WO2017200194A2 - Composition comprenant du diacétyle pour inhiber la croissance de cellules souches cancéreuses - Google Patents

Composition comprenant du diacétyle pour inhiber la croissance de cellules souches cancéreuses Download PDF

Info

Publication number
WO2017200194A2
WO2017200194A2 PCT/KR2017/002890 KR2017002890W WO2017200194A2 WO 2017200194 A2 WO2017200194 A2 WO 2017200194A2 KR 2017002890 W KR2017002890 W KR 2017002890W WO 2017200194 A2 WO2017200194 A2 WO 2017200194A2
Authority
WO
WIPO (PCT)
Prior art keywords
cancer
composition
diacetyl
cells
growth
Prior art date
Application number
PCT/KR2017/002890
Other languages
English (en)
Korean (ko)
Other versions
WO2017200194A3 (fr
Inventor
이동선
최학선
정동기
고영상
Original Assignee
이동선
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 이동선 filed Critical 이동선
Publication of WO2017200194A2 publication Critical patent/WO2017200194A2/fr
Publication of WO2017200194A3 publication Critical patent/WO2017200194A3/fr

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/12—Ketones
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A23L33/135—Bacteria or derivatives thereof, e.g. probiotics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/66—Microorganisms or materials therefrom
    • A61K35/74—Bacteria
    • A61K35/741—Probiotics
    • A61K35/744—Lactic acid bacteria, e.g. enterococci, pediococci, lactococci, streptococci or leuconostocs
    • A61K35/747—Lactobacilli, e.g. L. acidophilus or L. brevis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00—Cosmetics or similar toiletry preparations
    • A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/33—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds containing oxygen
    • A61K8/35—Ketones, e.g. benzophenone
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00—Cosmetics or similar toiletry preparations
    • A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/96—Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution
    • A61K8/99—Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution from microorganisms other than algae or fungi, e.g. protozoa or bacteria
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00—Preparations for care of the skin
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2002/00—Food compositions, function of food ingredients or processes for food or foodstuffs
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2200/00—Function of food ingredients
    • A23V2200/30—Foods, ingredients or supplements having a functional effect on health
    • A23V2200/308—Foods, ingredients or supplements having a functional effect on health having an effect on cancer prevention
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2800/00—Properties of cosmetic compositions or active ingredients thereof or formulation aids used therein and process related aspects
    • A61K2800/80—Process related aspects concerning the preparation of the cosmetic composition or the storage or application thereof
    • A61K2800/85—Products or compounds obtained by fermentation, e.g. yoghurt, beer, wine

Definitions

  • the present invention comprises diacetyl or a pharmaceutically acceptable salt thereof as an active ingredient, a composition for inhibiting cancer stem cell growth, perfume composition, inhibiting metastasis of cancer comprising the composition, or for treating or preventing cancer A composition, a food composition, etc.
  • Basal cell phenotype Breast cancer is believed to originate from early mammary progenitor cells in the early stages of differentiation and is known to have a poor prognosis and to be resistant to conventional chemotherapy. This is a good example to support the fact that the target treatment for cancer stem cells is not.
  • Cancer stem cells were first identified in myeloid leukemia and then in various populations of solid cancers, including breast, brain, colon, ovary, pancreatic, and prostate cancers.
  • the cancer stem cells are also called tumor-initiating cells and cancer stem-like cells. It has also been shown that various cancer types, including breast cancer, originate from cancer stem cells (CSCs), a subpopulation of tumors. Such populations are known to cause changes in tumor volume through self-renewal and differentiation.
  • CSCs cancer stem cells
  • Shh Sonic hedgehog
  • Stat3 NF- ⁇ B
  • Wnt / ⁇ -catenin Wnt / ⁇ -catenin
  • TGF- ⁇ and Notch signaling pathways are known to be critical for self-renewal of CSCs.
  • Cancer stem cells have drug resistance and radiation resistance to chemotherapy and radiation therapy, leading to cancer recurrence and metastasis. Thus, targeted therapies for cancer stem cells are essential for the treatment of cancer.
  • Cancer stem cells are known to express certain proteins, including Oct4, Sox2, Nanog, and Aldehyde dehydrogenase-1 (ALDH).
  • the ALDH is an enzyme that oxidizes toxic aldehydes, and its enzymatic activity is widely used as a CSC marker of leukemia, head and neck, bladder, bone, colon, liver, lung, pancreas, prostate, thyroid and cervical cancer. ALDH is known as a therapeutic target for cancer stem cells.
  • Stat3 (Signal transducers and activators of transcription 3) is mainly activated in CSCs, and mammosphere formation is associated with the JAK1 / 2-STAT3 pathway.
  • Secreted IL-6 activates the JAK1 / JAK2-STAT3 pathway and increases expression of the Oct4 gene.
  • the IL-6 / JAK1 / 2 / STAT3 signaling pathway is known to be important for the conversion of NSCCs (Non-CSCs) to CSCs.
  • Nuclear factor- ⁇ B (NF- ⁇ B) transcription factor is structurally activated in tumor cells, including colon, breast, and liver cancer, and is regulated by the I ⁇ B kinase (IKK) complex. Pyrrolidinedithiocarbamate (PDTC), a specific inhibitor of NF- ⁇ B, is known to inhibit breast cancer stem-like cells.
  • IKK I ⁇ B kinase
  • the breast cancer stem cells are known to be identified by the expression of biomarkers such as CD44 high / CD24 low , ESA + (epithelial specific antigen) and ALDH.
  • Chemotherapy is known to increase the proportion of cancer cells expressing CD44 high / CD24 low and mammoth formation.
  • CSCs induce increased levels of specific ABC transporters to protect CSCs from toxins.
  • ABC pumps are used to separate side populations (SP) and can be classified by ABCG2 transporter-specific Hoechst 33342 dyes. Because breast CSCs produce low levels of reactive oxygen species (ROS) compared to tumor cells, breast cancer stem-likes cells are radiation resistant.
  • ROS reactive oxygen species
  • CSCs are known to have less DNA damage than non-stem cancer cells (Diehn M, Cho RW, Lobo NA, Kalisky T, Dorie MJ, Kulp AN, Qian D, Lam JS, Ailles LE, Wong M, Joshua B, Kaplan MJ, Wapnir I, Dirbas FM, Somlo G, Garberoglio C, et al.Association of reactive oxygen species levels and radioresistance in cancer stem cells.Nature. 2009; 458 (7239): 780-783).
  • the breast cancer cell line MCF-7 is known to have a subset of cells with similar capacity to stem cells that can grow in oval form without apoptosis without attachment in vitro. Artificially creating a non-basement condition by floating culture, the cells with stem cell properties are attached to each other to form a spherical cell mass, which is called a neurosphere. Applying this concept to human breast stem cells is the "mammosphere". Mammoth Fair contains eight times more progenitor cells than normal human breast cells, and can be passaged continuously. After several passages, 100% of the cells grow into bi-potent precursors.
  • Mammoth is capable of differentiating into mammary gland epitherlial cells, ductal epithelial cells, and alveolar epitherlial cells, which are adult breast cells. It is observed to form a complex functional breast structure while forming a three-dimensional structure. Mammoth fair is one of the most characteristic characteristics of stem cells is capable of self-proliferation, so that a large number of mammo pairs or breast stem cells can be obtained from a single mammo pair. In addition, compared with hematopoietic stem cells, neural stem cells, embryonic stem cells, etc., many expression genes were confirmed to overlap, and mammospheres were reported to be actual breast stem cells. The standard method for analyzing the self-renewal ability of cancer stem cells is to analyze the implantation in vivo and the mammosphere formation assay in vitro.
  • breast cancer cell line not only breast cancer cell line but also various cancer cell lines including colorectal cancer, cells having stem cell properties may be attached to each other to form a spherical cell mass, which is called a tumorsphere.
  • the two pairs refers to tumor cells developed by the proliferation of one cancer stem cell or cancer progenitor cell.
  • Colorectal cancer also called colon cancer
  • CRC Colorectal cancer
  • colon cancer is the third major cancer in men and the second major cancer in women, with a five-year survival rate of only 8%.
  • cancer screening and effective treatment in the early stages of colorectal cancer mortality is decreasing.
  • 30-50% of colorectal cancer patients are known to relapse.
  • Two survival factors for colorectal cancer are known as tumor recurrence and metastasis.
  • Cancer stem cells have been known to exist in various solid cancer populations such as breast, brain, colon, ovary, pancreas, and prostate cancers, as well as myeloid leukemia, and various cancer types, including colorectal cancer, are derived from cancer stem cells, which are subpopulations of tumors.
  • the cancer stem cell surface antigens of the colon are known as CD133, CD44, CD24, CD26, CDCP1, and CXCR4.
  • CD133 is known as a marker for separating and identifying colon cancer initiation cells (Ricci-Vitiani L, Lombardi). DG, Pilozzi E, Biffoni M, Todaro M, Peschle C and De Maria R.
  • IL-8 has been shown to be associated with cell proliferation, migration, angiogenesis and anticancer susceptibility in vitro and in vivo in colorectal cancer cell line models (Ning Y, Manegold PC, Hong YK, Zhang W, Pohl A, Lurje G, Winder T, Yang D, LaBonte MJ, Wilson PM, Ladner RD and Lenz HJ.
  • Interleukin-8 is associated with proliferation, migration, angiogenesis and chemosensitivity in vitro and in vivo in colon cancer cell line models.Int J Cancer. 2011; 128; 128; (9): 2038-2049) It has also been reported that IL-4 antibodies show a protective effect against CD133 positive stem-like colorectal cancer, and IL-4 antibodies reduce tumor growth after chemotherapy.
  • cancer stem cells To date, studies on cancer stem cells have many limitations, and the role of cancer stem cells in the formation and maintenance of tumors is not clear. In order to efficiently perform treatments targeting cancer stem cells without damaging normal stem cells, knowledge and understanding of molecular biological characteristics and its regulatory pathways that are important for the maintenance and regulation of cancer stem cells are required.
  • An object of the present invention is to provide a composition for inhibiting cancer stem cell growth comprising a compound represented by the formula (1) or a pharmaceutically acceptable salt thereof as an active ingredient.
  • Another object of the present invention is to provide a pharmaceutical composition for inhibiting metastasis of cancer, or treating or preventing cancer, comprising the composition for inhibiting cancer stem cell growth.
  • Another object of the present invention is to provide a food composition for inhibiting cancer metastasis or improving or preventing cancer, comprising the composition for inhibiting cancer stem cell growth.
  • Another object of the present invention is to provide a fragrance composition for inhibiting growth of cancer stem cells, which comprises a volatile compound represented by the formula (1).
  • Another object of the present invention is to provide a pharmaceutical composition, a skin external preparation, a food composition, a cosmetic composition, a perfume composition, an additive for a humidifier, a cigarette filter, a personal care product, a home care product, and an electronic cigarette including the perfume composition.
  • Another object of the present invention is to provide a method of inhibiting the growth of cancer stem cells, comprising the step of exposing the volatile compounds represented by the formula (1) to cancer stem cells in a subject.
  • Another object of the present invention is to provide a method for inhibiting the growth of cancer stem cells, comprising administering to a subject a compound represented by Formula 1 or a pharmaceutically acceptable salt thereof.
  • Another object of the present invention is to provide a method for inhibiting cancer metastasis, comprising administering to a subject a compound represented by Formula 1 or a pharmaceutically acceptable salt thereof.
  • Another object of the present invention is to provide a method for preventing or treating cancer, comprising administering to a subject a compound represented by Formula 1 or a pharmaceutically acceptable salt thereof.
  • Another object of the present invention is to provide a use of the compound represented by the formula (1) or a pharmaceutically acceptable salt thereof for use in the manufacture of a medicament for inhibiting the growth of cancer stem cells.
  • Another object of the present invention is to provide a use of the compound represented by the formula (1) or a pharmaceutically acceptable salt thereof for use in the manufacture of a medicament for inhibiting cancer metastasis.
  • Still another object of the present invention is to provide a use of the compound represented by Formula 1 or a pharmaceutically acceptable salt thereof for use in the manufacture of a medicament for the prevention or treatment of cancer.
  • Diacetyl of the present invention inhibits the growth of breast cancer and colon cancer cells, and inhibited the formation of stem cells of breast cancer and colon cancer.
  • they inhibited the expression of self-renewing genes such as Nanog, Sox2, Oct4, and CD44, which are known to be characteristic of breast cancer stem cells, and IL-6 and IL-8, which are known to be involved in the mammoth formation of breast cancer stem cells.
  • Production was inhibited and it was confirmed to inhibit the STAT3 signaling pathway.
  • IL-8 which is known to be involved in the formation of tumor cells in colon cancer stem cells, and inhibited the STAT3 signaling pathway.
  • the compound inhibits the growth of cancer stem cells, such as breast cancer and colorectal cancer, and the growth of these cancers, and can be used for the treatment of cancers such as breast cancer and colorectal cancer.
  • FIG. 1 shows that diacetyl inhibits various cancer features in breast cancer cell lines.
  • FIG. 1 (A) shows the chemical structure of diacetyl and the viability of diacetyl for MCF-7 and MDA-MB-231 cells. MCF-7 and MDA-MB-231 cells were treated with increasing concentrations of diacetyl for 48 hours. The anti-proliferative effect of diacetyl was measured by MTS assay.
  • MCF-7 and MDA-MB-231 cells were treated with diacetyl for 24 hours and killed cells were analyzed by FACS using the Annexin V-PI staining kit.
  • Caspase3 / 7 activity in MDA-MB-231 cells was analyzed by Caspase-Gloss 3/7 kit.
  • Apoptotic cells were analyzed by fluorescence staining, and nuclei were stained with Hoechst 33258 (enlarged, x200) in breast cancer.
  • FIG. 2 (A) shows the effect of diacetyl on the migration potential of human breast cancer cells. Wound healing of MDA-MB-231 cells was taken at 0 and 18 hours, depending on whether or not diacetyl was treated.
  • FIG. 2 (B) shows the effect of diacetyl on colony formation in human breast cancer cells.
  • the dissociated 1000 MDA-MB-231 cells were seeded in 6-well plates and treated with the indicated concentrations of diacetyl and DMSO for 7 days. Representative images of colonies were recorded. Data shown represent mean ⁇ SD of three independent experiments. * Means P ⁇ 0.05 compared to DMSO-treated control.
  • FIG. 3 shows the effect of diacetyl on tumor growth in xenograft models.
  • Three million cells were injected into the mammary fat pad of immunodeficient NOD-SCID female nude mice.
  • (C) shows the effect of diacetyl on the weight of the tumor. Tumor volume was measured after initiation of treatment. * Means p ⁇ 0.05 compared to control. Representative images were captured at the end of 9 weeks of treatment and the results were shown with vehicle treated controls, diacetyl treated mice, and Dox treated mice.
  • MCF-7 and MDA-MB-231 cells were incubated under mammoth pairing conditions for 7 days.
  • (A) shows the effect of diacetyl on the formation of mammoth pair derived from MCF-7 cells. Primary mammospheres were incubated with diacetyl (0.5 and 1 mM) or DMSO.
  • (B) shows the effect of diacetyl on the formation of mammoth pair derived from MDA-MB-231 cells.
  • the mammoth pairs were incubated with diacetyl (0.5 and 1 mM) or water.
  • (c) shows the effect of diacetyl vapor (fragrance) on the formation of CSCs.
  • MDA-MB-231 cells were treated with diacetyl (0.5 mM) or water for 2 days, and then the CD44 high / CD24 low cell populations were analyzed. For FACS analysis, 50,000 cells were obtained. Gating was based on control antibodies.
  • FIG. B shows the effect of diacetyl on ALDH positive cell population.
  • MDA-MB-231 cells were treated with diacetyl (0.5 mM) or water for 2 days, followed by ALDEFLUOR analysis and FACS analysis.
  • the top panel shows ALDH positive cells treated with DEAB, an ALDH inhibitor as a negative control, and the bottom panel shows ALDH positive cells untreated with DEAB.
  • ALDH positive populations are marked in boxes.
  • (B) shows the effect of diacetyl on mammosphere growth.
  • Diacetyl inhibits the growth of mammoth pairs.
  • Diacetyl- and DMSO treated mammoth pairs for 2 days were separated into single cells and seeded in 6 cm dishes with equal cell numbers. 24 hours after inoculation, cells were counted. On days 2 and 3, cells were counted three times and plotted with mean values. The data represent mean ⁇ SD. * Means P ⁇ 0.05 compared to water-treated control.
  • Lane 1 probe alone; Lane 2: probe + nuclear extract; Lane 3: probe + diacetyl treated nuclear extract; Lane 4: self competition; Lane 5: nuclear extract incubated with mutant STAT3 probe. The diacetyl reduced DNA / STAT3 interaction in mammoth nuclear lysate.
  • C shows human inflammatory cytokine analysis of mammoth pairs treated with diacetyl or water.
  • the inflammatory cytokines were measured using a BD cytometric bead array (CBA) human inflammatory cytokines kit.
  • CBA analysis was performed using IL-6, IL-8, IL-10, IL-12, IL-1 ⁇ , and TNF antibodies.
  • Figure 8 shows that diacetyl inhibits various cancer features in colorectal cancer cell lines.
  • Figure 8 (A, B) shows the chemical structure of diacetyl and the survival rate of acetyl for HT-29 cells. HT-29 cells were treated with increasing concentrations of diacetyl for 48 hours. The anti-proliferative effect of diacetyl was measured by MTS assay.
  • FIG. 8 (C) shows the effect of diacetyl on cell death of colorectal cancer cells.
  • HT-29 cells were treated with diacetyl for 24 hours and killed cells were analyzed by FACS using the Annexin V-PI staining kit.
  • FIG. 8 Apoptotic cells were analyzed by fluorescence staining. Nuclei were stained with Hoechst 33258 in colon cancer (enlarged, x100).
  • 9A shows the effect of diacetyl on the migration potential of human colorectal cancer cells. Wound healing of HT-29 cells was taken at 0 hours and 36 hours, depending on whether or not diacetyl treatment.
  • 9B shows the effect of diacetyl on colony formation in human colorectal cancer cells.
  • the dissociated 1000 HT-29 cells were seeded in 6-well plates and treated with the indicated concentrations of diacetyl and water for 7 days. Representative images of colonies were recorded. Data shown represent mean ⁇ SD of three independent experiments. * Means P ⁇ 0.05 compared to DMSO-treated control.
  • HT-29 cells were incubated for 7 days in two pairs of forming conditions.
  • (B) shows the effect of diacetyl vapor (fragrance) on the formation of CSCs.
  • HT-29 cells were treated with diacetyl (0.5 mM) or water for 2 days, and then the CD44 high / CD133 high cell populations were analyzed. For FACS analysis, 50,000 cells were obtained. Gating was based on control antibodies.
  • FIG. B shows the effect of diacetyl on ALDH positive cell population.
  • HT-29 cells were treated with diacetyl (0.5 mM) or water for 2 days, followed by ALDEFLUOR analysis and FACS analysis.
  • the top panel shows ALDH positive cells treated with DEAB, an ALDH inhibitor as a negative control, and the bottom panel shows ALDH positive cells untreated with DEAB.
  • ALDH positive populations are marked in boxes.
  • (B) shows human inflammatory cytokine assays of diacetyl or water treated toomspare.
  • the inflammatory cytokines were measured using a BD cytometric bead array (CBA) human inflammatory cytokines kit.
  • CBA analysis was performed using IL-6, IL-8, IL-10, IL-12, IL-1 ⁇ , and TNF antibodies.
  • the secreted IL-8 can convert noncancerous stem cells (NSCCs) into cancer stem cells (CSCs) and regulate the dynamic equilibrium of NSCCs to CSCs. Diacetyl deregulates dynamic equilibrium from NSCCs to CSCs through deregulation of IL-8.
  • NSCCs noncancerous stem cells
  • CSCs cancer stem cells
  • FIG. 13 shows the protocol for the mouse model.
  • A Arrows indicate administration of 10 mg / kg of azooxymethane (AOM) via intraperitoneal injection. Dextran sodium sulfate (DSS) means that 2.5% DSS is introduced into drinking water.
  • B to the colon of mice of AOM / DSS (control), AOM / DSS + 10 mg / kg diacetyl (early-treated group, EST) and AOM / DSS + 10 mg / kg diacetyl (later-stage treated group, EST) Represents a representative picture.
  • C The number of colon tumors per mouse induced by AOM-DSS treatment and AOM-DSS-diacetyl treatment is shown.
  • D shows tumor load per mouse induced by AOM-DSS treatment and AOM-DSS-diacetyl treatment.
  • A The effect of diacetyl (0 to 2 mM) on death of lung cancer cells (A549 cells) is shown.
  • B shows the effect of diacetyl on A549 cell derived tomuspher formation. A549 cells were incubated for 7 days under tomuspher forming conditions. The primary tumuspair was incubated with diacetyl (0.5 and 1 mM) or water.
  • the present inventors screened 10 low molecular weight compounds derived from lactic acid bacteria and microorganisms, and among them, only diacetyl effectively inhibited breast cancer-derived mammoth formation (Table 1).
  • CSCs cancer stem cells
  • the experiment was to determine whether diacetyl can function as an inhibitor of various cancer stem cells (CSCs).
  • CSCs cancer stem cells
  • mouse xenograft models were used to effectively inhibit tumor growth. Accordingly, diacetyl was confirmed to be able to inhibit the growth of cancer stem cells including breast cancer and colorectal cancer by targeting CSCs, and can be used to treat cancers including breast cancer and colorectal cancer and completed the present invention.
  • the present invention provides a composition for inhibiting cancer stem cell growth comprising a compound represented by the following formula (1) or a pharmaceutically acceptable salt thereof as an active ingredient.
  • the compound may be derived from lactic acid bacteria.
  • lactic acid bacterium various strains or commercially available lactic acid bacteria can be used without limitation.
  • Lactobacillus genus, Streptococcus genus, Bifidobacterium genus, Lactococcus genus, Pediococcus genus or Leuconostoc Genus microorganisms can be used.
  • the strain is Lactobacillus casei, Lactobacillus acidophilus, Lactobacillus planttaum, Lactobacillus plantarum, Lactobacillus fermentum, Lactobacillus ferbatum (Lactobacillus fermentum) Lactobacillus curvatus, Lactobacillus confusus, Lactobacillus gasseri, Lactobacillus rhamnosus, Bifidobacterium breve or Bifidobacterium strain Bifidobacterium thermophilum) strain.
  • the compound may be derived from Lactobacillus rhamnosus, and the diacetyl may be separated from Lactobacillus rhamnosus.
  • the compound is characterized in that diacetyl (diactyl), the compound has a volatility.
  • cancer generally refers to or describes the physiological state of a mammal that is characterized by unregulated cell growth.
  • Cancer refers to a condition in which a problem occurs in the regulation of normal division, differentiation and death of cells, abnormally proliferating and invading surrounding tissues and organs to form agglomerates and destroy or modify existing structures.
  • the term "cancer stem cell” is an undifferentiated cell having the ability to differentiate into various cancer cells
  • the cancer includes colorectal cancer and colorectal cancer, breast cancer, cervical cancer, cervical cancer, ovarian cancer, including colon cancer and rectal cancer Cancer, prostate cancer, brain tumor, head and neck carcinoma, melanoma, myeloma, leukemia, lymphoma, gastric cancer, lung cancer, pancreatic cancer, non-small cell lung cancer, liver cancer, esophageal cancer, small intestine cancer, anal muscle cancer, fallopian tube carcinoma, endometrial carcinoma, vaginal carcinoma , Vulvar carcinoma, Hodgkin's disease, bladder cancer, kidney cancer, ureter cancer, renal cell carcinoma, renal pelvic carcinoma, bone cancer, skin cancer, head cancer, cervical cancer, skin melanoma, intraocular melanoma, endocrine gland cancer, thyroid cancer, parathyroid cancer, Adrenal cancer, soft tissue sarcoma, urethral cancer,
  • breast cancer stem cell refers to an undifferentiated cell having the ability to differentiate into breast cancer cells.
  • colon cancer stem cell refers to an undifferentiated cell having the ability to differentiate into colorectal cancer cells.
  • breast cancer stem cell growth inhibition is meant to include breast cancer stem cell maintenance (maintenance) inhibition, breast cancer stem cell malignance (inhibition), breast cancer stem cell migration and breast cancer stem cell invasive activity (invasive) inhibition.
  • the term “inhibition of colon cancer stem cell growth” inhibits colon cancer stem cell maintenance, inhibits colon cancer stem cell malignance, inhibits colon cancer stem cell migration and colon cancer stem cell invasive activity. It is meant to include.
  • the primary mammosphere (mammosphere) derived from MCF-7 and MDA-MB-231 cells Diacetyl (diactyl) was treated, as a result, it was confirmed that diacetyl inhibits the formation of the primary mammoth derived from breast cancer cell line, specifically, from breast cancer cells MCF-7 and MDA-MB-231 cells It was confirmed that the number of mammo pairs derived was reduced by 40 to 90%, as well as the size of mammo pairs was reduced (FIGS. 4A and 4B). Accordingly, it was confirmed that the compound of the present invention can inhibit the formation of mammospheres or inhibit the growth of mammospheres.
  • diacetyl diacetyl to the primary sphere (tumorsphere) derived from HT-29 cells (diactyl) was treated, and as a result, it was confirmed that diacetyl inhibited the formation of primary tumourspair derived from colorectal cancer cell line, specifically, the number of tumourspair derived from HT-29 cells which are colorectal cancer cells Not only was confirmed to decrease by 50-90%, it was also confirmed that the size of the Tooth Spare reduced (Fig. 10A).
  • the compound of the present invention is (i) inhibit the formation of mammosphere (mammosphere) derived from breast cancer, (ii) inhibit the growth of mammosphere derived from breast cancer, or (iii) from colon cancer Inhibit the formation of tumorspheres, or (iv) inhibit the growth of tumormers derived from colorectal cancer.
  • diacetyl diacetyl
  • the treatment of diacetyl (diactyl) to the primary sphere (tumorsphere) derived from A549 cells As a result, it was confirmed that diacetyl did not inhibit the formation of primary tumourspair derived from lung cancer cell line (FIG. 14). Therefore, it was found that the formation and growth inhibition of cancer stem cells of diacetyl are different for each cancer type.
  • the breast cancer stem cells may express one or more self-renewal genes selected from Nanog, Sox2, Oct4, and CD44.
  • diacetyl inhibited the expression of self-renewing genes such as Nanog, Sox2 and CD44, which are known to be characteristically expressed in breast cancer stem cells (FIG. 6A), and are involved in mammosphere formation of breast cancer stem cells.
  • Production of known IL-6 and IL-8 was inhibited (FIG. 7C), and it was confirmed to inhibit the STAT3 signaling pathway (FIG. 7B). Accordingly, it was confirmed that the compound can inhibit the growth of breast cancer stem cells.
  • the colorectal cancer stem cells inhibited the production of IL-8, which is known to be involved in the formation of tumorous pairs (FIG. 12B), and confirmed that the STAT3 signaling pathway was inhibited (FIG. 12A). Accordingly, it was confirmed that the compound can inhibit the growth of colorectal cancer stem cells.
  • composition of the present invention can be used as a pharmaceutical composition or food composition.
  • composition of the present invention when utilized as a pharmaceutical composition, it may include the compound or a pharmaceutically acceptable salt thereof.
  • the term "pharmaceutically acceptable salts” refers to all salts that retain the desired biological and / or physiological activity of the compound and exhibit minimal unwanted toxicological effects. Salts prepared according to conventional methods in the art, which methods are known to those skilled in the art. Specifically, the pharmaceutically acceptable salts include, but are not limited to, salts derived from pharmacologically or physiologically acceptable inorganic and organic acids and bases.
  • salts derived from inorganic bases may include, but are not limited to, sodium, potassium, lithium, ammonium, calcium, and magnesium salts.
  • Salts derived from organic bases include, but are not limited to, primary, secondary and tertiary amines; Substituted amines, including naturally occurring substituted amines; And isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, ethanolamine, 2-dimethylaminoethanol, tromethamine, lysine, arginine, histidine, caffeine, procaine, Hydrabamine, choline, betaine, ethylenediamine, glucosamine, N-alkylglucamine, theobromine, purine, piperazine, piperidine, and / or N-ethylpiperi Salts of cyclic amines, including dean. Also included are other carboxylic
  • salts derived from inorganic acids include hydrochloric acid, bromic acid, sulfuric acid, nitric acid, phosphoric acid, and the like.
  • Salts derived from organic acids are acetic acid, propionic acid, glycolic acid, pyruvic acid, oxalic acid, malic acid, malonic acid, succinic acid, maleic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, cinnamic acid , But may include, but is not limited to, mandelic acid, methanesulfonic acid, ethanesulfonic acid, p-toluenesulfonic acid, and / or salicylic acid.
  • the pharmaceutical composition may include a pharmaceutically acceptable carrier or additive.
  • pharmaceutically acceptable means that the subject of application (prescription) is not toxic as long as it is adaptable without inhibiting the activity of the active ingredient.
  • carrier is defined as a compound that facilitates the addition of the compound into cells or tissues.
  • the diacetyls of the present invention may be administered alone or in admixture with any convenient carrier and the like, and such dosage forms may be single or repeated dose formulations.
  • the pharmaceutical composition may be a solid formulation or a liquid formulation.
  • Solid preparations include, but are not limited to, powders, granules, tablets, capsules, suppositories, and the like.
  • Solid form preparations may include, but are not limited to, carriers, flavoring agents, binders, preservatives, disintegrants, lubricants, fillers, and the like.
  • Liquid formulations include, but are not limited to, solutions such as water, propylene glycol solutions, suspensions, emulsions, and the like, and may be prepared by adding suitable colorants, flavors, stabilizers, viscosity agents, and the like.
  • powders may be prepared by simply mixing a suitable pharmaceutically acceptable carrier such as diacetyl and lactose, starch and microcrystalline cellulose, which are the active ingredients of the present invention.
  • Granules are the diacetyl of the present invention; Suitable carriers, pharmaceutically acceptable; And a suitable pharmaceutically acceptable binder such as polyvinylpyrrolidone, hydroxypropyl cellulose, and the like, and then wet granulation using a solvent such as water, ethanol, isopropanol, or dry granulation using compression.
  • a suitable pharmaceutically acceptable binder such as polyvinylpyrrolidone, hydroxypropyl cellulose, and the like, and then wet granulation using a solvent such as water, ethanol, isopropanol, or dry granulation using compression.
  • a suitable pharmaceutically acceptable lubricant such as magnesium stearate
  • the diacetyl of the present invention is oral, injectable (eg, intramuscular, intraperitoneal, intravenous, infusion, subcutaneous, implants), inhalants, nasal administrations, depending on the condition and condition of the subject to be treated. It may be administered as a vaginal agent, rectal administration agent, sublingual agent, transdermal agent, topical agent, etc., but is not limited thereto. It may be formulated into a suitable dosage unit dosage form comprising a pharmaceutically acceptable carrier, excipient, vehicle, conventionally used and nontoxic, depending on the route of administration.
  • the pharmaceutical composition of the present invention may be administered daily from about 0.0001 mg / kg to about 10 g / kg, and may be administered in a daily dosage of about 0.001 mg / kg to about 1 g / kg.
  • the dosage may vary depending on the degree of purification of the mixture, the condition of the patient (age, sex, weight, etc.), the severity of the condition being treated, and the like. If desired, the total daily dose may be divided several times a day for convenience.
  • the content of diacetyl in the composition can be appropriately adjusted to an effective amount capable of exhibiting anti-inflammatory activity according to the symptoms of the disease, the progress of the symptoms, the condition of the patient, and the like.
  • the amount of acetyl may be 0.0001 wt% or more, specifically 0.001 wt% or more, 80 wt% or less, specifically 50 wt% or less, based on the total weight of the total composition, but is not limited thereto.
  • the compound of the present invention was confirmed that inhibit the growth of breast cancer cell-derived mammoth, can be used as a food composition for inhibiting breast cancer stem cell growth.
  • the compound was confirmed to inhibit the growth of colon cancer cell-derived Tumors spare, can be used as a food composition for inhibiting the growth of colorectal cancer stem cells.
  • composition of the present invention when used as a food composition, it may include an acceptable food supplement additive, and may further include appropriate carriers, excipients and diluents commonly used in the manufacture of food.
  • the food means a natural product or a processed product containing one or more nutrients, and specifically, means a state in which it can be directly eaten through a certain degree of processing.
  • the foods include various foods, beverages, gums, teas, vitamin complexes, and functional foods.
  • the food of the present invention includes special nutritional products (e.g., crude oil, young food, baby food, etc.), processed meat products, fish products, tofu, jelly, noodles (e.g. ramen, noodles, etc.), health supplements, seasonings ( For example, soy sauce, miso, red pepper paste, mixed soy sauce), sauces, confectionery (e.g. snacks), dairy products (e.g.
  • fermented milk, cheese, etc. other processed foods
  • kimchi, pickles various kimchi, pickles, etc.
  • beverages examples include, but are not limited to, fruits, vegetable drinks, soy milk, fermented beverages, ice cream, etc., natural seasonings (eg, ramen soup, etc.), vitamin complexes, alcoholic beverages, alcoholic beverages, and other dietary supplements.
  • the functional food, beverages, food additives or beverage additives may be prepared by a conventional manufacturing method.
  • the term "functional food” refers to the control of biological defense rhythm, disease prevention and recovery of food groups or food compositions that have added value to the food by using physical, biochemical, or biotechnological techniques to act and express the function of the food for a specific purpose. It means a food that is designed and processed to fully express the body control function related to the living body, specifically, it may be a health functional food.
  • the term "health functional food” refers to a food prepared and processed in the form of tablets, capsules, powders, granules, liquids and pills using raw materials or ingredients having useful functions for the human body.
  • the term “function” means obtaining a useful effect for health purposes such as nutrient control or physiological action on the structure and function of the human body.
  • the health functional food of the present invention can be prepared by a method commonly used in the art, and the preparation can be prepared by adding raw materials and ingredients commonly added in the art.
  • the formulation of the health functional food can also be prepared without limitation as long as the formulation is recognized as a health functional food.
  • Food composition of the present invention can be prepared in various forms of formulation, unlike the general medicine has the advantage that there is no side effect that can occur when taking a long-term use of the drug as a raw material, and excellent portability, the present invention Dietary supplements are available as supplements to enhance the effects of breast and colon cancer stem cell growth inhibition.
  • the functional food may include a food-acceptable food supplement additive, and may further include appropriate carriers, excipients and diluents commonly used in the manufacture of functional foods.
  • the amount of diacetyl may be at least 0.00001% by weight, specifically at least 0.1% by weight of the total weight of the food composition, 80% by weight or less, specifically 50% by weight or less, more specifically 40% by weight or less
  • the food is a beverage, based on 100 ml of the total volume of the food, 0.001 g or more, specifically 0.01 g or more, 50 g or less, specifically 10 g or less, more specifically 2 g or less May be, but is not limited thereto.
  • the food composition of the present invention may include sweeteners, flavoring agents, bioactive ingredients, minerals, etc. in addition to the active ingredients.
  • Sweeteners may be used in amounts that give the food a suitable sweet taste, and may be natural or synthetic.
  • a natural sweetener is used.
  • natural sweeteners include sugar sweeteners such as corn syrup solids, honey, sucrose, fructose, lactose and maltose.
  • Flavoring agents can be used to enhance the taste or aroma, both natural and synthetic. It is the case of using a natural thing specifically ,. In addition to flavors, the use of natural ones can be combined with nutritional purposes.
  • the natural flavor may be obtained from apples, lemons, citrus fruits, grapes, strawberries, peaches, and the like, or may be obtained from green tea leaves, round leaves, jujube leaves, cinnamon, chrysanthemum leaves, jasmine and the like. Moreover, what was obtained from ginseng (red ginseng), bamboo shoots, aloe vera, ginkgo, etc. can be used. Natural flavors can be liquid concentrates or solid extracts. In some cases, synthetic flavoring agents may be used, and synthetic flavoring agents may include esters, alcohols, aldehydes, terpenes, and the like.
  • catechins such as catechin, epicatechin, gallocatechin, epigallocatechin, vitamins such as retinol, ascorbic acid, tocopherol, calciferol, thiamine, riboflavin, and the like can be used.
  • mineral calcium, magnesium, chromium, cobalt, copper, fluoride, germanium, iodine, iron, lithium, magnesium, manganese, molybdenum, phosphorus, potassium, selenium, silicon, sodium, sulfur, vanadium, zinc and the like can be used.
  • the food composition of the present invention may contain a preservative, an emulsifier, an acidulant, a thickener, and the like, in addition to the sweetening agent.
  • preservatives, emulsifiers and the like are preferably added and used in very small amounts as long as the use to which they are added can be achieved. By trace amounts it is meant numerically in the range of 0.0005% to about 0.5% by weight based on the total weight of the food composition.
  • preservatives include sodium sorbate, sodium sorbate, potassium sorbate, calcium benzoate, sodium benzoate, potassium benzoate, EDTA (ethylenediaminetetraacetic acid), and the like.
  • Emulsifiers that can be used include acacia gum, carboxymethylcellulose, xanthan gum, pectin and the like.
  • acidulants examples include lead acid, malic acid, fumaric acid, adipic acid, phosphoric acid, gluconic acid, tartaric acid, ascorbic acid, acetic acid, phosphoric acid, and the like. Such acidulant may be added so that the food composition is at an appropriate acidity for the purpose of inhibiting the growth of microorganisms in addition to the purpose of enhancing taste.
  • Thickeners that can be used include suspending implements, sedimenters, gel formers, swelling agents and the like.
  • the present invention provides a pharmaceutical composition for inhibiting metastasis of cancer, or preventing or treating cancer, comprising the composition for inhibiting cancer stem cell growth.
  • the cancer is classified into primary cancer existing at the site of occurrence and metastatic cancer that has spread from the site of development to other parts of the body.
  • the metastasis of the cancer refers to a state in which a malignant tumor has spread to other tissues away from the organ. Cancer cells are formed by spreading through the blood circulation or lymph circulation, usually by blood circulation to other organs and then growing into new tumors. Cancer cells, on the other hand, are formed by moving directly to neighboring tissues.
  • the metastasis of the cancer is the proliferation of cancer cells by invasion where cancer cells move directly into and penetrate neighboring tissues, and cancer cells move through the bloodstream to form new tumors in organs that are not physically adjacent to the primary cancer. It includes all metastasis.
  • the cancer metastasis the movement of cells is essential. Therefore, it is obvious that inhibiting the migration of cancer cells is the primary method of preventing cancer metastasis.
  • the cancer is not limited thereto, but may be breast cancer or colon cancer.
  • the terms "cancer”, “cancer stem cells”, “cancer stem cell growth inhibition”, “pharmaceutical composition” is as described above.
  • the composition of the present invention when diacetyl was treated in the MCF-7 cell line and the MDA-MB-231 cell line, it was confirmed that growth of breast cancer cell lines was inhibited (FIG. 1B). Accordingly, the composition of the present invention can be used as a pharmaceutical composition for the treatment or prevention of breast cancer. In addition, it was confirmed that the diacetyl concentration-dependently inhibit the migration and colony formation of MDA-MB-231 cells (Fig. 2A and 2B). Accordingly, the composition of the present invention can suppress cancer metastasis by inhibiting the movement of cancer cells.
  • the pharmaceutical composition including the diacetyl may be used as a pharmaceutical composition for inhibiting metastasis of breast cancer as well as for treating or preventing breast cancer.
  • the composition of the present invention can be used as a pharmaceutical composition for the treatment or prevention of colorectal cancer.
  • the diacetyl inhibits the migration and colony formation of HT-29 cells (Figs. 9A and 9B).
  • the pharmaceutical composition containing the diacetyl can be utilized as a pharmaceutical composition for inhibiting metastasis of colorectal cancer as well as for treating or preventing colorectal cancer.
  • the diacetyl inhibitor reduced the population expressing CD44 high / CD24 low in breast cancer cells (FIG. 5A) and decreased the proportion of ALDH positive breast cancer cells (FIG. 5B). Accordingly, the composition of the present invention can inhibit the growth of breast cancer cells expressing CD44 high / CD24 low and can inhibit the growth of aldehyde dehydrogenase (ALDH) positive breast cancer cells.
  • ADH aldehyde dehydrogenase
  • the diacetyl inhibitor reduced the population expressing CD44 high / CD133 high in colorectal cancer cells (FIG. 11A), and reduced the proportion of ALDH positive colorectal cancer cells (FIG. 11B).
  • the composition of the present invention can inhibit the growth of colorectal cancer cells expressing CD44 high / CD133 high , and can inhibit the growth of aldehyde dehydrogenase (ALDH) positive colorectal cancer cells.
  • ADH aldehyde dehydrogenase
  • the present invention provides a food composition for inhibiting metastasis of cancer, or improving or preventing cancer, comprising the composition for inhibiting cancer stem cell growth.
  • the cancer may be breast cancer or colon cancer, but is not limited thereto.
  • cancer in the present invention, the terms "cancer”, “cancer stem cell”, “cancer stem cell growth inhibition”, “transition”, “food composition” are as described above.
  • the present invention provides a fragrance composition for inhibiting growth of cancer stem cells, comprising a volatile compound represented by the following Formula 1.
  • the cancer may be breast cancer or colon cancer, but is not limited thereto.
  • the compound is characterized in that diacetyl.
  • volatile means a property of the components of low-boiling substances in liquid or solid evaporate or sublimate at room temperature, and the higher the vapor pressure of the material, the more volatility becomes. Molecules fall off the surface of liquids or solids. Low boiling liquid fuels, gasoline, organic solvents, aromatic compounds including benzene are highly volatile.
  • fragrance means a substance that smells. It has a fragrance and enters the nose with intake to reach the nostrils, which stimulates the sense of smell and gives pleasure. It is divided into natural and synthetic fragrances of essential oils extracted from animals and plants. Synthetic fragrances may be synthesized and steered from other raw materials for synthesizing the same components as those of natural fragrances, and those having similar aroma as natural fragrances. In addition, it is a highly aromatic organic substance added to add fragrance to household goods such as cosmetics and food products, and they have excellent volatility at room temperature.
  • CSCs breast cancer stem cells
  • the volatile compound represented by Formula 1 of the present invention can inhibit the growth of stem cells of breast cancer and colon cancer by the fragrance evaporated from the volatile compounds, bar growth of stem cells of breast cancer and colon cancer It can be used as a fragrance composition which can be suppressed.
  • the present invention provides a pharmaceutical composition comprising the perfume composition.
  • the diacetyl can inhibit the growth of breast cancer and colorectal cancer stem cells by the fragrance evaporated into a volatile compound, it can be used as a pharmaceutical composition that can inhibit the growth of breast cancer and colorectal cancer stem cells It is possible.
  • the present invention provides an external preparation for skin, comprising the perfume composition.
  • the diacetyl can inhibit the growth of stem cells of breast cancer and colon cancer by the fragrance evaporated into a volatile compound, it is used as a skin external agent that can inhibit the growth of stem cells of breast cancer and colon cancer This is possible.
  • the external preparation for skin according to the present invention include, but are not limited to, ointments, lotions, soluble burns, suspensions, emulsions, creams, gels, sprays, powders, warnings, patches or water pastes. It may be formulated to any of the bases well known in the art.
  • the external preparation for skin according to the present invention may contain the perfume composition in an amount of 0.01 to 20% by weight based on the total weight of the composition.
  • the present invention provides a food composition comprising the perfume composition.
  • the perfume composition of the present invention can be used as a food composition, the description of the term "food composition” is as described above.
  • the present invention provides a cosmetic composition comprising the perfume composition.
  • the cosmetic composition of the present invention may include other ingredients known in the art to be added to the cosmetic composition in addition to the perfume composition described above. Since the cosmetic composition of the present invention is basically applied to the skin, it can be provided with reference to the cosmetic composition in the art, for example, solutions, suspensions, emulsions, pastes, gels, creams, lotions, powders, soaps, It may be formulated as a surfactant-containing cleansing, oil, powder foundation, emulsion foundation, wax foundation and spray, and the like, but is not limited thereto. More specifically, it may be prepared in the form of a flexible lotion, nutrition lotion, nutrition cream, massage cream, essence, eye cream, cleansing cream, cleansing foam, cleansing water, pack, spray or powder.
  • the formulation of the present invention is a paste, cream or gel, animal oils, vegetable oils, waxes, paraffins, starches, trachants, cellulose derivatives, polyethylene glycols, silicones, bentonites, silicas, talc or zinc oxide may be used as carrier components.
  • animal oils, vegetable oils, waxes, paraffins, starches, trachants, cellulose derivatives, polyethylene glycols, silicones, bentonites, silicas, talc or zinc oxide may be used as carrier components.
  • animal oils vegetable oils, waxes, paraffins, starches, trachants, cellulose derivatives, polyethylene glycols, silicones, bentonites, silicas, talc or zinc oxide
  • cellulose derivatives polyethylene glycols
  • silicones bentonites
  • silicas talc or zinc oxide
  • lactose, talc, silica, aluminum hydroxide, calcium silicate or polyamide powder may be used, in particular in the case of a spray, additionally chlorofluorohydrocarbon, propane Propellant such as butane or dimethyl ether.
  • a solvent, solubilizer or emulsifier is used as the carrier component, such as water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1 Fatty acid esters of, 3-butylglycol oil, glycerol aliphatic ester, polyethylene glycol or sorbitan.
  • liquid carrier diluents such as water, ethanol or propylene glycol
  • suspending agents such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester and polyoxyethylene sorbitan ester, Crystalline cellulose, aluminum metahydroxy, bentonite, tracant and the like can be used.
  • the carrier component is an aliphatic alcohol sulfate, an aliphatic alcohol ether sulfate, a sulfosuccinic acid monoester, an isethionate, an imidazolinium derivative, a methyltaurate, a sarcosinate, a fatty acid amide.
  • Ether sulfates, alkylamidobetaines, aliphatic alcohols, fatty acid glycerides, fatty acid diethanolamides, vegetable oils, lanolin derivatives or ethoxylated glycerol fatty acid esters and the like can be used.
  • the present invention can provide a perfume composition comprising the perfume composition. That is, the perfume composition of the present invention can be added to the perfume composition.
  • the fragrance composition of the present invention may comprise from 0.001 to 30% by weight, preferably from 1 to 30% by weight, more preferably from 1 to 10% by weight of the perfume composition. If the fragrance composition is added in less than 0.001% by weight of the total composition, the fragrance is very low, it is difficult to taste the fragrance, when added in excess of 30% by weight becomes too strong fragrance for use as a fragrance.
  • the composition can be added as it is or mixed with any component useful for a flavor or perfume composition.
  • they may be mixed with one or more of a wide range of natural, synthetic, synthetic chemicals, natural fragrances, flavoring substances, flavors or natural extracts used in the field of fragrances.
  • the fragrance composition may contain one or more ingredients or excipients commonly used with flavoring agents and flavoring agents, for example carrier materials, thickening agents, flavor enhancers and other auxiliaries commonly known and used in the art.
  • the fragrance composition of the present invention may provide a gelled or solidified composition for use in volatile fragrances, or may provide a liquid composition for use in sprayed fragrances.
  • the present invention provides an additive for a humidifier including the perfume composition.
  • fragrance composition of the present invention is volatile, it can be used as an active ingredient of an additive for a humidifier.
  • the present invention provides a cigarette filter comprising the perfume composition.
  • the fragrance composition of the present invention is volatile, it can be used when manufacturing a cigarette filter.
  • the present invention provides a personal care product comprising the perfume composition.
  • the personal care products of the present invention include hair products such as shampoos, rinses, treatments, hair essences, etc. without departing from the object of the present invention; Oral products such as toothpaste and gargle; Skin cleaners such as body washes, body gels, soaps, cleansing creams, cleansing foams, cleansing water and cleansing oils; Perfumes, and the like.
  • the present invention provides a home care product comprising the perfume composition.
  • the home care products of the present invention include, but are not limited to, detergents such as liquid detergents, dish detergents, laundry detergents, and bathroom detergents within the scope of not impairing the object of the present invention.
  • detergents such as liquid detergents, dish detergents, laundry detergents, and bathroom detergents within the scope of not impairing the object of the present invention.
  • pigments, fungicides, antioxidants, preservatives, moisturizers, thickeners, inorganic salts, synthetic polymer materials and the like can be further added.
  • the present invention provides an electronic cigarette comprising the perfume composition.
  • the fragrance composition of the present invention is volatile, it can be used in the production of electronic cigarette.
  • the fragrance composition of the present invention may be applied to an atomizer or an electronic cigarette to be vaporized or made into a particulate state to be inhalable.
  • Electronic cigarette or atomizer refers to an electronic device that vaporizes or particulates a fragrance or inhalable component added to a solvent such as propylene glycol, vegetable glycerin or water.
  • Vaporization means that the liquid component becomes a gas, for example, by Joule resistance heat according to the power supply.
  • And to be in the particulate state means atomizing the liquid by the nozzle structure or by using ultrasonic waves.
  • the electronic cigarette makes the perfume composition inhalable by vaporization and the atomizer is inhalable by making it into particulate form using a nozzle structure or ultrasonic waves.
  • the fragrance composition can be made in an inhalable state in a variety of ways.
  • the present invention provides a method of inhibiting growth of cancer stem cells, comprising exposing a volatile compound represented by Formula 1 to cancer stem cells in a subject.
  • the term "individual” means all animals including humans having cancer metastases or having cancer. Mammals, birds, and the like, including cattle, pigs, sheep, chickens, dogs, humans, and the like, wherein the growth of cancer stem cells is inhibited by the volatile compounds of the present invention. Include.
  • the volatile compound represented by Chemical Formula 1 of the present invention is volatile, and when the compound is exposed to cancer stem cells, growth of stem cells of cancer may be suppressed by the volatilization of the compound.
  • the present invention provides a method for inhibiting the growth of cancer stem cells, comprising administering to a subject a compound represented by Formula 1 or a pharmaceutically acceptable salt thereof.
  • Compound represented by the formula (1) of the present invention inhibits the growth of cancer stem cells, it can inhibit the growth of cancer stem cells by administration of the compound.
  • the present invention provides a method for inhibiting cancer metastasis, comprising administering to a subject a compound represented by Formula 1 or a pharmaceutically acceptable salt thereof.
  • the present invention provides a method for treating or preventing cancer, comprising administering to a subject a compound represented by Formula 1 or a pharmaceutically acceptable salt thereof.
  • the present invention provides a use of the compound represented by Formula 1 or a pharmaceutically acceptable salt thereof for use in the manufacture of a medicament for inhibiting the growth of cancer stem cells.
  • the present invention provides a use of the compound represented by the following formula (1) or a pharmaceutically acceptable salt thereof for use in the manufacture of a medicament for inhibiting cancer metastasis.
  • the present invention provides a use of the compound represented by the following formula (1) or a pharmaceutically acceptable salt thereof for use in the manufacture of a medicament for the prevention or treatment of cancer.
  • 6-, 24-well culture plates containing very low adherent cluster plates were obtained from Corning (Tewksbury, MA, USA).
  • Diacetyl an aromatic compound, was purchased from Sigma-Aldrich Co. (St. Louis, MO, USA).
  • Cell viability was measured using CellTiter 96® aqueous one solution cell proliferation assay kit (Promega, Madison, Wis., USA).
  • the ALDEFLUOR TM Kit was purchased from STEMCELL Technologies Inc (Vancouver, BC, Canada).
  • Other chemicals, such as doxorubicin, for example, are described in Sigma-Aldrich Co. (St. Louis, MO, USA).
  • Example 2-1 Human Breast Cancer Cell Culture Mammoth Fair ( mammospheres ) formation
  • MCF-7 and MDA-MB-231 Human breast cancer cells, MCF-7 and MDA-MB-231 were obtained from the American Type Culture Collection (ATCC; Manassas, VA, USA). MCF-7 and MDA-MB-231 cells contained Dulbecco's Modified Essential Medium (DMEM; Hyclone, 10% fetal bovine serum (FBS; Hyclone), 100 U / ml penicillin, and 100 ⁇ g / ml streptomycin (Hyclone). In Logan, UT, USA). The MCF-7 and MDA-MB-231 cells were maintained at 37 ° C. in a humidified incubator containing 5% CO 2. Cells were plated at a density of 1 ⁇ 10 6 cells in a 10 cm culture dish.
  • single cell suspended MCF-7 and MDA-MB-231 cells were prepared with ultra-low attachment 6-well plates containing 2 ml of complete MammoCult TM medium (StemCell Technologies, Vancouver, BC, Canada). Cells were inoculated at a cell number of 3.5-4 ⁇ 10 4 and 0.5-1 ⁇ 10 4 per well.
  • the complete MammoCult TM medium was supplemented with 4 ⁇ g / ml heparin, 0.48 ⁇ g / ml hydrocortisone, 100 U / ml penicillin and 100 ⁇ g / ml streptomycin. The cells were incubated for 7 days at 37 ° C., 5% CO 2 incubator.
  • Example 2-2 Human Colon Cancer Cell Culture Tomorrow Fair ( tumorsphere ) formation
  • Human colon cancer cells HT-29 were cultured and maintained in the same culture conditions as the breast cancer cells of Example 2-1.
  • single cell suspended HT-29 cells were 5 ⁇ per well in ultra-low attachment 6-well plates containing 2 ml of Cancer Stem Premeium medium (ProMab Biotechnologies Inc, Richmond, CA, USA). Inoculated at a cell number of 10 4 . The cells were incubated for 7 days at 37 ° C., 5% CO 2 incubator.
  • Example 2-3 Human lung cancer cell culture Today Fair ( tumorsphere ) formation
  • Human lung cancer cells were purchased from the American Type Culture Collection (ATCC; Manassas, VA, USA). Cultured and maintained in the same culture conditions as the breast cancer cells of Example 2-1. To establish the primary tumuspair, single cell suspended A549 cells were 5 ⁇ 10 4 per well in ultra-low attachment 6-well plates containing 2 ml of Cancer Stem Premeium medium (ProMab Biotechnologies Inc, Richmond, CA, USA). Inoculated with a cell number of. The cells were incubated for 7 days at 37 ° C., 5% CO 2 incubator.
  • Example 3-1 breast cancer Mammoth Automatic calculation
  • the cell culture plates were placed in a scanner (Epson Perfection V700 PHOTO, Epson Korea, Co, Seoul, Korea) to obtain 8-bit gray scale images of mammo pairs.
  • images were obtained using a NICE software program and downloaded from ftp://ftp.nist.gov/pub/physics/mlclarke/NICE.
  • the desired number of rows and columns e.g., 2 x 3 of a 6-well plate
  • individual ROIs were provided.
  • the ROI shape was defined by moving and scaling.
  • the background signal of the image was corrected using a threshold algorithm, and the selected image was automatically counted.
  • the mammosphere formation assay determined the formation efficiency (MFE,%) of mammo pairs corresponding to the number of mammo pairs per well / total number of plated cells per well x100.
  • Example 3-2 colorectal cancer Of the spheresphere Automatic calculation
  • TFE Tumors Spare Formation Analysis
  • Example 3-3 lung cancer Of the spheresphere Automatic calculation
  • Example 3-1 Lung cancer tumour pairs were counted in the same manner as in Example 3-1, and the tumour pair formation assay was based on the number of tumour pairs per well / total number of plated cells per well x100. ) was determined.
  • MCF-7 and MDA-MB-231 cells were measured using CellTiter 96® aqueous one solution cell proliferation kit.
  • MCF-7 and MDA-MB-231 cells were incubated in 96-well plates in the presence of diacetyl (0.1, 0.2, 0.5, 1 and 2 mM) for 48 hours. Absorbance was determined at 490 nm using a 96-well plate reader (Dynex Revelation, Dynex Ltd., Billingshurst, UK) according to the manufacturer's protocol. Each data was determined by measuring three sets.
  • HT-29 cells As colon cancer cells, HT-29 cells were used, and diacetyl was treated in the same manner as in Example 4-1, except that the concentrations of 0.1, 0.5, 1, and 2 mM were treated.
  • Lung cancer cells were carried out in the same manner as in Example 4-1, except that A549 cells were used.
  • Cancer cells were cultured in 6-well plates and incubated with diacetyl (1 mM) or DMSO (or water) for 24 hours. Bistained with PI and FITC-Annexin V according to manufacturer's instructions. The samples were analyzed by flow cytometry (Accuri C6, BD, San Diego, CA, USA).
  • MDA-MB-231, or HT-29 cells were treated with 2 mM diacetyl for 24 hours, and the cells were incubated at 37 ° C. for 30 minutes in a Hoechst 33258 solution (10 mg / ml). The cells were then observed under a fluorescence microscope.
  • MDA-MB-231 or HT-29 cells were seeded at low density in 6-well plates and treated with different diacetyl concentrations in DMEM medium. After 24 hours the medium was replaced with fresh medium and incubated for 7 days of growth. Grown colonies were counted.
  • MDA-MB-231 or HT-29 cells were seeded in 6-well plates and grown to 90% confluency. Using a sterile white micro pipette tip, the cell layer was scratched. After washing with DMEM medium, breast or colorectal cancer was treated with diacetyl or DMSO (or water). At 16 hours, wounded areas were photographed with a 10x optical microscope.
  • Example 10 CD44 and CD24 (or CD133) expression flow cytometry (Flow cytometric analysis)
  • CD44 and CD24 in MDA-MB-231 cells and expression of CD44 and CD133 in HT-29 cells were measured by FACS analysis. After isolation and harvesting of cells using IX trypsin / EDTA, one million cells were suspended and the FITC-bound anti-human CD44 and PE-bound anti-human CD24 or PE-bound anti-human CD133 antibody ( BD Pharmingen, San Diego, CA, USA) and incubated at 4 ° C. for 30 minutes. The cells were then washed three times with 1 ⁇ PBS and analyzed by flow cytometry (Accu C6, BD, San Diego, Calif., USA).
  • transcripts were measured with a One Step SYBR PrimeScript RT-PCR kit (Takara, Tokyo, Japan) using SYBR Green as a double stranded DNA specific dye.
  • One-step RT-PCR reactions include 10 ⁇ M PCR for 1 ⁇ g total RNA, 10 ⁇ l 2X One Step SYBR RT-PCR Buffer IV, 1 ⁇ l PrimeScript 1 step Enzyme Mix II, CD44, NANOG, OCT4, SOX2, ⁇ -actin It was performed at a final volume of 20 ⁇ l per reaction, including forward primers, and PCR reverse primers.
  • the forward and reverse primers are as follows.
  • CD44 forward primer AGAAGGTGTGGGCAGAAGAA (SEQ ID NO: 1)
  • CD44 reverse primer AAATGCACCATTTCCTGAGA (SEQ ID NO: 2)
  • NANOG forward primer ATGCCTCACACGGAGACTGT (SEQ ID NO: 3),
  • NANOG reverse primer AAGTGGGTTGTTTGCCTTTG (SEQ ID NO: 4),
  • OCT4 forward primer AGCAAAACCCGGAGGAGT (SEQ ID NO: 5),
  • OCT4 reverse primer CCACATCGGCCTGTGTATATC (SEQ ID NO: 6),
  • SOX2 forward primer TTGCTGCCTCTTTAAGACTAGGA (SEQ ID NO: 7),
  • SOX2 reverse primer CTGGGGCTCAAACTTCTCTC (SEQ ID NO: 8),
  • ⁇ -actin forward primer TGTTACCAACTGGGACGACA (SEQ ID NO: 9),
  • ⁇ -actin reverse primer GGGGTGTTGAAGGTCTCAAA (SEQ ID NO: 10).
  • the relative expression level of mRNA of the target gene was calculated using the comparative CT method. At least three independent PCR procedures were performed following statistical analysis. PCR products were normalized to the ⁇ -actin gene as an internal control.
  • the ALDEFLUOR assay system provides a novel approach to the identification, evaluation and isolation of CSCs based on the activity of aldehyde dehydrogenase (ALDH).
  • Active reagent BODIPY-aminoacetaldehyde was added to breast cancer cells or colon cancer cells and converted to fluorescence BODIPY-aminoacetate by aldehyde dehydrogenase (ALDH).
  • Diethylaminobenzaldehyde (DEAB), an ALDH inhibitor was used as a negative control.
  • MCF-7 cells or HT-29 cells were treated with 1 mM diacetyl for 24 hours, and the proportion of ALDH positive cells was analyzed by ALDEFLUOR assay.
  • ALDH positive and negative cells were sorted using flow cytometry (Accuri C6, BD, San Diego, CA, USA).
  • Diacetyl treated samples were separated on 10% SDS-PAGE and transferred to polyvinylidene difluoride membrane (Millipore, Bedford, Mass., USA). The membrane was blocked in PBS-Tween 20 (0.1%, v / v) containing 5% skim milk powder at room temperature for 30 minutes. The blots were incubated overnight at 4 ° C. with blocking solutions containing primary antibodies. Primary antibodies used were as follows: Stat3, p65, Lamin B, and phospho-Stat3 (Cell Signaling, Beverly, MA, USA). ⁇ -actin (Santa Cruz Biotechnology) was used as a loading control.
  • the blots were incubated with horseradish peroxidase-bound secondary antibody and photosensitized with a chemiluminescence detection kit (Santa Cruz Biotechnology).
  • Inflammatory cytokines were measured using a BD cytometric bead array (CBA) human inflammatory cytokines kit, according to the manufacturer's instructions (BD, San Diego, CA, USA).
  • CBA BD cytometric bead array
  • the mixed capture beads were vortexed and 50 ⁇ l of beads were added to the assay tube.
  • 50 ⁇ l of human inflammatory cytokine standard and incubated mammosphere / tomuspher solution were added to the assay tube and the cytokine PE solution was mixed. After 3 hours, the mixed solution was washed and analyzed by flow cytometry (Accuri C6, BD, San Diego, CA, USA).
  • Example 15 Electrophoretic mobility shift assays (EMSA )
  • EMSA was detected using Lightshift's chemiluminscet EMSA kit (Thermoscientific, IL, USA) according to the manufacturer's instructions. Biotin-top and bottom probs of the Stat3 probe (5′-CTTCATTTCCCGGAAATCCCTA-Biotin3 ′, SEQ ID NOs: 11 and 5′-TAGGGATTTCCGGGAAATGAAG-Biotin3 ′, SEQ ID NO: 12) were annealed and the double-stranded oligonucleotides were end-labeled with biotin.
  • Biotin-labeled DNA probes were incubated with diacetyl treated nuclear protein in a final volume of 20 ⁇ L EMSA buffer containing 1 ⁇ g / ⁇ L poly [dI-dC]) at room temperature for 20 minutes.
  • the reaction mixture was electrophoresed on 6% polyacrylamide unmodified gel in 0.5 ⁇ TBE (45 mM Tris borate and 1 mM EDTA) at 4 ° C. and visualized using a chemiluminescent nucleic acid detection kit (Thermoscientific, IL, USA) It was.
  • Example 16 Immunodeficiency NOD- SCID ( BALB / cSIc Producing Breast Cancer Cells) (nu / nu)) chemotherapy in female nude mice
  • NOD-SCID (BALB / cSIc (nu / nu) female nude mice producing a total of 24 breast cancer cells were divided into four groups. Six mice as negative controls did not receive chemotherapy. However, the volume of tumors in control mice was measured every 3 days, using the formula (width) 2 ⁇ length / 2. The other six nude mice received diacetyl drug at an optimal dose of 10-50 mg / kg using breast fat pad infusion. Another six nude mice received daily low doses of doxorubicin (Dox) 10 mg / kg as a positive control using breast fat pad infusion. The last group remaining was used as non-tumor group without treatment.
  • Dox doxorubicin
  • mice Eighteen-week-old male Balb / c mice were purchased from Orient Bio (Seongnam, Korea). All procedures using mice were reviewed at the Animal Protection Center at Cheju National University. Six mice were weighed in each group, and azooxymethane (AOM) and dextran sodium sulfate (DSS) were intraperitoneally administered at 10 mg / kg. After treatment with DSS, mice received 10 mg / kg of diacetyl for about 2 months. The mice used in the experiments used mice bred in the same conditions and the same age.
  • AOM azooxymethane
  • DSS dextran sodium sulfate mice
  • 1A shows the chemical formula of the diacetyl of the present invention.
  • diacetyl was treated by concentration, followed by MTS analysis. As a result, 48 hours after diacetyl treatment, it was confirmed that the growth of breast cancer cell lines was inhibited in a concentration-dependent manner at a concentration of 500 ⁇ M or more of diacetyl in MCF-7 cell line and 200 ⁇ M or more of diacetyl in MDA-MB-231 cell line (FIG. 1A).
  • Diacetyl was confirmed in Figure 1 to inhibit the proliferation of breast cancer cells in vitro.
  • Tumor volume in the diacetyl group was smaller than the control group not treated with diacetyl, the tumor volume was smaller than the positive control group Doxurubicin (Fig. 3A and B).
  • the tumor weight was smaller than the control group without the diacetyl treatment and significantly smaller than the positive control group, Doxurubicin. ( Figure 3C).
  • the body weights of mice in the diacetyl treatment group were similar to the control group (FIG. 3A).
  • diacetyl inhibited the formation of primary mammoths derived from breast cancer cell lines.
  • the number of mammo pairs was reduced by 40-90%, and the size of mammo pairs was also reduced (FIGS. 4A and 4B).
  • FIG. 4C it was confirmed whether breast cancer stem cell formation was inhibited through evaporation of the diacetyl fragrance. As a result, the evaporated diacetyl aroma was confirmed to inhibit the formation of breast cancer stem cells (Fig. 4C).
  • Diacetyl was treated for 24 hours on MDA-MB-231 cells and the effects of the diacetyl inhibitors were examined in subpopulations expressing CD44 high / CD24 low in breast cancer cells. As a result, the diacetyl inhibitor reduced the population expressing CD44 high / CD24 low in breast cancer cells (FIG. 5A). MDA-MB-231 cells were treated with diacetyl for 24 hours and ALDEFLUOR assay was performed to investigate the effect of diacetyl inhibitors on the proportion of ALDH positive breast cancer cells. As a result, it was confirmed that diacetyl reduced the proportion of ALDH positive breast cancer cells (FIG. 5B).
  • the binding of the diacetyl treated nuclear extract with Stat3 DNA was analyzed using a biotin-labeled Stat binding probe that binds with high affinity to STAT3.
  • diacetyl inhibited the binding of Biotin-labeled Stat probe to Stat3 (FIG. 7B, lane 3).
  • the specificity of the pStat3 / biotin-labeled Stat3 probe was determined by the unlabeled excess self-competitor (FIG. 7B, lane 4) and the mutated-Stat competitor (FIG. 7B, lane 5). It was confirmed using.
  • IL-6 and IL-8 have been known to play an important role in mammoth pair formation (Sansone P, Storci G, Tavolari S, Guarnieri T, Giovannini C, Taffurelli M, Ceccarelli C, Santini D, Paterini P, Marcu KB, Chieco P and Bonafe M.
  • IL-6 triggers malignant features in mammospheres from human ductal breast carcinoma and normal mammary gland.J Clin Invest. 2007; 117 (12): 3988-4002).
  • an inflammatory cytokine profiling analysis was performed using a flow cytometer.
  • the HT-29 cells were treated with diacetyl for 24 hours, and the effects of the diacetyl inhibitors were examined in subpopulations expressing CD44 high / CD133 high in colorectal cancer cells. As a result, the diacetyl inhibitor reduced the population expressing CD44 high / CD133 high in colorectal cancer cells (FIG. 11A).
  • HT-29 cells were treated with diacetyl for 24 hours and ALDEFLUOR assay was performed to investigate the effect of diacetyl inhibitors on the proportion of ALDH positive colorectal cancer cells. As a result, it was confirmed that diacetyl reduced the proportion of ALDH positive colorectal cancer cells (FIG. 11B).
  • Secreted IL-8 has been known to play an important role in the formation of tumuspair (Ginestier C, Liu S, Diebel ME, Korkaya H, Luo M, Brown M, Wicinski J, Cabaud O, Charafe-Jauffret E, Birnbaum D, Guan JL, Dontu G and Wicha MS.CXCR1 blockade selectively targets human breast cancer stem cells in vitro and in xenografts.J Clin Invest. 2010; 120 (2): 485-497).
  • an inflammatory cytokine profiling assay was performed using a flow cytometer. As a result, as shown in the inflammatory cytokine profiling data in FIG. 12B, by diacetyl treatment, the production level of secreted IL-8 was reduced.
  • the internal control used HT-29 Tomuspair culture without diacetyl treatment.
  • A549 The effect of diacetyl on the human lung cancer cell line A549 was investigated. As a result, unlike breast cancer and colon cancer cells, growth of the A549 cell line, which is a human lung cancer cell line, was not inhibited even by 2 mM diacetyl treatment (FIG. 14A).
  • the diacetyl of the present invention not only inhibits the proliferation of breast cancer and colorectal cancer, but also inhibits the growth of stem cells of breast cancer and colorectal cancer, thereby preventing the growth of breast cancer and colorectal cancer and their stem cells. It was found that it can be used for growth inhibition.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Chemical & Material Sciences (AREA)
  • Mycology (AREA)
  • Epidemiology (AREA)
  • Engineering & Computer Science (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Medicinal Chemistry (AREA)
  • Birds (AREA)
  • Nutrition Science (AREA)
  • Food Science & Technology (AREA)
  • Microbiology (AREA)
  • Polymers & Plastics (AREA)
  • Biotechnology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Molecular Biology (AREA)
  • Emergency Medicine (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Dermatology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
  • Coloring Foods And Improving Nutritive Qualities (AREA)
  • Organic Low-Molecular-Weight Compounds And Preparation Thereof (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

La présente invention concerne une composition comprenant du diacétyle ou un sel pharmaceutiquement acceptable de celui-ci en tant qu'ingrédient efficace pour inhiber la croissance de cellules souches cancéreuses, une composition aromatisante comprenant du diacétyle ou un sel pharmaceutiquement acceptable de celui-ci en tant qu'ingrédient efficace, une composition pharmaceutique pour supprimer la métastase du cancer ou pour traiter ou prévenir le cancer, contenant la composition, et une composition alimentaire. Le diacétyle de la présente invention supprime la croissance des cellules de cancer du sein et de cancer colorectal et inhibe la formation des cellules souches du cancer du sein et du cancer colorectal. En outre, on observe que le diacétyle est inhibiteur de l'expression des gènes d'auto-renouvellement, tels que Nanog, Sox2, Oct4 et CD44, qui sont connus pour être exprimés de manière caractéristique dans les cellules souches du cancer du sein, et la production d'IL-6 et d'IL-8, qui sont connues pour être impliquées dans la formation de mammosphères de cellules souches du cancer du sein, et pour interférer avec la voie de signalisation STAT3. En outre, on a découvert que le diacétyle supprime la production d'IL-8, qui est connue pour être impliquée dans la formation de sphères tumorales dans les cellules souches du cancer colorectal, et pour interférer avec la voie de signalisation STAT3. En conséquence, le composé inhibe la croissance de cellules souches dans des cancers tels que le cancer du sein et le cancer colorectal et la croissance des cancers, et peut donc être appliqué au traitement d'un cancer, tel que le cancer du sein et le cancer colorectal.
PCT/KR2017/002890 2016-05-18 2017-03-17 Composition comprenant du diacétyle pour inhiber la croissance de cellules souches cancéreuses WO2017200194A2 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2016-0060811 2016-05-18
KR20160060811 2016-05-18

Publications (2)

Publication Number Publication Date
WO2017200194A2 true WO2017200194A2 (fr) 2017-11-23
WO2017200194A3 WO2017200194A3 (fr) 2018-09-07

Family

ID=60325325

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2017/002890 WO2017200194A2 (fr) 2016-05-18 2017-03-17 Composition comprenant du diacétyle pour inhiber la croissance de cellules souches cancéreuses

Country Status (2)

Country Link
KR (1) KR101907151B1 (fr)
WO (1) WO2017200194A2 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3383494A4 (fr) * 2015-12-04 2019-08-07 The Regents of The University of California Inhibiteurs d'histone désacétylase

Family Cites Families (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP4512265B2 (ja) * 2000-12-26 2010-07-28 株式会社ヤクルト本社 乳酸菌培養上清およびその製造方法並びに当該上清を利用する皮膚外用剤
WO2004100885A2 (fr) * 2003-05-09 2004-11-25 The Trustees Of The University Of Pennsylvania Compositions et methodes de traitement anticancereux
CN101085949A (zh) * 2007-06-18 2007-12-12 大连工业大学 树莓啤酒及其酿造方法
US8993333B2 (en) * 2009-08-03 2015-03-31 Institut Clinident Method of evaluating cancer risk in human
KR101289033B1 (ko) * 2011-07-04 2013-07-23 한양대학교 산학협력단 암 줄기세포 성장 억제용 조성물
WO2015088039A1 (fr) * 2013-12-10 2015-06-18 国立大学法人九州大学 Méthode de détection d'un cancer utilisant le sens de l'odorat des nématodes
KR101670590B1 (ko) * 2014-05-26 2016-10-28 숙명여자대학교산학협력단 Ｅｒｋ 신호활성 억제제를 유효성분으로 함유하는 암 줄기세포 성장 억제용 조성물
KR101724541B1 (ko) * 2016-04-29 2017-04-07 제주대학교 산학협력단 페닐아세트알데히드를 포함하는, 유방암 줄기세포 성장 억제용 조성물

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3383494A4 (fr) * 2015-12-04 2019-08-07 The Regents of The University of California Inhibiteurs d'histone désacétylase
US10537535B2 (en) 2015-12-04 2020-01-21 The Regents Of The University Of California Histone deacetylase inhibitors

Also Published As

Publication number Publication date
WO2017200194A3 (fr) 2018-09-07
KR20170130278A (ko) 2017-11-28
KR101907151B1 (ko) 2018-10-12

Similar Documents

Publication Publication Date Title
WO2012148247A2 (fr) Composition pharmaceutique contenant de l'acétate d'acide oléanolïque en tant que principe actif pour la prévention ou le traitement de maladie à médiation par tlr ou il-6
WO2018124508A1 (fr) Composition pour la prévention et le traitement de maladies musculaires ou pour l'amélioration de la fonction musculaire, contenant de l'acide 3,5-dicaféoylquinique ou de l'extrait de chrysanthème
WO2022035115A1 (fr) Composition pour la prévention et le traitement des troubles musculo–squelettiques contenant un extrait d'alnus japonica ou un composé isolé à partir de celui-ci et utilisation de celle-ci
WO2017188690A1 (fr) Composition permettant d'inhiber la croissance des cellules souches cancéreuses mammaires, comprenant du phénylacétaldéhyde
WO2015037778A1 (fr) Composition contenant un composé de lignane comme principe actif pour prévenir ou traiter un cancer
WO2016080796A2 (fr) Composition pharmaceutique contenant un composé sesquiterpénique et utilisable en vue de la prévention ou du traitement de maladies à médiation par stat3, et son utilisation
WO2014168447A1 (fr) Composition pharmaceutique et aliment naturel fonctionnel pour prévenir ou traiter un cancer, contenant un extrait naturel comme principe actif
WO2012043949A1 (fr) Composition pour améliorer l'immunité contenant des composés représentés par les formules chimiques 1-8 ou l'extrait de sophora flavescens comme ingrédient actif
WO2017200194A2 (fr) Composition comprenant du diacétyle pour inhiber la croissance de cellules souches cancéreuses
WO2018236186A1 (fr) Composition comprenant un dérivé de sesquiterpène en tant que principe actif pour la prévention ou le traitement de maladies musculaires
WO2018128479A1 (fr) Composition pour la prévention ou le traitement de maladies musculaires, comprenant comme principe actif de l'acide subérique ou un sel pharmaceutiquement acceptable de celui-ci
WO2020055129A1 (fr) Composition de traitement ou de prévention du cancer comprenant un dérivé de verbénone
WO2018062820A1 (fr) Composition visant à prévenir la chute des cheveux et à en favoriser la pousse, comprenant un phytoœstrogène en tant que principe actif
WO2020085826A1 (fr) Composition pour soulager une irritation de la peau induite par des facteurs de pollution environnementaux ou pour la protection de la peau, contenant comme principe actif un extrait de noix de muscade ou du macelignane
WO2018070819A1 (fr) Composition comprenant du ciclésonide destinée à inhiber la croissance de cellules souches cancéreuses
WO2018021618A1 (fr) Inhibiteur de croissance de cellules souches cancéreuses, contenant du cis-3-hexénal.
WO2023277584A1 (fr) Composition pour éliminer les cellules sénescentes comprenant un composé sélénié en tant que principe actif
WO2020032435A1 (fr) Composition de prévention de la perte des cheveux ou de promotion de la restauration capillaire contenant du yarayara en tant qu'ingrédient actif
WO2018221922A1 (fr) Composition pour la prévention et le traitement de maladies musculaires, contenant un extrait de coptidis rhizoma, et son utilisation
WO2016190689A2 (fr) Composition permettant de prévenir, de soulager ou de traiter les maladies musculaires ou d'améliorer la fonction musculaire
WO2019017677A2 (fr) Composition comprenant du citral utilisé comme principe actif pour présenter un effet de raffermissement musculaire, de renforcement musculaire, de différenciation musculaire, de régénération musculaire ou de suppression de sarcopénie
WO2020145619A1 (fr) Composition pour la prévention des allergies, le soulagement de la dermatite atopique ou la régénération de la peau, contenant, en tant que principe actif, un undécane ou un undécanal
WO2019172566A1 (fr) Agent anti-stress, composition d'agent anti-anxiété ou antidépresseur contenant de l'ionone en tant que principe actif
WO2019083286A2 (fr) Composition contenant de l'irone comme principe actif pour prévenir la chute des cheveux ou stimuler la repousse des cheveux
WO2019083287A2 (fr) Composition contenant du phellandrène comme principe actif pour prévenir la chute des cheveux ou stimuler la repousse des cheveux

Legal Events

Date Code Title Description
NENP Non-entry into the national phase in:

Ref country code: DE

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17799552

Country of ref document: EP

Kind code of ref document: A2

122 Ep: pct application non-entry in european phase

Ref document number: 17799552

Country of ref document: EP

Kind code of ref document: A2