WO2017205514A1 - Méthodes de sensibilisation du cancer à l'immunothérapie - Google Patents

Méthodes de sensibilisation du cancer à l'immunothérapie Download PDF

Info

Publication number
WO2017205514A1
WO2017205514A1 PCT/US2017/034285 US2017034285W WO2017205514A1 WO 2017205514 A1 WO2017205514 A1 WO 2017205514A1 US 2017034285 W US2017034285 W US 2017034285W WO 2017205514 A1 WO2017205514 A1 WO 2017205514A1
Authority
WO
WIPO (PCT)
Prior art keywords
cdk5
binding antagonist
cells
tumor
cancer
Prior art date
Application number
PCT/US2017/034285
Other languages
English (en)
Inventor
Alex Yee-Chen HUANG
Agne PETROSIUTE
Original Assignee
Case Western Reserve University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Case Western Reserve University filed Critical Case Western Reserve University
Priority to US16/303,846 priority Critical patent/US11124571B2/en
Publication of WO2017205514A1 publication Critical patent/WO2017205514A1/fr
Priority to US17/480,831 priority patent/US11884730B2/en
Priority to US18/167,438 priority patent/US20230192863A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2803—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
    • C07K16/2827—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily against B7 molecules, e.g. CD80, CD86
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • A61K39/39533—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals
    • A61K39/39541—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals against normal tissues, cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70596—Molecules with a "CD"-designation not provided for elsewhere
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
    • C12Y207/11—Protein-serine/threonine kinases (2.7.11)
    • C12Y207/11022—Cyclin-dependent kinase (2.7.11.22)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca

Definitions

  • CDK cyclin-dependent kinase
  • CDKs The activity of CDKs is regulated post-translationally, by transitory associations with other proteins, and by alterations of their intracellular localisation. Tumor development is closely associated with genetic alteration and deregulation of CDKs and their regulators, suggesting that inhibitors of CDKs may be useful anti-cancer therapeutics. Indeed, early results suggest that transformed and normal cells differ in their requirement for e.g., cyclin A/CDK2 and that it may be possible to develop novel antineoplastic agents devoid of the general host toxicity observed with conventional cytotoxic and cytostatic drugs.
  • CDKs The function of CDKs is to phosphorylate and thus activate or deactivate certain proteins, including, for example, retinoblastoma proteins, lamins, histone Hi, and components of the mitotic spindle.
  • the catalytic step mediated by CDKs involves a phospho-transfer reaction from ATP to the macromolecular enzyme substrate.
  • Several groups of compounds (reviewed in N. Gray, L. Detivaud, C. Doerig, L. Meijer, Curr. Med. Chem. 1999, 6, 859) have been found to possess anti-proliferative properties by virtue of CDK-specific ATP antagonism.
  • Roscovitine is the compound 6-benzylamino-2-[(R)-l-ethyl-2- hydroxyethylamino]-9-isopropylpurine. Roscovitine has been demonstrated to be a potent inhibitor of cyclin dependent kinase enzymes, particularly CDK2. This compound is currently in development as an anti-cancer agent. CDK inhibitors are understood to block passage of cells from the Gl/S and the G2/M phase of the cell cycle. Roscovitine has also been shown to be an inhibitor of retinoblastoma phosphorylation and therefore implicated as acting more potently on Rb positive tumors.
  • PD-1 is a key immune checkpoint receptor expressed by activated T and B cells and mediates immunosuppression.
  • PD-1 is a member of the CD28 family of receptors, which includes CD28, CTLA-4, ICOS, PD-1, and BTLA.
  • Two cell surface glycoprotein ligands for PD-1 have been identified, Programmed Death Ligand-1 (PD-Ll) and Programmed Death Ligand-2 (PD-L2), that are expressed on antigen-presenting cells as well as many human cancers and have been shown to downregulate T cell activation and cytokine secretion upon binding to PD-1.
  • PD-1 primarily functions in peripheral tissues where activated T-cells may encounter the immunosuppressive PD-Ll (B7- Hl) and PD-L2 (B7-DC) ligands expressed by tumor and/or stromal cells. Inhibition of the PD-1/PD-L1 interaction mediates potent antitumor activity in preclinical models (U.S. Pat. Nos. 8,008,449 and 7,943,743), and the use of Ab inhibitors of the PD-1/PD-L1 interaction for treating cancer has entered clinical trials.
  • B7- Hl immunosuppressive PD-Ll
  • B7-DC PD-L2
  • Inhibition of the PD-1/PD-L1 interaction mediates potent antitumor activity in preclinical models (U.S. Pat. Nos. 8,008,449 and 7,943,743), and the use of Ab inhibitors of the PD-1/PD-L1 interaction for treating cancer has entered clinical trials.
  • Embodiments described herein relate to a method of sensitizing cancer to immunotherapy or treating tumor immunity in a subject in need thereof by administering to the subject a therapeutically effective amount of a CdK5 inhibitor to suppress immune checkpoint programmed death- ligand 1 (PD-Ll) in the cancer cells.
  • a CdK5 inhibitor to suppress immune checkpoint programmed death- ligand 1 (PD-Ll) in the cancer cells.
  • PD-Ll programmed cell death ligand 1
  • Cdk5 cyclin- dependent kinase 5
  • IFN- ⁇ Interferon- ⁇
  • Cdk5 results in persistent expression of the PD-Ll transcriptional repressors, the interferon regulatory factors IRF2 and IRF2BP2, which likely leads to reduced PD-Ll expression on tumors. Accordingly, disruption of Cdk5 activity in the cancer cells with a Cdk5 inhibitor can result in potent CD4(+) T cell-mediated tumor rejection.
  • the cancer cells of the subject treated with the Cdk5 inhibitor can express or over-express PD-Ll and/or Cdk5.
  • Cancer cells that express or over express PD-Ll and/or Cdk5 can include medulloblastoma or rhabdomyosarcoma.
  • the Cdk5 inhibitor can be selected from the group consisting of Dinaciclib, AT7519, Roscovitine, CYC065, PHA-793887, Milcidib, and SNS- 032.
  • the method can further include administering a PD-1 binding antagonist and/or a PD-Ll binding antagonist in combination with the Cdk5 inhibitor.
  • the PD-1 binding antagonist and/or PD-Ll binding antagonist can inhibit PD- 1/PD-Ll interaction and/or PD-1/PD-L1 signaling pathway.
  • the PD-1 binding antagonist and/or PD-Ll binding antagonist is an antibody.
  • the PD-1 binding antagonist and/or PD-Ll binding antagonist can be selected from the group consisting of MDX-1106, Merck 3745, CT-011, AMP-224, AMP-514, YW243.55.S70, MPDL3280A, MDX-1105, MEDI-4736, and
  • the subject is treated with at least one of tumor removal surgery, chemotherapy, radiation therapy, or immunotherapy.
  • the expression level of Cdk5 and/or PD-Ll in the cancer cells can be determined prior to administration of the Cdk5 inhibitor.
  • the Cdk5 inhibitor can be administered to cancer cells where the PD-Ll expression level or Cdk5 expression level exceeds a predetermined threshold value.
  • the predetermined threshold value can relate to cancer cell PD-Ll expression or Cdk5 expression.
  • the method can include detecting the expression level of Cdk5 and/or programmed death-ligand 1 (PD-Ll) in cancer cells.
  • a subject having cancer cells expressing or over-expressing Cdk5 and/or PD-Ll can be administered an amount of a CdK5 inhibitor effective to suppress immune checkpoint PD-Ll.
  • the Cdk5 inhibitor can include, for example, at least one of Dinaciclib, AT7519, Roscovitine, CYC065, PHA-793887, Milcidib, or SNS-032.
  • the method can further include administering a PD-1 binding antagonist and/or a PD-Ll binding antagonist in combination with the Cdk5 inhibitor.
  • the PD-1 binding antagonist and/or PD-Ll binding antagonist can inhibit PD- 1/PD-Ll interaction and/or PD-1/PD-L1 signaling pathway.
  • the PD-1 binding antagonist and/or PD-Ll binding antagonist is an antibody.
  • the PD-1 binding antagonist and/or PD-Ll binding antagonist can be selected from the group consisting of MDX-1106, Merck 3745, CT-011, AMP-224, AMP-514, YW243.55.S70, MPDL3280A, MDX-1105, MEDI-4736, and
  • the subject is treated with at least one of tumor removal surgery, chemotherapy, radiation therapy, or immunotherapy.
  • the expression level of Cdk5 and/or PD-Ll in the cancer cells can be determined prior to administration of the Cdk5 inhibitor.
  • the Cdk5 inhibitor can be administered to cancer cells where the PD-Ll expression level or Cdk5 expression level exceeds a predetermined threshold value.
  • the predetermined threshold value can relate to cell surface PD-Ll expression or Cdk5 expression.
  • Still other embodiments relate to a method of treating cancers expressing or over-expressing programmed death-ligand 1 (PD-Ll) and/or Cdk5 in a subject in need thereof.
  • the method can include administering to the subject a therapeutically effective amount of a CdK5 inhibitor to suppress immune checkpoint PD-Ll.
  • Cancer cells that express or over express PD-Ll and/or Cdk5 can include, for example, medulloblastoma or rhabdomyosarcoma.
  • the Cdk5 inhibitor can be selected from the group consisting of Dinaciclib, AT7519, Roscovitine, CYC065, PHA-793887, Milcidib, and SNS- 032.
  • the method can further include administering a PD-1 binding antagonist and/or a PD-Ll binding antagonist in combination with the Cdk5 inhibitor.
  • the PD-1 binding antagonist and/or PD-Ll binding antagonist can inhibit PD- 1/PD-Ll interaction and/or PD-1/PD-L1 signaling pathway.
  • the PD-1 binding antagonist and/or PD-Ll binding antagonist is an antibody.
  • the PD-1 binding antagonist and/or PD-Ll binding antagonist can be selected from the group consisting of MDX-1106, Merck 3745, CT-011, AMP-224, AMP-514, YW243.55.S70, MPDL3280A, MDX-1105, MEDI-4736, and MSB0010718C.
  • the subject is treated with at least one of tumor removal surgery, chemotherapy, radiation therapy, or immunotherapy.
  • the expression level of Cdk5 and/or PD-Ll in the cancer cells can be determined prior to administration of the Cdk5 inhibitor.
  • the Cdk5 inhibitor can be administered to cancer cells where the PD-Ll expression level or Cdk5 expression level exceeds a predetermined threshold value.
  • the predetermined threshold value can relate to cell surface PD-Ll expression or Cdk5 expression.
  • Figs. l(A-E) illustrate immunoassays, images, and plots showing targeted deletion of Cdk5 in medulloblastoma (MB) results in rejection by CD4+ T cells.
  • Cdk5 and p35 proteins are expressed in murine and human MB cell lines in vitro.
  • B MM1 shCdk5 and MM1 crCdk5 are deficient in Cdk5 protein expression.
  • E Tumor growth kinetics for individual animals in each group. Panel three is an inset of panel two. X indicates that an animal was euthanized due to tumor size or ulceration.
  • Figs. 2(A-I) illustrate plots and graphs showing disruption of either Cdk5 gene expression or Cdk5 activity suppresses PD-Ll expression that cannot be overcome with ⁇ ⁇ stimulation in both human and murine MB.
  • B Cdk5 kinase activity in MMl WT, shCdk5, and shNS over the course of 24-hour stimulation with IFNy (black) and the addition of 10 ⁇ Roscovitine (gray).
  • EB embryonic brain.
  • C In vitro mRNA expression of PD-Ll by MMl WT (white), crCdk5 (black), and crNeg (gray) with or without 24 hours of IFNy stimulation. Values represent the average of 3 biological replicates +/- SD.
  • D In vitro PD-Ll surface staining of MMl WT (white), crCdk5 (black), crNeg (gray), and crPDLl (striped) with or without 24 hours of IFNy stimulation. Values represent the average MFI +/- SD compared to unstimulated MMl WT over 7-8 replicates.
  • (I) TFS of MMl crNeg and crPDLl over 36 days (n 10 mice/group). *P ⁇ 0.05; ** P ⁇ 0.01 ; *** P ⁇ 0.001
  • Figs. 3(A-C) illustrate immunoblots and graphs showing Cdk5 gene silencing alters the IFNy signaling pathway and is associated with hyperphosphorylation of IRF2BP2.
  • A IFNy stimulation of MMl WT, crCdk5, and crNeg for 24 hours. IFNyR downstream mediators STAT1, phosphorylated (p)STATl, IRF1, IRF2, and IRF2BP2 were assayed.
  • B In vitro mRNA analysis oi IRF-1, IRF-2, and IRF2BP2 present in MMl WT (white), crCdk5 (black), and crNeg (gray) after treatment with IFNy for 24 hours.
  • C Global
  • phosphoproteomic analysis (left) of MMl WT, crCdk5, and crNeg cells shows a change in phosphorylation status of 35 different phosphopeptides found in 18 of the 22 identified proteins (right). Twelve proteins exhibit only increased phosphorylation, three exhibit only decreased phosphorylation, and three have both increased and decreased phosphorylation sites.
  • FIGs. 4(A-H) illustrate images showing orthotopic Cdk5 deficient tumors exhibit PD-Ll staining, CD4+ Tumor infiltrating lymphocytes (TIL), and accumulating infiltrates of CDl lb+ populations.
  • TIL Tumor infiltrating lymphocytes
  • E FACS analysis of the percentage of PD-1+ or PD-L1+ cells in the CD4+ or CD8+ populations.
  • F FACS analysis of the percentage of myeloid cells in tumor infiltrate based on differential CD45 staining (left) or Ly6C staining among CDl lb+CD45+ cells (right).
  • G Percent of total CDl lb+ population (left) and sub- populations (right) present in tumor infiltrate that express PD-Ll.
  • H MFI of PD-Ll expression among CDl lb+ total population (left) and sub-populations (right).
  • Figs. 5(A-E) illustrate plots and graphs showing kinase active Cdk5 is expressed by murine and human MB cell lines and deletion of Cdk5 does not alter proliferation.
  • A Genomic analysis from the UCSC cancer genome browser demonstrates that Cdk5, p35, and p39 are highly expressed in pediatric MB and neuroblastoma (NB) samples (above black line) compared to normal brain tissue (below black line).
  • Cdk5 kinase assay activity is detected in human MB (UW228, DAOY) and mouse MB (MMl) cell lines, with lysates from Cdk5 _/ ⁇ and Cdk5+/+ embryonic brains as negative and positive controls, respectively (Black Bars).
  • the non-selective Cdk5 inhibitor, Roscovitine (10 ⁇ ) abrogates this kinase activity (Gray bars).
  • C mRNA expression of Cdk5 transcript in MMl WT (white), shCdk5 (black), or shNS (gray).
  • D Proliferation curves of MMl WT (square), shCdk5 (triangle), and shNS (circle) in media with 10% serum (black lines) or 1% serum (gray lines) over 72 hours
  • E Proliferation curves of MMl WT (white), crCdk5 (black), crNeg (gray) in media containing 10% serum over 72 hours.
  • Figs. 6(A-D) illustrate plots showing similar subcutaneous growth kinetics of crCdk5 MMl and crNeg MMl in immunecompromised mice.
  • B TFS of MMl crCdk5 (circle) and crNeg (square) in NSG mice.
  • C Tumor weights of MMl crCdk5 (circle) and crNeg (square) in NSG mice. The solid line represents the average weight +/- SD.
  • D Inverse correlation between CD3+ cell count per HPF and Cdk5 staining intensity of clinical MB tissue samples as revealed by IHC analysis in Fig. ID.
  • Figs. 7(A-E) illustrate plots showing in vivo growth kinetics of MMl shCdk5 reveals thymic dependent tumor rejection upon subcutaneous (S.C.) injection.
  • Figs. 8(A-E) illustrate plots showing a link between Cdk5 and PD-L1 expressions in human and murine tumors.
  • B PD-L1 expression on primary cell cultures of MMl crNeg, crCdk5, or outgrowth of crCdk5 tumors. Cells were stimulated with IFNy for 24 hours (black) and compared to isotype staining (dotted line) and unstimulated cells (gray). Histogram is a representative staining from three separate experiments.
  • Figs. 9(A-B) illustrate plots showing co-occurrence of upregulated Cdk5 and PD-L1 expression in human cancer samples.
  • TCGA provisional datasets for all available cancer types were analyzed for Cdk5 and PD-L1 (CD274) mRNA expression through cBioPortal (http://www.cbioportal.org/).
  • Relative mRNA expression values of samples with existing RNA sequencing analysis (RNA Seq V2) were downloaded and analyzed with Microsoft excel.
  • Figs. lO(A-C) illustrate plots and an immunoassay showing silencing Cdk5 in MB alters IRF-2 expression but does not affect other IFN signaling pathways.
  • A Surface expression of MHC-I is upregulated on MMl WT, crCdk5, and crNeg. Cells were stimulated with IFNy for 24 hours (black) and compared to isotype staining (dotted line) and unstimulated cells (gray). Histogram is a representative staining from three separate experiments.
  • B IFNy stimulation of MMl WT, crCdk5, and crNeg over the course of 48 hours. IFNyR downstream mediators IRF1, and IRF2 were assayed.
  • C 24-hour stimulation of MMl WT, crCdk5, and crNeg cells. Downstream IFNy pathway elements STAT3, phosphorylated (p)STAT3, and STAT2 were assayed.
  • Figs. 1 l(A-D) illustrate an immunoassay, images, and plots showing CD3+ cell infiltrate and diminished growth rates associate with a decrease in tumor incidence following orthotopic administration of Cdk5-deficient MMl cells.
  • A Tumor incidence of MMl WT, shCdk5, and shNS 14 days after i.e. tumor inoculation.
  • FIG. 12(A-I) illustrate graphs, images, and plots showing subcutaneous Cdk5 deficient tumors characterized by increased stromal PD-Ll staining, CD4+ tumor infiltrating lymphocytes (TIL), and infiltrating CDl lb+ populations.
  • TIL tumor infiltrating lymphocytes
  • (B) Subcutaneous Tumors extracted 14 days post- inoculation from MMl shCdk5 or shNS stained for F4/80, PD-Ll, and PD-1 expression (Scale bars 2mm).
  • F FACS analysis of the percentage of PD-1+ or PD-L1+ cells in the CD4+ or CD8+ populations.
  • H Percent of total CDl lb+ population (left) and sub-populations (right) present in tumor infiltrate that express PD-Ll.
  • I MFI of PD-Ll expression between total (left) and sub-populations (right) of CDl lb+ cells. C thru H were graphed as the mean +/- SD.
  • (I) was graphed as individual MFI with mean indicated. n 9 / group. Each data point represents pooled samples from 3 mice. *P ⁇ 0.05
  • Figs. 13(A-B) illustrate schema of putative mechanism by which Cdk5 controls PD-Ll expression.
  • IRF2/IRF2BP2 repressor complex (B) In Cdk5 deficient cells, unknown kinase(s) hyper- phosphorylate IRF2BP2, prolong half-life of IRF2/IRF2BP2 repressor complex despite intact JAK/STAT/IRF- 1 signaling, ultimately leading to decreased PD-Ll expression.
  • IRF-E IRF- binding element.
  • Figs. 14(A-F) illustrate plots showing higher Cdk5 correlates with adverse clinical outcomes in human cancers.
  • FIGs. 15(A-B) illustrate graphs showing surface PD-L1 expression on MM1 cells following 24-hour exposure of IFNy (lOOng/ml) and various concentrations of CYC065.
  • A Mean fluorescence intensity as measured by flow cytometry.
  • FIGs. 16(A-B) illustrate graphs showing surface PD-L1 expression on RMS 76.9 cells following 24-hour exposure of IFNy (100ng/ml) and various concentrations of CYC065.
  • A Mean fluorescence intensity as measured by flow cytometry.
  • FIG. 17(A-C) illustrate plots showing tumor incidence (A), overall mortality (B) and tumor size (C) of MMl-bearing C57BL/6 mice treated with 50mg/kg daily x 5 days / week dose of CYC065 in water by gavage.
  • CYC065 was started either beginning on Day 0 (red line) or Day 7 (green line) following tumor inoculation. There is a 70% mortality associated with prolonged exposure of mice to CYC065. However, mice treated with CYC065 developed significantly smaller sized tumor.
  • Figs. 18(A-C) illustrate graphs showing tumor cells harvested on Day 21 of tumor-bearing mice treated in Fig. 17 were cultured in vitro for 7-10 days, and then subjected to stimulation with lOOng/ml of IFNy for 24 hours.
  • the surface expressions of PD-L1 (A), MHC Class II molecule, I-A b (B) and MHC Class I molecules, K b D b (C) were analyzed by flow cytometry.
  • a "cancer” refers a broad group of various diseases characterized by the uncontrolled growth of abnormal cells in the body. Unregulated cell division and growth divide and grow results in the formation of malignant tumors that invade neighboring tissues and may also metastasize to distant parts of the body through the lymphatic system or bloodstream.
  • An "immune response” refers to the action of a cell of the immune system (for example, T lymphocytes, B lymphocytes, natural killer (NK) cells, macrophages, eosinophils, mast cells, dendritic cells and neutrophils) and soluble macromolecules produced by any of these cells or the liver (including Abs, cytokines, and complement) that results in selective targeting, binding to, damage to, destruction of, and/or elimination from a vertebrate's body of invading pathogens, cells or tissues infected with pathogens, cancerous or other abnormal cells, or, in cases of autoimmunity or pathological inflammation, normal human cells or tissues.
  • a cell of the immune system for example, T lymphocytes, B lymphocytes, natural killer (NK) cells, macrophages, eosinophils, mast cells, dendritic cells and neutrophils
  • soluble macromolecules produced by any of these cells or the liver (including Abs, cytokines, and complement) that results
  • an "immunoregulator” refers to a substance, an agent, a signaling pathway or a component thereof that regulates an immune response.
  • "Regulating,” “modifying” or “modulating” an immune response refers to any alteration in a cell of the immune system or in the activity of such cell. Such regulation includes stimulation or suppression of the immune system which may be manifested by an increase or decrease in the number of various cell types, an increase or decrease in the activity of these cells, or any other changes which can occur within the immune system. Both inhibitory and stimulatory
  • immunoregulators have been identified, some of which may have enhanced function in the cancer microenvironment.
  • immunotherapy refers to the treatment of a subject afflicted with, or at risk of contracting or suffering a recurrence of, a disease by a method comprising inducing, enhancing, suppressing or otherwise modifying an immune response.
  • Treatment or “therapy” of a subject refers to any type of intervention or process performed on, or the administration of an active agent to, the subject with the objective of reversing, alleviating, ameliorating, inhibiting, slowing down or preventing the onset, progression, development, severity or recurrence of a symptom, complication, condition or biochemical indicia associated with a disease.
  • Patentiating an endogenous immune response means increasing the effectiveness or potency of an existing immune response in a subject. This increase in effectiveness and potency may be achieved, for example, by overcoming mechanisms that suppress the endogenous host immune response or by stimulating mechanisms that enhance the endogenous host immune response.
  • the "Programmed Death- 1 (PD-1)" receptor refers to an immunoinhibitory receptor belonging to the CD28 family. PD-1 is expressed predominantly on previously activated T cells in vivo, and binds to two ligands, PD-L1 and PD-L2.
  • the term "PD-1" as used herein includes human PD-1 (hPD-1), variants, isoforms, and species homologs of hPD- 1, and analogs having at least one common epitope with hPD-1. The complete hPD-1 sequence can be found under GENBANK Accession No. U64863.
  • P-L1 Programmed Death Ligand-1
  • PD-L1 is one of two cell surface glycoprotein ligands for PD- 1 (the other being PD-L2) that downregulate T cell activation and cytokine secretion upon binding to PD-1.
  • the term "PD-L1 " as used herein includes human PD-L1 (hPD-Ll), variants, isoforms, and species homologs of hPD-Ll, and analogs having at least one common epitope with hPD-Ll. The complete hPD-Ll sequence can be found under GENBANK Accession No. Q9NZQ7.
  • a “signal transduction pathway” or “signaling pathway” refers to the biochemical relationship between a variety of signal transduction molecules that play a role in the transmission of a signal from one portion of a cell to another portion of the cell.
  • a “cell surface receptor” includes, for example, molecules and complexes of molecules that are located on the surface of a cell and are capable of receiving a signal and transmitting such a signal across the plasma membrane of a cell.
  • An example of a cell surface receptor of the present invention is the PD-1 receptor, which is located on the surface of activated B cells, activated T cells and myeloid cells, and transmits a signal that results in a decrease in tumor- infiltrating lymphocytes and a decrease in T cell proliferation.
  • an “inhibitor” of signaling refers to a compound or agent that antagonizes or reduces the initiation, reception or transmission of a signal, be that signal stimulatory or inhibitory, by any component of a signaling pathway such as a receptor or its ligand.
  • a “subject” includes any human or nonhuman animal.
  • the term “nonhuman animal” includes, but is not limited to, vertebrates such as nonhuman primates, sheep, dogs, cats, rabbits, ferrets, rodents such as mice, rats and guinea pigs, avian species such as chickens, amphibians, and reptiles.
  • the subject is a mammal such as a nonhuman primate, sheep, dog, cat, rabbit, ferret or rodent.
  • the subject is a human.
  • the terms, "subject,” “patient” and “individual” are used interchangeably herein.
  • a “therapeutically effective amount” or “therapeutically effective dosage” of a drug or therapeutic agent, such as an Ab of the invention is any amount of the drug that, when used alone or in combination with another therapeutic agent, protects a subject against the onset of a disease or promotes disease regression evidenced by a decrease in severity of disease symptoms, an increase in frequency and duration of disease symptom-free periods, or a prevention of impairment or disability due to the disease affliction.
  • the ability of a therapeutic agent to promote disease regression can be evaluated using a variety of methods known to the skilled practitioner, such as in human subjects during clinical trials, in animal model systems predictive of efficacy in humans, or by assaying the activity of the agent in in vitro assays.
  • an anti-cancer agent promotes cancer regression in a subject.
  • a therapeutically effective amount of the drug promotes cancer regression to the point of eliminating the cancer.
  • "Promoting cancer regression” means that administering an effective amount of the drug, alone or in combination with an anti-neoplastic agent, results in a reduction in tumor growth or size, necrosis of the tumor, a decrease in severity of at least one disease symptom, an increase in frequency and duration of disease symptom-free periods, or a prevention of impairment or disability due to the disease affliction.
  • the terms "effective” and “effectiveness” with regard to a treatment includes both pharmacological effectiveness and physiological safety.
  • Pharmacological effectiveness refers to the ability of the drug to promote cancer regression in the patient.
  • Physiological safety refers to the level of toxicity, or other adverse physiological effects at the cellular, organ and/or organism level (adverse effects) resulting from administration of the drug.
  • a therapeutically effective amount of the drug preferably inhibits cell growth or tumor growth by at least about 20%, more preferably by at least about 40%, even more preferably by at least about 60%, and still more preferably by at least about 80% relative to untreated subjects.
  • tumor regression may be observed and continue for a period of at least about 20 days, more preferably at least about 40 days, or even more preferably at least about 60 days. Notwithstanding these ultimate measurements of therapeutic effectiveness, evaluation of immunotherapeutic drugs must also make allowance for "immune-related" response patterns.
  • An "immune-related" response pattern refers to a clinical response pattern often observed in cancer patients treated with immunotherapeutic agents that produce antitumor effects by inducing cancer-specific immune responses or by modifying native immune processes.
  • This response pattern is characterized by a beneficial therapeutic effect that follows an initial increase in tumor burden or the appearance of new lesions, which in the evaluation of traditional chemotherapeutic agents would be classified as disease progression and would be synonymous with drug failure. Accordingly, proper evaluation of
  • immunotherapeutic agents may require long-term monitoring of the effects of these agents on the target disease.
  • a therapeutically effective amount of a drug includes a "prophylactically effective amount," which is any amount of the drug that, when administered alone or in combination with an anti-neoplastic agent to a subject at risk of developing a cancer (e.g., a subject having a pre-malignant condition) or of suffering a recurrence of cancer, inhibits the development or recurrence of the cancer.
  • the prophylactically effective amount prevents the development or recurrence of the cancer entirely. “Inhibiting" the development or recurrence of a cancer means either lessening the likelihood of the cancer's development or recurrence, or preventing the development or recurrence of the cancer entirely.
  • a "tumor-infiltrating inflammatory cell” is any type of cell that typically participates in an inflammatory response in a subject and which infiltrates tumor tissue. Such cells include tumor-infiltrating lymphocytes (TILs), macrophages, monocytes, eosinophils, histiocytes and dendritic cells.
  • TILs tumor-infiltrating lymphocytes
  • macrophages macrophages
  • monocytes eosinophils
  • histiocytes histiocytes and dendritic cells.
  • Tumor immunity refers to the process in which tumors evade immune recognition and clearance. Thus, as a therapeutic concept, tumor immunity is “treated” when such evasion is attenuated, and the tumors are recognized and attacked by the immune system. Examples of tumor recognition include tumor binding, tumor shrinkage and tumor clearance.
  • Treatment refers to clinical intervention designed to alter the natural course of the individual or cell being treated, and can be performed either for prophylaxis or during the course of clinical pathology. Desirable effects of treatment include preventing occurrence or recurrence of disease, preventing metastasis, decreasing the rate of disease progression, ameliorating or palliating the disease state, and remission or improved prognosis.
  • composition refers to a preparation that is in such form as to permit the biological activity of the active ingredient to be effective, and that contains no additional components that are unacceptably toxic to a subject to which the formulation would be administered. Such formulations are sterile.
  • Embodiments described herein relate to a method of sensitizing cancer to immunotherapy, treating tumor immunity, and/or treating cancers expressing or over- expressing programmed cell death ligand 1 (PD-Ll) and/or Cdk5 in a subject in need thereof by administering to the subject a therapeutically effective amount of a CdK5 inhibitor to suppress immune checkpoint programmed death-ligand 1 (PD-Ll) in the cancer cells and promote T-cell mediated tumor immunity.
  • PD-Ll programmed cell death ligand 1
  • CdK5 immune checkpoint programmed death-ligand 1
  • PD-Ll programmed cell death ligand 1
  • Cdk5 cyclin-dependent kinase 5
  • IFN- ⁇ Interferon- ⁇
  • Cdk5 results in persistent expression of the PD-Ll transcriptional repressors, the interferon regulatory factors IRF2 and IRF2BP2, which leads to reduced PD- Ll expression on tumors. Accordingly, disruption of Cdk5 activity in the cancer cells with a Cdk5 inhibitor results in potent T cell-mediated tumor rejection. Moreover, this effect is mediated via posttranslational modification of IRF2BP2, leading to the increased abundance of IRF2/IRF2BP2 and sustained functional repression of PD-Ll transcription following IFNy stimulation. [0069] In some embodiments, cancer cells of the subject treated with the Cdk5 inhibitor can express or overexpress PD-Ll and/or Cdk5.
  • cancer cells that can potentially express or overexpress PD-Ll and/or Cdk5 can include liver cancer, bone cancer, pancreatic cancer, skin cancer, cancer of the head or neck, breast cancer, lung cancer, cutaneous or intraocular malignant melanoma, renal cancer, uterine cancer, ovarian cancer, colorectal cancer, colon cancer, rectal cancer, cancer of the anal region, stomach cancer, testicular cancer, uterine cancer, carcinoma of the fallopian tubes, carcinoma of the endometrium, carcinoma of the cervix, carcinoma of the vagina, carcinoma of the vulva, non-Hodgkin's lymphoma, cancer of the esophagus, cancer of the small intestine, cancer of the endocrine system, cancer of the thyroid gland, cancer of the parathyroid gland, cancer of the adrenal gland, sarcoma of soft tissue, cancer of the urethra, cancer of the penis, solid tumors of childhood, lymphocytic lymphoma, cancer of the bladder,
  • a cancer that expresses or overexpresses PD-Ll and/or Cdk5 can include glioblastoma multiforme, adrenocortical carcinoma, hepatocellular carcinoma, pheochomocytoma/paraganglioma, cutaneous melanoma, uveal melanoma, uterine carcinosarcoma, diffuse large b-cell lymphoma, low grade glioma, testicular germ cell tumor, papillary renal cell carcinoma, endometrial carcinoma, mesothelioma, thymoma, ovarian high-grade serous carcinoma, bladder urothelial carcinoma, colorectal
  • adenocarcinoma cholangiocarcinoma, sarcoma, lung squamous cell carcinoma, cervical squamous cell carcinoma, prostatic adenocarcinoma, lung adenocarcinoma, chomophobe renal cell carcinoma, pancreatic adenocarcinoma, head and neck squamous cell carcinoma, clear cell renal cell carcinoma, thryroid carcinoma, acute myeloid leukemia, rhabdomyosarcoma, and breast invasive cell carcinoma.
  • a cancer that expresses or overexpresses PD-Ll and/or Cdk5 can include medulloblastoma or rhabdomyosarcoma.
  • the Cdk5 inhibitor administered to the subject to sensitize the cancer to immunotherapy, treat tumor immunity, and/or treat cancers expressing or over-expressing programmed cell death ligand 1 (PD-Ll) and/or Cdk5 can include any therapeutic agent that inhibits or reduces one or more of, the catalytic activity and function of the Cdk5 to suppress immune checkpoint programmed death-ligand 1 (PD-Ll) in the cancer cells and/or promote persistent expression of the PD-Ll transcriptional repressors, the interferon regulatory factors IRF2 and IRF2BP2, which likely leads to reduced PD-Ll expression on tumors.
  • the catalytic or functional activity of the Cdk5 can be suppressed, inhibited, and/or blocked in several ways including: direct inhibition of the activity of Cdk5 (e.g., by using neutralizing antibodies, small molecules or peptidomimetics, dominant negative polypeptides); inhibition of genes that express the Cdk5 (e.g., by blocking the expression or activity of the genes and/or proteins); activation of genes and/or proteins that inhibit one or more of, the catalytic activity and function of Cdk5 (e.g., by increasing the expression or activity of the genes and/or proteins); inhibition of genes and/or proteins that are downstream mediators of the Cdk5 (e.g., by blocking the expression and/or activity of the mediator genes and/or proteins); introduction of genes and/or proteins that negatively regulate one or more of, catalytic activity and function of Cdk5 (e.g., by using recombinant gene expression vectors, recombinant viral vectors or recombinant polypeptides); or gene
  • the Cdk5 inhibitor can be a selective or non-selective CdK5 inhibitor.
  • selective and non- selective Cdk5 inhibitors include Dinaciclib, AT7519, Roscovitine, CYC065, PHA-793887, PHA-767491 , Milcidib, and SNS-032.
  • Other examples of Cdk5 inhibitors include purvalanol A, purvalanol B, olomucine, and 2,6,9- trisubstituted purines as described in WO97/20842, WO98/05335, WO99/07705, US 2009/0325983, and US 2010/0093769, which are all incorporate by reference in their entirety.
  • the Cdk5 inhibitor can include roscovitine or CYC069, which are 2,6,9-trisubstituted purines that are commercially available from
  • Cdk5 inhibitors described herein can be administered alone, for human therapy they will generally be administered in admixture with a pharmaceutical carrier, excipient or diluent.
  • compositions described herein therefore relate to a pharmaceutical composition
  • a pharmaceutical composition comprising a Cdk5 inhibitor admixed with a pharmaceutically acceptable excipient, diluent or carrier.
  • excipients for the various different forms of pharmaceutical compositions described herein may be found in the "Handbook of
  • Carriers or diluents for therapeutic use are well known in the pharmaceutical art, and are described, for example, in Remington's Pharmaceutical Sciences, Mack Publishing Co. (A. R. Gennaro edit. 1985).
  • suitable carriers include lactose, starch, glucose, methyl cellulose, magnesium stearate, mannitol, sorbitol and the like.
  • suitable diluents include ethanol, glycerol and water.
  • compositions may comprise as, or in addition to, the carrier, excipient or diluent any suitable binder(s), lubricant(s), suspending agent(s), coating agent(s), solubilising agent(s).
  • binders include starch, gelatin, natural sugars such as glucose, anhydrous lactose, free-flow lactose, beta-lactose, corn sweeteners, natural and synthetic gums, such as acacia, tragacanth or sodium alginate, carboxymethyl cellulose and
  • Examples of lubricants include sodium oleate, sodium stearate, magnesium stearate, sodium benzoate, sodium acetate, sodium chloride and the like.
  • Preservatives, stabilizers, dyes and even flavoring agents may be provided in the pharmaceutical composition.
  • preservatives include sodium benzoate, sorbic acid and esters of p-hydroxybenzoic acid.
  • Antioxidants and suspending agents may be also used.
  • the Cdk5 inhibitors described herein can be present as salts or esters, in particular pharmaceutically acceptable salts or esters.
  • salts of the Cdk5 inhibitors described herein include suitable acid addition or base salts thereof.
  • suitable pharmaceutical salts may be found in Berge et al, J Pharm Sci, 66, 1-19 (1977). Salts are formed, for example with strong inorganic acids such as mineral acids, e.g., sulphuric acid, phosphoric acid or hydrohalic acids; with strong organic carboxylic acids, such as alkanecarboxylic acids of 1 to 4 carbon atoms which are unsubstituted or substituted (e.g., by halogen), such as acetic acid; with saturated or unsaturated dicarboxylic acids, for example oxalic, malonic, succinic, maleic, fumaric, phthalic or tetraphthalic; with hydroxycarboxylic acids, for example ascorbic, glycolic, lactic, malic, tartaric or citric acid; with aminoacids, for example aspartic or glutamic acid; with benzo
  • Esters are formed either using organic acids or alcohols/hydroxides, depending on the functional group being esterified.
  • Organic acids include carboxylic acids, such as alkanecarboxylic acids of 1 to 12 carbon atoms which are unsubstituted or substituted (e.g., by halogen), such as acetic acid; with saturated or unsaturated dicarboxylic acid, for example oxalic, malonic, succinic, maleic, fumaric, phthalic or tetraphthalic; with hydroxycarboxylic acids, for example ascorbic, glycolic, lactic, malic, tartaric or citric acid; with aminoacids, for example aspartic or glutamic acid; with benzoic acid; or with organic sulfonic acids, such as (Cl-C4)-alkyl- or aryl-sulfonic acids which are unsubstituted or substituted (for example, by a halogen) such as methane- or p-tolu
  • Suitable hydroxides include inorganic hydroxides, such as sodium hydroxide, potassium hydroxide, calcium hydroxide, aluminium hydroxide.
  • Alcohols include alkanealcohols of 1-12 carbon atoms which may be unsubstituted or substituted, e.g., by a halogen).
  • compositions including Cdk5 inhibitors described herein may be adapted for oral, rectal, vaginal, parenteral, intramuscular, intraperitoneal, intraarterial, intrathecal, intrabronchial, subcutaneous, intradermal, intravenous, nasal, buccal or sublingual routes of administration.
  • compositions for oral administration, particular use is made of compressed tablets, pills, tablets, gellules, drops, and capsules.
  • these compositions contain from about 1 mg to about 2000 mg and, more preferably, from about 25 mg to about 1000 mg, of active ingredient per dose.
  • compositions of the present invention may also be in form of suppositories, pessaries, suspensions, emulsions, lotions, ointments, creams, gels, sprays, solutions or dusting powders.
  • an alternative means of transdermal administration is by use of a skin patch.
  • the active ingredients can be incorporated into a cream consisting of an aqueous emulsion of polyethylene glycols or liquid paraffin.
  • the active ingredients can also be incorporated, at a concentration of between 1 and 10% by weight, into an ointment consisting of a white wax or white soft paraffin base together with such stabilisers and preservatives as may be required.
  • Injectable forms may contain between about 10 mg to about 1000 mg, preferably between about 10 to about 500 mg, of active ingredient per dose.
  • compositions may be formulated in unit dosage form, i.e., in the form of discrete portions containing a unit dose, or a multiple or sub-unit of a unit dose.
  • the combination or pharmaceutical composition of the invention is administered intravenously.
  • the Cdk5 inhibitor may be administered at a dose of from 0.1 to 100 mg/kg body weight, or from 2 to 50 mg/kg, more preferably from 0.1 to 25 mg/kg body weight.
  • a Cdk5 inhibitor such as roscovitine or CYC065
  • the Cdk5 inhibitor can be administered at a dosage of about 0.4 to about 3 g/day.
  • Roscovitine and CYC065 can be administered orally in tablets or capsules.
  • the total daily dose of the Cdk5 inhibitor can be administered as a single dose or divided into separate dosages administered two, three or four time a day.
  • the method can further include administering PD-L1/PD- 1 signaling pathway inhibitor, PD- 1 binding antagonist, and/or a PD-Ll binding antagonist in combination with the Cdk5 inhibitor.
  • the PD-Ll/PD- 1 signaling pathway inhibitor, PD-1 binding antagonist and/or PD-Ll binding antagonist can inhibit PD-1/PD-L1 interaction and/or PD-1/PD-L1 signaling pathway.
  • high Cdk5 gene expression is associated with either decreased overall survival or decreased disease free or metastasis free survival in cutaneous melanoma, glioma, breast and lung cancer (Fig. 14), and clinical trials with anti-PD-l/anti-PD-Ll therapy in patients with these cancers are underway.
  • the PD-Ll/PD- 1 signaling pathway inhibitor can include any molecule that inhibits the interaction of a PD-Ll/PD- 1 binding partner with either one or more of its binding partner, so as to remove T-cell dysfunction resulting from signaling on the PD- Ll/PD- 1 signaling with a result being to restore or enhance T-cell function
  • a PD-L/PD- 1 signaling pathway inhibitor includes a PD- 1 binding antagonist and a PD-Ll binding antagonist.
  • the PD- 1 binding antagonist can include a molecule that decreases, blocks, inhibits, abrogates or interferes with signal transduction resulting from the interaction of PD- 1 with one or more of its binding partners, such as PD-Ll or PD-L2.
  • the PD- 1 binding antagonist is a molecule that inhibits the binding of PD- 1 to its binding partners.
  • the PD- 1 binding antagonist inhibits the binding of PD- 1 to PD-Ll and/or PD-L2.
  • PD-1 binding antagonists include anti-PD- 1 antibodies, antigen binding fragments thereof, immunoadhesins, fusion proteins, oligopeptides and other molecules that decrease, block, inhibit, abrogate or interfere with signal transduction resulting from the interaction of PD- 1 with PD-Ll and/or PD-L2.
  • a PD- 1 binding antagonist reduces the negative co-stimulatory signal mediated by or through cell surface proteins expressed on T lymphocytes mediated signaling through PD- 1 so as render a dysfunctional T-cell less dysfunctional (e.g., enhancing effector responses to antigen recognition).
  • the PD-1 binding antagonist is an anti-PD-1 antibody.
  • a PD-1 binding antagonist is MDX- 1 106 described herein.
  • a PD- 1 binding antagonist is Merck 3745 described herein.
  • a PD- 1 binding antagonist is CT-01 1 described herein.
  • the anti-PD-1 antibody is MK-3475 (formerly lambrolizumab, Merck), AMP-514, AMP-224 (Medlmmune/AstraZeneca), BMS-936558 (MDX-1106, Bristol-Myers Squibb), or CT-011 (Curetech).
  • Pembrolizumab (MK-3475) is a humanized, monoclonal anti-PD- 1 antibody designed to reactivate anti-tumor immunity. Pembrolizumab exerts dual ligand blockade of the PD- 1 pathway by inhibiting the interaction of PD-1 on T cells with its ligands PD-Ll and PD-L2.
  • the anti-PD-1 antibody is one of the antibodies disclosed in U.S. Pat. No. 8,354,509, and U.S. Pat. No. 8, 168,757, the disclosure of which is incorporated by reference in their entirety.
  • Nivolumab also known as BMS-936558 or MDX1106, is a fully human IgG4 monoclonal antibody developed by Bristol-Myers Squibb for the treatment of cancer.
  • the anti-PD-1 antibody is one of the antibodies disclosed in WO2004/056875, U.S. Pat. No. 7,488,802 and U.S. Pat. No. 8,008,449, the disclosure of which is incorporated by reference in their entirety.
  • AMP-514 and AMP-224 are an anti-programmed cell death 1 (PD- 1) monoclonal antibody (mAb) developed by Amplimmune, which was acquired by
  • the anti-PD-1 antibody is one of the antibodies disclosed in US Appl. Pub. No. 20140044738, the disclosure of which is incorporated by reference in their entirety.
  • Pidilizumab (CT-011) is an anti-PD-1 monoclonal antibody developed by Israel- based Curetech Ltd.
  • the anti-PD-1 antibody is one of the antibodies disclosed in US Pat. Appl. Pub. Nos. 20080025980 and 20130022595, the disclosure of which is incorporated by reference in their entirety.
  • the PD-L 1 binding antagonist can include any molecule that decreases, blocks, inhibits, abrogates or interferes with signal transduction resulting from the interaction of PD- Ll with either one or more of its binding partners, such as PD- 1.
  • a PD-L1 binding antagonist is a molecule that inhibits the binding of PD-L 1 to its binding partners.
  • the PD-L1 binding antagonist inhibits binding of PD-L 1 to PD-1.
  • the PD-L 1 binding antagonists include anti-PD-Ll antibodies, antigen binding fragments thereof, immunoadhesins, fusion proteins, oligopeptides and other molecules that decrease, block, inhibit, abrogate or interfere with signal transduction resulting from the interaction of PD-L 1 with one or more of its binding partners, such as PD- 1 , B7- 1.
  • a PD-L1 binding antagonist reduces the negative co- stimulatory signal mediated by or through cell surface proteins expressed on T lymphocytes mediated signaling through PD-L 1 so as to render a dysfunctional T-cell less dysfunctional (e.g., enhancing effector responses to antigen recognition).
  • a PD-L1 binding antagonist is an anti-PD-Ll antibody.
  • an anti-PD-Ll antibody is YW243.55.S70 described herein.
  • an anti-PD-Ll antibody is MDX- 1105 described herein.
  • an anti-PD-Ll antibody is MPDL3280A described herein.
  • the anti-PD-Ll antibody is MPDL3280A and
  • YW243.55.S70 (Genentech/Roche), MEDI-4736 (Medlmmune/AstraZeneca), BMS-936559 (MDX-1105, Bristol-Myers Squibb), and MSB0010718C (EMD Serono/Merck KGaA).
  • MPDL3280A (Genentech) is an engineered anti-PD-Ll antibody designed to target PD-L1 expressed on tumor cells and tumor-infiltrating immune cells. MPDL3280A is designed to prevent PD-L1 from binding to PD- 1 and B7.1. This blockade of PD-L1 may enable the activation of T cells, restoring their ability to detect and attack tumor cells. MPDL3280A contains an engineered fragment crystallizable (Fc) domain designed to optimize efficacy and safety by minimizing antibody-dependent cellular cytotoxicity (ADCC).
  • Fc fragment crystallizable
  • the anti-PD-Ll antibody is one of the antibodies disclosed in U.S. Pat. No. 7,943,743, the disclosure of which is incorporated by reference in their entirety.
  • BMS-936559 (MDX-1105, Bristol-Myers Squibb) is a fully human IgG4 anti- PD-Ll mAb that inhibits the binding of the PD-Ll ligand to both PD-1 and CD80.
  • the anti-PD-Ll antibody is one of the antibodies disclosed in U.S. Pat. No. 7,943,743, the disclosure of which is incorporated by reference in their entirety.
  • MSB0010718C (EMD Serono of Merck KGaA) is fully human IgGl monoclonal antibody that binds to PD-Ll.
  • the anti-PD-Ll antibody is one of the antibodies disclosed in WO 2013079174 Al, the disclosure of which is incorporated by reference in their entirety.
  • MEDI4736 (Medlmmune/AstraZeneca) is a human IgGl antibody which binds specifically to PD-Ll, preventing binding to PD-1 and CD80.
  • the anti-PD-Ll antibody is one of the antibodies disclosed in WO 2011066389 Al and U.S. Pat. No. 8,779,108, the disclosure of which is incorporated by reference in their entirety.
  • the anti-PD-Ll antibody is one of the antibodies disclosed in U.S. Pat. No. 8,552,154, the disclosure of which is incorporated by reference in their entirety
  • Disruption of the PD-1/PD-L1 interaction by antagonistic Abs can enhance the immune response to cancerous cells in a patient.
  • PD-Ll is not expressed in normal human cells, but is abundant in a variety of human cancers (Dong et al., 2002).
  • the interaction between PD-1 and PD-Ll impairs T cell responses as manifested by a decrease in tumor- infiltrating lymphocytes (TILs) and a decrease in T-cell receptor mediated proliferation, resulting in T cell anergy, exhaustion or apoptosis, and immune evasion by the cancerous cells.
  • TILs tumor- infiltrating lymphocytes
  • T-cell receptor mediated proliferation resulting in T cell anergy, exhaustion or apoptosis, and immune evasion by the cancerous cells.
  • Immune suppression can be reversed by inhibiting the local interaction between PD-Ll and PD-1 using an anti-PD-1 and/or an anti-PD-Ll Ab. These Abs may be used alone or in combination with the Cdk5 inhibitors described herein to inhibit the growth of cancerous tumors.
  • Cdk5 inhibitors and optionally a PD-L1/PD- 1 signaling pathway inhibitor can be administered to a subject that has or is to be treated with at least one of a immunotherapy, tumor removal surgery, chemotherapy, and/or radiation therapy.
  • Immunotherapeutics which can be administered in combination with the Cdk5 inhibitors described herein and optionally the PD-Ll/PD-1 signaling pathway inhibitor, can directly or indirectly, affect toll like receptors, nucleotide-oligomerization domain-like receptors, RIG-I-Like receptors, c-type lectin receptors, or cytosolic DNA Sensors, or a combination thereof.
  • the immunotherapeutics are capable of activating a human plasmacytoid dendritic cell, myeloid dendritic cell, NK cell, or tumor cell, or a combination thereof.
  • the immunotherapeutics activate human immune cells, including but not limited to dendritic cells, macrophages, monocytes, myeloid-derived suppressor cells, NK cells, B cells, T cells, or tumor cells, or a combination thereof.
  • the immunotherapeutic can include an immune cell that is administered to the subject.
  • the immune cell can be a dendritic cell, engineered dendritic cell, T-cell, or engineered T-cell, or a combination thereof.
  • the immune cell is isolated from the subject.
  • the dendritic cells are autologous dendritic cells or allogeneic dendritic cells.
  • dendritic cells suitable for use in accordance with the present invention are isolated or obtained from any tissue in which such cells are found, or are otherwise cultured and provided. Dendritic cells may be found, for example, but in no way limited to, in the bone marrow, in peripheral blood mononuclear cells (PBMCs) of a mammal or in the spleen of a mammal. Additionally, any suitable media that promote the growth of dendritic cells may be used in accordance with the present invention, and may be readily ascertained by one skilled in the art.
  • PBMCs peripheral blood mononuclear cells
  • the immune cell is primed against a tumor cell lysate, tumor cell antigen, tumor cell cytokine, and/or stem cell lysate.
  • the tumor cell lysate comprises lysate prepared or derived from the nervous system tumor in the subject who has been, is being, or will be treated by a method described herein.
  • the tumor cell lysate comprises lysate prepared or derived from a nervous system tumor in another subject.
  • the tumor cell lysate, tumor cell antigen, or tumor cell cytokine is prepared from a system tumor.
  • the tumor cell lysate, tumor cell antigen, tumor cell cytokine, and/or stem cell lysate is prepared from a biological sample.
  • the biological sample comprises tumor cells, cancerous cells, cells from a tumor, tumor tissue, cancerous tissue, and/or a tumor biopsy.
  • the biological sample is obtained from the subject who has been, is being, or will be treated by a method described herein. In another embodiment, the biological sample is obtained from another subject.
  • the immune cell is administered to the subject intravenously.
  • the ventricle can be any ventricle in the nervous system.
  • Typical dosages of an effective amount of the immune cell can be as indicated to the skilled artisan by the in vitro responses in cells or in vivo responses in animal models. Such dosages typically can be reduced by up to about an order of magnitude in concentration or amount without losing relevant biological activity.
  • the actual dosage can depend upon the judgment of the physician, the condition of the patient, and the effectiveness of the therapeutic method based, for example, on the in vitro responsiveness of relevant cultured cells or histocultured tissue sample, or the responses observed in the appropriate animal models.
  • the immune cell is administered once a day (SID/QD), twice a day (BID), three times a day (TID), four times a day (QID), or more, so as to administer an effective amount of the immune cell to the subject, where the effective amount is any one or more of the doses described herein.
  • the immune cell is administered at the prevention stage of a tumor (i.e., when the subject has not developed the tumor but is likely to or in the process to develop the tumor). In other embodiments, the immune cell is administered at the treatment stage of a tumor (i.e., when the subject has already developed the tumor).
  • the chemotherapeutic agent administered in combination with the Cdk5 inhibitor and optionally the PD-Ll/PD-1 signaling pathway inhibitor is a chemical compound useful in the treatment of cancer.
  • chemotherapeutic agents include alkylating agents such as thiotepa and cyclophosphamide; alkyl sulfonates such as busulfan, improsulfan, and piposulfan; aziridines such as benzodopa, carboquone, meturedopa, and uredopa; ethylenimines and methylamelamines including altretamine, triethylenemelamine, trietylenephosphoramide, triethiylenethiophosphoramide and trimethylolomelamine;
  • acetogenins especially bullatacin and butlatacinone
  • spongistatin nitrogen mustards such as chlorambucil, chlornaphazine, cholophosphamide, estramustine, ifosfamide, mechlorethamine, mechlorethamine oxide hydrochloride, melphalan, novembichin, phenesterine, prednimustine, trofosfamide, uracil mustard;
  • nitrogen mustards such as chlorambucil, chlornaphazine, cholophosphamide, estramustine, ifosfamide, mechlorethamine, mechlorethamine oxide hydrochloride, melphalan, novembichin, phenesterine, prednimustine, trofosfamide, uracil mustard;
  • nitrosureas such as carmustine, chlorozotocin, fotemustine, lomustine, nimustine, and ranimnustine; antibiotics such as the enediyne antibiotics (e.g., calicheamicin, especially calicheamicin gammall and calicheamicin omegall (see, e.g., Nicolaou et ah, Angew. Chem. Intl. Ed.
  • dynemicin including dynemicin A; an esperamicin; as well as neocarzinostatin chromophore and related chromoprotein enediyne antibiotic chromophores), aclacinomysins, actinomycin, authramycin, azaserine, bleomycins, cactinomycin, carabicin, caminomycin, carzinophilin, chromomycinis, dactinomycin, daunorubicin, detorubicin, 6-diazo-5-oxo-L-norleucine, doxorubicin (including morpholino- doxorubicin, cyanomorpholino-doxorubicin, 2-pyrrolino-doxorubicin, doxorubicin HC1 liposome injection and deoxy doxorubicin), epirubicin, esorubicin
  • lentinan lentinan
  • lonidainine maytansinoids such as maytansine and ansamitocins
  • mitoguazone mitoxantrone
  • mopidanmol mopidanmol
  • nitraerine pentostatin
  • phenamet pirarubicin
  • losoxantrone 2- ethylhydrazide
  • procarbazine PSK.RTM.
  • anti-PD-Ll antibodies of the invention are bisphosphonates such as clodronate, NE-58095, zoledronic acid/zoledronate, alendronate, pamidronate, tiludronate, or risedronate; as well as troxacitabine (a 1,3-dioxolane nucleoside cytosine analog); anti-sense oligonucleotides, particularly those that inhibit expression of genes in signaling pathways implicated in abherant cell proliferation, such as, for example, PKC-alpha, Raf, H-Ras, and epidermal growth factor receptor (EGF-R); vaccines such as Stimuvax vaccine, Theratope vaccine and gene therapy vaccines, for example, Allovectin vaccine, Leuvectin vaccine, and Vaxid vaccine; topoisomerase 1 inhibitor; an anti-estrogen such as fulvestrant; a Kit inhibitor such as imatinib or EXEL-
  • the chemotherapeutic agent can be administered using the appropriate modes of administration, for instance, the modes of administration recommended by the manufacturer.
  • Various routes are utilized to administer the chemotherapeutic agent of the claimed methods, including but not limited to intratumoral, intravenous, intraarterial, intramuscular, subcutaneous, intraperitoneal, aerosol, nasal, via inhalation, oral, transmucosal, transdermal, parenteral, implantable pump or reservoir, continuous infusion, enteral application, topical application, local application, capsules and/or injections.
  • the chemotherapeutic agent is administered intracranially, intraventricularly, intrathecally, epidurally, intradurally, topically, intravascularly, intravenously, intraarterially,
  • intratumorally intramuscularly, subcutaneously, intraperitoneally, intranasally, or orally.
  • the expression level of Cdk5 and/or PD-Ll in the cancer cells can be determined prior to administration of the Cdk5 inhibitor and/or other therapeutics. It was found that cell surface expression of PD-Ll and/or upregulation of Cdk5 expression in tumors is a marker for selecting cancer patients who would benefit from treatment with a Cdk5 inhibitor and optionally a PD-Ll/PD-1 signaling pathway inhibitor.
  • cell surface expression of PD-Ll and/or expression of Cdk5 in tumors may be used as a marker for identifying or selecting suitable cancer patients who would benefit from immunotherapy with Cdk5 inhibitors and optionally antibodies that target, and disrupt or inhibit signaling from, inhibitory immunoregulators such as PD-Ll.
  • immunotherapy methods described herein including assaying PD- Ll expression and/or Cdk5 expression, are described as comprising the selection of a patient that is, or is not, suitable for Cdk5 ihibitor or as comprising the administration of a Cdk5 inhibitor and optionally a PD-Ll/PD-1 signaling pathway inhibitor for immunotherapeutic purposes, it should be understood that these methods apply generally to the selection of a patient that is, or is not, suitable for immunotherapy with, or to the administration of a Cdk5 inhibitor.
  • the step comprising the provision of a test tissue sample obtained from a patient is an optional step. That is, in certain embodiments the method includes this step, and in other embodiments, this step is not included in the method. It should also be understood that in certain preferred embodiments the "assessing" step to identify, or determine the number or proportion of, cells in the test tissue sample that express PD-L1 and/or Cdk5 is performed by a transformative method of assaying for PD-L1 and/or Cdk5 expression, for example by performing a reverse transcriptase-polymerase chain reaction (RT-PCR) assay.
  • RT-PCR reverse transcriptase-polymerase chain reaction
  • no transformative step is involved and PD-L1 expression and/or Cdk5 expression is assessed by, for example, reviewing a report of test results from a laboratory.
  • the steps of the methods up to, and including, assessing PD-L1 expression and/or Cdk5 expression provides an intermediate result that may be provided to a physician or other medical practitioner for use in selecting a suitable candidate for Cdk5 inhibitor therapy and/or administering a Cdk5 inhibitor to the patient.
  • the steps that provide the intermediate result may be performed by a medical practitioner or someone acting under the direction of a medical practitioner. In other embodiment, these steps are performed by an independent person or laboratory.
  • the disclosure further provides a method for treatment of a subject afflicted with cancer, which method comprises: (a) selecting a subject that is not suitable for treatment with a Cdk5 inhibitor, the selecting comprising (i) optionally providing a test tissue sample obtained from a patient with cancer of the tissue, the test tissue sample comprising tumor cells and tumor-infiltrating inflammatory cells; (ii) assessing the proportion of cells in the test tissue sample that express PD-L1 and/or Cdk5; and (iii) selecting the subject as not suitable for therapy with a Cdk5 inhibitor, based on an assessment that the proportion of cells in the test tissue sample that express PD-L1 and/or Cdk5 is less than a predetermined threshold level; and (b) administering a standard-of-care therapeutic other than a Cdk5 inhibitor to the selected subject.
  • the proportion of cells that express PD-L1 and/or Cdk5 is assessed by performing an assay to determine the presence of PD-L1 and/or Cdk5 RNA.
  • the presence of PD-L1 and/or Cdk5 RNA is determined by RT-PCR, in situ hybridization or RNase protection.
  • the proportion of cells that express PD-L1 and/or Cdk5 is assessed by performing an assay to determine the presence of PD-L1 and Cdk5.
  • the presence of PD-L1 and/or Cdk5 is determined by immunohistochemistry (IHC), enzyme- linked immunosorbent assay (ELISA), in vivo imaging, or flow cytometry.
  • IHC immunohistochemistry
  • ELISA enzyme- linked immunosorbent assay
  • flow cytometry in vivo imaging
  • PD-L1 and/or Cdk5 expression is assayed by IHC.
  • PD-Ll and/or Cdk5 expression is assayed by immunoPET imaging.
  • the Cdk5 inhibitor can be administered to cancer cells where the surface PD-Ll expression level or Cdk5 expression level exceeds a predetermined threshold value.
  • the predetermined threshold value relating to cell surface PD-Ll expression or Cdk5 expression.
  • the predetermined threshold is based on a proportion of tumor cells in a test tissue sample that expresses PD-Ll and/or Cdk5.
  • the predetermined threshold is at least 0.001% of tumor cells expressing PD-Ll and/or Cdk5 as determined by IHC.
  • the predetermined threshold is at least 0.01%, preferably at least 0.1%, more preferably at least 1% of tumor cells expressing PD-Ll and/or Cdk5, as determined by IHC. In certain embodiments, the predetermined threshold is at least 5% of tumor cells expressing PD-Ll and/or Cdk5 as determined by IHC. In certain embodiments, the predetermined threshold is at least 0.01%, at least 0.1%, at least 1%, or at least 5% of tumor cells expressing s PD-Ll and/or Cdk5 as determined by IHC.
  • any method where administration of a Cdk5 inhibitor is selected or administered based on an assessment that the proportion of cells in a test tissue sample from the subject expresses PD-Ll and/or Cdk5 at a level above a predetermined threshold level it follows that a complementary method of treatment may be performed wherein a standard-of-care treatment other than the immunotherapy is selected or administered based on an assessment that the proportion of cells in a test tissue sample from the subject expresses PD-L1 and/or Cdk5 at a level below the predetermined threshold level.
  • This disclosure further provides a method for predicting the therapeutic effectiveness of an Cdk5 inhibitor for treating a cancer patient, which method comprises: (a) optionally providing a test tissue sample obtained from a patient with cancer of the tissue, the test tissue sample comprising tumor cells; (b) assaying the test tissue sample to determine the proportion of cells therein that express PD-L1 and/or Cdk5; (c) comparing the proportion of cells that express PD-L1 and/or Cdk5 with a predetermined threshold value; and (d) predicting the therapeutic effectiveness of the Cdk5 inhibitor in treating the tumor, wherein if the proportion of cells that express PD-L1 and/or Cdk5 exceeds the threshold proportion the Cdk5 inhibitor is predicted to be effective in treating the patient, and wherein if the proportion of cells that express PD-L1 and/or Cdk5 is below the threshold proportion the Cdk5 inhibitor is predicted to not be effective in treating the patient.
  • mice Male B6 nude mice (B6.Cg/NTac- oxnin « NE10) were obtained from Taconic, and male C57BL/6J, MHC-II KO and ⁇ 2 ⁇ KO mice were obtained from The Jackson Laboratory (Bar Harbor, ME). NSG mice were obtained from the Athymic Animal and Xenograft Core Facility of the Case Comprehensive Cancer Center. Animals were housed, bred and handled in the Animal Resource Center facilities at Case Western Reserve
  • mice MB cell lines MMl, MM2, MM3 and MM5, derived from Patched ' /p53 ' mice were obtained from G. Plautz (the Cleveland Clinic).
  • Human MB cell lines DAOY, UW228, D283 and D425 were available in our tumor repository.
  • Human RMS cell line SJCRH30 was purchased from ATCC (CRL-2061).
  • Mouse RMS76.9 was generously provided by C. Mackall (NCI/NIH). All cells were grown in RPMI supplemented with 10% FBS.
  • Endogenous Cdk5 gene expression in MMl was silenced using commercially available Cdk5-targeting antisense shRNAs (Thermo Scientific Open Biosystems cat# RMM4532-EG12568) or by designing CRISPR/Cas9 guide RNAs to edit the Cdk5 locus.
  • Antisense GAPDH, or non-silencing shRNA or crNeg constructs were used as controls.
  • Viral particles were generated in HEK293T cells and used to transduce MMl. Gene targeting was validated by western blotting for both shRNA and CRISPR silencing or qPCR in the case of shRNA silencing.
  • shRNA Cdk5 silencing a construct with the antisense sequence, TTGAGT AG AC AGATCTCCC , afforded 70% gene knockdown relative to wild type and shNS control and was used to generate MMl shCdk5 cells.
  • Whole cell lysates were prepared from mouse and human MB cell lines or other control cells by incubating 4x107 cells in 300ul of lysis buffer (1% NP-40, lOmM Tris-HCl, pH7.5, 140mM NaCl, 2mM EDTA) supplemented with protease inhibitors (Roche), phosphatase inhibitor cocktails 1 and 2 (Sigma- Aldrich) and Na2V03 for 30min on ice followed by centrifugation at 12,000x g for 20min at 4°C to remove nuclei and other cell debris.
  • Total protein concentration was determined using the BioRad DC protein assay kit (BioRad cat# 500-0116) and the lysates were either used immediately or stored at -80°C.
  • samples were boiled for 5 min at 95°C in 4x LDS sample buffer containing ⁇ - ⁇ , separated on 4-20% Tris-Glycine gels, and the proteins were subsequently transferred onto 0.2mm nitrocellulose membranes. After blocking for lh at RT in 5% non-fat dry milk in lx TBS/T 0.05%, blots were incubated overnight at 4oC in primary antibodies to detect target proteins. A blot incubated with anti- beta Actin served as a loading control.
  • Cdk5-specific kinase activity assay was performed using luminescent kinase assay kit as per manufacturer's protocol with slight modifications (Promega).
  • cell lysates were prepared at 1 ⁇ g/ ⁇ l concentration and precleared with protein Aagarose beads and rabbit IgG (Santa Cruz Biotechnology) at 4°C for 2 h.
  • Immunoprecipitates were washed twice with lysis buffer and twice with kinase buffer [20 mM Tris-HCl (pH 7.4)/10 mM MgCl 2 /l mM
  • Reverse transcription (RT) of ⁇ g of total RNA was performed with oligo(dT)16 using on using Superscript First Strand Synthesis System for RT-PCR kit (Life Technologies, Carlsbad, CA).
  • the resulting cDNA was used as a template for the amplification of target gene transcripts by real time PCR, using SYBR Green PCR Master Mix (Life Technologies, Carlsbad, CA) on the ABI 7300 Real- Time PCR machine (Life Technologies, Carlsbad, CA).
  • Target gene expression was calculated using the standard curve method upon normalization to cytochrome c
  • GTCCATCGACATGTGGTCAG GTCCATCGACATGTGGTCAG; Cdk5 reverse: CTGGTC ATCC AC ATC ATTGC ;
  • cytochrome c forward CTGCC AC AGC ATGGATTATG ; cytochrome c reverse:
  • C ATC ATC ATT AGGGCC ATCC; p35 forward: GTCCCTATCCCCCAGCTATC; p35 reverse: TTCTTGTCCTTGGCGTTCTT; PD-L1 forward: TGCTGCATAATCAGCTACGG and PD-L1 reverse: TCCACGGAAATTCTCTGGTT.
  • Cdk5, p35, and p39 mRNA expression was analyzed in pediatric MB and neuroblastoma (NB) samples from the publicly available "Pediatric Tumor Affymetrix Database" of Dr. Javed Khan (Version 2013-09-27; http://pob.abcc.ncifcrf.gov/cgi-bin/JK) accessed through the University of California Santa Cruz Cancer Genomics Browser (https://genome-cancer.ucsc.edu/).
  • TCGA Cancer Genome Atlas
  • numerous cancer types were accessed from 21 the public access data portal of the Memorial Sloan Kettering Cancer Center cBioPortal
  • Murine MB cell lines MM1 WT, MM1 shCdk5 and MM1 shNS were grown in RPMI supplemented with 10% FBS. Once 80% confluent, culture medium was replaced with medium containing lOOng/ml rmIFN- ⁇ (R&D Systems). Cells were incubated at 37°C and harvested by incubating for 5min at 37oC in lOmM EDTA/PBS at different time points (Oh, 4h, 8h and 24h). In all subsequent experiments, treatment of cells was carried out for 24h with lOOng/ml rmIFN- ⁇ .
  • Murine MB cell lines MM1 were grown in RPMI supplemented with 10% FBS.
  • a stock solution of Roscovitine (lOmM) or vehicle control- DMSO was diluted in fresh tumor medium and added to samples to achieve a final concentration of 10 ⁇ or 20 ⁇ .
  • nodular/desmoplastic (3) and large cell (1) variants containing 3 cores (2 mm diameter each) per case, and consecutive sections were stained with anti-human Cdk5 (clone 40773, Abeam) and antihuman CD3 (clone 2GV6, Ventana). Expression of Cdk5 was assessed semi-quantitatively on a 4-tiered scale as absent, weak, moderate, and strong; the total number of intratumoral CD3+ lymphocytes was counted in 4-5 high-power fields (HPF) and presented as average number of lymphocytes per HPF. For murine samples, 5xl0 4 MM1 shCdk5 or MM1 shNS cells were 22 inoculated into the left thighs or i.e. of C57BL/6 mice.
  • mice were injected with lOOug of anti-CD4 antibody (GK1.5), anti-CD8 antibody (2.43) or both antibodies 72h and 24h prior to tumor inoculation and twice weekly thereafter to ensure sustained depletion of T cell subset depletion during the experimental period.
  • GK1.5 anti-CD4 antibody
  • anti-CD8 antibody 2.483
  • IgG IgG isotype served as controls. All mice were monitored for development of tumors up to day 25.
  • Phosphorylation sites were identified based on unbiased phosphopeptide enrichment workflow that couples the immunoprecipitation of phosphorylated peptides with LCMS peak volume quantification.
  • Global phosphorylation studies were performed in MM1 WT cells or MM1 cells with shCdk5 and shNS or crCdk5 and crNeg using an unfractionated label free approach.
  • Cells were lysed in a 2% SDS solution with protease (P845, Sigma Aldrich) and phosphatase (PhosphoSTOP, Roche) inhibitors. Two hundred microliters of cell lysate was washed using the FASP cleaning procedure to remove detergent.
  • mice injected with Cdk5-deficient MB cells showed tumor-free survival (TFS) at 19 and 42 days, whereas mice injected with the WT and control tumors exhibited 0% and 7% TFS after 19 days, respectively (Figs. 1C, 7A).
  • mice injected with Cdk5 -deficient MB cells developed tumors that were significantly smaller (0.02 +/- 0.04 g) than those from mice injected with WT (0.91 +/- 0.39 g) or NS (0.51 +/- 0.21 g) cells (Fig. 7B).
  • mice To identify specific T cell populations responsible for the potent rejection of Cdk5- deficient MM1 in C57BL/6 mice, we inoculated mice with either MM1 crCdk5 or crNeg cells (5x104 s.c.) and depleted either CD8+ T cells, CD4+ T cells or both subsets using specific depleting antibodies.
  • MM1 crNeg To identify specific T cell populations responsible for the potent rejection of Cdk5- deficient MM1 in C57BL/6 mice, we inoculated mice with either MM1 crCdk5 or crNeg cells (5x104 s.c.) and depleted either CD8+ T cells, CD4+ T cells or both subsets using specific depleting antibodies.
  • Fig. 1C 100% of mice injected with MM1 crNeg and 80% of mice receiving MM1 crCdk5 developed measurable tumors (Fig. 1C), although MM1 crNeg tumors were 8-fold larger than MM1 crC
  • IFNy is a major cytokine associated with CD4+ T cell effector function, and IFNy was abundant in the Cdk5 -deficient brain tumor microenvironment (Fig. 2A). IFNy activates Cdk5 activity by inducting p35. In turn, Cdk5 activates the IFNy-activated inhibitor of translation (GAIT) complexes. Indeed, Cdk5 kinase activity was significantly increased after 24-hour exposure of MM1 WT and MM1 shNS to IFNy, whereas MM1 shCdk5 cells showed similar activity as Cdk5 'A embryonic brain tissue (Fig. 2B).
  • GIT IFNy-activated inhibitor of translation
  • IFNy is known to induce the upregulation of immune checkpoint molecules like PD-Ll in tumor cells, and in infiltrating lymphocytes and monocytes, in a T-cell dependent manner, and the expression of PD-Ll on infiltrating immune cells is evidence of a strong intratumoral immune response. Therefore, we examined whether targeted disruption of Cdk5 expression in MB impaired PD- Ll induction in response to IFNy stimulation. We first analyzed available human tumor databases and found a co-occurrence of Cdk5 and PD-Ll mRNA expression levels in many tumor types (Fig. 9). Furthermore, in the Cdk5-deficient MM1 we observed a 37.58 +/- 14.28% reduction in basal PDL1 mRNA level (Fig. 2C).
  • Cdk5-deficient MM1 exhibited a blunted PD-Ll upregulation in response to IFNy stimulation ex vivo (Figs. 2C, 2D, 8B).
  • Other IFNy-responsive proteins were not significantly affected in the Cdk5-deficient tumors, including H-2Kb/Db, FASL, and VCAM-1 (Fig. 10A and data not shown), indicating that a global disruption of the IFNyR signaling pathway was not responsible for the failure of PD-Ll up-regulation in vitro and for the increased T cell immune sensitivity in vivo.
  • the Cdk5-deficient cells only upregulated PD-Ll 2.8-fold as compared to baseline, reaching a peak level that was similar to the basal expression in un-stimulated WT and NS controls.
  • the blunted response to IFNy is specific for PD-Ll, as lack of Cdk5 activity did not induce the expression of PD- L2 (Fig. 2F).
  • Fig. 2G To further corroborate the link between Cdk5 activity and PD-Ll protein production, we treated MMl WT cells with Roscovitine and observed a dose-dependent decrease in PD-Ll transcript (Fig. 2G).
  • in vitro treatment of human MB with Roscovitine diminished surface PD-Ll upregulation upon IFNy exposure in a dose-dependent manner (Fig.
  • mice inoculated with MMl crNeg control cells developed tumors within the first week, while 30% of mice inoculated with MMl crPDLl remained tumor free for more than 4 weeks, similar to mice injected with MMl crCdk5 tumors (Figs. 21, 1C).
  • IRF1 interferon regulatory factor- 1
  • IRF2 interferon regulatory factor-2
  • IRF2 and its co-repressor IRF2BP2 were elevated at baseline in Cdk5-deficient cells and persisted for up to 48 hours after IFNy exposure (Figs. 3A, 10B). This difference in protein expression cannot be accounted for at the transcriptional level, since Irf2 or Irf2bp2 transcript levels were similar among all cell lines in response to IFNy stimulation (Fig. 3B). Similarly, STAT2 and STAT3 responded equally to IFNy among all cell lines (Fig. IOC). Next, we performed phosphoproteomic analysis of both shCdk5 and crCdk5 MMl cells after 24 hours of IFNy stimulation.
  • IRF2BP2 differentially phosphorylated in Cdk5- deficient cells as compared to control cells, with IRF2BP2 being among the highest phosphorylated peptide species associated with IFN signaling pathway in Cdk5 -deficient cells (Fig. 3C).
  • CD8+ T cells are not the primary effector cells responsible for tumor rejection in this model, their increased recruitment in the MB microenvironment reflects an overall inflammatory tumor milieu, as evidence in increased surface PD-Ll expression and overall tissue IFNy levels (Figs. 1C, 7C, 2A). A similar phenomenon was also observed in the subcutaneous tumor microenvironment (Fig. 12A-E). Furthermore, the myeloid infiltrate in i.e.
  • Cdk5 has been a focus of anti-cancer therapeutic development in recent years, yet its immune-modulatory role has not been appreciated.
  • disruption of Cdk5 sensitizes MB, the most prevalent malignant childhood brain tumor, to CD4+ T cell-dependent immune surveillance.
  • this effect is mediated via posttranslational modification of IRF2BP2, leading to the increased abundance of IRF2/IRF2BP2 and sustained functional repression of PD-Ll transcription following IFNy stimulation.
  • IFNy As a key mediator in immunity, IFNy exhibits both anti-tumor and pro-tumor activities, the latter through production of immunosuppressive molecules such as PD-Ll and indoleamine 2,3-dioxygenase (IDO). IFNy accomplishes this by binding to the
  • STAT1 binds to GAS elements on the promoters of interferon-stimulated genes (ISGs) including IRF1 to induce gene transcription.
  • IRF- 1 activates a multitude of secondary response genes including PD-Ll expression.
  • IRF2 acts as a repressor that competes with IRF1 for binding to the same IRF-E promoter element.
  • IRF2 is upregulated in response to either type I IFNs or IRF- 1 due to the presence of IRF-E in the IRF2 promoter.
  • IRF-1 upregulates IRF-2
  • IRF-2 provides a negative feedback loop by binding to its own promoter to block
  • IRF-2BP2 was identified as a co-repressor for IRF-2. Phosphorylation of S-360 on IRF2BP2 is required for nuclear localization of the IRF2-IRF2BP2 complex. Furthermore, low IRF2BP2 expression was correlated with high PD-Ll expression in human breast cancer. Our data suggest a direct link between disruption of Cdk5 expression and activity and the hyper-phosphorylation of IRF2BP2 at sites that are distinct from the known nuclear localization site (data not shown).
  • CD4+ T cells with lower PD-1 expression were found in the Cdk5-deficient CNS tumor microenvironment, while CDl lb+ cells accumulate in larger quantities with higher PD-L1+ expression (Fig. 4C-G). It is unclear whether PD-L1 up-regulation in the myeloid compartment is a response to increasing effector T cell IFNy production, or if these PD-L1+ myeloid cells play a distinct role modulating the function of infiltrating effector T cells. One such role could be reactivation of tumor- specific CD4+ T cells through cross-presentation of MHC Ilassociated tumor antigens, as MM1 cells do not express MHC II molecules (data not shown). Since virtually every human MB contains a CD3+ T cell infiltrate, additional characterization of infiltrating immune cells and manipulation of immune checkpoint may augment clinical efficacy of immunotherapy for MB.
  • mice were gavaged with CYC065 compound (dissolved in water) at the highest recommended dose of 50mg/kg (Cyclacel suggested a dose range of 25-50mg/kg) using the dosing schedule: daily x 5 days with 2 days off.
  • mice were monitored at least twice a week for tumor growth and tumor size measurements.
  • Tumor mass was resected on Day 21 and grown in culture for 1 week, followed by 24-hour exposure to IFNy to assess PD-Ll response in vitro.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Biochemistry (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biophysics (AREA)
  • Epidemiology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Mycology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Toxicology (AREA)
  • Cell Biology (AREA)
  • Biotechnology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)

Abstract

L'invention porte sur une méthode de sensibilisation du cancer à une immunothérapie chez un sujet en ayant besoin, qui comprend l'administration au sujet d'une quantité thérapeutiquement efficace d'un inhibiteur de CdK5 pour supprimer le point de contrôle immunitaire PD-L1.
PCT/US2017/034285 2016-05-25 2017-05-24 Méthodes de sensibilisation du cancer à l'immunothérapie WO2017205514A1 (fr)

Priority Applications (3)

Application Number Priority Date Filing Date Title
US16/303,846 US11124571B2 (en) 2016-05-25 2017-05-24 Methods of sensitizing cancer to immunotherapy
US17/480,831 US11884730B2 (en) 2016-05-25 2021-09-21 Methods of sensitizing cancer to immunotherapy
US18/167,438 US20230192863A1 (en) 2016-05-25 2023-02-10 Methods of sensitizing cancer to immunotherapy

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US201662341459P 2016-05-25 2016-05-25
US62/341,459 2016-05-25
US201662432131P 2016-12-09 2016-12-09
US62/432,131 2016-12-09

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US16/303,846 A-371-Of-International US11124571B2 (en) 2016-05-25 2017-05-24 Methods of sensitizing cancer to immunotherapy
US17/480,831 Continuation US11884730B2 (en) 2016-05-25 2021-09-21 Methods of sensitizing cancer to immunotherapy

Publications (1)

Publication Number Publication Date
WO2017205514A1 true WO2017205514A1 (fr) 2017-11-30

Family

ID=60412599

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2017/034285 WO2017205514A1 (fr) 2016-05-25 2017-05-24 Méthodes de sensibilisation du cancer à l'immunothérapie

Country Status (2)

Country Link
US (2) US11124571B2 (fr)
WO (1) WO2017205514A1 (fr)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019108589A1 (fr) * 2017-11-30 2019-06-06 Beth Israel Deaconess Medical Center, Inc. Compositions et méthodes pour le traitement du cancer
CN110215516A (zh) * 2018-03-02 2019-09-10 南京大学 一种抑制cdk5协同免疫治疗在抑制乳腺癌中的应用

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20120010229A1 (en) * 2010-07-08 2012-01-12 Macdougall John R Therapeutic regimens for hedgehog-associated cancers
WO2013188355A1 (fr) * 2012-06-12 2013-12-19 Merck Sharp & Dohme Corp. Méthodes de traitement d'une leucémie lymphoïde chronique réfractaire par un inhibiteur de cdk
WO2015026634A1 (fr) * 2013-08-20 2015-02-26 Merck Sharp & Dohme Corp. Traitement du cancer avec une combinaison d'un antagoniste de pd-1 et du dinaciclib

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP5586826B2 (ja) * 2007-09-28 2014-09-10 京セラ株式会社 携帯電子機器
US10413552B2 (en) * 2015-06-18 2019-09-17 The Hospital For Sick Children Method of treating medulloblastoma

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20120010229A1 (en) * 2010-07-08 2012-01-12 Macdougall John R Therapeutic regimens for hedgehog-associated cancers
WO2013188355A1 (fr) * 2012-06-12 2013-12-19 Merck Sharp & Dohme Corp. Méthodes de traitement d'une leucémie lymphoïde chronique réfractaire par un inhibiteur de cdk
WO2015026634A1 (fr) * 2013-08-20 2015-02-26 Merck Sharp & Dohme Corp. Traitement du cancer avec une combinaison d'un antagoniste de pd-1 et du dinaciclib

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019108589A1 (fr) * 2017-11-30 2019-06-06 Beth Israel Deaconess Medical Center, Inc. Compositions et méthodes pour le traitement du cancer
CN110215516A (zh) * 2018-03-02 2019-09-10 南京大学 一种抑制cdk5协同免疫治疗在抑制乳腺癌中的应用

Also Published As

Publication number Publication date
US11124571B2 (en) 2021-09-21
US20190194330A1 (en) 2019-06-27
US11884730B2 (en) 2024-01-30
US20220169735A1 (en) 2022-06-02

Similar Documents

Publication Publication Date Title
US11708412B2 (en) Methods for treating hematologic cancers
CN107787373B (zh) 法尼基转移酶抑制剂在制备用于治疗癌症的药物中的用途
US10821142B2 (en) Cancer treatment and diagnosis
US11911469B2 (en) Combination of ACAT1 inhibitor and checkpoint antibody for treating cancer
CN109195603B (zh) 用tg02治疗癌症
TW201825098A (zh) 具有對抗帶有egfr或her2外顯子20突變之癌細胞之抗腫瘤活性的化合物
CN109844536B (zh) 预测对pd-1轴抑制剂的响应
US20230272083A1 (en) Combination of an anti-pd-l1 antibody and a dna-pk inhibitor for the treatment of cancer
US11884730B2 (en) Methods of sensitizing cancer to immunotherapy
US20230227918A1 (en) Predictive and diagnostic methods for prostate cancer
US20210077582A1 (en) Compositions and methods for increasing the efficacy of anti-pd-1 antibody immunotherapy
US9724337B2 (en) AG-205 for the treatment of breast cancer
Afolabi et al. Synergistic tumor cytolysis by NK cells in combination with a pan-HDAC inhibitor, panobinostat
CA2976072A1 (fr) Polytherapie d'inhibiteurs de hsp90 et d'inhibiteurs de pd-1 pour traiter un cancer
Luo et al. Necroptosis-dependent immunogenicity of cisplatin: implications for enhancing the radiation-induced abscopal effect
US11571400B2 (en) ACAT1 inhibitors for treating cancer
KR20210107023A (ko) 암 치료를 위한 조합 요법
US9662329B2 (en) Use of survivin antagonists in polyomavirus-related disease
Jaglowski et al. Novel therapies and their integration into allogeneic stem cell transplant for chronic lymphocytic leukemia
US20230192863A1 (en) Methods of sensitizing cancer to immunotherapy
CA2960036A1 (fr) Methodes de diagnostic et de traitement du cancer
JP2023543197A (ja) Ｃｓｆ１ｒキナーゼ阻害剤およびその使用
WO2021234150A1 (fr) Charge de mutation de tumeur associée à la sensibilité à l'immunothérapie dans un carcinome urothélial localement avancé ou métastatique
JP2023551071A (ja) Ｓ－エクオールを用いた分子マーカーの調節

Legal Events

Date Code Title Description
NENP Non-entry into the national phase

Ref country code: DE

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17803513

Country of ref document: EP

Kind code of ref document: A1

122 Ep: pct application non-entry in european phase

Ref document number: 17803513

Country of ref document: EP

Kind code of ref document: A1