WO2017190487A1 - Primer set for amplifying multiple target dna sequences in sample and use thereof - Google Patents

Abstract

Provided are a primer set for amplifying multiple target DNA sequences in a sample and a method for amplifying multiple target DNA sequences in a sample using the primer set. The primer set comprises multiple pairs of upstream and downstream specific primers for each target DNA sequence. Each pair of upstream and downstream specific primers comprises specific sequences for the target sequence, and the specific sequences satisfy with the following conditions: (1) no amplification occurs between the specific sequences and sequences other than the target sequence; (2) no dimer forms between the specific sequences; and (3) no hairpin structure forms. A consensus sequence that is not homologous to the genome is linked to the 5' terminus of the specific sequence. The 3' terminus of the specific sequence has a modification for increasing the steric hindrance, and the modification does not hinder the specific sequence from binding to a perfectly matching template with the specific sequence and elongating, but basically hinders the specific sequence from binding to an imperfect matching template and elongating.

Description

Primer set for amplifying multiple target DNA sequences in a sample and application thereof Technical field

The invention relates to the capture, enrichment and analysis of nucleic acid sequences. More specifically, the present invention relates to a multiplex PCR-based target sequence enrichment method.

Background technique

Whole genome sequencing allows for mutations, insertions, deletions, and structural variations at the genome-wide level. However, due to the large genomic capacity, sequencing at 30x yields data volumes approaching 100G. Sequencing of low-mutation frequencies associated with tumors requires at least 1000× coverage, and if genome-wide sequencing is performed, it will produce 3000G of data. In addition to the enormous difficulty of data analysis, the amount of data of this scale will significantly increase the cost of sequencing, which in turn will limit the application of sequencing. In order to solve this problem, the target area capture technology came into being.

Target region capture technology refers to the targeted capture of the nucleic acid sequence of the target region by a specific technical means, and then the library is sequenced to achieve the purpose of deep sequencing of the target region, and the sequencing cost is greatly reduced. PCR is a common technique for enriching target regions, and it is more common to capture multiple target regions at once using multiplex PCR techniques. Multiplex PCR is suitable for capture of hotspots or target areas of smaller length. Two important factors that limit the application of multiplex PCR techniques are non-specific amplification and dimer production.

Therefore, there is a need in the art for multiplex PCR techniques that are effective in reducing non-specific amplification and dimer production.

Summary of the invention

The invention provides a target sequence enrichment method based on multiplex PCR amplification, which comprises: screening of compatible multiplex PCR primers; performing the first round of specific multiplex PCR amplification; performing a second round of universal primer amplification and enrichment The product was recovered and sequenced on the machine.

Thus, in a first aspect, the invention provides a primer set for amplifying a plurality of target DNA sequences in a sample, the primer set comprising a plurality of pairs of upstream and downstream specific primers for each target DNA sequence, wherein:

a) each pair of the upstream and downstream specific primers includes a specific sequence for the target sequence, and the following conditions are satisfied between all the specific sequences: (1) each specific sequence does not undergo amplification with a sequence other than the target sequence, (2) no dimer is formed between the specific sequences, and (3) the specific sequence does not form a hairpin structure;

b) a universal sequence linked to a different source of the genome at the 5' end of the specific sequence;

c) a modification that increases steric hindrance at the base 3' end of the specific sequence, the modification does not block the binding and extension of the template that exactly matches the specific sequence, but substantially blocks it Combination and extension of templates that do not exactly match.

In a specific embodiment, the specific sequence satisfies the following conditions: (1) the specific sequence and the Tm- and non-target regions of the target region have a Tm ≥ 5 ° C, preferably ≥ 10 ° C; ) The specific sequence and the Tm- of the target region form a dimer with other specific sequences with a Tm ≥ 5 ° C, preferably ≥ 10 ° C; (3) the specific sequence and the target region Tm - form a hairpin structure Tm ≥ 5 The value of °C, preferably ≥10 °C, preferably Tm, is calculated based on the nearest neighbor method of the SantaLucia 2007 thermodynamic parameter table.

In the present invention, the modification at the base of the 3' end of the specific sequence is included at the 3' end-2, -3 base, ribose or phosphodiester bond of the specific sequence; in a preferred embodiment In the scheme, the GC content of the 5 bases at the 3' end of the specific sequence is greater than 50%, that is, three or more bases are C or G, and the base of the 3' end of the specific sequence is Modifications are also included at the 3' end-4 base, ribose or phosphodiester bond of the specific sequence. That is, in a preferred embodiment, in the case where the GC content of the 5 bases at the 3' end of the specific sequence is greater than 50%, that is, three or more bases are C or G, Modifications at the base of the 3' end of the specific sequence are also included at the 3' end-2, -3, -4 position base, ribose or phosphodiester bond of the specific sequence.

In a specific embodiment, the modification to increase steric hindrance is selected from the group consisting of: deoxyhypoxanthine (dI), deoxyuracil (dU), 5-Methyl dC, 2'-O-Me-dC, phosphate Group, thio group, digoxin, biotin, Aminolinker C7, BHQ1, BHQ2, Dabcyl, JOE, ROX, FAM, TAMRA, alkyl group, fluoro group, amino group and Thiol-C3S-S.

In a specific embodiment, the modification at the 3' end of the base that increases steric hindrance comprises a thio modification at the 3' end-1, -2, -3 base.

In a specific embodiment, the 5 base of the 3' end of the specific sequence has a GC content greater than 50% and a thio modification at the 3' base to the base of the specific sequence.

In a specific embodiment, the specific primer sequence has a uniform thermodynamic parameter, preferably a Tm standard deviation < 5 °C; more preferably a Tm standard deviation < 2 °C; most preferably a Tm standard deviation < 1 °C. The standard deviation of Tm is the standard deviation of the Tm between all of the specific primer sequences and the corresponding target DNA sequence.

In a second aspect, the invention provides a method of amplifying a plurality of target DNA sequences in a sample, the method comprising:

a) providing a sample comprising the target DNA sequence and the non-target sequence, the primer set of the first aspect of the invention, and a universal primer pair complementary to the universal sequence of the 5' end of the specific primer in the primer set;

b) performing a PCR reaction with a specific primer in the primer set to amplify a target DNA sequence in the sample, and the annealing temperature of the PCR reaction is performed in a step from high to low, for example, in an annealing process. Annealing at three temperatures of equal difference (eg 60 ° C, 59 ° C, 58 ° C);

c) amplifying the amplification product in step b) with the universal primer pair to further enrich the amplification product.

In a specific embodiment, the method further comprises the step of d) sequencing the amplified product obtained in step c).

In a specific embodiment, the method further comprises the step b') of recovering the amplified product enriched in step b).

In a specific embodiment, the recovery is by fragment screening and purification of the first round of PCR reaction products using magnetic beads to remove large fragments, genomic DNA, primer dimers, primers and other reactive components outside the target region. , to obtain a PCR product of the sequence of the target region.

In a specific embodiment, the plurality of annealing temperatures are 3 temperatures, such as 60 ° C, 59 ° C, 58 ° C.

detailed description

The invention provides a target sequence enrichment method based on multiplex PCR amplification, the method comprising: Screening of capacitive multiplex PCR primers; first round of specific multiplex PCR amplification; second round of universal primer amplification and enrichment; recovery of products and sequencing on the machine to achieve the purpose of detection. Accordingly, the present invention provides a primer set for amplifying a plurality of target DNA sequences in a sample and a method of amplifying a plurality of target DNA sequences in the sample using the primer set.

In the present invention, the primers in the multiplex PCR primer set of the present invention preferably have the following characteristics:

1. Is specific, that is, in the multiplex PCR system, all primers in the same reaction system do not amplify other non-target sequences except the target sequence. The specific primer is designed by first performing a genome-wide sillco amplification analysis on any pair of primers, and comparing the predicted amplification product with the target amplification product if there is a non-target product in the predicted product. And the thermodynamic parameters between the non-target predicted products and the target products are similar, then the non-specific amplification of the primers is determined; if the thermodynamic parameters of the non-target predicted products and the target products are different, then it is considered that no Non-specific amplification. The criteria for determining the difference in thermodynamic parameters are: Tm (with target product) - Tm (with non-target product) ≥ 5 ° C, preferably Tm (with target product) - Tm (with non-target product) ≥ 10 ° C; in addition, different The thermodynamic calculation method and parameters have an influence on the calculation result, and the nearest neighbor method based on the SantaLucia 2007 thermodynamic parameter table is preferably used in the present invention;

2. No dimer production, that is, in the multiplex PCR system, stable dimers cannot be formed between all the primers in the same reaction system, and the criterion is: Tm (with target product)-Tm ( Dimer) ≥ 5 ° C, preferably Tm (with target product) - Tm (dimer) ≥ 10 ° C; in addition, different thermodynamic calculation methods and parameters will have an impact on the calculation results, preferably based on SantaLucia 2007 thermodynamics in the present invention The nearest neighbor method of the parameter table is calculated;

3. No hairpin structure is produced, that is, any primer in the multiplex PCR system does not form a stable hairpin structure itself, and the criterion is: Tm (with target product)-Tm (hairpin structure) ≥ 5 ° C, preferably Tm ( And the target product) -Tm (hairpin structure) ≥ 10 ° C; in addition, different thermodynamic calculation methods and parameters have an impact on the calculation results, in the present invention, the nearest neighbor method based on the Santa Lucia 2007 thermodynamic parameter table is preferably calculated;

4. There are consistent thermodynamic parameters, that is, in the multiplex PCR system, all primers in the same reaction system have the same or similar Tm values, preferably Tm standard deviation ≤ 5 ° C, more preferably Tm standard deviation ≤ 2 ° C, most Preferably, the standard deviation of Tm is ≤ 1 ° C;

5. The length of the amplified product is in the range of 100-300 bp, preferably 150-250 bp, and most preferably 180-220 bp;

6. A universal sequence with a different source than the genome is ligated to the 5' end of all primers.

In another embodiment of the invention, the method of increasing steric hindrance at the 3' end of the primer sequence comprises:

1. Adding a modification at the 3' end of the specific primer sequence that increases steric hindrance, which does not block its binding and extension to a template that exactly matches the specific primer sequence, but blocks It binds and extends to a template that does not exactly match the specific primer sequence, such as deoxygenated hypoxanthine (dI), deoxyuracil (dU), 5-Methyl dC, 2'-O-Me- dC, phosphate group, thio group, digoxin, biotin, Aminolinker C7, BHQ1, BHQ2, Dabcyl, JOE, ROX, FAM, TAMRA, alkyl group, fluoro group, amino group and Thiol- C3 SS. Among them, the modifying groups Aminolinker C7, BHQ1, BHQ2, Dabcyl, JOE, ROX, FAM, TAMR and Thiol-C3 S-S are shorthand for the name of the group and are recognized by the industry for primer synthesis.

2. Generally, the modification is added at the 3' end-2, -3 base of the specific primer sequence, preferably the modification is an increase at -1, -2, -3 bases;

3. When the GC content of the 5 bases at the 3' end of the specific primer sequence is greater than 50%, a modification such as a thio modification is added at the 3' base to the base of the specific sequence.

In the present invention, the 3' end-1, -2, and -3 positions mean that the 3' end is at the 1st, 2nd, and 3rd positions in the 5' number. And so on.

In the present invention, base modification is carried out using a group which does not block its binding and extension to a template which completely matches the specific primer sequence, but substantially blocks its incompleteness with the specific primer. Binding and extension of matched templates: deoxygenated hypoxanthine (dI), deoxyuracil (dU), 5-Methyl dC, 2'-O-Me-dC, phosphate groups, thio groups, digoxin, Biotin, Aminolinker C7, BHQ1, BHQ2, Dabcyl, JOE, ROX, FAM, TAMRA, alkyl group, fluoro group, amino group, Thiol-C3S-S, and the like. The modification is by chemical synthesis on a phosphodiester bond, a sugar group or a base, and some chemical groups are added in order to reduce the stability of base pairing. The addition of a chemical group on a phosphate bond or a glycosyl or base is known in the art. For example, the deoxyhypoxanthine (dI) is attached to the primer phosphodiester bond, the deoxyuracil (dU) is attached to the phosphodiester bond of the primer, and the methyl group is attached to the 5' of the primer deoxyribose cytosine. (5-Methyl dC), a methyl group attached to the 2' (2'-O-Me-dC) of deoxyribose cytosine, a phosphate group attached to the phosphodiester bond of the primer 3', a thio group Attached to the phosphodiester bond of primer 3', the digoxigenin group is attached to the phosphodiester bond of primer 3', the biotin group is attached to the phosphodiester bond of primer 3', and Aminolinker C7 is linked to primer 3 ' on the phosphodiester bond, BHQ1 is attached to the phosphodiester bond of primer 3', BHQ2 is attached to the 3' phosphodiester bond of the primer, Dabcyl is attached to the phosphodiester bond of the primer, and JOE is attached to primer 3 On the phosphodiester bond, ROX is attached to the phosphodiester bond of primer 3', FAM is attached to the phosphodiester bond of the primer, TAMRA is attached to the phosphodiester bond of primer 3', and the alkyl group is attached. To the 6' of the primer deoxyribose guanine, the fluoro group is attached to the 2' of the deoxyribose, and the amino group is attached to the primer The 2', thiol group of deoxyribose is attached to the 3' phosphodiester bond of the primer (Thiol-C3S-S).

In the present invention, the calculated T _m of the sequence is not held to a particular method, various methods of calculating the Tm value may be used in the present invention, the Tm value obtained by various methods not substantially reverse the effects of the present invention, but the effect of The degree will vary. Although the nearest neighbor method of the SantaLucia 2007 thermodynamic parameter table can calculate Tm, the Tm value calculated by other methods can correspond to it, and those skilled in the art can compare the Tm calculated by various methods through simple experiments, thereby The calculated Tm value is appropriately selected.

According to the experience of the inventors, for the human genome coding region, more than 99% of the target regions can be designed to be suitable for the primer sequences of the present invention, indicating that our previous filtration of the primer set is reasonable.

In the invention, the term "sample" is used in its broadest sense and is intended to include a sample or culture obtained from any source, preferably from a biological source. Biological samples are available from animals, including humans, and include liquids, solids, tissues, and gases. Biological samples include blood products such as plasma, serum, and the like. Thus, a "nucleic acid sample" comprises nucleic acids of any origin (eg, DNA, RNA, cDNA, mRNA, tRNA, miRNA, etc.). In the case where the nucleic acid sample is RNA or mRNA, there is a step of reverse transcription of the RNA or mRNA into DNA prior to step c). In the present application, the nucleic acid sample is preferably derived from a biological source, such as a human or non-human cell, tissue, and the like. The term "non-human" refers to all non-human animals and entities including, but not limited to, vertebrates such as rodents, non-human primates, sheep, cattle, ruminants, rabbits, pigs, goats, horses, dogs, Cats, birds, etc. Non-humans also include invertebrates and prokaryotes, such as bacteria, plants, yeast, viruses, and the like. Thus, nucleic acid samples for use in the methods and systems of the invention are nucleic acid samples derived from any organism, whether eukaryotic or prokaryotic.

In certain embodiments, the hybridization between the primer and the target nucleic acid is carried out under preferably stringent conditions sufficient to support hybridization between the nucleic acids, wherein the nucleic acid comprises a linking compound and the target nucleic acid sample A complementary region to provide the nucleic acid hybridization complex. The complex is then captured by the linker compound and washed under conditions sufficient to remove the non-atopic binding nucleic acid, and the hybridized target nucleic acid sequence is then eluted from the captured nucleic acid complex.

In certain embodiments, the nucleic acid comprises a chemical group or a linking compound, such as a binding moiety such as biotin, digoxin, or the like, which is capable of binding to a solid support. The solid support may comprise a corresponding capture compound, such as streptavidin for biotin or a digoxin antibody for digoxin. The invention is not limited to the linking compounds used, and alternative linking compounds are equally suitable for use in the methods, bait sequences and kits of the invention.

In an embodiment of the invention, the plurality of target nucleic acid molecules preferably comprise a whole genome of an organism or at least one chromosome or a nucleic acid molecule of any size. Preferably, the nucleic acid molecule is at least about 200 kb in size, at least about 500 kb, at least about 1 Mb, at least about 2 Mb, or at least about 5 Mb, more preferably from about 100 kb to about 5 Mb, from about 200 kb to about 5 Mb, from about 500 kb to about 5 Mb. From about 1 Mb to about 2 Mb or from about 2 Mb to about 5 Mb.

In certain embodiments, the target nucleic acid is from an animal, plant or microorganism, and in a preferred embodiment, the target nucleic acid molecule is selected from a human. If the amount of nucleic acid sample is relatively small (e.g., a human nucleic acid sample obtained in some cases, such as the genome of a developing fetus), the nucleic acid can be amplified prior to performing the methods of the invention, such as by whole genome amplification. Pre-amplification may be necessary for performing the methods of the invention, such as in forensic applications (e.g., for use in genetics for forensic purposes).

In certain embodiments, the plurality of target nucleic acid molecules are a set of genomic DNA molecules. The bait sequence may be selected, for example, from a plurality of decoy sequences defining a plurality of exons, introns or regulatory sequences from a plurality of genetic loci; a plurality of decoy sequences defining a full sequence of at least one individual genetic locus, Said locus is of any size, preferably at least 1 Mb, or at least one of the above specified sizes; a plurality of decoy sequences defining a single nucleotide polymorphism (SNP); or a plurality of bait sequences defining an array, for example designed as A chimeric array of full sequences of at least one complete chromosome is captured.

As used herein, the term "hybridization" refers to the pairing of complementary nucleic acids. Hybridization and hybridization strength (eg, the strength of binding between nucleic acids) are affected by a number of factors, such as the degree of complementarity between nucleic acids, the stringency of hybridization conditions used, the melting temperature (Tm) of the formed hybrid, and the GC of the nucleic acid. Content value. Although the invention is not limited to specific hybridization conditions, it is preferred to use stringent hybridization conditions. Stringent hybridization conditions depend on the sequence and vary with hybridization parameters (eg, salt concentration, presence of organics, etc.). Generally, "stringent" conditions are selected to be from about 5 ° C to about 20 ° C below the Tm of the particular nucleic acid sequence at the specified ionic strength and pH. Preferably, stringent conditions are from about 5 ° C to 10 ° C below the temperature melting point of the particular nucleic acid to which the complementary nucleic acid is bound. The Tm is the temperature (under defined ionic strength and pH) at which 50% of the nucleic acid (eg, the target nucleic acid) hybridizes to the fully matched probe.

As used herein, "stringent conditions" may, for example, be 50% formamide, 5 x SSC (0.75 M NaCl, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5 x Denhardt solution, sonicated sperm DNA (50 mg/ml), 0.1% SDS, and 10% dextran sulfate hybridized at 42 ° C at 0.2 ° SSC (sodium chloride / sodium citrate) and at 42 ° C Wash at 50 °C with 50% formamide and then at 55 °C with 0.1 x SSC containing EDTA. For example, buffers containing 35% formamide, 5 x SSC, and 0.1% (w/v) sodium dodecyl sulfate (SDS) are expected to be suitable for hybridization at 45 ° C for 16-72 hours under moderately non-stringent conditions.

As used herein, the term "primer" refers to an oligonucleotide, whether purified, cleaved or produced synthetically, under conditions which induce the synthesis of a primer extension product complementary to a nucleic acid strand. (for example in the presence of nucleotides and inducing agents such as DNA polymerase, and at suitable temperatures and pH), can serve as a starting point for synthesis. The primer is preferably a single strand having the greatest amplification efficiency. Preferably, the primer is an oligodeoxynucleotide. The primer must be sufficiently long to initiate synthesis of the extension product in the presence of the inducing agent. The exact length of the primer depends on many factors including temperature, source of the primer and the method used.

As used herein, the term "probe sequence" refers to an oligonucleotide (eg, a nucleotide sequence), whether produced in nature, purified, cleaved, or produced by synthetic, recombinant, or PCR amplification, capable of A target oligonucleotide, such as at least a portion of a target nucleic acid sequence, hybridizes. The probe can be single stranded or double stranded. Probes can be used for the detection, identification and isolation of specific gene sequences.

As used herein, the term "target nucleic acid molecule" refers to a molecule or sequence from a region of a target genomic region. The preselected probe determines the extent of the target nucleic acid molecule. Thus, the "target" attempts to distinguish it from other nucleic acid sequences. A "fragment" is defined as a nucleic acid region in the sequence of interest, such as a "fragment" or a "portion" of a nucleic acid sequence.

As used herein, the term "isolated" when used in reference to a nucleic acid, such as when used in "isolated nucleic acid", refers to the identification and isolation of a nucleic acid sequence from at least one other component or contaminant to which it is normally associated. . An isolated nucleic acid exists in a form different from its natural presence. In contrast, nucleic acids of unseparated nucleic acids such as DNA and RNA exist in their naturally occurring state. The isolated nucleic acid, oligonucleotide or polynucleotide may exist in a single stranded form or in a double stranded form.

In an embodiment of the invention, the primers for use in the methods, primer sets and kits described herein comprise a linking compound, such as a binding moiety. The binding moiety comprises any portion that joins or introduces the 5&apos; end of the amplification primer for subsequent capture of the nucleic acid amplification product. The binding moiety is any sequence that introduces the 5' end of the primer sequence, such as a captureable 6 histidine (6HIS) sequence. For example, a primer comprising a 6HIS sequence can be captured by nickel, such as in a nickel coated or tube containing nickel coated beads, granules, or the like, in a microwell, or in a purification column, wherein the beads are packed into a column and the sample is loaded and The column is passed through to capture complexes with reduced complexity (eg, and subsequent target elution). An example of another binding moiety for use in embodiments of the invention includes a hapten, such as digoxin, for example, which is ligated to the 5&apos; end of the amplification primer. Digoxin can be captured using a digoxin antibody, such as a substrate coated or containing an anti-digoxigenin antibody.

In certain embodiments, the binding moiety is biotin, and the capture matrix, such as beads, such as paramagnetic particles, is coated with streptavidin for isolating the amplification product from a non-specific hybridization target nucleic acid. . For example, when biotin is a binding moiety, a streptavidin (SA) coated matrix, such as SA coated beads (eg, magnetic beads/particles), is used to capture the biotinylated amplification product. The SA-bound complex is washed, and the hybridized target nucleic acid is eluted from the amplification product for sequencing.

Primer sequences corresponding to at least one region of the genome in the sequence can be provided in parallel on a solid support using a maskless array synthesis technique. Alternatively, the primer sequence can be obtained continuously and applied to the solid support using a standard DNA synthesizer, or can be obtained from an organism and fixed to the solid support. After amplification, the non-amplified product nucleic acid is separated from the vector-bound amplification product by washing. Elution from the solid support, for example, in hot water or in a nucleic acid elution buffer comprising, for example, TRIS buffer and/or EDTA, to produce an eluate enriched for the target nucleic acid molecule.

Alternatively, primer sequences for the target molecule can be synthesized on a solid support as described above, released and amplified from the solid support as a set of primer sequences. The set of primers released can be fixed to the carrier, such as glass, metal, ceramic, or polymeric beads or other solid support, either covalently or non-covalently. The primer may be designed to be conveniently released from the solid support, for example to provide an acid or base labile nucleic acid sequence at or near the end of the nucleic acid analog closest to the vector, which releases the primer under low or high pH conditions, respectively. . A variety of cleavable linking compounds are known in the art. The carrier can be provided, for example, in a cylinder having a liquid inlet and an outlet. A method of immobilizing a nucleic acid to a vector is known in the art, for example by binding a biotin-labeled nucleotide to the primer and coating the vector with streptavidin, whereby the coated vector is not The primers in the collection are covalently attracted and immobilized. The sample is passed through the primer-containing vector under hybridization conditions, whereby the amplified target nucleic acid molecule that hybridizes to the immobilized vector can be eluted for later analysis or other use.

Example 1: Exemplary Steps of the Method of the Invention

A method of amplifying a plurality of target DNA sequences in a sample comprises the steps of:

1) providing a sample comprising a target DNA sequence and a non-target sequence, a specific primer set of the present invention, and a universal primer pair complementary to a universal sequence at the 5' end of the specific primer;

2) performing a first round of multiplex PCR reaction with a specific primer in the primer set to amplify a target DNA sequence in the sample, and the annealing temperature of the PCR reaction is performed in a step from high to low, in the present embodiment In an example, an annealing process is performed using three equal temperatures (for example, 60 ° C, 59 ° C, and 58 ° C), and the number of amplification cycles is less than 10,

The first round of multiplex PCR reaction amplifies a plurality of target region DNA sequences in such a manner that in the round of PCR reaction, multiple pairs of specific primers are simultaneously placed in the same reaction system to simultaneously amplify a plurality of target region sequences, wherein all upstream primers The 3' end contains a specific sequence complementary to the sequence of the target region, and the 5' end contains the universal sequence 1 (GSP1: CTTTCCCTACACGACgctcttccgatct (SEQ ID NO. 1)); the 3' end of all downstream primers contains a specific sequence complementary to the target region sequence. Sequence, the 5' end contains the universal sequence 2 (GSP2: GGAGTTCAGACGTGTgctcttccgatct (SEQ ID NO. 2)), and the base of the 3' end of the upstream and downstream primers has 3 or 4 group modifications, which increases the specificity of amplification; In this round of multiplex PCR reactions, the components of the reaction system are as follows: ddH ₂ O, PCR reaction buffer, substrate (dNTP), multiplex PCR primer mix, sample genomic DNA or cDNA, and high fidelity polymerase.

The current multiplex PCR reaction step includes the following three steps: first step pre-denaturation: 95 ° C for 3.5 min; second step amplification: denaturation step is maintained at 96-98 ° C for 20 s, gradient annealing is maintained at 66 ° C for 1 min, at Maintaining at 65 °C for 1 min and at 64 °C for 1 min, the extension step is maintained at 72 °C for 30 s, and the second step of amplification is amplified for 10-22 cycles according to the amount of template input. The annealing time is based on the number of amplification target sequences. Corresponding changes; the third step of amplification is extended at 72 ° C for 5 min. In this round of multiplex PCR reaction, gradient annealing is used to enable each pair of primers to efficiently and complementarily bind to the template, thereby improving the amplification efficiency, as in the present example. Annealing is performed using an equal temperature of three temperatures (e.g., 60 ° C, 59 ° C, 58 ° C) in one annealing process. After the current round of multiplex PCR reaction, a double-stranded PCR product of multiple target region sequences was obtained. The 5' end of the double stranded PCR product comprises universal sequence 1 (GSP1) and the 3' end includes universal sequence 2 (GSP2).

The double-stranded PCR product is digested with a nuclease such as Exonuclease VII, Exonuclease I, Mung Bean Nuclease, T7 Endonuclease I, Nuclease BAL-31, Nuclease P1, Nuclease S1, Mung Bean Nuclease, and the like.

The products of the first round of multiplex PCR reaction were screened and purified by Agencourt AMPure magnetic beads to remove large fragments, genomic DNA, primer dimers, primers and other reaction components outside the target region, and the sequence containing the target region was obtained. Double-stranded PCR product;

3) performing a second round of PCR amplification reaction with a universal primer, re-amplifying the double-stranded PCR amplification product obtained in the first round of multiplex PCR reaction, and further enriching the amplification product of double-stranded PCR;

In the reaction system of the second round of PCR amplification reaction, the double-stranded PCR product including the target region sequence purified in the first round of multiplex PCR reaction is used as a template, and the universal primer FGSP1 (AATGATACGGCGACCACCGAGATCTacactctttccctacacgac, SEQ ID NO. 3 PCR amplification with RGSP2 (CAAGCAGAAGACGGCATACGAGAT******gtgactggagttcagacgtgt, SEQ ID NO. 4), wherein the 3' end of FGSP1 is universal sequence 1 (GSP1) and the 5th end is universal sequence 3 (AATGATACGGCGACCACCGAGATCT, SEQ ID NO .5); the 3' end of RGSP2 is universal sequence 2 (GSP2), the 5' end is universal sequence 4 (CAAGCAGAAGACGGCATACGAGAT, SEQ ID NO. 6), and the middle 6 "*" represent Index sequence, which is used to distinguish different samples. . The design principle of the Index sequence is length 6, between two Make sure there are at least two base differences. After the second round of PCR reaction, the 5' end of the amplified target region sequence product is the universal primer sequence FGSP1, and the 3' end is the universal primer sequence RGSP2.

The PCR product of the second round of PCR reaction was purified by Agencourt AMPure magnetic beads to remove other components, and the target region sequence product containing the universal primer sequence FGSP1 and the universal primer sequence RGSP2 was obtained;

4) Recovering the sequence product of the target region enriched in the previous step and performing sequencing on the machine.

Example 2

The inventors randomly selected 1000 sites on the exon and intron of the human genome for testing the method of the present invention, and the experimental procedure was carried out in accordance with the method of Example 1.

Table 1: Chromosome distribution of randomly selected 1000 loci

chromosome	Number	chromosome	Number
Chr1	75	Chr12	65
Chr2	40	Chr13	20
Chr3	60	Chr14	10
Chr4	105	Chr15	25
Chr5	55	Chr16	35
Chr6	65	Chr17	40
Chr7	30	Chr18	10
Chr8	65	Chr19	25
Chr9	30	Chr20	35
Chr10	65	Chr21	15
Chr11	100	Chr22	30

In the present embodiment, Tm is calculated based on the nearest neighbor method of the SantaLucia 2007 thermodynamic parameter table. The following is a brief description of primer design.

(1) The length of the amplified product is randomly selected within the range of 100-300 bp, and the PCR primers are divided into multiple groups. In each group, 2 °C < Tm standard deviation ≤ 5 ° C, 1 ° C < Tm standard deviation ≤ 2 ° C, Tm standard deviation ≤ 1 ° C; another control group, did not consider the Tm standard deviation, there is a Tm standard deviation > 5 ° C in the group;

(2) Select some primers (other primers can be used as a control), add modification on the base, ribose or phosphodiester bond at the 3' end-1, -2, -3 of the sequence, deoxygenated hypoxanthine (dI) , deoxyuracil (dU), 5-Methyl dC, 2'-O-Me-dC, phosphate group, thio group, digoxin, biotin, Aminolinker C7, BHQ1, BHQ2, Dabcyl, JOE, ROX, FAM, TAMRA, alkyl group, fluoro group, amino group and Thiol-C3S-S;

(3) When the GC content of the 5 bases at the 3' end of the primer sequence is greater than 50%, select a part of the primers (other primers as a control) to increase the base at the 3' end-4 of the sequence to the deoxyribose cytosine. 5' methyl group modification (5-Methyl dC), 3' end-4 base attachment increased to phosphodiester bond thio-modified group, 3' end-4 increased attachment to deoxyribose 2 'The fluoro-modified group, 3' end-4 increases the deoxygenated hypoxanthine (dI) modifying group attached to the phosphodiester bond or the 3' end-4 increases the deoxygenation attached to the phosphodiester bond A uracil (dU) modifying group.

Among them, the group modification at these positions is synthesized by a primer synthesis company by organic chemical means.

In addition, all primers are also grouped as follows:

(1) Tm (with target product) - Tm (with non-target product) ≤ 5 ° C, 5 ° C < Tm (with target production -Tm (with non-target product) ≤ 10 ° C; Tm (with target product) - Tm (with non-target product) > 10 ° C;

(2) Tm (with target product) - Tm (dimer) ≤ 5 ° C, 5 ° C < Tm (with target product) - Tm (dimer) ≤ 10 ° C, Tm (with target product) - Tm (two Polymer) > 10 ° C;

(3) Tm (with target product) - Tm (hairpin structure) ≤ 5 ° C, 5 ° C < Tm (with target product) - Tm (hairpin structure) ≤ 10 ° C; Tm (with target product) - Tm (hairpin structure) >10 °C.

The test results are measured by the capture efficiency and the coverage under 100× coverage. The test results are given in the form of graphs, which can be seen from these data charts:

1) The smaller the Tm standard deviation, the higher the capture efficiency and coverage, but in order to achieve good capture efficiency and 100× coverage while ensuring the design space of the primer, the Tm standard deviation is preferably ≤ 2 ° C;

2) The capture efficiency and coverage of most 3' primers were higher than those of the unmodified control group;

3) When the GC content of the 5 bases at the 3' end of the primer sequence is greater than 50%, the capture efficiency and coverage of the base thio modification at the 3' end-4 of the primer sequence is higher than that of the unmodified control group;

4) The larger the difference between Tm (target product) and Tm (non-target product), the higher the capture efficiency and coverage, and the good capture efficiency can be achieved by Tm (target product)-Tm (non-target product) >10 °C. And 100× coverage;

5) The larger the difference between Tm (target product) and Tm (dimer), the higher the capture efficiency and coverage, and the good capture efficiency can be achieved by Tm (target product)-Tm (dimer) >10 °C. And 100× coverage;

6) The larger the difference between Tm (target product) and Tm (issuing structure), the higher the capture efficiency and coverage, and the good capture efficiency can be achieved by Tm (target product)-Tm (issue structure) > 5 °C. 100× coverage, while ensuring more than >10 °C candidate primers can be selected.

Preferably, Tm (target product)-Tm (non-target product) > 10 ° C, Tm (target product) - Tm (dimer) > 10 ° C, Tm (target product) - Tm (hairpin structure) > 5 ° C.

Among them, the control refers to a normal primer without any modification, and is used for comparison with the data of the corresponding test group.

The results are as follows:

Table 2. Effect of Tm standard deviation on the test results in the group

Primer characteristics	Capture efficiency	100x coverage
Tm standard deviation ≤ 1 ° C	80.01%	84.37%
1 °C <Tm standard deviation ≤ 2 ° C	76.34%	78.80%
2°C<Tm standard deviation ≤5°C	71.24%	72.02%
Tm standard deviation > 5 ° C	60.27%	64.99%

Table 3. Effect of base modification at the 3' end-1, -2, -3 of the primer sequence on the detection results

Primer characteristics	Capture efficiency	100× coverage
AminolinkerC7	93.25	100%
Deoxyuracil (dU)	91.32%	100%
5-Methyl dC	87.23%	95.2%
2'-O-Me-dC	79.98%	92.7%
Thio group	83.62%	92.71%
Phosphate group	85.66%	93.37%
Amino group	93.41%	100%
Deoxygenated hypoxanthine (dI)	95.87%	100%
BHQ1	94.31%	100%
Biotin	70.21%	74.94%
Digoxin	60.07%	64.18%

BHQ2	95.26%	100%
Dabcyl	93.63%	99.11%
FAM	88.34%	93.34%
JOE	86.73%	89.14%
ROX	82.62%	88.25%
TAMRA	83.41%	87.27%
Alkyl group	96.66%	100%
Fluoro group	85.26%	87.31%
Thiol-C3S-S	92.21%	100%
Control (normal primer)	78.05%	83.36%

Table 4. Effect of base thio modification at the 3' end-4 of the primer sequence on the detection results when the GC content of the 5 bases at the 3' end of the primer sequence is greater than 50%

Primer characteristics	Capture efficiency	100× coverage
Fluorinated group at the 3' end-4	93.10%	100%
3' end-4 methyl modification	89.23%	98.87%
3' end-4 base thio	82.77%	91.15%
3' end-4 deoxyuracil (dU)	90.92%	99.57%
3' end-4 deoxygenated hypoxanthine (dI)	94.03%	99.91%
Control (normal primer)	79.21%	84.09%

Table 5. Effect of primer specificity on test results

Primer characteristics	Capture efficiency	100× coverage
Tm (target product)-Tm (non-target product) ≤ 5 ° C	62.35%	67.03%
5 ° C < Tm (target product) - Tm (non-target product) ≤ 10 ° C	70.01%	73.45%
Tm (target product) - Tm (non-target product) > 10 ° C	78.84%	82.47%

Table 6. Effect of primer dimer on test results

Primer characteristics	Capture efficiency	100× coverage
Tm (target product)-Tm (dimer) ≤ 5 ° C	45.21%	50.74%
5 ° C < Tm (target product) - Tm (dimer) ≤ 10 ° C	61.27%	68.17%
Tm (target product)-Tm (dimer) > 10 ° C	78.64%	83.55%

Table 7. Effect of primer hairpin structure on test results

Primer characteristics	Capture efficiency	100× coverage
Tm (target product)-Tm (issuing structure) ≤ 5 ° C	64.28%	68.36%
5 ° C < Tm (target product) - Tm (hairpin structure) ≤ 10 ° C	75.09%	80.94%
Tm (target product) - Tm (issuing structure) > 10 ° C	79.98%	83.49%

Claims (10)

1. A primer set for amplifying a plurality of target DNA sequences in a sample, the primer set comprising a plurality of pairs of upstream and downstream specific primers for each target DNA sequence, wherein:

   a) Each pair of the upstream and downstream specific primers includes a specific sequence for the target sequence, and the following conditions are satisfied between all the specific sequences: (1) each of the specific sequence does not expand beyond the target sequence (2) no dimer is formed between the specific sequences; (3) the specific sequence does not form a hairpin structure;

   b) a universal sequence linked to a different source of the genome at the 5' end of the specific sequence;

   c) a modification that increases steric hindrance at the base 3' end of the specific sequence, the modification does not block the binding and extension of the template that exactly matches the specific sequence, but substantially blocks it Combination and extension of templates that do not exactly match.
2. The primer set of claim 1, wherein the specific sequence satisfies the following conditions: (1) the specific sequence and the Tm of the target region - and the non-target region have a Tm ≥ 5 ° C, preferably ≥ 10 ° C; (2) The specific sequence and the Tm of the target region - forming a dimer with other specific sequences with a Tm ≥ 5 ° C, preferably ≥ 10 ° C; (3) the specific sequence and the Tm of the target region - forming a Tk of the hairpin structure ≥ 5 ° C, preferably ≥ 10 ° C, the preferred Tm value is calculated based on the nearest neighbor method of the Santa Lucia 2007 thermodynamic parameter table.
3. The primer set of claim 1, wherein the modification of increasing steric hindrance is selected from the group consisting of: deoxyhypoxanthine (dI), deoxyuracil (dU), 5-Methyl dC, 2'-O-Me-dC, and a phosphate group. , thio group, digoxin, biotin, Aminolinker C7, BHQ1, BHQ2, Dabcyl, JOE, ROX, FAM, TAMRA, alkyl group, fluoro group, amino group and Thiol-C3S-S.
4. The primer set of claim 1 or 3, wherein the modification of the steric hindrance at the base of the 3' end comprises a modification at the 3' end-1, -2, -3 base, ribose or phosphodiester bond.
5. The primer set according to any one of claims 1 to 4, wherein the 5 base of the specific sequence has a GC content of more than 50%, and the base sequence has an increase at the 3' end to the base of the specific sequence. Modification of steric hindrance, such as fluoro modification, methyl modification, deoxyuracil (dU), thio modification, deoxyhypoxanthine (dI), amino modification, and the like.
6. The primer set according to any one of claims 1 to 5, wherein the specific primer sequence has a uniform thermodynamic parameter, preferably a Tm standard deviation ≤ 5 ° C; more preferably a Tm standard deviation ≤ 2 ° C; most preferably a Tm standard deviation ≤ 1 ° C.
7. A method of amplifying a plurality of target DNA sequences in a sample, including

   a) providing a sample comprising a DNA sequence of interest and a non-target sequence, a primer set according to any of the preceding claims, and a universal primer pair complementary to a universal sequence at the 5' end of said specific primer;

   b) performing a multiplex PCR reaction with a specific primer in the primer set to amplify a plurality of target DNA sequences in the sample, and the annealing temperature of the multiplex PCR reaction is performed in steps from high to low, for example, in one Annealing using multiple temperatures of equal difference during annealing;

   c) amplifying the amplification product in step b) with the universal primer pair to further enrich the amplification product.
8. The method of claim 7, further comprising the step b') of recovering the amplified product enriched in step b).
9. The method of claim 8, wherein the recovering is by using a magnetic bead to perform fragment screening and purification on the first round of PCR reaction products, and removing large fragments, genomic DNA, primer dimers, primers and other reaction components outside the target region. PCR product of the sequence of the target region.
10. The method of any one of claims 7-9, further comprising the step of d) sequencing the amplified product obtained in step c).