a sample collected from a test animal to an independent variable of a formula created in advance. The method for examining natural killer cell function according to any one of the above.
The method for examining natural killer cell function according to any one of claims 1 to 5, comprising the steps (1) to (3).
The method for examining natural killer cell function according to claim 6, wherein the natural killer cells in the steps (1) and (2) are stored after being separated.
The method for examining natural killer cell function according to claim 7, wherein the natural killer cell is cryopreserved.
The method for examining natural killer cell function according to any one of claims 1 to 8, wherein the test animal and the donor animal are human.
A program for testing a natural killer cell function, which causes a computer to function as a NINK score calculation means, wherein the NINK score calculation means is measured on samples collected from a plurality of donor animals, the following (a) to (d) A program for testing natural killer cell function, which is calculated by a mathematical expression obtained by multiple regression analysis using three or more finite parameters selected from the above as independent variables:
(A) ratio of the number of natural killer cells to the number of peripheral blood mononuclear cells;
(B) mRNA expression level of natural killer cell activation receptor in natural killer cells;
(C) Natural killer cell cytokine mRNA expression level;
(D) mRNA expression level of a cell death inducing factor in natural killer cells.
An apparatus for testing natural killer cell function comprising a NINK score calculation means, wherein the NINK score calculation means was measured on samples collected from a plurality of donor animals from the following (a) to (d) A device for testing natural killer cell function, which is calculated by a mathematical expression obtained by multiple regression analysis using three or more selected finite parameters as independent variables:
(A) ratio of the number of natural killer cells to the number of peripheral blood mononuclear cells;
(B) mRNA expression level of natural killer cell activation receptor in natural killer cells;
(C) Natural killer cell cytokine mRNA expression level;
(D) mRNA expression level of a cell death inducing factor in natural killer cells.
Reagent kit for testing natural killer cell function using NINK score as an index, including at least three or more kinds of reagents for obtaining the following measured values (11) and (12) for a sample collected from a test animal :
(11) Ratio of the number of natural killer cells to the number of peripheral blood mononuclear cells;
(12) Natural killer cell activation receptor mRNA expression level in natural killer cells,
At least two mRNA expression levels selected from the group consisting of natural killer cell cytokine mRNA expression levels and natural killer cell death-inducing factor mRNA expression levels.
A NINK score obtained by the test method according to any one of claims 1 to 9, which is converted into NK activity, and measured using peripheral blood mononuclear cells and natural killer cell target cells prepared in advance. A method of converting the NINK score into NK activity, comprising calculating the NK activity by substituting the NINK score obtained for the test animal into a regression linear equation having the determined NK activity and NINK score as variables.