CN102206257A - Edwardsiella tarda immunogenic protective antigen, and related expression vector, vaccine and application - Google Patents
Edwardsiella tarda immunogenic protective antigen, and related expression vector, vaccine and application Download PDFInfo
- Publication number
- CN102206257A CN102206257A CN2011100958267A CN201110095826A CN102206257A CN 102206257 A CN102206257 A CN 102206257A CN 2011100958267 A CN2011100958267 A CN 2011100958267A CN 201110095826 A CN201110095826 A CN 201110095826A CN 102206257 A CN102206257 A CN 102206257A
- Authority
- CN
- China
- Prior art keywords
- protective antigen
- tarda
- blunt tarda
- vaccine
- edwardsiella tarda
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Farming Of Fish And Shellfish (AREA)
Abstract
The invention provides an Edwardsiella tarda immunogenic protective antigen which is an Edwardsiella tarda flagellar related protein with an amino acid sequence expressed in SEQ ID NO:2 and a preferred nucleotide sequence expressed in SEQ ID NO:1, a recombination expression vector corresponding to the Edwardsiella tarda immunogenic protective antigen, an Edwardsiella tarda subunit vaccine prepared by the Edwardsiella tarda immunogenic protective antigen, and an application of the Edwardsiella tarda immunogenic protective antigen in the preparation of the Edwardsiella tarda subunit vaccine. The Edwardsiella tarda immunogenic protective antigen provided by the invention has a good immunogenicity and can be used for preparing a safe, effective and economic vaccine, thus has a high commercial value and is suitable for large scale popularization and application.
Description
Technical field
The present invention relates to the antigen technical field, more specifically, relate to the immune protective antigen technical field, be meant a kind of blunt tarda immune protective antigen, correlated expression carrier, vaccine and application especially.
Background technology
Along with the continuous stable development of fishery cultivating, various disease problems become increasingly conspicuous, and cultured output and growth are caused have a strong impact on.In China, sudden, the explosive disease of seawater cage culture that grew up in recent years and industrialized culture fish frequently takes place.At present, the average death loss rate of the sea farming of China is more than 30%, and annual financial loss reaches 16,000,000,000 yuan, and the disease problem has become the important factor that the restriction mariculture industry develops in a healthy way.
At the generation of various diseases, be that the chemotherapy of representative had once been brought into play active effect to the control and the control of disease with the microbiotic.But the environmental pollution that this disease measure of control cause, a large amount of appearance of anti-medicine cause of disease, the negative impacts such as drug residue of fishery products are on the rise.In European Union, the U.S. and Canada, disabled gradually in culture fishery based on the chemicals of microbiotic.
Be the serious day by day development trend of cultured fishes disease of containing that various environmental factorss and cultivation density surge etc. cause, advance the Sustainable development of mariculture industry, the World Food Programme is in conjunction with developed country's fishery successful experience of developing (Ormonde P.Fisheries resources:trends in production, utilization and trade.In:Nomura I (ed.) .The State of World Fishery and Agriculture2002.Rome:FAO Information Division, 2002, p3-p45.), (System management approaches, SMA) aquaculture model prevents the generation of various diseases to advocate " system management approach ".Main contents in this measure are exactly that to advocate with vaccine inoculation be the various immune protection The Application of Technology of representative.The employing of these measures will significantly reduce the use of chemicals, both avoid the pollution to environment, increase the consumption safety of fishery products again.As the cost-effective disease control strategy and the means that meet environmental friendliness, the strategy of sustainable development, vaccination is just becoming the main forward position and the Application Areas of countries in the world research and development in modern aquaculture standard.
But pointed strong, the disease-resistant cycle of vaccine is grown lifetime immunity, effect is remarkable and control characteristics initiatively.With pathogenic bacteria cell deactivation body is that the inactivated vaccine (Kill vaccine) of base form is that the aquiculture disease control provides effective means; but inactivated vaccine generally has the technology applied defect of administration inconvenience (drug administration by injection just has immune protective efficiency preferably); very inconvenience for the fish farming industry of the thousands of quantity of needs immunity, the administration cost often can not be born by culture fishery.And, for disease serious fry and juvenile fish being taken place then can't implement drug administration by injection, simultaneously, to many disease inactivated vaccines poor effect or invalid often.Everything has brought obstruction all for aquiculture disease immune protection broad application.
The industry characteristics of culture fishery require the necessary economy of disease control technology, application implementation conveniently.Therefore, the exploitation of vaccine product is except that the technical requirements that height is tired, and immune cost must be cheap, can not exceed the ability to bear of aquaculture.Attenuated live vaccine because of have convenient drug administration (can soak administration), immunizing potency height (can reduce dosage), with low cost, can develop the new technology advantage of wide spectrum vaccine (live bacterial vaccines often has intersecting protective), become current vaccine research of used for aquiculture in the world and hot of research and development and field, forward position.
Edwardsiella is the common pathogenic agent of a class that causes fresh water, marine fish bacteriosis, specifically be divided into blunt tarda (Edwardsiella tarda), catfish tarda (Edwardsiella ictaluri) and guarantor section tarda (Edwardsiella hoshinae).Be referred to as tarda disease (Edwardsiellosis) by its fish hueppe's disease that causes.It is wide that this disease is propagated area, do not have obviously seasonality, infection rate and mortality ratio height, and the kind of harm is many, and carp is arranged, tilapia, common eel, grey mullet, salmon, trout, the fingerling that great majority such as flounder flounder have higher economic worth.In addition, blunt tarda also infects shellfish, reptiles, batrachians, birds, mammals.Merit attention, blunt tarda still is a kind of important infecting both domestic animals and human cause of disease bacterium, and it is the member of unique mankind of infection in the Edwardsiella.At present, the more serious pathogenic agent of the sick disease of China's cultured fishes tarda is mainly blunt tarda, and the grave danger that exists pathogenic agent to shift to human body is arranged.United States Patent (USP) has and utilizes Rifampin screening to obtain report (the Evans J J of the natural attenuation mutant of wild strain as attenuated live vaccine, Klesius, P H and Shoemaker C A2006 Modifi ed live Edwardsiella tarda vaccine for aquatic animals; United States Patent7067122).Still there is not effective prophylactico-therapeutic measures of this disease at present in China.
Separate in the sick fish body of the tarda disease that the wild strain EIB202 of blunt tarda of the present invention breaks out in culturing the fishing ground from marine site, China East Sea and obtain, be a kind of supervirulent blunt tarda bacterial strain (Edwardsiella tarda EIB202, Xiao Jingfan etc., " Isolation and identification of fish pathogen Edwardsiella tarda from mariculture in China ", " Aquaculture Research " Vol.40,2009), be deposited in Chinese typical culture collection center, address: Chinese Wuhan City Wuhan University, deposit number is: CCTCC NO:M 208068, preservation date is on May 1st, 2008, specifically referring to Chinese invention patent application CN200910052707.6.
Because blunt tarda pathogenesis is still lacked systematic understanding, its many hosts adaptability also causes the control of this bacterium particularly difficult.At present, the control of tarda disease mainly relies on antibiotic use, based on chemotherapy.Because microbiotic can extensively be discerned, their application in aquaculture more and more are restricted.In addition, morbific blunt tarda usually is found has natural resistance to the plain mixture of multiple antibacterial, has increased the difficulty based on the treatment of microbiotic.By contrast, from a secular viewpoint, vaccine is that disease is controlled safer more efficient methods.Since the antigenicity of inactivated vaccine a little less than, and the security instability of attenuated vaccine for this reason, develop commercialization scale operation easy to use, efficient, easy, effective subunit vaccine, to water industry particularly necessity.
Summary of the invention
Main purpose of the present invention is exactly the problems and shortcomings at above existence; a kind of blunt tarda immune protective antigen, correlated expression carrier, vaccine and application are provided; this blunt tarda immune protective antigen immunogenicity is better; for the tarda disease of cultured fishes provides a kind of safety; effectively; economic vaccine has actual business development using value, is suitable for large-scale promotion application.
To achieve these goals; in a first aspect of the present invention; a kind of blunt tarda immune protective antigen is provided; be characterized in; described blunt tarda immune protective antigen is blunt tarda flagellum associated protein, and the aminoacid sequence of described blunt tarda flagellum associated protein is shown in SEQ ID NO:2.
Preferably, the nucleotide sequence of described blunt tarda flagellum associated protein is shown in SEQ ID NO:1.
In a second aspect of the present invention, a kind of recombinant expression vector is provided, be characterized in, comprise expression vector and be incorporated into the extraneous nucleotide sequence of the above-mentioned blunt tarda immune protective antigen of coding on the described expression vector.
Preferably, described extraneous nucleotide sequence is shown in SEQ ID NO:1.
In a third aspect of the present invention, a kind of subunit vaccine of blunt tarda is provided, be characterized in, be prepared from by above-mentioned blunt tarda immune protective antigen.
In a fourth aspect of the present invention, provide the above-mentioned application of blunt tarda immune protective antigen in the subunit vaccine of the blunt tarda of preparation.
Preferably, described blunt tarda is blunt tarda EIB202, and deposit number is: CCTCC NO:M 208068.
Beneficial effect of the present invention specifically is: blunt tarda immune protective antigen of the present invention is blunt tarda flagellum associated protein; the aminoacid sequence of described blunt tarda flagellum associated protein is shown in SEQ ID NO:2; experiment shows that this blunt tarda immune protective antigen has immanoprotection action preferably to blunt tarda; simultaneously; for the subunit vaccine exploitation; this blunt tarda immune protective antigen also will be as the preferred target spot of follow-up vaccine design; for the tarda disease of cultured fishes provides a kind of safety; effectively; economic vaccine; actual business development using value is arranged, be suitable for large-scale promotion application.
Description of drawings
Fig. 1 is the SDS-PAGE figure behind a specific embodiment of the recombinant expression vector of the present invention blunt tarda immune protective antigen purifying of expressing, swimming lane 1: albumen Marker; Swimming lane 2 and 3:FD protein expression result; Swimming lane 4 and 5:FD protein purification result.
Fig. 2 is that the premunition protection behind the blunt tarda immune protective antigen immunity zebra fish of the present invention is analyzed.
Fig. 3 is that the premunition protection after the blunt tarda immune protective antigen immunity turbot of the present invention is analyzed.
Fig. 4 is blunt tarda immune protective antigen immunity turbot serum sterilizing vigor of the present invention analysis.
Fig. 5 is specific antibody titres analysis in the blunt tarda immune protective antigen immunity turbot serum of the present invention.
Embodiment
Content for a better understanding of the present invention is described further especially exemplified by following examples.
The preparation of embodiment 1 recombinant protein vaccine
One, experiment material
1, bacterial strain and plasmid
Intestinal bacteria Escherichia coli TOP10, intestinal bacteria E.coli BL21 (DE3) are available from TIANGEN Biotech (Beijing) Co., Ltd.; Blunt tarda E.tarda EIB202, preserving number is: CCTCC M 208068; PET 28a (+) carrier is available from precious biotechnology (Dalian) company limited.
2, substratum and culture condition
Substratum:
LB：1％Tryptone，0.5％Yeast extract，1％NaCl。Solid medium adds 2%ager.121 ℃ of autoclaving 20min.Being used for intestinal bacteria cultivates.
TSB：3％TSB。Solid medium adds 2%ager.121 ℃ of autoclaving 20min.Being used for EIB202 cultivates.
The DHL substratum: 60g deoxycholate hydrogen sulfide lactose agar substratum is dissolved in the 1L deionized water, boils repeatedly to be dissolved to clarification, and the cooling back makes dull and stereotyped.
Culture condition:
Intestinal bacteria are left standstill shaking table concussion cultivation in cultivation or the LB liquid nutrient medium at 37 ℃ of LB solid medium middle plateforms
Blunt tarda is inoculated in the TSB liquid nutrient medium, the jolting of spending the night of 28 ℃, 200r/min.Blunt tarda liquid is coated with or lines on the DHL solid medium, is inverted in incubated overnight in 37 ℃ of constant incubators, forms the translucent evil mind bacterium colony in edge on the DHL solid medium.
3, experiment reagent
Conventional molecular biology reagent and test kit are available from TIANGEN Biotech (Beijing) Co., Ltd.; Restriction enzyme Nde I, Xho I is available from precious biotechnology (Dalian) company limited.The conventional reagent of protein expression and purifying is available from Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.Affinity chromatography medium Ni-Sepharose FF is available from GE Healthcare.The monoclonal antibody of the brill IgM of the Chinese People's Anti-Japanese Military and Political College is available from Aquatic Diagnostics, and the sheep anti mouse monoclonal antibody is available from Tiangen.
4, antigenic protein gene sequence
According to E.tarda EIB202 whole genome sequence, obtain the dna sequence dna (SEQ ID NO:1) of corresponding blunt tarda flagellum associated protein FD gene.Its aminoacid sequence is seen SEQ ID NO:2.
5, antigen protein primer
With the Auele Specific Primer of Primer Premier 5 software design FD genes, primer is synthetic through Shanghai bio-engineering corporation, is the PAGE purified product.
FDf：GGGAGATCATATGGCCATTTCGGTATCG (Nde I)
FDr：GCCGCTCGAGTAAGATCTGGCGTACGT (Xho I)
6, laboratory animal and immunoreagent
Zebra fish is purchased in Shanghai plant, the long 4cm of body, the about 0.4g of body weight.Place 2 weeks of aquarium endoadaptation handling before the experiment earlier, after move to the fish feeding system and adapted to for 2 weeks.The fish feeding system mobile water body of changing every day is cultured about 22 ℃ of temperature.Feed 2 times and in time remove the ight soil residue every day.
Turbot is purchased in Weifang, Shandong plant, body weight 30g, and the long 10cm of body places the tank endoadaptation to raise and train for 2 weeks, and is standby.Use natural sea-water to replace 2/3 volume and culture water and inflation, water temperature 14-16 ℃ every day in the experiment.The immunization front and back are according to the breed program management of routine.
Fish is purchased the company in Sigma with narcotic tricaine methanesulphonate (MS-222).Fish is used adjuvant MONTANIDE
TMISA 763A buys the company in French SEPPIC.
Two, experimental technique
1, the structure of FD recombinant antigen protein gene
The extracting of vector plasmid pET28a is carried out according to the operation instructions of TIANprep Mini Plasmid Kit.Carry out the genomic extraction of blunt tarda EIB202 according to the operation instructions of TIANamp Bacteria DNA Kit.Genome is used for the PCR reaction, and the primer must arrive the purpose product that two ends contain Nde I and Xho I restriction enzyme digestion sites for the Auele Specific Primer FDf/FDr of design.Select for use restriction enzyme Nde I and Xho I to carry out double digestion, goal gene after enzyme is cut and carrier behind the purpose band, utilize sepharose DNA to reclaim test kit and reclaim DNA under the cutting through agarose gel electrophoresis.
After obtaining having the goal gene and plasmid of sticky end, under the effect of dna ligase, both are coupled together, form the recombinant plasmid that contains goal gene.Recombinant plasmid promptly can be used for changeing clone's e. coli bl21 (DE3) host bacterium.Clone on the flat board cuts through order-checking and enzyme and verifies and to be defined as the positive, is the proteic recombination bacillus coli BL21 of blunt tarda FD (DE3)/pET-28a-FD.
2, the expression and purification of FD recombinant antigen protein
The successful expression strain of order-checking is inoculated, grown into and to a certain degree add inductor IPTG and carry out abduction delivering.Collect the centrifugal back of bacterium liquid supersonic method broken wall, supernatant is collected in centrifugal back.Protein electrophoresis detects the FD recombinant protein of abduction delivering, sees shown in Fig. 1 arrow.The protein electrophoresis result shows that the FD recombinant protein has great expression.
A His mark respectively has been with at FD recombinant protein two ends, can combine with Ni specifically.Therefore can come single-minded ground purification of target albumen with the Ni post.With the albumen that wash-out obtains, the molecular weight cut-off of packing into is in the dialysis tubing of 14kD, dialyses-70 ℃ of preservations in PBS solution.
Embodiment 2: the drug administration by injection immunoprotection test that with the zebra fish is experimental animal
Determination of protein concentration
Utilize nucleic acid quantification instrument NanoDrop ND-1000 spectrophotometer to detect its OD280, determine recombinant protein concentration, albumen is diluted to predetermined concentration with the PBS damping fluid.
The immunization of zebra fish
Purifying FD recombinant protein and adjuvant ISA 763A were according to 7: 3 mixed, and final protein concentration reaches 0.3 μ g/ μ l.The zebra fish random packet is cultured, and 30/group, every zebra fish carries out the tail muscles injecting immune.Normally raise then, observe activity and the death condition of fish.The immunity time is one month.Negative control is PBS and adjuvant combined group.
Before the injection operation, zebra fish is soaked among the 100ng/ml MS-222 anaesthetizes earlier.After finishing experimental period, will remain zebra fish and carry out euthanasia, promptly be soaked among the 300ng/ml MS-222 more than 10 minutes.
The poison of attacking of zebra fish is injected
Collect blunt tarda EIB202 thalline, with sterilization PBS washing three times, the cell density with spectrophotometric determination after resuspended, quantitatively OD
600Be 1, and bacterium liquid be diluted to dense required degree gradient with PBS; Every the test zebra fish carries out the tail muscles injecting immune according to the dosage of 5 μ l/fish; Observed and recorded is respectively organized zebra fish morbidity and dead situation.
The mensuration of recombinant protein immune protective efficiency
After culturing for 4 weeks after the zebra fish immunity,, select proper dosage that the zebra fish of immunity is attacked the poison experiment according to wild strain medium lethal dose LD50 value; Observed and recorded is respectively organized zebra fish morbidity and death condition.
By (1) formula calculate relative protection ratio (Relative percent survival, RPS):
RPS=(the 1-immune group rate of dying/control group mortality ratio) * 100% (1)
The death condition that zebra fish is attacked in malicious back 8 days is seen Fig. 2.Zebra fish is attacked poison had the death of minute quantity fish in back first day, and the fish body settles out subsequently.Began to have the situation of mass mortality on the 3rd day, and find that zebra fish is slowly movable, preceding on one's deathbed afterbody swings, infection site body colour blackout.Death condition tended towards stability in the 8th day.Wherein the mortality ratio of blank group is 81%, and the mortality ratio of immune group is 23%.Calculating learns that the proteic relative protection ratio of FD is 71%.
Sick fish is dissected the back find the enlargement of fish body spleen, the pinkiness of losing blood, it is hemorrhage that dispersivity appears in liver.Be coated with the DHL plate after will sick fish tissue suitably handling dilution, 28 ℃ of incubated overnight have a large amount of evil mind bacterium colonies to exist on the plate, illustrate that zebra fish is nosogenetic to have infected blunt tarda really.
Embodiment 3: the drug administration by injection immunoprotection test that with the turbot is experimental animal
The immunity of turbot
The turbot random packet is cultured, and 30/group, every dosage according to 100 μ l/fish carries out the tail muscles injection.After the purifying protein dialysed overnight,, reach 0.3 μ g/ μ l according to 7: 3 mixed to protein concentration with adjuvant ISA 763A according to its concentration.PBS and the negative contrast of adjuvant ISA 763A immune group.Normally raise then, observe the movable of fish and have or not death.The immunity time was 10 weeks.
Before the injection operation, turbot is soaked among the 100ng/ml MS-222 anaesthetizes earlier.After finishing experimental period, will remain turbot and carry out euthanasia, promptly be soaked among the 300ng/ml MS-222 more than 10 minutes.
Turbot attack poison
To attack malicious method in zebra fish identical for the poison of attacking of turbot, and turbot in the 10th week, according to wild strain LD50 value, is selected proper dosage that the turbot of immunity is divided into groups to attack poison and tested after immunity.
Antigen protein is the immune protective efficiency analysis in the turbot body
The death condition that turbot is attacked in malicious back 8 days is seen Fig. 3.Experimental result shows that turbot is attacked the poison back and begun to have the situation of mass mortality on the 3rd day, and obvious disease symptom is arranged: the gill cover edge of sick fish, and the subcutaneous hyperemia of the film fin base portion and the outside of belly, rubescent, hemorrhage subsequently place's focus generation purulence ulcer forms subcutaneous abscess.Death condition tended towards stability in the 7th day.Wherein the mortality ratio of blank group is 80%, and the mortality ratio of immune group is 30%.Calculating learns that the proteic relative protection ratio of FD is 62.5%.
Compare the experimental result that zebra fish and turbot immunity FD albumen is obtained; the candidate antigens albumen FD that primary dcreening operation obtains on the one-level animal model zebra fish is described; on secondary animal model turbot, immanoprotection action is preferably arranged also; this lays good basis for follow-up further multiple sieve experiment on the one hand, has confirmed that also zebra fish can become the new animal model of screening protective antigen.Simultaneously, for the subunit vaccine exploitation, FD also will be as the preferred target spot of follow-up vaccine design.
Embodiment 4:FD antigen protein immune level is analyzed
Turbot blood sampling and sero-fast preparation
Behind the turbot immunity FD recombinant protein, get blood in the 8th week and the 10th week from experiment fish tail vein respectively, every tail takes out about 0.3ml blood.It is centrifugal that the whole blood room temperature leaves standstill the back, collects upper serum, be stored in-80 ℃ standby.
The antiserum(antisera) sterilization experiment
Inoculate blunt tarda EIB202, incubated overnight.With PBS washing three times, get a certain amount of bacteria suspension and mix with immune serum and hatch, in 1,2,3,4, the 5h spread plate of taking a sample respectively; The blank sample is that bacteria suspension mixes with NIS.Establish three groups of parallel controls for every group.All dull and stereotyped 20h that cultivate carry out enumeration, and calculate the sterilizing ability of antiserum(antisera) in different time points.With antiserum(antisera) and the EIB202 hatching that turbot immunity FD recombinant protein is obtained, get the sero-fast sterilizing ability of different incubation period point analysiss.The results are shown in Figure 4.
By last figure result as can be known, antiserum(antisera) and the hatching of blunt tarda are after 4 hours, and viable count is minimum, and promptly this moment, serum had best sterilizing ability.After viable bacteria hatching 4 hours, the survival rate of blunt tarda is that the survival rate of bacterium in 41%, the 10 all serum is 53% in the 8th all serum, and the antiserum(antisera) in obvious the 8th week has more bactericidal property.
The serum antibody level determination is analyzed
The specific antibody level that produces after the immunity of experiment fish turbot is measured conventional indirect ELISA method and is detected:
The hatching of recombinant protein FD wrapper sheet behind the purifying is spent the night.Wash plate 3 times, pat dry; Add confining liquid solution, in 22 ℃ of sealing 2h.Wash plate 3 times, pat dry; Add the fish immune serum, 100 μ l/ holes are added in each hole with 2 times of serial dilution degree, and initial extent of dilution is 1: 4, and greatest dilution is 1: 512, and blank serum is done same treatment in contrast.Hatch 3h in 22 ℃.Wash plate 5 times, pat dry; Add the monoclonal antibody of the brill IgM of the Chinese People's Anti-Japanese Military and Political College, hatch 1h in 22 ℃.Wash plate 5 times, pat dry; Add sheep anti mouse monoclonal antibody (HRP mark), hatch 1h in 22 ℃.Wash plate 5 times, pat dry; Add solvable type tmb substrate washing lotion, the room temperature lucifuge is placed 10min; Add reaction terminating liquid, place microplate reader to detect with the OD450 wavelength.
Antibody titer is determined according to the P/N value.Test serum absorbance (P)=serum OD value to be checked-blank serum OD value, negative control sera absorbance (N)=negative serum OD value-blank OD value, when both ratios greater than 2.1 the time, sero-fast highly diluted multiple is its final antibody titer.
Utilize that conventional indirect ELISA method measures that turbot immunity FD recombinant protein produces specific antibody level, the results are shown in Figure 5.The result shows that sero-fast light absorption value is obviously greater than blank serum.Produced certain specific antibody behind the turbot immunity FD recombinant protein.
In sum, blunt tarda immune protective antigen immunogenicity of the present invention is better, and for the tarda disease of cultured fishes provides a kind of safety, effectively, economic vaccine has actual business development using value, is suitable for large-scale promotion application.
In this specification sheets, the present invention is described with reference to its certain embodiments.But, still can make various modifications and conversion obviously and not deviate from the spirit and scope of the present invention.Therefore, specification sheets and accompanying drawing are regarded in an illustrative, rather than a restrictive.
Claims (7)
1. blunt tarda immune protective antigen; it is characterized in that; described blunt tarda immune protective antigen is blunt tarda flagellum associated protein, and the aminoacid sequence of described blunt tarda flagellum associated protein is shown in SEQ ID NO:2.
2. blunt tarda immune protective antigen according to claim 1 is characterized in that the nucleotide sequence of described blunt tarda flagellum associated protein is shown in SEQ ID NO:1.
3. a recombinant expression vector is characterized in that, comprises expression vector and the extraneous nucleotide sequence that is incorporated into the coding blunt tarda immune protective antigen according to claim 1 on the described expression vector.
4. blunt tarda immune protective antigen according to claim 3 is characterized in that described extraneous nucleotide sequence is shown in SEQ ID NO:1.
5. the subunit vaccine of a blunt tarda is characterized in that, is prepared from by blunt tarda immune protective antigen according to claim 1.
6. the application of blunt tarda immune protective antigen according to claim 1 in the subunit vaccine of the blunt tarda of preparation.
7. application according to claim 6 is characterized in that, described blunt tarda is blunt tarda EIB202, and deposit number is: CCTCC NO:M 208068.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110095826 CN102206257B (en) | 2011-04-15 | 2011-04-15 | Edwardsiella tarda immunogenic protective antigen, and related expression vector, vaccine and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110095826 CN102206257B (en) | 2011-04-15 | 2011-04-15 | Edwardsiella tarda immunogenic protective antigen, and related expression vector, vaccine and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102206257A true CN102206257A (en) | 2011-10-05 |
| CN102206257B CN102206257B (en) | 2013-06-05 |
Family
ID=44695348
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201110095826 Active CN102206257B (en) | 2011-04-15 | 2011-04-15 | Edwardsiella tarda immunogenic protective antigen, and related expression vector, vaccine and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102206257B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105920593A (en) * | 2016-06-08 | 2016-09-07 | 山东省海洋生物研究院 | Edwardsiella tarda subunit oral microencapsule vaccine for aquatic product |
| CN106085903A (en) * | 2016-06-08 | 2016-11-09 | 山东省海洋生物研究院 | A kind of Aquatic product Edwardsiella tarda |
| WO2017211052A1 (en) * | 2016-06-08 | 2017-12-14 | 类延乐 | Flic protein microcapsule vaccine |
| CN116574166A (en) * | 2023-05-04 | 2023-08-11 | 中国海洋大学 | Bicistronic DNA vaccine of fish beta defensin and outer membrane protein C |
-
2011
- 2011-04-15 CN CN 201110095826 patent/CN102206257B/en active Active
Non-Patent Citations (3)
| Title |
|---|
| QIYAO WANG 等: "Genome sequence of the versatile fish pathogen Edwardsiella tarda provides insights into its adaptation to broad host ranges and intracellular niches", 《PLOS ONE》 * |
| WANG,Q.等: "flgD gene product [Edwardsiella tarda EIB202]", 《NCBI DATABASE》 * |
| 张晓佩 等: "迟钝爱德华氏菌鞭毛蛋白的提取与分析", 《福建农业学报》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105920593A (en) * | 2016-06-08 | 2016-09-07 | 山东省海洋生物研究院 | Edwardsiella tarda subunit oral microencapsule vaccine for aquatic product |
| CN106085903A (en) * | 2016-06-08 | 2016-11-09 | 山东省海洋生物研究院 | A kind of Aquatic product Edwardsiella tarda |
| WO2017211052A1 (en) * | 2016-06-08 | 2017-12-14 | 类延乐 | Flic protein microcapsule vaccine |
| CN106085903B (en) * | 2016-06-08 | 2019-09-24 | 山东省海洋生物研究院 | A kind of aquatic products Edwardsiella tarda |
| CN116574166A (en) * | 2023-05-04 | 2023-08-11 | 中国海洋大学 | Bicistronic DNA vaccine of fish beta defensin and outer membrane protein C |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102206257B (en) | 2013-06-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102430120B (en) | Adjuvant for enhancing fish vaccine immunization effect and application thereof | |
| CN103255089B (en) | The strong malicious slow Edwardsiella vaccine strain of one strain and application thereof | |
| CN102988981B (en) | Adjuvant for improving immunization effect of Edwardsiella vaccine and use method of adjuvant | |
| CN101342367B (en) | Edwardsiella tarda attenuated live vaccine | |
| CN105801707A (en) | Oral vaccine for treating grass carp hemorrage as well as preparation and application thereof | |
| CN108003240A (en) | A kind of multi-joint antiidiotype Yolk antibody vaccine of mariculture fish and preparation method thereof | |
| CN108939062A (en) | A kind of aeromonas salmonicida vaccine and its application | |
| CN102206257B (en) | Edwardsiella tarda immunogenic protective antigen, and related expression vector, vaccine and application | |
| CN101629149B (en) | Marker-free gene-deletion attenuated mutant strain derived from Edwardsiella tarda wild strain, related preparation and application thereof | |
| CN104962572A (en) | Preparation method for aeromonas hydrophila outer membrane protein gene prokaryotic expression protein | |
| CN103275890A (en) | Vibrio anguillarum (listonella anguillarum) virulent strain and application thereof | |
| CN103014051B (en) | Multiple-potency live vaccine for fish and application thereof | |
| CN104961811A (en) | Aeromonas hydrophila outer membrane protein gene prokaryotic expression protein and application thereof | |
| CN1276076C (en) | No mark gene deletion deoxidated mutant strain of wild Manhu bacteria and its use | |
| CN101974472B (en) | Marker-free gene deletion attenuated mutant strain of Edwardsiella tarda wild strain as well as relevant preparations and application thereof | |
| CN104093419B (en) | The preparation method of the wide spectrum vaccine of prevention birds colibacillosis | |
| CN102604993B (en) | Immunologic adjuvant-Helicobacter pylori antigen fused protein oral vaccine and preparation method thereof | |
| CN103667145B (en) | Edwardsiella tarda genetic engineering low virulent strain and its application | |
| EP2912198B1 (en) | Immunogenic composition against aeromonas hydrophila | |
| CN106047763A (en) | Vibrio anguillarum O3 serotype bacterial strain and application thereof | |
| CN109010816A (en) | One kind killing the different vibrio vaccine of salmon and its application | |
| CN105316252A (en) | Five-gene-deleted streptococcus suis serotype 2 strain and application | |
| CN104208665B (en) | A kind of Edwardsiella tarda subunit vaccine and its preparation method and application | |
| CN103509732B (en) | Edwardsiella tarda natural low virulent strain and application thereof | |
| TW200303212A (en) | Selection of poultry eimeria strains through extra-intestinal sporozoites |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |