AU2016102399A4

AU2016102399A4 - Primer set for amplifying multiple target DNA sequences in sample and use thereof

Info

Publication number: AU2016102399A4
Application number: AU2016102399A
Authority: AU
Inventors: Wanshi CAI; Xingyi HANG; Wubin QU; Jianming YI
Original assignee: Igenetech Biotech Beijing Co Ltd
Current assignee: Igenetech Biotech (beijing) Co Ltd
Priority date: 2016-05-06
Filing date: 2016-11-21
Publication date: 2019-05-16
Anticipated expiration: 2024-11-21
Also published as: CN107446995A; CN107446995B; AU2016405379A1; WO2017190487A1; CN105925678B; CN105925678A

Abstract

The present disclosure provides a primer set for amplifying multiple target DNA sequences in a sample and a method for amplifying multiple target DNA sequences in a sample with said primer set, the primer set comprises a number of pairs of upstream and downstream specific primers for each target DNA sequence, each pair of the upstream and downstream specific primers comprises a specific sequence for target sequence, and the specific sequence shall satisfy the following requirements: (1) each of the specific sequences does not amplify a sequence outside the target sequence, (2) the specific sequences do not form a dimer, and (3) the specific sequences do not form a hairpin structure, the specific sequence at its 5' terminal is linked to a universal sequence being no homologous to the genome; the specific sequence at its 3' terminal comprises on the base modification for increasing steric hindrance, and said modification does not block the binding of the specific sequence to the template perfectly matching the specific sequence and the extension, but substantially blocks the binding of the specific sequence to the template imperfectly matching the specific sequence and the extension.

Description

PRIMER SET FOR AMPLIFYING MULTIPLE TARGET DNA

SEQUENCES IN A SAMPLE AND THE USE THEREOF

TECHNICAL FIELD

The present disclosure relates to capture, enrichment and analysis of a nucleic acid sequence. In particular, the present disclosure relates to a multiple PCR-based method for enriching a target sequence.

BACKGROUND

Mutation, insertion, deletion and structural variation can be found out through whole genome sequencing at a whole genomic level. However, sequencing at 30 x will produce a data size approaching 100 G due to enormous genomic capacity. For the low mutation frequency sequencing for tumors etc., the coverage of at least 1000 * is needed, and if the whole genome sequencing is performed, a data size of 3000 G will be generated. The data size at such a scale will not only render the data analysis extremely difficult, but also significantly increase the sequencing cost, which in turn limits the use of sequencing. To solve this difficulty, the target region capture technology emerges.

The target region capture technology involves directionally capturing the nucleic sequence of a target region and then preparing a library for sequencing, so as to achieve the purpose of deep sequencing of the target region while greatly reducing sequencing cost. PCR is a common technique for enriching a target region, and what is more common is to capture multiple target regions at once by the multiple PCR technique. The multiple PCR technique is suitable for capturing a hot spot region or a target region of short length. Two major factors limiting the application of the multiple PCR technique is non-specific amplification and dimer formation.

Thus, there is a need for the multiple PCR technique capable of effectively reducing non-specific amplification and dimer formation.

SUMMARY OF THE INVENTION

The present disclosure provides a multiple PCR amplification-based method for enriching a target sequence, comprising screening compatible multiple PCR primers,

2016102399 21 Nov 2016 performing a first round of specific multiple PCR amplification, performing a second round of amplification with universal primers for enrichment, and recovering and sequencing the products.

Thus, in a first aspect, the present disclosure provides a primer set for amplifying multiple target DNA sequences in a sample, said primer set comprising a number of pairs of upstream and downstream specific primers for each of the target DNA sequences, wherein:

a) each pair of the upstream and downstream specific primers comprise a specific sequence for a target sequence, and all of the specific sequences satisfy the following requirements: (1) each of the specific sequences does not amplify a sequence outside the target sequence, (2) the specific sequences do not form a dimer between each other, and (3) the specific sequences do not form a hairpin structure;

b) the specific sequence at its 5’ terminal is linked to a universal sequence not homologous to the genome; and

c) the specific sequence at its 3’ terminal comprises modification for increasing steric hindrance on the base(s), and said modification does not block binding of the specific sequence to the perfectly matching template and the extension, but substantially blocks binding of the specific sequence to an imperfectly matching template and the extension.

In a particular embodiment, the specific sequences satisfy the following requirements between each other: (1) Tm between a specific sequence and the target region minus Tm between the specific sequence and a non-target region is equal to or greater than 5°C, preferably equal to or greater than 10°Q (2) Tm between a specific sequence and the target region minus Tm of the dimer formed by one specific sequence with another specific sequence is equal to or greater than 5 °C, preferably equal to or greater than 10°Q and (3) Tm between a specific sequence and the target region minus Tm of the hairpin formed in the specific sequence is equal to or greater than 5°C, preferably equal to or greater than 10°Q preferably, the Tm values are calculated with Nearest-Neighbor method based on the table of thermodynamic parameters suggested by SantaLucia 2007.

2016102399 21 Nov 2016

In the present disclosure, the modification at 3’ terminal base of the specific sequences includes those on the base(s), ribose(s) or phosphodiester bond(s) at positions - and -3 of 3’ terminal of the specific sequence; and in preferred embodiments, the five bases at 3’ terminal of the specific sequence have a GC content of greater than 50%, that is, three or more bases are C or G. The modification at 3’ terminal base of the specific sequences further includes those on the base, ribose or phosphodiester bond at position -4 of 3’ terminal of the specific sequence. That is, in preferred embodiments, the five bases at 3’ terminal of the specific sequence have a GC content of greater than 50%, i.e., three or more bases are C or G. The modification at 3’ terminal base of the specific sequence further includes those on the base(s), ribose(s) or phosphodiester bond(s) at positions -2, - and -4 of 3’ terminal of the specific sequence.

In a particular embodiment, the modification for increasing steric hindrance is selected from the group consisting of deoxyinosine (di), deoxyuracil (dU), 5-Methyl dC, 2'-O-Me-dC, phosphate group, thio group, digoxin, biotin, AminolinkerC7, BHQ1, BHQ2, Dabcyl, JOE, ROX, FAM, TAMRA, alkyl group, fluoro group, amino group and Thiol-C3S-S.

In a particular embodiment, the modification for increasing steric hindrance at 3’ terminal base includes thio modifications on the bases at positions -1,-2 and -3 at 3’ terminal base.

In a particular embodiment, the five bases at 3’ terminal of a specific sequence have a GC content of greater than 50%, and the specific sequence has thio modification on the base at position -4 at its 3 ’ terminal.

In a particular embodiment, the specific primer sequences have unified thermodynamic parameters, preferably the Tm standard deviation is equal to or less than 5°Q more preferably the Tm standard deviation is equal to or less than 2°Q and most preferably the Tm standard deviation is equal to or less than 1°C By Tm standard deviation means the standard deviation of Tms between all the specific primer sequences and the corresponding target DNA sequences.

In a second aspect, the present disclosure provides a method for amplifying multiple target DNA sequences in a sample, said method comprising:

2016102399 21 Nov 2016

a) providing a sample comprising target DNA sequences and non-target sequences, the primer set according to the first aspect of the present disclosure, and a pair of universal primers complementary to the universal sequences at 5’ terminal of the specific primers of the primer set;

b) performing a PCR reaction with the specific primers of the primer set to amplify the target DNA sequences in the sample, wherein the PCR reaction is gradiently annealed at high-to-low temperatures, for example, at three temperatures with an equal interval, such as 60°C, 59°Cand 58°C, during a single annealing process; and

c) further amplifying the amplified product in step b) with the universal primer pair to further enrich the amplified product.

In a particular embodiment, the method further comprises step d) of sequencing the amplified product obtained in step c).

In a particular embodiment, the method further comprises step b’) of recovering the amplified product enriched in step b).

In a particular embodiment, the recovering is performed by screening and purifying fragments from the first PCR reaction product with magnetic beads to remove large fragments outside the target regions, genomic DNA, primer dimers, primers and other reaction components, thereby obtaining the PCR product of the target region sequences.

In a particular embodiment, there are three annealing temperatures, for example, 60°C, 59°Cand 58°C

DETAILED DESCRIPTION OF THE INVENTION

The present disclosure provides a multiple PCR amplification-based method for enriching target sequences, comprising the steps of screening compatible multiple PCR primers, performing the first round of specific multiple PCR amplification, performing the second round of amplification for enrichment with universal primers, and recovering and sequencing the products, so as to achieve the purpose of detection. Therefore, the

2016102399 21 Nov 2016 present disclosure provides a primer set for amplifying multiple target DNA sequences in a sample and a method of amplifying multiple target DNA sequences in a sample with the primer set.

In the present disclosure, the primers of the multiple PCR primer set of the present disclosure preferably possess the following characteristics:

1. The primers have specificity. That is, in this multiple PCR system, all primers in the same reaction system do not amplify another non-target sequence other than the target sequences. The design approach for the primers with specificity is as follows: conducting whole genomic in sillco amplification and analysis with any one pair of primers firstly, and then comparing the predicted amplification product with the target amplification product, where the predicted product comprises non-target products, if the non-target products have thermodynamic parameters similar to those of the target products, it is determined that this pair of primers involve non-specific amplification; and if the non-target products have thermodynamic parameters relatively much different from those of the target products, it is determined that no non-specific amplification occurs. The criteria for determining the difference of thermodynamic parameters is as follows: Tm (between the specific sequence and the target product) Tm (between the specific sequence and a non-target product) >5°C, preferably Tm (between the specific sequence and the target product) - Tm (between the specific sequence and a non-target product) >10°C In addition, different thermodynamic calculation methods and parameters may affect the calculation results, and NearestNeighbor method based on the table of thermodynamic parameters suggested by SantaLucia 2007 is preferred in the present disclosure.

2. No dimer is formed. That is, in this multiple PCR system, all primers in the same reaction system cannot form stable dimers between each other. The criteria for determination is as follows: Tm (between the specific sequence and the target product) -Tm ( a dimer) >5°C, preferably Tm (between the specific sequence and the target product) -Tm (a dimer) >10°C In addition, different thermodynamic calculation methods and parameters may affect the calculation results, and Nearest-Neighbor method based on the table of thermodynamic parameters suggested by SantaLucia 2007 is preferred in the present disclosure.

2016102399 21 Nov 2016

3. No hairpin structure is formed. That is, in this multiple PCR system, any primers per se do not form stable hairpin structure. The criteria for determination is as follows: Tm (between the specific sequence and the target product) -Tm (a hairpin structure) >5°C, preferably Tm ( between the specific sequence and the target product) -Tm (a hairpin structure) >10°C In addition, different thermodynamic calculation methods and parameters affect the calculation results, and NearestNeighbor method based on the table of thermodynamic parameters suggested by SantaLucia 2007 is preferred in the present disclosure.

4. The primers have unified thermodynamic parameters. That is, in this multiple PCR system, all primers in the same reaction system have the same or similar Tm values, preferably with a Tm standard deviation equal to or less than 5 °C, more preferably with a Tm standard deviation equal to or less than 2°C, and most preferably with a Tm standard deviation equal to or less than 1°C

5. The amplification product has a length in the range of 100-300 bp, preferably 150-250 bp, and most preferably 180-220 bp.

6. All the primers are linked at 5’ terminal to universal sequences that are not homologous to the genome.

In another embodiment of the disclosure, the method of increasing steric hindrance at 3’ terminal of the primer sequence comprises the following steps:

1. A modification capable of increasing steric hindrance is introduced to the specific primer sequence at 3’ terminal. The modification does not block the binding of the specific sequence to the perfectly matching template and the extension, but substantially blocks the binding of the specific sequence to an imperfectly matching template and the extension. The exemplified modifications include deoxyinosine (di), deoxyuracil (dU), 5-Methyl dC, 2'-O-Me-dC, phosphate group, thio group, digoxin, biotin, AminolinkerC7, BHQ1, BHQ2, Dabcyl, JOE, ROX, FAM, TAMRA, alkyl group, fluoro group, amino group and Thiol-C3 S-S. Among these modifications, modifying groups AminolinkerC7, BHQ1, BHQ2, Dabcyl, JOE, ROX, FAM, TAMR and Thiol-C3 S-S are shortened names of the groups and are well-recognized in the art of primer synthesis.

2016102399 21 Nov 2016

2. Modification is generally introduced to the bases at positions -2 and -3 of 3’ terminal of the specific primer sequence, and preferably the modification is introduced to the bases at positions -1,-2 and -3 of 3’ terminal.

3. Modification, such as thio modification, is introduced to the base at position -4 of 3’ terminal of the specific sequence where the five bases at 3’ terminal of the specific primer sequence have a GC content of greater than 50%.

In the present disclosure, positions -1,-2 and -3 of 3’ terminal represent positions 1, 2 and 3 counting from 3’ terminal to 5’ terminal. The same numbering rule applies in the whole context.

In the present disclosure, modification of bases with the following groups is not for the purpose of blocking the binding of the specific sequence to its perfectly matching template and the extension, but for the purpose of substantially blocking the binding of the specific sequence to an imperfectly matching template and the extension: deoxyinosine (dl), deoxyuracil (dU), 5-Methyl dC, 2'-O-Me-dC, phosphate group, thio group, digoxin, biotin, AminolinkerC7, BHQ1, BHQ2, Dabcyl, JOE, ROX, FAM, TAMRA, alkyl group, fluoro group, amino group, Thiol-C3 S-S, etc. Said modification is made by addition of some chemical groups on phosphodiester bond(s), sugar group(s) or base(s) through chemical synthesis, in order to decrease stability of base pairing. It is well known in the art to add chemical group(s) on phosphodiester bond(s), sugar group(s) or base(s). For example, deoxyinosine (dl) is linked to the phosphodiester bond of a primer, deoxyuracil (dU) is linked to the phosphodiester bond of a primer, the methyl group is linked to position 5’ of deoxyribose cytosine (5-methyl dC) of a primer, methyl group is linked to position 2’ of deoxyribose cytosine (2'-O-Me- dC) of a primer, phosphate group is linked to the phosphodiester bond at 3 ’ terminal of a primer, thio group is linked to the phosphodiester bond at 3’ terminal of a primer, digoxin is linked to the phosphodiester bond at 3 ’ terminal of a primer, biotin group is linked to the phosphodiester bond at 3 ’ terminal of a primer, AminolinkerC7 is linked to the phosphodiester bond at 3 ’ terminal of a primer, BHQ1 is linked to the phosphodiester bond at 3’ terminal of a primer, BHQ2 is linked to the phosphodiester bond at 3’ terminal of a primer, Dabcyl is linked to the phosphodiester bond of a primer, JOE is linked to the phosphodiester bond at 3’ terminal of a primer, ROX is linked to the phosphodiester bond at 3’ terminal of a primer, FAM is

2016102399 21 Nov 2016 linked to the phosphodiester bond of a primer, TAMRA is linked to the phosphodiester bond at 3’ terminal of a primer, the alkyl group is linked to position 6’ of deoxyribose guanine of a primer, fluoro group is linked to position 2’ of deoxyribose of a primer, amino group is linked to position 2’ of deoxyribose of a primer, and thiol group is linked to the phosphodiester bond at 3’ terminal of a primer (Thiol-C3 S-S).

In the present disclosure, Tm value of a sequence can be calculated without limiting to a particular method, and the Tm value calculated by various methods can be used in the present disclosure. The Tm values obtained by different methods cannot substantially reverse the effect of the present disclosure, but cause different degree of the effect. Nearest-Neighbor method based on the table of thermodynamic parameters suggested by SantaLucia 2007 can be used to calculate Tm values, which, however, can be made corresponding to Tm values calculated by other methods. The skilled person in art can compare the Tm values calculated by various methods through simple experimentation, thereby suitably selecting the Tm values calculated by various methods.

Empirically, for the coding regions of human genome, a primer sequence suitable for the present disclosure can be designed for more than 99% target regions, indicating that it is reasonable of filtering the primer set as mentioned above.

The term “sample” is used herein in its widest meaning and is intended to comprise a specimen or culture derived from any source, preferably from a biological source. A biological sample can be obtained from an animal, including a human, and comprises fluid, solid, tissue and gas. The biological sample comprises a blood sample, for example, plasma, serum, and the like. Thus, a “nucleic acid sample” comprises a nucleic acid of any source (such as DNA, RNA, cDNA, mRNA, tRNA, miRNA, and the like). Where the nucleic acid sample is RNA or mRNA, the method of the invention further comprises a step of subjecting the RNA or mRNA to reverse transcription into DNA prior to step c). In the present application, the nucleic acid sample is preferably derived from any biological source, for example, human or non-human cells or tissues, and the like. The term “non-human” refers to all non-human animals and entities, including but not limited to vertebrates such as rodents, non-human primates, sheep, bovines, ruminants, lagomorphs, pigs, goats, horses, dogs, cats, birds, and the like. Non-human further comprises invertebrates and prokaryotes, such as bacteria, plants, yeasts, viruses. Thus,

2016102399 21 Nov 2016 the nucleic acid sample used in the method and system of the present disclosure is the one derived from any organism, either eukaryotic or prokaryotic.

In certain embodiments, the hybridization between a primer and the target nucleic acid is preferably conducted under a stringent condition sufficient to enable the hybridization between the nucleic acids, wherein the nucleic acid comprises a linker compound and a region complementary to the target nucleic acid sample, so as to provide a nucleic acid hybridization complex. The complex is then captured via the linker compound and washed in a condition sufficient to remove non-specifically bounded nucleic acids, and next the hybridized target nucleic acid sequence is eluted from the captured nucleic acid complex.

In certain embodiments, the nucleic acid comprises a chemical group or a linker compound, such as a binding moiety, e.g. biotin and digoxin, capable of binding to a solid support. Said solid support may comprise a corresponding capturing compound, such as streptavidin for biotin or an anti-digoxin antibody for digoxin. The present disclosure is not limited to the linker compounds as used, and an alternative linker compound is equally suitable for the methods, bait sequences and kits of the present disclosure.

In an embodiment of the present disclosure, said multiple target nucleic acid molecules preferably comprise the whole genome, at least one chromosome or a nucleic acid of any molecular size of an organism. Preferably, the nucleic acid molecule has a size of at least about 200 kb, at least about 500 kb, at least about 1 Mb, at least about 2 Mb, or at least about 5 Mb, and more preferably has a size of from about 100 kb to about 5 Mb, about 200 kb to about 5 Mb, about 500 kb to about 5 Mb, about 1 Mb to about 2 Mb or about 2 Mb to about 5 Mb.

In certain embodiments, the target nucleic acids are derived from an animal, plant or microorganism, and in preferred embodiments, the target nucleic acids are derived from human. If the amount of a nucleic acid sample is relatively low (such as a sample of human nucleic acid, e.g. fetal genome in development, as obtained under certain circumstances). The nucleic acid may be amplified, for example through whole genomic amplification, before performing the method of the present disclosure. To perform the

2016102399 21 Nov 2016 method of the present disclosure, pre-amplification might be a necessity, e.g. in forensic applications (such as for the purpose of genetic characterization in forensic applications).

In certain embodiments, the multiple target nucleic acid molecules are a group of genomic DNA molecules. The bait sequences can be selected from, for example, several bait sequences defining several exons, introns or regulatory sequences derived from a plurality of genetic loci; several bait sequences defining the complete sequence of at least one single genetic loci of any size, preferably at least 1 Mb or of at least one of the specified sizes as mentioned above; several bait sequences defining a single nucleotide polymorphism (SNP); or several bait sequences defining an array, such as a chimeric array designed to capture the complete sequence of at least one complete chromosome.

The term “hybridize”, “hybridizing”, “hybridization” or any other grammatical form is used herein to refer to the pairing of complementary nucleic acids. The hybridization and the hybridization intensity such as the binding intensity between nucleic acids are affected by various factors, such as the complementary degree between nucleic acids, the stringency of the hybridization condition as used, the melting temperature (Tm) of the formed hybrid and the GC content of nucleic acids. Although the present disclosure is not limited to a particular hybridization condition, it is preferred to use a stringent hybridization condition. The stringent hybridization condition depends on the sequence and varies as a function of hybridization parameters, such as salt concentration, and the presence of an organic. Generally, the “stringent” condition is selected as being about 5°C to about 20°C lower than the Tm of the specific nucleic acid sequences at a specified ionic intensity and pH. Preferably, the stringent condition is about 5°C to about 10°C lower than the melting temperature of a particular nucleic acid for binding to the complementary nucleic acid. Said Tm is a temperature at which 50% nucleic acids for example target nucleic acids hybridize perfectly matching probes (at a specified ionic intensity and pH).

In the context, “the stringent condition”, for example, may refer to hybridization in 50% formamide, 5 x SSC (0.75 M NaCl, 0.075 M sodium citrate), 50 mM sodium phosphate (pH6.8), 0.1% sodium pyrophosphate, 5 x Denhardt solution, ultrasonic salmon sperm DNA (50 mg/ml), 0.1% SDS, and 10% dextran sulfate at 42°C, washing in 0.2 x SSC (sodium chloride /sodium citrate) at 42°C and in 50% formamide at 55°C, and

2016102399 21 Nov 2016 subsequently washing in 0.1 x SSC containing EDTA at 55°C. For example, it is expected that the buffer solution comprising 35% formamide, 5 * SSC and 0.1% (w/v) sodium dodecyl sulfate (SDS) is suitable for hybridization under a moderately nonstringent condition at 45°C for 16-72 hours.

The term “primer” is used herein to refer to oligonucleotide, obtained either by purification and enzyme digestion of naturally occurring source or by a synthetic method. Primers can serve as initiation site for synthesis when being put into a condition inducing synthesis of products obtained by extending primers complementary to nucleic acid strands (for example, in the presence of nucleotides and an inducible agent such as a DNA polymerase at a suitable temperature and pH). The primers are preferably in a form of a single strand with the highest amplification efficiency. Preferably, the primers are oligodeoxynucleotides. The primers should be long enough to initiate the synthesis of extension product in the presence of inducible agent(s). The exact length of the primers depends on a number of factors, including temperature, primer source and the used method.

The term “probe sequence” is used herein to refer to oligonucleotides (such as nucleotide sequences), obtained either by purification and enzyme digestion of naturally occurring sources or alternatively by synthesis, recombination or PCR amplification, and can hybridize with at least one portion of another target oligonucleotide such as a target nucleic acid sequence. The probe may be single-stranded or double-stranded. The probe can be used for detection, identification and isolation of specific gene sequences.

The term “target nucleic acid molecule” is used herein to refer to a molecule or sequence derived from the target genomic region. The preselected probes define the target nucleic acid molecules. Thus, the wording “target” is intended for differentiating from other nucleic acid sequences. One “segment” is used to define one nucleic acid region in the target sequence, for example as one “segment” or one “portion” of the nucleic acid sequence.

Where the term “isolate” “isolating”, “isolation” or any other grammatical form is used herein in relation to nucleic acids, for example when it is used in the wording “isolate the nucleic acid”, it means that the nucleic acid sequence is identified and isolated from at least one other component or contaminant commonly associated with the

2016102399 21 Nov 2016 naturally occurring source thereof. The isolated nucleic acid is present in a form different from its naturally occurring form. In contrast, the un-isolated nucleic acids such as DNA and RNA are present in a naturally occurring form. The isolated nucleic acids, oligonucleotides or polynucleotides may be present in a single-stranded or a doublestranded form.

In embodiments of the present disclosure, the primers as used in the method, the primer set and the kit as specified herein comprise a linker compound, such as a binding moiety. The binding moiety comprises any portion for linker or introducing to 5 ’ terminal of the amplification primer for subsequently capturing the nucleic acid amplification product. The binding moiety can be any sequence for introducing to 5’ terminal of the primer sequence, such as 6><histidine (6HIS) sequence capable of being captured. For example, the primer comprising 6HIS can be captured by nickel, for example in tubes, micropores, or purification columns which are nicked-coated or contain nicked-coated beads, particles, or the like, wherein such beads are packed into the columns and the samples are loaded into and passed through the columns for the purpose of capturing the complex with reduced complexity (and subsequently eluting the target, for example). Examples of another binding moiety used in the embodiments of the present disclosure comprise haptin, such as digoxin, linked to, such as 5’ terminal of the amplification primer. Digoxin can be captured by anti-Digoxin antibodies, such as the substrate coated with or comprising anti-Digoxin antibodies.

In certain embodiments, the binding moiety is biotin, and streptavidin is used to coat the substrate, for example beads such as paramagnetic particles, so as to isolate the amplification product from non-specifically hybridized target nucleic acids. For example, where biotin is the binding moiety, the substrate coated with streptavidin (SA), such as beads (such as magnetic beads/particles) coated with SA, is used to capture the amplification product labeled with biotin. The complex bound with SA is washed and the hybridized target nucleic acid is eluted from the amplification product for sequencing.

Maskless array synthesis can be used to provide in parallel primer sequences corresponding to at least one region of the genome in sequence. Alternatively, the primer sequences can be continuously obtained with a standard DNA synthesizer and be applied to the solid support, or alternatively the primer sequences can be obtained from an

2016102399 21 Nov 2016 organism and be fixed on the solid support. Upon amplification, the nucleic acid that is not the amplification product can be isolated from the amplification product that is bound to the support by washing. For example, it is eluted from the solid support in hot water or in the buffered solution comprising such as TRIS buffer and/or EDTA for eluting nucleic acids, so as to produce a elute being enriched in the target nucleic acid molecules.

Alternatively, the primer sequences for the target molecules can be synthesized on the solid support as mentioned above, and be released from the solid support as the primer sequence set and be amplified. The released primer set can be fixed covalently or non-covalently on a support, such as glass, metal, ceramic, polymerized beads or other solid supports. The primers can be designed to be released conventionally from the solid support, for example, by providing a nucleic acid sequence that is acid or base unstable at or near the terminal of the nucleic acid analog closest to the support, which enables the release of the primers at a low or high pH, respectively. It is known in the art that there are a number of cuttable linker compounds. The support can be provided, for example, in a cylinder with a liquid inlet and outlet. The method of fixing the nucleic acid on the support is well known in the art, for example, through incorporating biotin-labeled nucleotides to the primers and coating the support with streptavidin, thereby noncovalently attracting and fixing the primers in the set. The sample can be hybridized by the support comprising the primers at a hybridization condition, and the amplified target nucleic acid molecules hybridized with the solid support can be eluted, and be used for the subsequent analysis or other use.

Example 1. Exemplified Steps of the Method of the present disclosure

The method of amplifying multiple target DNA sequences in a sample comprises the following steps:

Step 1): Provide a sample comprising target DNA sequences and non-target sequences, the specific primer set of the disclosure and the universal primer pairs complementary to 5’ terminal universal sequence of the specific primers.

Step 2): Perform a first round of multiple PCR reaction with the specific primers in the primer set to amplify the target DNA sequences in the sample. The PCR reaction is gradiently annealed at high-to-low temperatures. In this example, during the annealing

2016102399 21 Nov 2016 process, the annealing was performed at three temperatures with equal interval, such as

60°C, 59°C, and 58°C, and the cycle number for amplification was less than 10.

A first round of multiple PCR reaction for amplifying multiple DNA sequences of target regions was performed by the following steps: in this round of PCR reaction, a number of pairs of specific primers were put into the same reaction system and are used to amplify multiple sequences of target regions, wherein all upstream primers at 3’ terminals have specific sequences complementary to the sequences of target regions, and at 5’ terminals have universal sequence 1 (GSP1: CTTTCCCTACACGACgctcttccgatct (SEQ ID NO. 1)), all downstream primers at 3’ terminals have specific sequences complementary to sequences of target regions, and at 5’ terminals have universal sequence 2 (GSP2: GGAGTTCAGACGTGTgctcttccgatct (SEQ ID NO.2)), and the upstream and downstream primers at 3’ terminal have bases that have 3 or 4 group modifications for improving the amplification specificity. In this round of multiple PCR reaction, the reaction system comprises ddH₂O, the PCR reaction buffer, the substrate (dNTPs), the mixture of multiple PCR primers, genomic DNA or cDNA of the sample and high fidelity polymerase.

This round of multiple PCR reaction comprises the following three steps: the first step of pre-denaturation at 95°C for 3.5 min; the second step of amplification comprising denaturation at 96-98°C for 20 s, gradiently annealing at 66°C for 1 min, at 65°C for 1 min and at 64°C for 1 min, and extension at 72°C for 30 s; and the third step of extension at 72°C for 5 min, wherein the second step is conducted for 10-22 cycles according to the template amount added, and the annealing time varies according to the number of the target sequences for amplification. The gradiently annealing is utilized in this round of multiple PCR reaction so that each pair of primers can effectively bind to the template in a complementary manner to improve the amplification efficiency. In this example, the annealing was conducted at three temperatures of equal interval (such as 60°C, 59°C and 58°Q in one annealing process. After this round of multiple PCR reaction, double-strand PCR products for multiple sequences of target regions were obtained. Said double-strand PCR products have universal sequence 1 (GSP1) at 5’ terminals and universal sequence 2 (GSP2) at 3’ terminals.

2016102399 21 Nov 2016

The double-strand PCR products were digested with nuclease e.g. Exonuclease VII, Exonuclease I, Mung Bean Nuclease, T7 Endonuclease I, Nuclease BAL-31, Nuclease Pl, Nuclease SI, and Mungbean Nuclease.

The products of the first round of multiple PCR reaction were screened and purified with Agencourt AMPure magnetic beads, in order to remove large fragments outside the target regions, genomic DNA, primer dimers, primers and other reaction components, thereby obtaining double-strand PCR products comprising sequences of target regions.

Step 3): Perform a second round of PCR amplification reaction with universal primers, in order to further amplify the double-strand PCR amplification products obtained in the first round of multiple PCR reaction and further enrich the double-strand PCR amplification products.

In the reaction system of the second round of PCR amplification reaction, the PCR amplification was conducted with the double-strand PCR product comprising sequences of target regions purified in the first round of multiple PCR reaction as the template, universal primer FGSP1 (AATGATACGGCGACCACCGAGATCTacactctttccctacacgac, SEQ ID NO.3) and RGSP2 (CAAGCAGAAGACGGCATACGAGAT******gtgactggagttcagacgtgt, SEQ ID NO.4), wherein FGSP1 has a 3’ terminal being universal sequence 1 (GSP1) and a 5’ terminal being universal sequence 3 (AATGATACGGCGACCACCGAGATCT, SEQ ID NO.5), and RGSP2 has a 3 ’ terminal being universal sequence 2 (GSP2) and a 5 ’ terminal being universal sequence 4 (CAAGCAGAAGACGGCATACGAGAT, SEQ ID NO.6), wherein the six “*” symbols in the middle of SEQ ID NO.4 represent the Index sequence for differentiating different samples. The principle for designing an Index sequence is to make sure that the length thereof is 6 and there are at least two bases different between each other. After the second round of PCR reaction, obtained was amplified products of sequences of target regions with 5’ terminal being universal primer sequence FGSP1 and 3’ terminal being universal primer sequence RGSP2.

The PCR product of the second round of PCR reaction was purified with Agencourt AMPure magnetic beads, in order to remove other ingredients and obtain the product of sequences of target regions comprising universal primer sequence FGSP1 and universal primer sequence RGSP2.

2016102399 21 Nov 2016

Step 4): The products of target region sequences enriched in Step 3) were recovered for sequencing.

Example 2

1000 sites on exons and introns of human genome were randomly selected to test the method of present disclosure, and the experimental procedures were proceeded according to method in Example 1.

Table 1: Chromosome distribution of the randomly selected 1000 sites

Chromosome	Number	Chromosome	Number
chrl	75	chrl 2	65
chr2	40	chrl 3	20
chr3	60	chrl 4	10
chr4	105	chrl 5	25
chr5	55	chrl 6	35
chr6	65	chrl 7	40
chr7	30	chrl 8	10
chr8	65	chrl 9	25
chr9	30	chr20	35
chrlO	65	chr21	15
chrl 1	100	chr22	30

In this example, Tm was calculated with Nearest-neighbor method based on the table of thermodynamic parameters suggested by SantaLucia 2007. Here below is a brief description of primer design.

(1) The length of the amplification product was randomly selected within the range of 100-300 bp. The PCR primers were divided into several groups, with 2°C<standard deviation of Tm <5°C, l°C<standard deviation of Tm <2°C, and standard deviation of Tm <1°C for each group. In addition, the control group was set without considering Tm standard deviation, and there exist circumstances where Tm standard deviation >5°C in this group.

2016102399 21 Nov 2016 (2) Partial primers were selected (other primers can be taken as control) to introduce modification, for example, deoxyinosine (dl), deoxyuracil (dU), 5-Methyl dC, 2'-O-MedC, phosphate group, thio group, digoxin, biotin, AminolinkerC7, BHQ1, BHQ2, Dabcyl, JOE, ROX, FAM, TAMRA, alkyl group, fluoro group, amino group and Thiol-C3 S-S, on the bases, ribose or phosphodiester bond at positions -1,-2 and -3 at 3’ terminal of the sequences.

(3) Where the five bases at 3’ terminal of the primer sequence have a GC content of greater than 50%, partial primers were selected (other primers can be taken as control) to add modification of methyl group linked to 5’ position of deoxyribose cytosine (5-Methyl dC) on the base at position -4 of 3 ’ terminal of the primer sequence, add modification of thio group linked to the phosphodiester bond on the base at position -4 of 3 ’ terminal, add modification of fluoro group linked to position 2’ of deoxyribose cytosine at position -4 of 3’ terminal, add modification of deoxyinosine (dl) to the phosphodiester bond at position -4 of 3’ terminal, or add modification of deoxyuracil (dU) to the phosphodiester bond at position -4 of 3 ’ terminal.

The group modifications at the above positions were synthesized through organic chemistry by a primer synthesis supplier.

In addition, all the primers were further divided into the following groups:

(1) Tm (between specific sequence and target product) - Tm (between specific sequence and non-target product) < 5°C, 5°C < Tm (between specific sequence and target product) - Tm (between specific sequence and non-target product) < 10°Q and Tm (between specific sequence and target product) - Tm (between specific sequence and non-target product) > 10°C;

(2) Tm (between specific sequence and target product) - Tm (dimer) < 5°C, 5°C < Tm (between specific sequence and target product) - Tm (dimer) < 10°C, Tm (between specific sequence and target product) - Tm (dimer) > 10°C;

(3) Tm (between specific sequence and target product) - Tm (hairpin structure) < 5°C, 5°C < Tm (between specific sequence and target product) - Tm (hairpin structure) < 10°Q and Tm (between specific sequence and target product) - Tm (hairpin structure) > 10°C

2016102399 21 Nov 2016

Detection results: The detection results were measured as the capture rate and the coverage rate at 100 ^χ coverage and are given below in tables. It can be seen from the data in these tables that:

1) the smaller the standard deviation of Tm is, the higher the capture rate and the coverage rate are; to achieve good capture rate and 100^xcoverage rate whilst ensuring the space for designing a primer, however, it is preferable that the standard deviation of Tm is equal to or less than 2°Q

2) the capture rate and the coverage rate for most modifications at 3 ’ terminal of the primers is higher than the control without a modification;

3) where the five bases at 3’ terminal of the primer sequence has a GC content of more than 50%, the capture rate and the coverage rate for the primer sequence modified with thio group on the base at position -4 of 3 ’ terminal are higher than the controls without a modification;

4) the bigger the difference of Tm (between specific sequence and target product)

- Tm (between specific sequence and non-target product) is, the higher the capture rate and the coverage rate are, and good capture rate and 100^xcoverage rate can be achieved only when Tm (between specific sequence and target product) - Tm (between specific sequence and non-target product) is greater than 10°Q

5) the bigger the difference of Tm (between specific sequence and target product)

- Tm (dimer) is, the higher the capture rate and coverage rate are, and good capture rate and 100^x coverage rate can be achieved only when Tm (between specific sequence and target product) - Tm (dimer) is greater than 10°Q

6) the bigger the difference of Tm (between specific sequence and target product)

- Tm (hairpin structure) is, the higher the capture rate and coverage rate are, and when Tm (between specific sequence and target product) - Tm (hairpin structure) > 5°C, good capture rate and 100^xcoverage rate can be achieved and more candidate primers can be chosen as compared with the difference of greater than 10°C

Preferably, Tm (between specific sequence and target product) - Tm (between specific sequence and non-target product) is greater than 10°C, Tm (between specific sequence and target product) - Tm (dimer) is greater than 10°C, and Tm (between specific sequence and target product) - Tm (hairpin structure) is greater than 5°C

2016102399 21 Nov 2016

The control refers to the normal primer without any modification and is used to compare with corresponding data of testing groups.

The results are given below:

Table 2. Effect of standard deviation of Tm between groups on detection results

Primer features	Capture rate	100 x coverage rate
standard deviation of Tm < 1°C	80.01%	84.37%
1°C< standard deviation of Tm <2°C	76.34%	78.80%
2°C< standard deviation of Tm <5°C	71.24%	72.02%
standard deviation of Tm >5 °C	60.27%	64.99%

Table 3. Effect of modification on the bases at position -1,-2 and -3 of 3’ terminal of the primer sequence on detection results

Primer features	capture rate	100 x coverage rate
AminolinkerC7	93.25	100%
deoxyuracil (dU)	91.32%	100%
5-Methyl dC	87.23%	95.2%
2'-O-Me- dC	79.98%	92.7%
thio group	83.62%	92.71%
phosphate group	85.66%	93.37%
amino group	93.41%	100%
deoxyinosine (di)	95.87%	100%
BHQ1	94.31%	100%
biotin	70.21%	74.94%
digoxin	60.07%	64.18%
BHQ2	95.26%	100 %
Dabcyl	93.63%	99.11%
FAM	88.34%	93.34%
JOE	86.73%	89.14%
ROX	82.62%	88.25%
TAMRA	83.41%	87.27%

2016102399 21 Nov 2016

alkyl group	96.66%	100%
fluoro group	85.26%	87.31%
Thiol-C3 S-S	92.21%	100%
Control (normal primer)	78.05%	83.36 %

Table 4. Effect of thio modification on the base at position -4 of 3’ terminal of the primer sequence on the detection results when the five bases of 3’ terminal of the primer sequence has a GC content of higher than 50%

Primer features	capture rate	100 * coverage rate
Fluoro group at position -4 of 3 ’ terminal	93.10%	100%
Methyl modification at position -4 of 3 ’ terminal	89.23%	98.87%
Thio modification at position -4 of 3 ’ terminal	82.77%	91.15%
deoxyuracil (dU) at position -4 of 3 ’ terminal	90.92%	99.57%
deoxyinosine (di) at position -4 of 3 ’ terminal	94.03%	99.91%
Control (normal primer)	79.21%	84.09%

Table 5. Effect of primer specificity on the detection results

Primer features	capture rate	100 x coverage rate
Tm (between specific sequence and target product) - Tm (between specific sequence and non-target product) < 5°C	62.35%	67.03%
5°C < Tm (between specific sequence and target product) - Tm (between specific sequence and non-target product) < 10°C	70.01%	73.45%
Tm (between specific sequence and target product) - Tm (between specific sequence and non-target product) > 10°C	78.84%	82.47%

Table 6. Effect of primer dimer on Detection results

Primer features	capture rate	100 x coverage rate
Tm(between specific sequence and target	45.21%	50.74%

2016102399 21 Nov 2016

product)-Tm(dimer)<5°C
5°C < Tm (between specific sequence and target product) - Tm (dimer)<10°C	61.27%	68.17%
Tm (between specific sequence and target product)-Tm (dimer)>10°C	78.64%	83.55%

Table 7. Effect of hairpin structure of primer on detection results

Primer features	capture rate	100 x coverage rate
Tm(between specific sequence and target product)-Tm(hairpin structure)<5°C	64.28%	68.36%
5°C<Tm(between specific sequence and target product) - Tm (hairpin structure) < 10°C	75.09%	80.94%
Tm (between specific sequence and target product) - Tm (hairpin structure) > 10°C	79.98%	83.49%

Claims

2016102399 21 Nov 2016

WHAT IS CLAIMED IS:

1. A primer set for amplifying multiple target DNA sequences in a sample, said primer set comprising a number of pairs of upstream and downstream specific primers for each of the target DNA sequences, wherein:

a) each pair of the upstream and downstream specific primers comprise the specific sequence for a target sequence, and all of the specific sequences satisfy the following requirements: (1) each of the specific sequences does not amplify a sequence outside the target sequence, (2) the specific sequences do not form a dimer between each other, and (3) the specific sequences do not form a hairpin structure;

b) the specific sequence at its 5 ’ terminal is linked to a universal sequence being no homologous to the genome; and

c) the specific sequence at its 3’ terminal comprises on the base(s) modification for increasing steric hindrance, and said modification does not block binding of the specific sequence to its perfectly matching template and the extension, but substantially blocks binding of the specific sequence to an imperfectly matching template and the extension.
2. The primer set according to claim 1, wherein the specific sequences satisfy the following requirements between each other: (1) Tm between a specific sequence and the target region minus Tm between the specific sequence and a non-target region is equal to or greater than 5 °C, preferably equal to or greater than 10°Q (2) Tm between a specific sequence and the target region minus Tm of a dimer formed by the specific sequence with another specific sequence is equal to or greater than 5°C, preferably equal to or greater than 10°Q and (3) Tm between a specific sequence and the target region minus Tm of the hairpin formed in the specific sequence is equal to or greater than 5°C, preferably equal to or greater than 10°Q preferably, the Tm value is calculated with Nearest-Neighbor method based on the table of thermodynamic parameters suggested by SantaLucia 2007.

2016102399 21 Nov 2016
3. The primer set according to claim 1, where the modification for increasing steric hindrance is selected from the group consisting of deoxyinosine (di), deoxyuracil (dU), 5-Methyl dC, 2'-O-Me-dC, phosphate group, thio group, digoxin, biotin, AminolinkerC7, BHQ1, BHQ2, Dabcyl, JOE, ROX, FAM, TAMRA, alkyl group, fluoro group, amino group and Thiol-C3 S-S.
4. The primer set according to claim 1, wherein the modification for increasing steric hindrance on the base at 3’ terminal includes modification on the base, ribose or phosphodiester bond at position -1, -2 and/or -3 at 3’ terminal.
5. The primer set according to any of claims 1-4, wherein the five bases at 3’ terminal of the specific sequence have a GC content of greater than 50%, and the specific sequence has on the base at position -4 of 3 ’ terminal the modification for increasing steric hindrance, such as fluoro modification, methyl group modification, deoxyuracil (dU), thio modification, deoxyinosine (di), amino modification etc.
6. The primer set according to any of claims 1 to 5, wherein the specific primer sequences have unified thermodynamic parameters, and preferably Tm standard deviation is equal to or less than 5°Q more preferably Tm standard deviation is equal to or less than 2°C, and most preferably Tm standard deviation is equal to or less than 1°C
7. A method for amplifying multiple target DNA sequences in a sample, comprising the steps of:

a) providing a sample comprising target DNA sequences and non-target sequences, the primer set according to any one of claims 1-6, and a pair of universal primers complementary to the universal sequences at 5’ terminal of the specific primers;

b) performing a multiple PCR reaction with the specific primers of the primer set to amplify multiple target DNA sequences in the sample, wherein the multiple PCR reaction is gradiently annealed at high-to-low temperatures, for example, at three temperatures with equal interval during an annealing process; and

c) further amplifying the amplified product in step b) with the universal primer pairs to further enrich the amplified product.
8. The method according to claim 7, wherein the method further comprises step b’) of recovering the amplified product enriched in step b).

2016102399 21 Nov 2016
9. The method according to claim 8, wherein the recovering is performed by screening and purifying fragments from the first round of the PCR reaction product with magnetic beads to remove large fragments outside the target regions, genomic DNA, primer dimers, primers and other reaction components, thereby obtaining the PCR product of the target region sequences.
10. The method according to any of claims 7-9, wherein the method further comprises step d) of sequencing the amplified product obtained in step c).