WO2017211052A1

WO2017211052A1 - Flic protein microcapsule vaccine

Info

Publication number: WO2017211052A1
Application number: PCT/CN2016/107373
Authority: WO
Inventors: 类延乐
Original assignee: 类延乐
Priority date: 2016-06-08
Filing date: 2016-11-26
Publication date: 2017-12-14
Also published as: CN105920594A

Abstract

The present invention provides a microcapsule vaccine. An amino acid sequence of a fliC protein is represented by SEQ ID No:1. The microcapsule vaccine can also be used as a feed additive.

Description

FliC protein microcapsule vaccine

Technical field

The invention belongs to the technical field of preparation of aquaculture vaccines, and particularly relates to a floc protein microcapsule vaccine.

Background technique

Edwardsiella tarda is an important pathogen of aquatic animals. It belongs to the family Enterobacteriaceae and belongs to the genus Edwards. This bacterium was first reported by Hoshina in blush disease and is currently a great hazard in aquaculture. Pathogens. The bacteria can infect a variety of fish including freshwater and marine aquaculture, and can cause a large number of deaths in a short period of time, which has brought huge economic losses to China's aquaculture industry.

The use of vaccines can improve the specific immunity level of farmed fish, make the fish body immune to the infection of specific pathogenic microorganisms, do not pollute the environment, and have no drug residues. It is the mainstream development direction of fish disease prevention and control in the future. Therefore, screening immunogenic antigens and using them to prepare vaccines has practical application significance.

Summary of the invention

The object of the present invention is to provide a fliC protein microcapsule vaccine, which can effectively prevent diseases caused by E. faecalis, thereby making up for the deficiencies of the prior art.

The microcapsule vaccine provided by the present invention, wherein the amino acid sequence of the antigen fliC protein is SEQ ID NO: 1;

Wherein the gene encoding the fliC protein has a nucleotide sequence of SEQ ID NO: 2;

The above proteins are coupled with lipopolysaccharide;

The microcapsule vaccine of the invention comprises mixing the fliC protein with the astragalus polysaccharide, mixing with sodium alginate, and preparing the emulsion with distilled water, wherein the final concentration of sodium alginate is 2%, the emulsion is evenly stirred, and then sprayed. Calcium alginate microcapsules were formed in a solution with a concentration of 3% CaCl ₂ , and stirring was continued for 20 min after the spraying; the calcium alginate microcapsules were collected by centrifugation, and then the microcapsules were dispersed into a 0.2% chitosan solution and thoroughly stirred. Thereafter, the microcapsules are collected by centrifugation, washed with distilled water, and the collected microcapsules are dispersed in a mannitol solution, mixed, frozen, and lyophilized to prepare a microcapsule vaccine.

The microcapsule vaccine of the present invention can be used as a feed additive.

The fliC protein vaccine provided by the invention has strong immunogenicity and has good immune effect. Moreover, the oral immunization has less stress on the smaller fish body, and the labor cost is low, which is convenient for large-scale promotion and application. The vaccine has no peculiar smell, good palatability, and easy to eat fish.

DRAWINGS

Figure 1: Sequence comparison of the fliC protein of the present invention with the fliC gene in NCBI.

detailed description

The invention will be described in detail below with reference to the drawings and specific embodiments.

Example 1: Acquisition and sequence analysis of fliC protein

1) Separation of Edwards

In 2015, a gingival brood cultured in a gingival farm in Shandong Province showed obvious symptoms of delayed E. faecium infection, but the diseased fish had been previously treated with a delayed E. faecium vaccine. The fish were obtained from the dead fish under sterile conditions, and streaked on a common nutrient agar plate. After incubation at 30 ° C, the dominant colonies were picked and purified until the pure culture was obtained.

A pure culture of each strain was isolated and expanded on a common nutrient agar plate, and then the colony was eluted with sterile physiological saline to obtain a bacterial suspension for injection infection. The final screened strain showed high virulence to healthy gums, causing 90% of gum deaths, and death gums exhibiting the same symptoms as diseased gums. Therefore, it was confirmed that the screened E. faecalis ET strain was the pathogen of gingival ascites. The strain can be isolated again in the infected gingiva.

Comparative experiments showed that the ET strains screened by the present invention were used for the challenge test of the gingival seedlings with the currently marketed E. sinensis vaccine, and the results showed that the vaccines currently marketed had much lower immunity. The effect of the inactivated vaccine made with the ET strain of the present invention. It is speculated that the immunization effect of the current vaccine is not good due to the mutation of a certain pathogenic gene of the ET strain.

2) Amplification and sequence analysis of the flagellin fliC of E. faecalis ET strain

According to the gene sequence of Genbank's dull Edward FliC, specific primers were designed:

fliC forward primer: CGGGATCCATGGCACAAGTAATCAACACC,

fliC reverse primer: CCGCTCGAGACGCAGCAGAGACAGGACGTTC;

The bacterial genome extraction kit was used to extract bacterial genomic DNA as a template, and the positive and negative primers of each gene were used for PCR amplification. The PCR reaction system and reaction conditions were: 50 μl reaction system containing 37 μl H ₂ O, 5 μl. 10×Taq buffer, 4 μl dNTP (2.5 mM), 1 μl of each of the positive and negative primers, 1 μl of Taq DNA Polymerase and 1 μl of DNA template; PCR reaction procedure was denaturation at 94 ° C for 10 min; denaturation at 94 ° C, 1 min, annealing at 50 ° C for 1 min, extension at 72 ° C At 1 min, 30 cycles were performed and finally extended at 72 ° C for 8 min. The PCR product was detected by 1% agarose gel electrophoresis, and the gel imaging system was photographed. The results showed that the gene amplification was successful and the size of the amplified product was consistent with the desired target gene.

After the amplification product was recovered and sequenced, the results showed that the sequence of the fliC gene was significantly different from the sequence disclosed in NCBI; the amino acid sequence obtained by the present invention is the fliC protein of SEQ ID NO: 1 compared to the fliC of NCBI. There are differences in the presence of more than 10 amino groups in the gene (Fig. 1). The amino acid sequence of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) obtained is SEQ ID NO: 3, NCBI ratio The results indicate that GAPDH is consistent with the published sequences in NCBI.

The immunization effect showed that the vaccine prepared by using the fliC protein having the amino acid sequence of SEQ ID NO: 1 had a better immunological effect on the ET strain than the vaccine prepared by the published fliC protein in NCBI.

Example 2: Expression of recombinant protein and its coupling with lipopolysaccharide

1) Construction of fliC gene expression vector: The amplified diploid E. faecalis fliC gene product was recovered and purified, and the purified product was digested with BamHI and XholI, ligated into prokaryotic expression vector pET32a, and its expression vector pET32a- fliC, and the expression vector was transformed into E. coli BL21 (DE3), cultured on LB plate containing ampicillin, and the positive clone expression bacteria were screened by PCR method, and the PCR-positive clones were further utilized. Sequencing was confirmed.

2) Expression and purification of recombinant protein: After confirming the correct insertion sequence in the vector, the selected transfected Edward FliC positive clone expressing bacteria were inoculated into LB medium containing ampicillin and cultured on an incubator to exponential growth. At the time of introduction, the expression of IPTG was added to the final concentration of 1 mM for 6 h, and the cells were collected by centrifugation. After sonication, the recombinant protein was purified by Ni-chelating affinity chromatography column (HisTrap HP 1 ml, GE). The product was dialyzed against a urea concentration gradient and finally dialyzed against PBS. After dialysis was completed, the sample was freeze-dried to concentrate the sample, and the purified recombinant protein was detected by SDS-PAGE. The recombinant protein of Escherichia coli fliC has a molecular weight of 63 kDa, the target gene encodes 416 amino acids, the theoretical molecular weight of the expressed protein fragment is 43 kDa, and the size of the plasmid pET32a is about 20 kDa. The result is consistent with the theoretical size.

3) Coupling of recombinant protein with LPS: Dissolve 110 mg of dry powder of lipopolysaccharide in 10 ml of distilled water, add 400 mg of solid NaIO ₄ to the LPS aqueous solution, mix and incubate for 2 min, then add 220 μl of ethanolamine to terminate the oxidation reaction, and add the reaction product to the pore size. In a 3K-sized dialysis bag, it was placed in 0.01 mol/L of PBS, and dialyzed overnight at 4 ° C, during which the dialysate was changed twice. At the same time, 390 mg of carbodiimide (EDC) was weighed and dissolved in 5 ml of distilled water, then 90 mg of the purified FliC recombinant protein was added, and the pH of the reaction system was adjusted to 5.4 with 1 M HCl, and incubated at room temperature for 2 h with shaking. The LPS after the completion of the oxidation reaction was dissolved and mixed with the EHC-containing recombinant FliC protein, and incubated at 22 ° C for 1 h. Finally, the reaction solution was dialyzed against PBS buffer overnight, during which the dialysate was replaced, and finally the dialyzed solution was obtained. After centrifugation at 8000 g for 30 min, the resulting supernatant was the coupled crude of FliC and LPS.

4) Purification of recombinant protein-LPS conjugate: The crude protein was coupled with each recombinant protein, and each recombinant protein-LPS conjugate was separated and purified by Sephacryl S-300 gel column chromatography. Specifically, the crude coupling product is first filtered through a membrane having a pore size of 0.22 μm, and then the column volume is 120 mL. 10 ml of the coupled crude material was applied to the Sephacryl S-300 column. The PBS buffer was used as the equilibration and elution buffer. The flow rate was controlled to 2 ml/min. The sample was collected according to the ultraviolet absorption wave. According to the molecular sieve principle, the molecular weight was determined. Larger coupled products will be obtained first separately. The collected coupling product was dialyzed against ultrapure water, then freeze-dried and stored at -20 ° C until use.

Example 3: Preparation of an oral microcapsule vaccine of fliC subunit:

The coupled product of the above-prepared fliC recombinant protein and LPS is mixed with the Astragalus polysaccharide in a ratio of 2-4:1 by mass ratio, and then the antigen mixture is mixed with sodium alginate at a mass ratio of 1:3. The emulsion was prepared by using distilled water to ensure that the final concentration of sodium alginate in the emulsion was 2%, and it was embedded for 30 minutes under the stirring of the mixer. The emulsion was directly sprayed into a 3% CaCl ₂ solution agitated by a mixer using a spray-type acute pore coagulation bath method to form a calcium alginate microcapsule, and the volume ratio of the emulsion to the CaCl ₂ solution was 1: 1. Continue stirring for 30 minutes after spraying. The microcapsules were collected by centrifugation, and then the microcapsules were dispersed into a 0.2% chitosan solution, stirred well for 30-40 min, the microcapsules were collected by centrifugation, washed three times with distilled water and centrifuged, and the collected microcapsules were dispersed at 8%. In the mannitol solution, it is mixed and frozen, and after lyophilization, it is packaged and packaged to prepare a subunit oral microcapsule vaccine. The apparent properties of the prepared microcapsules were observed by a microscope, and it was found that the microcapsules were uniform in size and the average diameter was 150±10 μm.

Example 4: Immunoprotective effect of fliC subunit microcapsule vaccine on gingiva

A total of 80 healthy gums were prepared, with an average body weight of 50g ± 5g. The gingiva was kept for 7 days using a temperature-controlled circulating culture system, and the water temperature was controlled at 21 ° C. The commercial pellet feed was normally fed during the period. Before the experiment, the fish were divided into two groups, 40 mice in each group. After fasting for 24 hours, the fishes of the immunized group were fed with oral microcapsule vaccine of fliC subunit. The feeding method: oral microcapsules The vaccine is mixed with fish feed and put into the water body for free feeding. The dosage is: 0.5g of microcapsule vaccine per kg body weight of fish, and continuous feeding for 5 days. 15 days after the first feeding, the second immunization was performed again, and the usage and dosage were the same as the first time. The control group was fed with microcapsule granules prepared from sodium alginate solution containing no immunogen and Astragalus polysaccharide. The feeding method and feeding amount were the same as those in the immunized group, and 35 hours after the first feeding, the preparation was slow with physiological saline. The live bacteria suspension of Edwards was at a concentration of 1×10 ⁷ CFU/ml. The experimental fish body was challenged by intramuscular injection, and 100 μl was injected per tail. After the challenge, the disease incidence and mortality of the fish were continuously observed and recorded, and the relative immune protection rate of the oral microcapsule vaccine of the Edwards subunit was calculated. The results showed that the cumulative mortality of the fish in the control group was over 90%, and the cumulative mortality of the fish in the immunized group was less than 20% after 20 days of attack. According to the calculation, the oral microcapsules of the E. faecalis subunit developed by the present invention were obtained. The relative immune protection rate of the vaccine against the gums is above 80%.

Moreover, the results of the challenge experiment with the E. faecalis ET strain showed that the fliC prepared by the present invention The subunit oral microcapsule vaccine was significantly more immune (p < 0.05) than the other commercially available strains of E. sinensis, presumably due to differences in the amino acid sequence of the fliC gene.

In summary, the oral microcapsule vaccine of the retarded Edwards subunit produced by the invention is convenient to use, has suitable particle size, has good sustained release and antigen protection, and can effectively stimulate the intestinal immune system to produce immunity. Response, so that the fish body to obtain specific immune protection against Edwards deficient, has a good development and application prospects.

Claims

A microcapsule vaccine characterized in that the antigen used in the microcapsule vaccine is the fliC protein having the amino acid sequence of SEQ ID NO: 1.
The microcapsule vaccine according to claim 1, wherein the fliC protein has a nucleotide sequence encoding the gene of SEQ ID NO: 2.
The microcapsule vaccine according to claim 1, wherein the fliC protein is coupled with a lipopolysaccharide.
The method for preparing a microcapsule vaccine according to claim 1, wherein the fliC protein is mixed with the xanthine polysaccharide, mixed with sodium alginate, formulated into an emulsion with distilled water, and the emulsion is uniformly stirred and sprayed. Calcium alginate microcapsules were formed in a solution of 3% CaCl 2 , and stirring was continued for 20 min after the completion of the spraying; the calcium alginate microcapsules were collected by centrifugation, and then the microcapsules were dispersed into a 0.2% chitosan solution, fully After stirring, the microcapsules were collected by centrifugation, washed with distilled water, and the collected microcapsules were dispersed in a mannitol solution, mixed, frozen, and lyophilized to prepare a microcapsule vaccine.
The method according to claim 4, wherein the final concentration of sodium alginate in the emulsion is 2%.
Use of the microcapsule vaccine of claim 1 as a feed additive.
The use according to claim 6 wherein said feed additive is a feed additive for gingiva.
A gum feed characterized in that the microcapsule vaccine of claim 1 is used in the feed.