WO2017181070A1 - Vaccine against seneca valley virus - Google Patents
Vaccine against seneca valley virus Download PDFInfo
- Publication number
- WO2017181070A1 WO2017181070A1 PCT/US2017/027708 US2017027708W WO2017181070A1 WO 2017181070 A1 WO2017181070 A1 WO 2017181070A1 US 2017027708 W US2017027708 W US 2017027708W WO 2017181070 A1 WO2017181070 A1 WO 2017181070A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- virus
- immunogenic composition
- lesions
- svv
- group
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/12—Viral antigens
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/66—Microorganisms or materials therefrom
- A61K35/76—Viruses; Subviral particles; Bacteriophages
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
- A61K2039/525—Virus
- A61K2039/5254—Virus avirulent or attenuated
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
- C12N2770/00011—Details
- C12N2770/32011—Picornaviridae
- C12N2770/32034—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
Definitions
- Seneca Valley virus (Senecavirus A; SVV), a single-stranded non-enveloped RNA virus, belongs to the genus Senecavirus, family Picornaviridae (Adams et al., 2015; Hales et al., 2008). Important members in the family Picornaviridae also include poliovirus, rhinovirus, hepatitis A virus, foot-and-mouth disease virus (FMDV) and swine vesicular disease virus (SVDV; (Graves, 1973; Inoue et al., 1989)). The genome of SVV is a positive-sense RNA molecule having a length of -7.3 kb.
- ORF open reading frame
- the viral polyprotein is predicted to be processed by virus-encoded proteases into 12 polypeptides in the standard picornavirus L-4-3-4 layout, with viral structural proteins encoded towards the 5' end of the genome, while non- structural proteins are encoded at the 3' end (Hales et al., 2008; Rueckert and Wimmer, 1984).
- the SVV RNA genome contains an internal ribosome entry site (IRES), which displays the secondary structural features that resembles the IRES element (type IV IRES) of classical swine fever virus (CSFV) in the family Flaviviridae, suggesting recombination events might be occurring between the genomes of the Picornaviridae and Flaviviridae during persistent co-infection in pigs (Willcocks et al., 2011).
- IRES internal ribosome entry site
- Senecavirus A known as SVV-001 isolate
- SVV-001 isolate The first identification of Senecavirus A, known as SVV-001 isolate, was reported in 2002 from PER.C6 cell culture, and thereafter the virus was developed as an oncolytic agent due to its selective tropism for human tumor cells and also no observed pathogenicity in human and animals (Hales et al., 2008; Reddy et al., 2007).
- sporadic serologically similar SVV isolates have been identified from pig samples in the US and Canada (Hales et al., 2008; Knowles and Hallenbeck, 2005; Pasma et al., 2008).
- Phylogenetic analysis suggested those different isolates of SVV had a common ancestor (Knowles et al., 2006).
- Senecavirus A might be a potential causative agent of idiopathic vesicular disease in pigs (Leme et al., 2015; Singh et al., 2012; Vannucci et al., 2015; Wu et al., 2016; Zhang et al., 2015).
- SVV positive clinical symptoms of anorexia, lethargy, lameness, and vesicular lesions were observed.
- Gross lesions could be found on the oral mucosa, snout, nares, distal limbs, especially around the coronary bands (Singh et al., 2012).
- the present disclosure provides for an immunogenic composition or vaccine providing protection against SVV. Further, a method for eliciting an immune response in an animal is provided, where the steps include administration of the immunogenic composition or vaccine disclosed herein to an animal or human in need thereof. A method for reducing the incidence and/or severity of clinical signs associated with SVV is also provided as an aspect of the present disclosure. Such a method comprises the steps of administration of the immunogenic composition or vaccine providing protection against SVV to an animal or human in need thereof.
- the immunogenic composition or vaccine of the present disclosure is preferably killed/inactivated virus, modified live virus, or in a viral vector.
- a nucleic acid or protein subunit, either of which can be modified, vaccine or immunogenic composition is also provided herewith.
- the immunogenic composition or vaccine of the present disclosure includes a nucleic acid.
- the nucleic acid is preferably selected from a inactivated nucleic acid from the modified live or killed sequence of SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 3, the pKS515-01 clone (SEQ ID No. 36), SEQ ID No. 37, SEQ ID No. 38, the Canadian SVV sequence deposited as Gen Bank Accession # KC667560, and any sequence having at least 80%, at least 90%, or at least 95% sequence homology with any one of the recited sequences.
- the immunogenic composition or vaccine of the present disclosure includes a live or killed virus.
- the virus is modified. Further, the modifications can be accomplished in any of the sequences described herein including SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 3, and the pKS515-01 clone.
- a subunit of any of the nucleic acid sequences described above, or the amino acid sequence expressed thereby, is used in the vaccine or immunogenic composition.
- the immunogenic composition or vaccine of the present disclosure further comprises at least one additional element.
- the at least one additional element is preferably selected from, but not limited to, pharmaceutical carriers, adjuvants, pathogens other than SVV, additional antigens, preservatives, stabilizers, colors, flavors, and combinations thereof.
- the at least one additional element is an antigenic protein or peptide.
- the antigenic protein or peptide can be used as a positive marker for the immunogenic composition or vaccine.
- a method for reducing the incidence or severity of clinical symptoms of SVV is also provided.
- the method preferably includes the steps of administration of the immunogenic composition or vaccine of the present disclosure to an animal or human in need thereof.
- the dosage is preferably provided in an effective amount.
- clinical symptoms are selected from, but not limited to, lesions including skin lesions, lesions on oral mucosa, snout lesions, nares lesions, and distal limb lesions, anorexia, lameness, lethargy, fever, decreased viral load, and respiratory distress.
- the clinical symptoms are preferably reduced in incidence or severity by about 20% to 100% when compared to those animals or humans not provided the immunogenic composition or vaccine of the present disclosure.
- a method for eliciting an immune response against SVV is also provided.
- the method preferably includes the steps of administration of the immunogenic composition or vaccine of the present disclosure to an animal or human in need thereof.
- the immunogenic composition or vaccine is preferably a modified live virus; however, the method is not so limited.
- the present disclosure provides for an immunogenic composition or vaccine providing protection against SVV. Further, a method for eliciting an immune response in an animal in provided, where the steps include administration of the immunogenic composition or vaccine disclosed herein to an animal or human in need thereof. A method for reducing the incidence or severity of clinical signs associated with SVV is also provided as an aspect of the present disclosure. Such a method comprises the steps of administration of the immunogenic composition of vaccine providing protection against SVV to an animal or human in need thereof.
- the immunogenic composition or vaccine of the present disclosure can either be a killed or live virus, a modified live or killed virus, a nucleic acid based immunogenic composition; a protein based immunogenic composition; a chimeric composition; or any combination thereof.
- a nucleic acid based immunogenic composition or vaccine is provided.
- the nucleic acid is preferably selected from a modified live or killed sequence of SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 3, SEQ ID No. 36, SEQ ID No. 37, SEQ ID No. 38, the Canadian SVV sequence deposited as Gen Bank Accession # KC667560, the pKS515-01 clone and any sequence having at least 80%, at least 90%, or at least 95% sequence homology with any one of the recited sequences.
- a protein based composition is provided.
- the protein component is selected from, but not limited to, a recombinant protein, a harvested protein, a purified protein, and combinations thereof.
- the protein component is an SVV P1.
- a method for reducing the clinical symptoms associated with SVV is also provided.
- the step of the method preferably includes administration of an immunogenic composition or vaccine described herein to an animal or human.
- These clinical symptoms preferably include, but are not limited to, lesions including skin surface lesions, vesicular lesions on oral mucosa, snout lesions, nares lesions, and distal limb coronary band lesions, anorexia, lameness, lethargy, fever, decreased viral load, and respiratory distress.
- the method preferably includes the step of administration of the immunogenic composition or vaccine to an animal or human thereof.
- the clinical symptoms associated with SVV are reduced in frequency and/or severity by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or reduced by 100%. This is in comparison to an animal or human not receiving the immunogenic composition or vaccine of the present disclosure.
- a method for reducing the severity or incidence of clinical symptoms of one or more of Poliovirus; Rhinovirus; hepatitis A virus; foot-and-mouth disease virus (FMDV); and swine vesicular disease (SVDV) is provided.
- the method includes the steps of administering the SVV immunogenic composition or vaccine of the present disclosure to an animal in need thereof.
- a method for reducing the incidence or severity of clinical symptoms of idiopathic vesicular disease includes the step of administering the immunogenic composition or vaccine of the present disclosure to an animal or human.
- the symptoms of idiopathic vesicular disease are selected from, but not limited to, the group consisting of lesions, skin surface lesions, vesicular lesions on oral mucosa, snout lesions, nares lesions, distal limb coronary band lesions, anorexia, lameness, lethargy, fever, respiratory distress, decreased viral load, and any combination thereof.
- a method for reducing the incidence or severity of clinical symptoms of a pathogen selected from the group consisting of Poliovirus, Rhinovirus, hepatitis A virus, foot-and-mouth disease virus (FMDV), and/or swine vesicular disease (SVDV) is provided.
- the method includes the step of administering the immunogenic composition or vaccine of the present disclosure to an animal or human.
- the clinical symptoms of the pathogen are preferably selected from, but not limited to, lesions, skin surface lesions, vesicular lesions on oral mucosa, snout lesions, nares lesions, distal limb coronary band lesions, anorexia, lameness, lethargy, fever, respiratory distress, decreased viral load, and any combination thereof.
- the recipient of the product and method of the present disclosure may be a human or an animal.
- the animal is preferably selected from, but not limited to, porcine, pigs, cows, goats, horses, dogs, cats, poultry, and other related wild and domestic animals.
- the animal is a porcine, most preferably, a pig.
- the immunogenic composition or vaccine comprises a killed or inactivated virus.
- the killed virus is selected from the group consisting of a Canadian SVV virus strain (Gen Bank Accession # KC667560), SVV JS15-01 DNA clone, SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 3, SEQ ID No. 36, SEQ ID No. 37, SEQ ID No. 38, and sequences having at least 80%, at least 90%, or at least 95% sequence homology or identity with any of the recited sequences.
- the immunogenic composition may also comprise additional elements, antigens, pharmaceutical carriers, adjuvants, preservatives, stabilizers, or combinations thereof.
- the sequence for use in the immunogenic composition or vaccine disclosed herein is selected from, but not limited to, SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 3, SEQ ID No. 36, SEQ ID No. 37, SEQ ID No. 38, and the Canadian SVV virus strain deposited as Gen Bank Accession # KC667560), or any sequence having at least 80%, at least 90%), or at least 95% sequence homology with one of the recited sequences, where the sequence is a modified live sequence, such that the sequence is infectious, but does not produce the clinical symptoms associated with SVV or produces symptoms that are less severe or prevalent, when compared to symptoms from a wild type infection.
- the sequence for use in the immunogenic composition or vaccine disclosed herein is selected from, but not limited to, SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 3, the pKS515-01 clone, and the Canadian SVV virus strain deposited as Gen Bank Accession # KC667560), or any sequence having at least 80%, at least 90%, or at least 95% sequence homology with one of the recited sequences, where the sequence has been attenuated, such that the sequence is infectious, but does not produce the clinical symptoms associated with SVV or produces symptoms that are less severe or prevalent, when compared to symptoms from a wild type infection. Any method of attenuation will work for purposes of the present disclosure, where attenuating the virus by passaging and site directed mutagenesis are preferred methods.
- sequence for use in the immunogenic composition or vaccine disclosed herein is selected from, but not limited to, SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 3, the pKS515-01 clone, and the Canadian SVV virus strain deposited as Gen Bank Accession # KC667560), or any sequence having at least 80%, at least 90%, or at least 95% sequence homology with one of the recited sequences, where the sequence has been inactivated or killed, such that multiple copies of the inactivated or killed virus produce an immune response in the host.
- Modified or modified live nucleotide sequence will be understood as meaning any nucleotide sequence obtained by mutagenesis according to techniques well known to the person skilled in the art, and containing modifications with respect to the normal sequences according to the disclosure, for example mutations in the regulatory and/or promoter sequences of polypeptide expression, especially leading to a modification of the rate of expression of said polypeptide or to a modulation of the replicative cycle.
- Nucleotide, polynucleotide or nucleic acid sequence will be understood according to the present disclosure as meaning both a double-stranded or single-stranded RNA or DNA in the monomeric and dimeric (so-called in tandem) forms and the transcription products of said DNAs.
- the present disclosure does not relate to the genomic nucleotide sequences taken in their natural environment, that is to say, in the natural state. It concerns sequences for which it has been possible to isolate, purify or partially purify, starting from separation methods such as, for example, ion-exchange chromatography, by exclusion based on molecular size, or by affinity, or alternatively fractionation techniques based on solubility in different solvents, or starting from methods of genetic engineering such as amplification, cloning and subcloning, it being possible for the sequences of the disclosure to be carried by vectors. Further, the sequences have been altered from what is found in nature to include mutations induced through site-directed mutagenesis or other attenuation techniques, such as serial passaging, further demonstrating that the sequences are made by the hand of man and not found in nature.
- the vaccine or immunogenic composition of the present invention does not contain a nucleotide or amino acid sequence found in nature, as it has been constructed by the hand of man. Therefore, the immunogenic composition or vaccine of the present invention is markedly different from what is found in nature. Similar to Example 5 for the Nature-Based Product Examples of eligible subject matter under 35 U.S.C. 101 issued by the US Patent Office in 2014, the immunogenic composition or vaccine of the present invention is like claim 2 of that example because the immunogenic composition or vaccine gene has additional elements, such as the mutations within the sequence or inactivation of the virus that provides it with a functionally different characteristic than naturally occurring Seneca Valley Virus strains.
- Pharmaceutically acceptable vehicle is understood as designating a compound or a combination of compounds entering into a pharmaceutical composition or vaccine which does not provoke secondary reactions and which allows, for example, the facilitation of the administration of the active compound, an increase in its duration of life and/or its efficacy in the body, an increase in its solubility in solution or alternatively an improvement in its conservation.
- These pharmaceutically acceptable vehicles are well known and will be adapted by the person skilled in the art as a function of the nature and of the mode of administration of the chosen active compound.
- these can comprise adjuvants of the appropriate immunity which are known to the person skilled in the art, such as, for example, aluminum hydroxide, a representative of the family of muramyl peptides such as one of the peptide derivatives of N-acetyl muramyl, a bacterial lysate, carbomers, or alternatively Freund's incomplete adjuvant.
- adjuvants of the appropriate immunity such as, for example, aluminum hydroxide, a representative of the family of muramyl peptides such as one of the peptide derivatives of N-acetyl muramyl, a bacterial lysate, carbomers, or alternatively Freund's incomplete adjuvant.
- the immunogenic composition and vaccine described herein can be administered by the systemic route, in particular by the intravenous route, by the intramuscular, intradermal or subcutaneous route, or by the oral or nasal, or intranasal route.
- the immunogenic composition or vaccine composition according to the disclosure will be administered by the intramuscular route, through the food, or by nebulization several times, staggered over time.
- the immunogenic composition or vaccine composition according to the disclosure will be administered intranasally.
- compositions can be determined according to the criteria generally taken into account in the establishment of a treatment adapted to an animal such as, for example, the age or the weight, the seriousness of its general condition, the tolerance to the treatment and the secondary effects noted.
- the vaccine of the present disclosure is administered in an amount that is protective against SVV.
- the administration of the immunogenic composition or vaccine according to the present disclosure may be administered one times, two times, three times, four times, five times, six times, seven times, eight times, nine times, or at least 10 times.
- the immunogenic composition or vaccine of the present disclosure is effective after a single dose administration.
- the immunogenic composition or vaccine according to the present disclosure may be administered one time or several times, spread out over time in an amount of about 0.1 to 1000 ⁇ g per kilogram weight of the animal or human, where values and ranges such as, but not limited to, 0.5 to 800 ⁇ g per kilogram weight of the animal or human, 1 to 1000 ⁇ g per kilogram weight of the animal or human, 1 to 500 ⁇ g per kilogram weight of the animal or human, 1 to 300 ⁇ g per kilogram weight of the animal or human, 1 to 200 ⁇ g per kilogram weight of the animal or human, 1 to 150 ⁇ g per kilogram weight of the animal or human, 1 to 125 ⁇ g per kilogram weight of the animal or human, 1 to 100 ⁇ g per kilogram weight of the animal or human, 5 ⁇ g per kilogram weight of the animal or human, 10 ⁇ g per kilogram weight of the animal or human, 15 ⁇ g per kilogram weight of the animal or human, 20 ⁇ g per kilogram weight of the animal or human, 25 ⁇ g per kilogram weight of the animal or human, 30 ⁇
- the immunogenic composition or vaccine may include an antigen from at least one further pathogen other than SVV, making it a combination vaccine or immunogenic composition.
- an effective amount of a vaccine or immunogenic composition administered provides effective protection including a reduction in the severity or incidence of clinical signs of infection up to and including immunity against infections caused by SVV and at least one further disease-causing organism.
- the further pathogen is preferably selected from the group consisting of: Actinobacillus pleuropneumonia; Adenovirus; Alphavirus such as Eastern equine encephalomyelitis viruses; Bordetella bronchiseptica; Brachyspira spp., preferably B. hyodyentheriae; B.
- piosicoli Brucella suis, preferably biovars 1, 2, and 3; Clasical swine fever virus; Clostridium spp., preferably CI. difficile, CI. perfringens types A, B, and C, CI. novyi, Cl.septicum, CI.
- Coronavirus preferably Porcine Respiratory Corona virus; Eperythrozoonosis suis; Erysipelothrix rhsiopathiae; Escherichia coli; Haemophilus parasuis, preferably subtypes 1, 7 and 14: Hemagglutinating encephalomyelitis virus; Japanese Encephalitis Virus; Lawsonia intracellularis; Leptospira spp.; preferably Leptospira australis; Leptospira canicola; Leptospira grippotyphosa; Leptospira icterohaemorrhagicae; and Leptospira interrogans; Leptospira pomona; Leptospira tarassovi; Mycobacterium spp.
- M. avium preferably M. intracellulare; and M.bovis; Mycoplasma hyopneumoniae (M hyo); Pasteurella multocida; Porcine cytomegalovirus; Porcine Parvovirus; Porcine Reproductive and Respiratory Syndrome (PRRS) Virus; Pseudorabies virus; Rotavirus; Salmonella spp.; preferably S. thyhimurium; and S. choleraesuis; Staph, hyicus; Staphylococcus spp.
- PRRS Porine Reproductive and Respiratory Syndrome
- Streptococcus spp. preferably Strep, suis; Swine herpes virus; Swine Influenza Virus; Swine pox virus; Swine pox virus; Vesicular stomatitis virus; Virus of vesicular exanthema of swine; Leptospira Hardjo; Mycoplasma hyosynoviae; Poliovirus; Rhinovirus; hepatitis A virus; foot-and-mouth disease virus (FMDV); swine vesicular disease (SVDV), and combinations thereof.
- Strep, suis Swine herpes virus
- Swine Influenza Virus Swine pox virus
- Swine pox virus Swine pox virus
- Vesicular stomatitis virus Virus of vesicular exanthema of swine
- Leptospira Hardjo Mycoplasma hyosynoviae
- Poliovirus Poliovirus
- Rhinovirus hepatit
- the at least one further pathogen is selected from, but not limited to, Poliovirus; Rhinovirus; hepatitis A virus; foot-and-mouth disease virus (FMDV); swine vesicular disease (SVDV), and combinations thereof.
- the combination vaccine is administered to pigs in one or two doses at an interval of about 2 to 4 weeks.
- the first administration is performed when the animal is about 2 to 3 weeks to about 8 weeks of age.
- the second administration is performed about 1 to about 4 weeks after the first administration of the first vaccination.
- revaccination is performed in an interval of 3 to 12 months after administration of the second dose.
- Administration of subsequent vaccine doses is preferably done on a 6 month to an annual basis.
- animals vaccinated before the age of about 2 to 3 weeks should be revaccinated.
- Administration of subsequent vaccine doses is preferably done on an annual basis.
- the combination vaccine is administered to pigs in a single dose and the single dose is effective to lessen the severity or incidence of clinical symptoms of infection without any subsequent administration.
- site directed mutagenesis refers to an in vitro procedure that uses oligonucleotide primers to confer a mutation in a double-stranded nucleic acid plasmid. Such site directed mutagenesis can be accomplished using inverse PCR using standard primers. Primers can be developed in either an overlapping (QuikChange®, Agilent) or back-to-back orientation (Q5® Site-Directed Mutagenesis kit). It is preferred that the result of site directed mutagenesis is a strain of SVV that is infectious, but does not produce clinical symptoms or produces clinical symptoms that are reduced in severity or prevalence.
- an "attenuated" virus for purposes of the present disclosure, is a virus that is no longer virulent and can be used to make a modified live vaccine.
- an attenuated virus can be attenuated by serial passaging; however, any method for attenuating viruses including site directed mutagenesis will work for purposes of the present disclosure.
- Homologous nucleotide sequence or “having sequence homology” in the sense of the present disclosure is understood as meaning a nucleotide sequence having at least a percentage identity with the bases of a nucleotide sequence according to the disclosure of at least 80%, where ranges and values, including but not limited to, from 80% to 85%, 85% to 96%, 80% or 95%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.5%, 99.9%, and higher are envisioned for the present disclosure, where this percentage being purely statistical and it being possible to distribute the differences between the two nucleotide sequences at random and over the whole of their length.
- an "immunogenic composition” as used herein, means a SVV composition which elicits an "immunological response" in the host of a cellular and/or antibody-mediated immune response to the SVV sequence, whether the sequence is killed/inactivated, modified live, a subunit of the nucleotide sequence or peptide expressed by that sequence, or in a vector.
- this immunogenic composition is capable of conferring protective immunity against SVV infection and the clinical symptoms associated therewith.
- Sequence Identity refers to a relationship between two or more polypeptide sequences or two or more polynucleotide sequences, namely a reference sequence and a given sequence to be compared with the reference sequence. Sequence identity is determined by comparing the given sequence to the reference sequence after the sequences have been optimally aligned to produce the highest degree of sequence similarity, as determined by the match between strings of such sequences. Upon such alignment, sequence identity is ascertained on a position-by-position basis, e.g., the sequences are "identical” at a particular position if at that position, the nucleotides or amino acid residues are identical.
- Sequence identity can be readily calculated by known methods, including but not limited to, those described in Computational Molecular Biology, Lesk, A. N., ed., Oxford University Press, New York (1988), Biocomputing: Informatics and Genome Projects, Smith, D.W., ed., Academic Press, New York (1993); Computer Analysis of Sequence Data, Part I, Griffin, A.M., and Griffin, H. G., eds., Humana Press, New Jersey (1994); Sequence Analysis in Molecular Biology, von Heinge, G., Academic Press (1987); Sequence Analysis Primer, Gribskov, M.
- Preferred methods to determine the sequence identity are designed to give the largest match between the sequences tested. Methods to determine sequence identity are codified in publicly available computer programs which determine sequence identity between given sequences. Examples of such programs include, but are not limited to, the GCG program package (Devereux, J., et al., Nucleic Acids Research, 12(1):387 (1984)), BLASTP, BLASTN and FASTA (Altschul, S. F. et al., J.
- BLASTX program is publicly available from NCBI and other sources (BLAST Manual, Altschul, S. et al., NCVI NLM NIH Bethesda, MD 20894, Altschul, S. F. et al., J. Molec. Biol., 215:403-410 (1990), the teachings of which are incorporated herein by reference). These programs optimally align sequences using default gap weights in order to produce the highest level of sequence identity between the given and reference sequences.
- nucleotide sequence having at least, for example, 85%, preferably 90%, even more preferably 95% "sequence identity" to a reference nucleotide sequence it is intended that the nucleotide sequence of the given polynucleotide is identical to the reference sequence except that the given polynucleotide sequence may include up to 15, preferably up to 10, even more preferably up to 5 point mutations per each 100 nucleotides of the reference nucleotide sequence.
- a polynucleotide having a nucleotide sequence having at least 85%, preferably 90%, even more preferably 95% identity relative to the reference nucleotide sequence, up to 15%, preferably 10%) even more preferably 5%> of the nucleotides in the reference sequence may be deleted or substituted with another nucleotide, or a number of nucleotides up to 15%>, preferably 10%>, even more preferably 5%> of the total nucleotides in the reference sequence may be inserted into the reference sequence.
- mutations of the reference sequence may occur at the 5' or 3' terminal positions of the reference nucleotide sequence or anywhere between those terminal positions, interspersed either individually among nucleotides in the reference sequence or in one or more contiguous groups within the reference sequence.
- a polypeptide having a given amino acid sequence having at least, for example, 85%, preferably 90%, even more preferably 95% sequence identity to a reference amino acid sequence it is intended that the given amino acid sequence of the polypeptide is identical to the reference sequence except that the given polypeptide sequence may include up to 15, preferably up to 10, even more preferably up to 5 amino acid alterations per each 100 amino acids of the reference amino acid sequence.
- a given polypeptide sequence having at least 85%, preferably 90%, even more preferably 95% sequence identity with a reference amino acid sequence up to 15%, preferably up to 10%, even more preferably up to 5% of the amino acid residues in the reference sequence may be deleted or substituted with another amino acid, or a number of amino acids up to 15%), preferably up to 10%, even more preferably up to 5% of the total number of amino acid residues in the reference sequence may be inserted into the reference sequence.
- These alterations of the reference sequence may occur at the amino or the carboxy terminal positions of the reference amino acid sequence or anywhere between those terminal positions, interspersed either individually among residues in the reference sequence or in the one or more contiguous groups within the reference sequence.
- residue positions which are not identical differ by conservative amino acid substitutions. However, conservative substitutions are not included as a match when determining sequence identity.
- sequence identity is the definition that would be used by one of skill in the art.
- the definition by itself does not need the help of any algorithm, said algorithms being helpful only to achieve the optimal alignments of sequences, rather than the calculation of sequence identity.
- BLAST N or BLAST P "BLAST 2 sequence" software which is available in html at the web site ncbi.nlm.nih.gov/gorf/bl2, and habitually used by the inventors and in general by the skilled man for comparing and determining the identity between two sequences, gap cost which depends on the sequence length to be compared is directly selected by the software (i.e. 11.2 for substitution matrix BLOSUM-62 for length >85).
- a “conservative substitution” refers to the substitution of an amino acid residue or nucleotide with another amino acid residue or nucleotide having similar characteristics or properties including size, hydrophobicity, etc., such that the overall functionality does not change significantly.
- isolated means altered “by the hand of man” from its natural state, i.e., if it occurs in nature, it has been changed or removed from its original environment, or both.
- a polynucleotide or polypeptide naturally present in a living organism is not “isolated,” but the same polynucleotide or polypeptide separated from the coexisting materials of its natural state is “isolated”, as the term is employed herein.
- Figure 1 Schematic diagram of the full-length SVV genome and construction of the full-length cDNA clones.
- A SVV genome organization and strategies of assembling the full-length cDNA clone.
- Top scheme Genome organization of SVV. The ORFs are flanked by 5'- and 3'-UTR followed by poly(A) tails at the 3'-end. Arrows indicate the polyprotein processing site by 3C protease. Dotted line showing the Sacl restriction enzyme site for introducing the mutation in cloned virus in panel B.
- Bottom scheme Five separate genomic fragments were amplified and assembled into the pACYC177 vector using the unique restriction enzyme sites and Gibson assembly cloning method.
- the full-length viral genome is under the control of a cytomegalovirus (CMV) promoter and followed by a HDV ribozyme.
- CMV cytomegalovirus
- B Genome organization of the cloned virus vKS 15-01 -Clone with Sacl site inactivated in 2C region.
- C A scheme of the reporter virus genome with an EGFP-T2A fusion gene inserted between 2A/2B.
- T2A teschovirus 2 A peptide, where *** represents the poly A (AAAA n ) tail, % represents the Restriction sites joining fragments, and # represents the Gibson assembly joining fragments;
- FIG. 2 Differentiation of the parental virus from the cloned virus and EGFP -tagged virus in infected cells.
- A Agarose gel picture showing the Sacl enzyme digested DNA fragments generated by RT-PCR amplification of viral genomic region nt 3551-5227 from the SVV KS 15-01 (parental virus) and vKS 15-01 -Clone (cloned virus).
- B DNA sequencing result of PCR products generated in panel A. Gray box showing the Sacl enzyme site being mutated (C350 to T350) in the cloned virus.
- FIG. 3 Detection of the viral protein and EGFP expression in parental and recombinant virus- infected cells.
- A Immunofluorescent assay for detecting SVV VPl and EGFP expression. PK-15 cells were infected with SVV KS 15-01 (parental virus), vKS 15-01 - Clone (cloned virus) or vKS 15-01 -EGFP (EGFP virus) at an MOI of 0.01; mock-infected cells (PK-15) were used as the negative control.
- Fig. 4 In vitro growth characterization of the parental virus, cloned virus and EGFP -tagged virus.
- A Multiple-step virus growth curve. Each data point shown represents a mean value from duplicates, and error bars showing standard errors of the mean (SEM).
- B Plaque morphology of SVV KS 15-01 (parental virus), vKS 15-01 -Clone (cloned virus) vKS15- 01 -EGFP (EGFP virus);
- Fig. 5 Clinical signs and surface lesions observed on infected pigs.
- A Comparison of rectal temperatures among different groups of pigs. Fever is defined as temperature above 104° F.
- B Comparison of clinical scores among different groups of pigs. Clinical score of each pig was generated by scoring clinical observations of pig attitude, respiratory signs, abdominal appearance, snout lesion, oral mucosa lesion, and coronary band lesion. See details of the scoring system in Table S2. Each data point shown in (A) and (B) represents the mean value + SEM from each pig group.
- C-D Surface lesions observed on pigs infected with the parental virus.
- C Vesicular lesion observed on the dorsal snout at 9 dpi.
- D Coronary band lesion on the left front lateral claw at 9 dpi;
- E Healing scar from the vesicular ulcer observed on the dorsal snout at 14 dpi.
- F Erosive lesion of the left front lateral claw observed during necropsy (14 dpi);
- Fig. 6 Comparison of viral load in pigs inoculated with the parental virus, cloned virus, and EGFP -tagged virus.
- Serum, fecal swab, and nasal swab samples were collected from each individual pig at the indicated dpi, and pen (group)-based oral fluid samples were also collected at the indicated dpi.
- Viral loads in samples were quantified by qRT-PCR and calculated equivalent to log TCID 50 /mL.
- A serum
- B fecal swab
- C nasal swab
- (D) oral fluid Statistical significance between different groups was determined by one-way ANOVA and Tukey's test and indicated with asterisks (*, P ⁇ 0.05; ***, P ⁇ 0.001).
- FIG. 7 Analysis the stability of molecular marker or reporter gene in recombinant viruses from infected pigs.
- A Stability of the Sacl enzyme site mutation in infected pigs. Agarose gel picture showing the Sacl enzyme digested DNA fragments generated by RT-PCR amplification of viral genomic region nt 3551-5227. Viral RNA was extracted from serum sample of pigs inoculated with the SVV KS 15-01 (parental virus) or vKS 15-01 -Clone (cloned virus) at 3 dpi. Each individual pig number is shown on top of the panel.
- B-E Stability of the EGFP reporter gene in pigs infected with EGFP -tagged virus.
- Fig. 8 IFN-a response in serum samples from pigs inoculated with the parental virus, cloned virus, and EGFP-tagged virus.
- IFN-a production in serum was quantified by using a ProcartaPlex Porcine IFN alpha Simplex kit (eBioscience, San Diego, CA). Samples from mock-infected pigs were included as a control. Each data point shown represents the mean value + SEM from each pig group; and
- Fig. 9 Neutralizing antibody titers in serum samples from pigs inoculated with the parental virus, cloned virus, and EGFP-tagged virus.
- Neutralizing antibody assay was performed using the parental virus KS 15-01; and an immunofluorescence focus assay with anti-VP2 mAb was used to determine the serum neutralizing antibody titer.
- the neutralizing antibody titer was defined as the highest serum dilution at which more than 90% of viral growth was inhibited.
- Samples from mock-infected pigs were included as a control. Each data point shown represents the mean value + SEM from each group of pigs.
- SVV Seneca valley virus
- EGFP enhanced green fluorescent protein
- vKS 15-01 -EGFP was generated using reverse genetics.
- the pKS 15-01 -Clone derived SVV replicated efficiently in vitro and in vivo, and induced similar levels of neutralizing antibody and cytokine response in infected animals; in contrast, the vKS 15-01 -EGFP showed impaired growth ability and induced lower level of immune response in infected animals.
- the incidence of vesicular lesions produced in vKS 15-01 -Clone-infected pigs was lower than those in parental virus-infected pigs, while no vesicular lesion was detected in vKS15-01-EGFP-infected pigs.
- PK-15 and BFD -21 cells were cultured in Modified Eagle medium (MEM) (Gibco) supplemented with 10% fetal bovine serum (Sigma), antibiotics (100 units/mL of penicillin and 100 ⁇ g/mL of streptomycin (Gibco)) and 0.25 ⁇ g/mL fungizone at 37°C and 5% C0 2 .
- MEM Modified Eagle medium
- KS 15-01 was isolated from a pig nasal swab sample submitted to Kansas Veterinary Diagnostic Laboratory (KSVDL) and isolated virus was cultured on PK-15 cells.
- a CMV promoter was inserted in front of the fragment A, while a hepatitis delta virus ribozyme element was incorporated at the 3 '-terminus of the SVV genome, following the fragment E.
- Both fragments A and E were cloned into pACYC177 vector through a standard DNA cloning procedure using unique restriction enzyme sites. Subsequently, fragments B, C, and D were assembled into pACYC177 vector with fragments A and E using DNA recombination method following the instruction of NEBuilder® HiFi DNA Assembly Cloning Kit (New England BioLabs).
- a Sacl site was inactivated with C4216 to T4216 mutation using site-directed mutagenesis method.
- the resulted full-length cDNA clone was designated as pKS 15-01 -Clone.
- the EGFP gene (GenBank accession No. U55762; Clontech Laboratories) was synthesized and fused with a Teschovirus 2A element (T2A) at its C-terminus.
- T2A Teschovirus 2A element
- the EGFP-T2A fusion gene was inserted between viral genes 2A and 2B using overlap extension PCR method (Ho et al., 1989). This full-length cDNA clone was designated as pKS 15-01 -EGFP.
- Primers utilized for construction of SVV cDNA clones were listed in Table 1.
- BHK-21 cells seeded in 6-well plate were transfected with the plasmid DNA of a SVV full-length cDNA clone using Lipofectamine 3000 transfection reagent following the manufacturer's instructions (Invitrogen). At 48h post- transfection, cell cultural supernatant from BHK-21 cells was transferred to PK-15 cells. Cytopathic effect (CPE) was monitored daily after infection. Recombinant viruses were harvested during 18-48 hours post infection (hpi) when significant CPE was observed.
- CPE Cytopathic effect
- vKS 15-01 -Clone The clone SVV recovered from cDNA infectious clone of pKS 15-01 -Clone was designated as vKS 15-01 -Clone, while the EGFP-tagged virus recovered from cDNA infectious clone of pKS15-01-EGFP was designated as vKS15-01-EGFP.
- RNA extraction cDNA was generated with Superscript III reverse transcriptase (Invitrogen), and the corresponding viral genomic region was amplified by PCR using the primer pair, SVV- 3547F/SVV-5200R (Table 1). Subsequently, PCR product was gel-purified and digested by Sacl. The PCR product was also subjected to DNA sequencing to confirm the presence of C 42 i6 to T4216 mutation. To confirm the presence of EGFP insertion in vKS15-01-EGFP, the corresponding viral genomic region (nt 3242-3700) was amplified by RT-PCR using the primer pair, SVV-6757F and SVV-7191R (Table 1), and PCR product was sent to DNA sequencing analysis.
- Superscript III reverse transcriptase Invitrogen
- PK-15 cells in 6-well plate were infected at a multiply of infection (MOI) of 0.01 with parental virus (KS15-01), cloned virus (vKS 15-01 -Clone), or EGFP virus (vKS 15-01 -EGFP), or mock-infected.
- MOI multiply of infection
- cell lysates were harvested with 200 ⁇ 1 ⁇ 11 PierceTM IP Lysis Buffer (Pierce). After removing cell debris by centrifuge at 1,5000 g for 15 min, cell lysate was mixed with 4x Laemmli loading buffer (Bio-Rad) containing 5% ⁇ - mercaptoethanol and denatured at 95°C for 6 min.
- Proteins were separated in 12.5% SDS-PAGE gel, and blotted onto nitrocellulose membrane. Before antigen detection, the membrane was blocked with 5% skim milk in lx phosphate-buffered saline (PBS) at 4°C overnight. To detect the expression of SVV VP1 and housekeeping gene ⁇ -tubulin, the membrane was incubated at room temperature with a mixture of primary antibodies, including a monoclonal antibody against VP1 (mAbl35-48) and a rabbit polyclonal antibody (abm, Canada) again ⁇ -tubulin. To detect the expression of EGFP and ⁇ -tubulin, a mixture of primary antibodies of anti-EGFP (Sigma, St.
- PK-15 cells in 12-well plate were infected with parental virus, cloned virus, or EGFP virus at an MOI of 0.01. At 12 hpi, cell monolayers were fixed with 4% formaldehyde in PBS (pH 7.4) for 10 min, permeabilized with 0.1% Trition X- 100. After lh incubation with primary anti-VPl mAb 135-48, cell monolayers were washed with PBS for three times and further incubated for lh with Alexa Fluor® 594 AffiniPure Donkey Anti-Mouse IgG (H+L) (Jackson ImmunoResearch Inc., West Grove, PA) secondary antibody. After extensive wash, cells were analyzed under a fluorescent microscope, and pictures were taken with EVOS FL Cell Imaging System (Life technologies, Carlsbad, CA).
- PK-15 cells around 100% confluency in 24-well culture plate were infected with 0.01 MOI of SVV KS 15-01 (parental virus), vKS 15-01 -Clone (cloned virus), or vKS 15-01 -EGFP (EGFP virus), or mock-infected. Cell cultural supernatant was harvested at 6, 12, 24, 36, 48 hpi. The virus titer was further determined by virus titration using PK-15 cells and calculated as 50% tissue culture infective doses per milliliter (TCID 50 /mL) according to the method of Reed and Muench (Reed and Muench, 1938). To determine the plaque morphology of the parental virus, the cloned virus and EGFP virus, a plaque assay was performed by using PK-15 cells as described previously (Fang et al., 2006).
- Pigs were intranasally inoculated with 5 ml/pig of the virus (or culture medium) at a dose of lxlO 8 TCID 50 /mL.
- Clinical observations and rectal temperature data were recorded daily from 0-14 days post infection (dpi).
- Serum, oral fluid, nasal swab and fecal swab samples were collected at 0, 3, 7 and 14 dpi.
- the pig experiment was terminated at 14 dpi.
- gross pathology for each pig was evaluated and abnormal tissue and skin samples were collected.
- Quantitative RT-PCR determining viral load in clinical samples.
- SVV real-time quantitative RT-PCR was performed by Kansas Veterinary Diagnostic Laboratory (KSVDL). Briefly, viral genomic RNA was prepared using a MagMAX-96 viral RNA isolation kit (Life Technologies, Carlsbad, CA) according to the manufacturer's instructions.
- RT-PCR was performed using Path-IDTM Multiplex One-Step RT-PCR Kit (Applied Biosystems, Foster City, CA) in the CFX96 Touch Real-Time PCR Detection System with the following cycling parameters: 48°C for 10 min, 95°C for 10 min, 45 cycles of 95°C for 15 sec and 60°C for 60 sec.
- a standard curve was established by using serial 10-fold diluted KS 15-01 virus from lxlO 6 TCID 50 /mL to lxlO 1 TdD 50 /mL. Viral RNA load equivalent to TdD 50 /mL was determined based on the standard curve.
- Serum neutralizing antibody assay was performed using the parental virus KS 15-01, and the neutralizing antibody titer was determined by immunofluorescence focus assay. Briefly, serum samples were heat-inactivated at 56°C for 30 min, and then 2-fold serially diluted with MEM containing 2% horse serum (HS). The diluted serum ( ⁇ /well) was mixed with equal volume of KS15-01 virus (200 TCID 50 ) and incubated at 37°C. After lh incubation, 150 ⁇ of the serum-virus mixture was added to a 96-well microtiter plate containing 90-100% confluent PK-15 cells and incubated at 37°C.
- HS horse serum
- SVV KS 15-01 Construction of an infectious clone of a newly emerging SVV isolate KS 15-01
- the parental SVV was obtained from a diagnostic case. Initially, the nasal swab samples were analyzed by next generation sequencing and Senecavirus A genome sequence was detected (Hause et al., 2016). Subsequently, the virus was isolated from a Senecavirus A positive nasal swab sample and plaque purified, designated as SVV KS 15-01. In order to construct a full- length cDNA clone, the SVV KS 15-01 isolate was re-sequenced using Sanger sequencing method.
- pKS 15-01 -Clone a full- length genomic cDNA clone of the virus (pKS 15-01 -Clone) was constructed using the strategy shown in Figure 1.
- This pKS 15-01 -Clone construct contains a CMV promoter at the 5' terminus of the viral genome, the 7281 -nucleotide full-length genome of KS 15-01, and a poly(A) tail of 22 residues incorporated at the 3' end of the genome.
- the DNA sequence of pKS 15-01 -Clone contained 4 nucleotide differences (Table 2), including an additional T at 5' end, a G 7 to T 7 mutation at the 5'-UTR, T 7234 to C 7234 and C 7262 to T 7262 mutations at the 3'-UTR; a mutation at nucleotide C 42 i 6 to T 42 i 6 was introduced to inactivate the Sacl restriction enzyme site in 2C region for differentiating the cloned virus from the parental virus (Fig. 1 A-B).
- the C 42 i 6 to T 42 i 6 mutation is a silent mutation with no change on the encoded amino acid sequence.
- plasmid DNA of pKS 15-01 -Clone was transfected into BHK-21 cells.
- supernatants from the transfected cells were passaged onto PK-15 cells.
- PK-15 cells were stained using the VP2-specific mAb 30-158 (Fig. 3A). The results showed that SVV VP2 protein was specifically detected in PK-15 cells inoculated with supernatant from the transfected BHK-21 cells.
- cytopathic effects were observed within 18 to 24h post-infection (hpi).
- PK-15 cells were infected with each of the viruses at an MOI of 0.01 and harvested at 6, 12, 24, 36, 48 hpi.
- the results showed that the cloned virus possessed growth kinetics similar to those of the parental virus (Fig. 4 A).
- the peak viral titers reached at 36 hpi for both viruses, in which the peak titer of the cloned virus was 10 8 0 TCID 50 /ml, while the peak titer of the parental virus was 10 8 4 TCID 50 /ml. Plaque morphology of these viruses was further determined.
- the plaque size produced by the cloned virus was similar to that of the parental virus.
- a Sacl restriction enzyme site was inactivated in 2C region ( Figure 1). As shown in Figure 2A, a 1677-bp RT-PCR fragment derived from amplifying nucleotides 3551 to 5227 of the viral genome was cleaved by Sacl in the parental virus. In contrast, the corresponding RT-PCR product amplified from the cloned virus was not cleaved by Sacl.
- T2A teschovirus 2A peptide
- the plasmid DNA of the construct pKS 15-01 -EGFP was transfected into BHK-21 cells, and the cell culture supernatant from transfected BFD cells was passaged onto PK-15 cells at 48h post transfection.
- the live EGFP-expressing cells were visible as early as 6 h post infection (Fig. 3A).
- An Alexa Fluor® 594 AffiniPure Donkey Anti-mouse IgG (H+L) was used as the secondary antibody. Immunofluore scent microscopy showed the expression of both EGFP and VPl proteins (Fig. 3 A).
- vKS 15-01 -EGFP the growth kinetics of the EGFP-tagged virus (vKS 15-01 -EGFP) was compared to those of the parental wild-type and cloned viruses.
- the vKS15-01-GFP displayed a similar growth behavior as the parental virus and cloned virus (Fig. 4A-B).
- the genomic region containing EGFP insertion of passage 2 virus as amplified by RT-PCR and subjected for sequencing. The results confirmed the existence of intact EGFP in vKS 15-01 -EGFP (Fig. 2C).
- EGFP protein in vKS 15-01 -EGFP infected cells using western blot was further analyzed, and the vKS 15-01 - Clone and parental viruses were included as comparison.
- the result confirmed the presence of the EGFP with ⁇ 27-kDa and a cleaved VPl with ⁇ 32-kDa in cells infected with vKS 15-01 - EGFP, while only VPl with ⁇ 32-kDa was detected in cells infected with the parental and cloned viruses (Fig. 3B).
- Fluid filled vesicles on the snout started appearing at dpi 1 on 5 pigs from group 1 (Fig 5C, Table 4). These vesicles progressed into ulcerative lesions and resolved in 3-4 days (Fig. 5A). Gross ulcerative lesions on distal limbs, especially around the coronary bands, were also observed on two pigs in group 1, which started at dpi 7 (Fig. 5D, Table 4). In contrast, no apparent clinical signs were observed in group 3 pigs and group 4 pigs. Through the time course of this study, rectal temperature was normal for all pigs in groups 3 and 4 except one pig in group 3 whose temperature is over 40°C at 2, 3, and 14 dpi (Table 5).
- one pig from group 1 shown healing scar from the vesicular ulcer on the snout (Fig. 5E); all five pigs from group 1 showed round, discrete erosive lesions around the coronary bands of the lateral claws (Fig. 5F), and lesions on any combination of legs with front leg injury being more common.
- a footpad erosive lesion was observed on the right front leg during necropsy, but no dorsal snout lesion and coronary band lesion were observed in this group of pigs through time course of study.
- necropsy 14 dpi
- enlarged mesenteric lymph nodes were observed on two pigs in group 2.
- Mild lung lesions were observed in seven pigs, including two pigs from group 1, three pigs from group 2, and three pigs from group 3.
- One pig from group 1 showed severe multifocal lung lesions, which was suspected to be associated with bacterial infection but not due to SVV infection, since the similar type of lung lesion was not observed from other four pigs in group 1.
- Gross pathology was also performed on tonsil, heart, liver, spleen, kidney, and intestine; no gross lesion was observed on these internal organs from group 1-4 pigs.
- both groups of pigs almost cleared out of the viruses, in which minimal amount of viral RNA was detected in serum, fecal and nasal swab sample (Fig. 6A-C); however, low levels of viral RNA (equivalent to 10 2 0 TCID 50 /ml) still remained in oral fluid samples (Fig. 6D).
- group 3 pigs at 3 and 7 dpi, only one pig (#34) showed positive qRT-PCR result in the serum sample, but four out of five pigs showed positive qRT-PCR result in nasal swab, and all five pigs showed positive qRT-PCR result in oral fluid and fecal swab samples (Fig. 6).
- viral RNA levels are lower in all samples (except oral fluid at 14 dpi) from group 3 pigs; and some differences were statistically significant at 3 dpi in serum, nasal swab and fecal swab samples (Fig. 6A-C), suggesting that the EGFP insertion impaired the in vivo growth ability of the virus.
- the PCR product was further verified by restriction enzyme digestion using Sacl enzyme. As shown in Fig. 7 A, a 1677-bp PCR fragment derived from each of group 2 pigs was not cleaved by Sacl; in contrast, the PCR fragment derived from the group 1 pigs was cleaved by Sacl. The same method was used to verify the EGFP insertion in the virus from group 3 pigs.
- viral RNA from the serum of pig #34 (showed positive qRT-PCR result) was used to RT-PCR amplify the EGFP insertion region, and the PCR product was subjected to sequence analysis.
- the pair of primers was design to cover the 3487- 4472 nucleotide region of the viral genome.
- a 986-bp PCR product was expected.
- a PCR product close to 500 bp was obtained and the sequencing result revealed that the amino acids 63 to 237 of EGFP were deleted (Fig. 7B and 7F).
- IFN-a is an indicator of early innate immune response
- IFN-a expression was initially measured in serum samples from infected and control pigs through the time course of study. Overall, only a minimal level of IFN-a was stimulated in all the pigs and there is no significant difference on the IFN-a expression levels between different groups of pigs (Fig. 8).
- IFN-a concentration is slightly higher in groups 1 (9.8 pg/ml) and 2 pigs (14.0 pg/ml) compared to that of group 3 (1.8 pg/ml) and group 4 pigs (6.9 pg/ml) (Fig. 8B), but the difference is not statistically significant.
- the expression level of IFN- ⁇ as an indicator as cell-mediated immune response was measured, but IFN- ⁇ was un-detectable in all groups of pigs through the time course of the study.
- SVV infection stimulated a rapid robust serum neutralizing (SN) antibody response (Fig. 9). The SN antibody response can be observed at 3 dpi in group 1 and group 2 pigs.
- the SN titer reached more than 1 :2000 in some of the pigs from group 1 and 2.
- the SN titers in group 3 pigs are consistently lower in comparison to these two groups (groups 1 and 2).
- pig #34 consistently showed the highest SN titers with the titer of 1 :256 at 7 dpi, and 1 : 1024 at 14 dpi.
- the SN titers of the other four pigs in group 3 were at the lower levels, but were still 2-100-fold higher than those of Mock-infected pigs.
- the cDNA clone contains three nucleotide mutations, including an additional U at 5' end, a G 7 to U 7 mutation at the 5' -UTR, U 7234 to C 7234 and C 7262 to U 7262 mutations at the 3'- UTR. These mutations may reflect quasispecies in the virus stock or may have been introduced by cloning procedures.
- the cloned virus showed similar growth kinetics and plaque morphology to those of the parental virus.
- the pig experiment showed that the cloned virus caused slightly less clinical symptoms than that of the parental virus.
- Four pigs in group 2 showed fever and/or depression, while all pigs in group 1 showed fever and/or depression.
- the authentic 5' - end sequence of SVV was determined for the first time in this study using 5' RACE method.
- 5' RACE method For future in depth analysis, more accurate 5' -UTR (and 3' -UTR) sequences are required for field SVV strains, especially for those strains with different pathogenic/virulence properties.
- the cloned virus contains the nucleotide C 42 i 6 to T 42i6 to inactivate the Sacl restriction enzyme site in 2C. Although this is a silent mutation, it is unknown whether this mutation has the effect on viral RNA structure and expression level(s) of certain viral protein(s), which may ultimately affect the pathogenesis of the virus.
- the SVV infectious clone generated in this study will be a useful tool allowing us to introduce site-directed mutations to the 5'-, 3' -UTR or other genomic regions to identify the key nucleotide(s) that might affect the pathogenesis of the virus.
- GFP Green fluorescent protein
- SVV-EGFP recombinant EGFP-expressing reporter virus
- the reporter virus was used for developing a SVV-based oncolytic agent, which was only characterized in lung cancer cell lines and tumor- bearing mice, but not in the natural host cells and animals.
- EGFP-tagged SVV was generated using the strain KS 15-01 that was isolated from infected pigs, and the EGFP-SVV was characterized in PK-15 cells (porcine kidney cell line) and nursery pigs.
- the foreign gene insertion site identified previously was adapted, in which a GFP gene was inserted between 2 A and 2B.
- In vitro growth characterization showed that the recombinant EGFP-SVV had similar growth kinetics and plaque morphology as those of parental virus (Fig. 4).
- the partial EGFP insertion appeared to attenuate the in vivo growth ability of the virus, in which the virus titer in serum was about 653-fold and 3-fold lower than that of parental virus at 3 dpi and 7 dpi, respectively.
- intact full-length EGFP was detected in nasal swab and fecal materials from all five pigs inoculated with EGFP- SVV. This result suggested that SVV carrying 195-bp fragment of EGFP is capable to infect the pig systemically and the viral particles were able to enter into the blood circulation system; the recombinant virus carrying intact full-length EGFP had limited ability to cause systemic infection in pigs, but its infectivity at the local site is unknown.
- the intact EGFP-SVV could be trapped at certain sites inside the pig, and then be expelled out from the body through nasal secretion and fecal discharge.
- the impaired growth ability reflects to the attenuated pathogenic properties of the virus, in which no clinical signs and vesicular lesions were observed in EGFP- SVV inoculated pigs.
- the data demonstrated the flexibility of the viral genomic region around 2A and 2B; however, the SVV genome may have a size limitation for a foreign gene insertion. The mechanism for tolerating foreign gene insertion in between 2A and 2B (or other alternative sites) of SVV genome remains to be determined.
- IFN-a IFN-a
- IFN- ⁇ IFN- ⁇ Only minimal levels of IFN-a were detected in serum samples from pigs of group 1 (9.8 pg/mL) and group 2 (14.0 pg/mL) at 3 dpi, but the levels are not significant from that of Mock-control group (6.9 pg/mL). IFN- ⁇ was un-detectable in all groups of pigs through the time course of study.
- both group 1 and 2 pigs developed rapid neutralizing antibody response with high levels of SN titers being detected as early as 3 dpi.
- SN titers reached 1 :2779 in group 1 pigs and 1 : 1642 in group 2 pigs; such a high level of SN titers remained at 14 dpi.
- the increased SN titer correlates well with the decreased viral titer in serum, nasal secretion and fecal material through the time course of study, in which the virus appeared to be cleared out from blood circulation and other local sites at 14 dpi.
- Table 1 Primers for constructing full-length cDNA clone and sequencing viral genome.
- Coronary band lesion 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 dpi Attitude 0 1 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 dpi Attitude 0 1 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
- Oral Mucosa lesion 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
- Coronary band lesion 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 dpi Attitude 0 0 1 1 1 1 1 1 2 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 dpi Attitude 0 0 1 1 1 1 1 1 1 2 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
- Oral Mucosa lesion 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
- Coronary band lesion 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 dpi Attitude 0 0 1 2 0 0 1 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 dpi Attitude 0 0 1 2 0 0 1 1 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
- Oral Mucosa lesion 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
- Coronary band lesion 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 dpi Attitude 0 0 2 2 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 dpi Attitude 0 0 2 2 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
- Oral Mucosa lesion 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
- Coronary band lesion 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 dpi Attitude 0 0 2 2 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 dpi Attitude 0 0 2 2 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
- Oral Mucosa lesion 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
- Coronary band lesion 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 dpi Attitude 0 0 1 1 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 dpi Attitude 0 0 1 1 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
- Oral Mucosa lesion 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
- Coronary band lesion 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 dpi Attitude 1 0 1 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 dpi Attitude 1 0 1 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
- Oral Mucosa lesion 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
- Coronary band lesion 0 0 3 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 dpi Attitude 1 0 1 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
- Oral Mucosa lesion 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
- Oral Mucosa lesion 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
- Oral Mucosa lesion 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
- Oral Mucosa lesion 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
- Oral Mucosa lesion 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
- b respiratory score. 0, normal; 1, mildly abnormal respiratory character; 2, severely abnormal respiratory character (eg: dyspnea), c: abdominal appearance score. 0, normal; 1, gaunt.
- d, e, f surface lesion score on snout, oral mucosa and coronary band. 0, normal surfaces; 1, hyperemia; 2, blister (vesicle formation); 3, ulcerative lesion
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Virology (AREA)
- Microbiology (AREA)
- Mycology (AREA)
- Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Epidemiology (AREA)
- Animal Behavior & Ethology (AREA)
- General Health & Medical Sciences (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Immunology (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Abstract
An immunogenic composition or vaccine against Seneca Valley Virus ("SVV") is provided. Such a composition is effective in lessening the severity or incidence of clinical symptoms associated with SVV. Specifically, skin lesions, lesion of the oral mucosa, snout lesions, nares lesions, distal limb lesions, anorexia, lameness, fever, decreased viral load, respiratory distress, and lethargy are reduced by the method provided in the disclosure.
Description
VACCINE AGAINST SENECA VALLEY VIRUS
BACKGROUND
[0001] Seneca Valley virus (Senecavirus A; SVV), a single-stranded non-enveloped RNA virus, belongs to the genus Senecavirus, family Picornaviridae (Adams et al., 2015; Hales et al., 2008). Important members in the family Picornaviridae also include poliovirus, rhinovirus, hepatitis A virus, foot-and-mouth disease virus (FMDV) and swine vesicular disease virus (SVDV; (Graves, 1973; Inoue et al., 1989)). The genome of SVV is a positive-sense RNA molecule having a length of -7.3 kb. It contains a single open reading frame (ORF), encoding a large polyprotein, flanked by a long 5' untranslated region (UTR; ~ 668 nucleotides), and a short 3' UTR (-68 nucleotides) with a poly(A) tail. The viral polyprotein is predicted to be processed by virus-encoded proteases into 12 polypeptides in the standard picornavirus L-4-3-4 layout, with viral structural proteins encoded towards the 5' end of the genome, while non- structural proteins are encoded at the 3' end (Hales et al., 2008; Rueckert and Wimmer, 1984). Primary cleavage events are predicted to involve a ribosome-skipping mechanism to separate P1-2A from 2BC-P3 (Donnelly et al., 2001) and a traditional proteolytic process by 3C protease to cleave between L and PI and between 2BC and P3 (Hales et al., 2008). In comparison with other picomaviruses, sequence analysis of the prototypic strain SVV-001 showed that the PI, 2C, 3C and 3D polypeptides regions were most closely related to those of cardioviruses, but other regions of the polyprotein differed considerably from those of the other known picomaviruses (Hales et al., 2008). Within its 5'- UTR, the SVV RNA genome contains an internal ribosome entry site (IRES), which displays the secondary structural features that resembles the IRES element (type IV IRES) of classical swine fever virus (CSFV) in the family Flaviviridae, suggesting recombination events might be occurring between the genomes of the Picornaviridae and Flaviviridae during persistent co-infection in pigs (Willcocks et al., 2011).
[0002] The first identification of Senecavirus A, known as SVV-001 isolate, was reported in 2002 from PER.C6 cell culture, and thereafter the virus was developed as an oncolytic agent due to its selective tropism for human tumor cells and also no observed pathogenicity in human and animals (Hales et al., 2008; Reddy et al., 2007). Subsequently, sporadic serologically similar SVV isolates have been identified from pig samples in the US and Canada (Hales et al., 2008;
Knowles and Hallenbeck, 2005; Pasma et al., 2008). Phylogenetic analysis suggested those different isolates of SVV had a common ancestor (Knowles et al., 2006). Historically, the association of SVV with swine vesicular disease is speculative, since the virus has also been isolated from pigs without clinical symptoms, and experimentally inoculating the SVV isolates into the pig was unable to reproduce the disease (Hales et al., 2008; Knowles et al., 2006; Pasma et al., 2008; Yang et al., 2012). However, recent case reports from Brazil, Canada, China and US provided evidence that Senecavirus A might be a potential causative agent of idiopathic vesicular disease in pigs (Leme et al., 2015; Singh et al., 2012; Vannucci et al., 2015; Wu et al., 2016; Zhang et al., 2015). In some of those pigs tested as SVV positive, clinical symptoms of anorexia, lethargy, lameness, and vesicular lesions were observed. Gross lesions could be found on the oral mucosa, snout, nares, distal limbs, especially around the coronary bands (Singh et al., 2012). These clinical presentations appear to resemble those symptoms caused by other economically more devastating transboundary pathogens that caused vesicular disease, including foot-and-mouth disease virus (FMDV) and swine vesicular disease virus (SVDV), which may lead to foreign animal disease investigations.
[0003] During this ongoing outbreak of swine Senecavirus A, a SVV reverse genetics system is needed to study the basic viral pathogenesis as well as development of modified live virus vaccines. Previously, a full-length cDNA infectious clone of SVV-001 was constructed (Poirier et al., 2012). However, it was intentionally used for development of anticancer agent, and the cloned viruses have not been characterized in natural host animals. This study provides a full-length cDNA infectious clone of a newly emerging Senecavirus A (strain KS15-01). The in vitro and in vivo growth properties of the parental and cloned viruses were evaluated in cultured cells and nursery pigs. The availability of this infectious clone provides a powerful research tool for studying the SVV pathogenic mechanisms and also serves as a valuable backbone for future MLV vaccine development.
SUMMARY OF THE INVENTION
[0004] The present disclosure provides for an immunogenic composition or vaccine providing protection against SVV. Further, a method for eliciting an immune response in an animal is provided, where the steps include administration of the immunogenic composition or vaccine disclosed herein to an animal or human in need thereof. A method for reducing the
incidence and/or severity of clinical signs associated with SVV is also provided as an aspect of the present disclosure. Such a method comprises the steps of administration of the immunogenic composition or vaccine providing protection against SVV to an animal or human in need thereof.
[0005] The immunogenic composition or vaccine of the present disclosure is preferably killed/inactivated virus, modified live virus, or in a viral vector. A nucleic acid or protein subunit, either of which can be modified, vaccine or immunogenic composition is also provided herewith.
[0006] In one aspect, the immunogenic composition or vaccine of the present disclosure includes a nucleic acid. The nucleic acid is preferably selected from a inactivated nucleic acid from the modified live or killed sequence of SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 3, the pKS515-01 clone (SEQ ID No. 36), SEQ ID No. 37, SEQ ID No. 38, the Canadian SVV sequence deposited as Gen Bank Accession # KC667560, and any sequence having at least 80%, at least 90%, or at least 95% sequence homology with any one of the recited sequences.
[0007] In another aspect, the immunogenic composition or vaccine of the present disclosure includes a live or killed virus. In some embodiments, the virus is modified. Further, the modifications can be accomplished in any of the sequences described herein including SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 3, and the pKS515-01 clone.
[0008] In another aspect, a subunit of any of the nucleic acid sequences described above, or the amino acid sequence expressed thereby, is used in the vaccine or immunogenic composition.
[0009] In one aspect, the immunogenic composition or vaccine of the present disclosure further comprises at least one additional element. The at least one additional element is preferably selected from, but not limited to, pharmaceutical carriers, adjuvants, pathogens other than SVV, additional antigens, preservatives, stabilizers, colors, flavors, and combinations thereof. In a further embodiment, the at least one additional element is an antigenic protein or peptide. In such an embodiment, the antigenic protein or peptide can be used as a positive marker for the immunogenic composition or vaccine.
[0010] A method for reducing the incidence or severity of clinical symptoms of SVV is also provided. The method preferably includes the steps of administration of the immunogenic composition or vaccine of the present disclosure to an animal or human in need thereof. The dosage is preferably provided in an effective amount. Preferably, clinical symptoms are selected
from, but not limited to, lesions including skin lesions, lesions on oral mucosa, snout lesions, nares lesions, and distal limb lesions, anorexia, lameness, lethargy, fever, decreased viral load, and respiratory distress. The clinical symptoms are preferably reduced in incidence or severity by about 20% to 100% when compared to those animals or humans not provided the immunogenic composition or vaccine of the present disclosure.
[0011] A method for eliciting an immune response against SVV is also provided. The method preferably includes the steps of administration of the immunogenic composition or vaccine of the present disclosure to an animal or human in need thereof. The immunogenic composition or vaccine is preferably a modified live virus; however, the method is not so limited.
DETAILED DESCRIPTION
[0012] The present disclosure provides for an immunogenic composition or vaccine providing protection against SVV. Further, a method for eliciting an immune response in an animal in provided, where the steps include administration of the immunogenic composition or vaccine disclosed herein to an animal or human in need thereof. A method for reducing the incidence or severity of clinical signs associated with SVV is also provided as an aspect of the present disclosure. Such a method comprises the steps of administration of the immunogenic composition of vaccine providing protection against SVV to an animal or human in need thereof.
[0013] The immunogenic composition or vaccine of the present disclosure can either be a killed or live virus, a modified live or killed virus, a nucleic acid based immunogenic composition; a protein based immunogenic composition; a chimeric composition; or any combination thereof.
[0014] In one embodiment, a nucleic acid based immunogenic composition or vaccine is provided. The nucleic acid is preferably selected from a modified live or killed sequence of SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 3, SEQ ID No. 36, SEQ ID No. 37, SEQ ID No. 38, the Canadian SVV sequence deposited as Gen Bank Accession # KC667560, the pKS515-01 clone and any sequence having at least 80%, at least 90%, or at least 95% sequence homology with any one of the recited sequences.
[0015] In a further embodiment, a protein based composition is provided. Preferably, the protein component is selected from, but not limited to, a recombinant protein, a harvested
protein, a purified protein, and combinations thereof. In one embodiment, the protein component is an SVV P1.
[0016] A method for reducing the clinical symptoms associated with SVV is also provided. The step of the method preferably includes administration of an immunogenic composition or vaccine described herein to an animal or human. These clinical symptoms preferably include, but are not limited to, lesions including skin surface lesions, vesicular lesions on oral mucosa, snout lesions, nares lesions, and distal limb coronary band lesions, anorexia, lameness, lethargy, fever, decreased viral load, and respiratory distress. The method preferably includes the step of administration of the immunogenic composition or vaccine to an animal or human thereof. Preferably the clinical symptoms associated with SVV are reduced in frequency and/or severity by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or reduced by 100%. This is in comparison to an animal or human not receiving the immunogenic composition or vaccine of the present disclosure.
[0017] In a further aspect, a method for reducing the severity or incidence of clinical symptoms of one or more of Poliovirus; Rhinovirus; hepatitis A virus; foot-and-mouth disease virus (FMDV); and swine vesicular disease (SVDV) is provided. The method includes the steps of administering the SVV immunogenic composition or vaccine of the present disclosure to an animal in need thereof.
[0018] A method for reducing the incidence or severity of clinical symptoms of idiopathic vesicular disease is provided. The method includes the step of administering the immunogenic composition or vaccine of the present disclosure to an animal or human. Preferably, the symptoms of idiopathic vesicular disease are selected from, but not limited to, the group consisting of lesions, skin surface lesions, vesicular lesions on oral mucosa, snout lesions, nares lesions, distal limb coronary band lesions, anorexia, lameness, lethargy, fever, respiratory distress, decreased viral load, and any combination thereof.
[0019] In another aspect, a method for reducing the incidence or severity of clinical symptoms of a pathogen selected from the group consisting of Poliovirus, Rhinovirus, hepatitis A virus, foot-and-mouth disease virus (FMDV), and/or swine vesicular disease (SVDV) is provided. The method includes the step of administering the immunogenic composition or vaccine of the present disclosure to an animal or human. The clinical symptoms of the pathogen
are preferably selected from, but not limited to, lesions, skin surface lesions, vesicular lesions on oral mucosa, snout lesions, nares lesions, distal limb coronary band lesions, anorexia, lameness, lethargy, fever, respiratory distress, decreased viral load, and any combination thereof.
[0020] The recipient of the product and method of the present disclosure may be a human or an animal. The animal is preferably selected from, but not limited to, porcine, pigs, cows, goats, horses, dogs, cats, poultry, and other related wild and domestic animals. In a preferred embodiment, the animal is a porcine, most preferably, a pig.
[0021] In one preferred aspect of the present disclosure, the immunogenic composition or vaccine comprises a killed or inactivated virus. Preferably, the killed virus is selected from the group consisting of a Canadian SVV virus strain (Gen Bank Accession # KC667560), SVV JS15-01 DNA clone, SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 3, SEQ ID No. 36, SEQ ID No. 37, SEQ ID No. 38, and sequences having at least 80%, at least 90%, or at least 95% sequence homology or identity with any of the recited sequences.
[0022] In one aspect, the immunogenic composition may also comprise additional elements, antigens, pharmaceutical carriers, adjuvants, preservatives, stabilizers, or combinations thereof.
[0023] In a preferred embodiment, the sequence for use in the immunogenic composition or vaccine disclosed herein is selected from, but not limited to, SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 3, SEQ ID No. 36, SEQ ID No. 37, SEQ ID No. 38, and the Canadian SVV virus strain deposited as Gen Bank Accession # KC667560), or any sequence having at least 80%, at least 90%), or at least 95% sequence homology with one of the recited sequences, where the sequence is a modified live sequence, such that the sequence is infectious, but does not produce the clinical symptoms associated with SVV or produces symptoms that are less severe or prevalent, when compared to symptoms from a wild type infection.
[0024] In an alternate embodiment, the sequence for use in the immunogenic composition or vaccine disclosed herein is selected from, but not limited to, SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 3, the pKS515-01 clone, and the Canadian SVV virus strain deposited as Gen Bank Accession # KC667560), or any sequence having at least 80%, at least 90%, or at least 95% sequence homology with one of the recited sequences, where the sequence has been attenuated, such that the sequence is infectious, but does not produce the clinical symptoms associated with
SVV or produces symptoms that are less severe or prevalent, when compared to symptoms from a wild type infection. Any method of attenuation will work for purposes of the present disclosure, where attenuating the virus by passaging and site directed mutagenesis are preferred methods.
[0025] In a further embodiment, the sequence for use in the immunogenic composition or vaccine disclosed herein is selected from, but not limited to, SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 3, the pKS515-01 clone, and the Canadian SVV virus strain deposited as Gen Bank Accession # KC667560), or any sequence having at least 80%, at least 90%, or at least 95% sequence homology with one of the recited sequences, where the sequence has been inactivated or killed, such that multiple copies of the inactivated or killed virus produce an immune response in the host.
[0026] Modified or modified live nucleotide sequence will be understood as meaning any nucleotide sequence obtained by mutagenesis according to techniques well known to the person skilled in the art, and containing modifications with respect to the normal sequences according to the disclosure, for example mutations in the regulatory and/or promoter sequences of polypeptide expression, especially leading to a modification of the rate of expression of said polypeptide or to a modulation of the replicative cycle.
[0027] Nucleotide, polynucleotide or nucleic acid sequence will be understood according to the present disclosure as meaning both a double-stranded or single-stranded RNA or DNA in the monomeric and dimeric (so-called in tandem) forms and the transcription products of said DNAs.
[0028] It must be understood that the present disclosure does not relate to the genomic nucleotide sequences taken in their natural environment, that is to say, in the natural state. It concerns sequences for which it has been possible to isolate, purify or partially purify, starting from separation methods such as, for example, ion-exchange chromatography, by exclusion based on molecular size, or by affinity, or alternatively fractionation techniques based on solubility in different solvents, or starting from methods of genetic engineering such as amplification, cloning and subcloning, it being possible for the sequences of the disclosure to be carried by vectors. Further, the sequences have been altered from what is found in nature to include mutations induced through site-directed mutagenesis or other attenuation techniques,
such as serial passaging, further demonstrating that the sequences are made by the hand of man and not found in nature.
[0029] The vaccine or immunogenic composition of the present invention does not contain a nucleotide or amino acid sequence found in nature, as it has been constructed by the hand of man. Therefore, the immunogenic composition or vaccine of the present invention is markedly different from what is found in nature. Similar to Example 5 for the Nature-Based Product Examples of eligible subject matter under 35 U.S.C. 101 issued by the US Patent Office in 2014, the immunogenic composition or vaccine of the present invention is like claim 2 of that example because the immunogenic composition or vaccine gene has additional elements, such as the mutations within the sequence or inactivation of the virus that provides it with a functionally different characteristic than naturally occurring Seneca Valley Virus strains.
[0030] Pharmaceutically acceptable vehicle is understood as designating a compound or a combination of compounds entering into a pharmaceutical composition or vaccine which does not provoke secondary reactions and which allows, for example, the facilitation of the administration of the active compound, an increase in its duration of life and/or its efficacy in the body, an increase in its solubility in solution or alternatively an improvement in its conservation. These pharmaceutically acceptable vehicles are well known and will be adapted by the person skilled in the art as a function of the nature and of the mode of administration of the chosen active compound.
[0031] As far as the vaccine formulations are concerned, these can comprise adjuvants of the appropriate immunity which are known to the person skilled in the art, such as, for example, aluminum hydroxide, a representative of the family of muramyl peptides such as one of the peptide derivatives of N-acetyl muramyl, a bacterial lysate, carbomers, or alternatively Freund's incomplete adjuvant.
[0032] The immunogenic composition and vaccine described herein can be administered by the systemic route, in particular by the intravenous route, by the intramuscular, intradermal or subcutaneous route, or by the oral or nasal, or intranasal route. In a more preferred manner, the immunogenic composition or vaccine composition according to the disclosure will be administered by the intramuscular route, through the food, or by nebulization several times,
staggered over time. In a further preferred aspect, the immunogenic composition or vaccine composition according to the disclosure will be administered intranasally.
[0033] Their administration modes, dosages and optimum pharmaceutical forms can be determined according to the criteria generally taken into account in the establishment of a treatment adapted to an animal such as, for example, the age or the weight, the seriousness of its general condition, the tolerance to the treatment and the secondary effects noted. Preferably, the vaccine of the present disclosure is administered in an amount that is protective against SVV.
[0034] The administration of the immunogenic composition or vaccine according to the present disclosure may be administered one times, two times, three times, four times, five times, six times, seven times, eight times, nine times, or at least 10 times. In one aspect, the immunogenic composition or vaccine of the present disclosure is effective after a single dose administration.
[0035] For example, the immunogenic composition or vaccine according to the present disclosure may be administered one time or several times, spread out over time in an amount of about 0.1 to 1000 μg per kilogram weight of the animal or human, where values and ranges such as, but not limited to, 0.5 to 800 μg per kilogram weight of the animal or human, 1 to 1000 μg per kilogram weight of the animal or human, 1 to 500 μg per kilogram weight of the animal or human, 1 to 300 μg per kilogram weight of the animal or human, 1 to 200 μg per kilogram weight of the animal or human, 1 to 150 μg per kilogram weight of the animal or human, 1 to 125 μg per kilogram weight of the animal or human, 1 to 100 μg per kilogram weight of the animal or human, 5 μg per kilogram weight of the animal or human, 10 μg per kilogram weight of the animal or human, 15 μg per kilogram weight of the animal or human, 20 μg per kilogram weight of the animal or human, 25 μg per kilogram weight of the animal or human, 30 μg per kilogram weight of the animal or human, 35 μg per kilogram weight of the animal or human, 40 μg per kilogram weight of the animal or human, 45 μg per kilogram weight of the animal or human, 50 μg per kilogram weight of the animal or human, 55 μg per kilogram weight of the animal or human, 60 μg per kilogram weight of the animal or human, 65 μg per kilogram weight of the animal or human, 70 μg per kilogram weight of the animal or human, 75 μg per kilogram weight of the animal or human, 80 μg per kilogram weight of the animal or human, 85 μg per kilogram weight of the animal or human, 90 μg per kilogram weight of the animal or human, 95
μ per kilogram weight of the animal or human, 100 μg per kilogram weight of the animal or human, 125 μg per kilogram weight of the animal or human, 150 μg per kilogram weight of the animal or human, 200 μg per kilogram weight of the animal or human, 250 μg per kilogram weight of the animal or human, 300 μg per kilogram weight of the animal or human, 400 μg per kilogram weight of the animal or human, 500 μg per kilogram weight of the animal or human, 600 μg per kilogram weight of the animal or human, 700 μg per kilogram weight of the animal or human, 800 μg per kilogram weight of the animal or human, 900 μg per kilogram weight of the animal or human, and 1000 μg per kilogram weight of the animal or human are envisioned. In other preferred forms, the above amounts are also provided without reference to the weight of the animal or human.
[0036] According to the present disclosure, the immunogenic composition or vaccine may include an antigen from at least one further pathogen other than SVV, making it a combination vaccine or immunogenic composition. In such an embodiment, an effective amount of a vaccine or immunogenic composition administered provides effective protection including a reduction in the severity or incidence of clinical signs of infection up to and including immunity against infections caused by SVV and at least one further disease-causing organism. The further pathogen is preferably selected from the group consisting of: Actinobacillus pleuropneumonia; Adenovirus; Alphavirus such as Eastern equine encephalomyelitis viruses; Bordetella bronchiseptica; Brachyspira spp., preferably B. hyodyentheriae; B. piosicoli, Brucella suis, preferably biovars 1, 2, and 3; Clasical swine fever virus; Clostridium spp., preferably CI. difficile, CI. perfringens types A, B, and C, CI. novyi, Cl.septicum, CI. tetani; Coronavirus, preferably Porcine Respiratory Corona virus; Eperythrozoonosis suis; Erysipelothrix rhsiopathiae; Escherichia coli; Haemophilus parasuis, preferably subtypes 1, 7 and 14: Hemagglutinating encephalomyelitis virus; Japanese Encephalitis Virus; Lawsonia intracellularis; Leptospira spp.; preferably Leptospira australis; Leptospira canicola; Leptospira grippotyphosa; Leptospira icterohaemorrhagicae; and Leptospira interrogans; Leptospira pomona; Leptospira tarassovi; Mycobacterium spp. preferably M. avium; M. intracellulare; and M.bovis; Mycoplasma hyopneumoniae (M hyo); Pasteurella multocida; Porcine cytomegalovirus; Porcine Parvovirus; Porcine Reproductive and Respiratory Syndrome (PRRS) Virus; Pseudorabies virus; Rotavirus; Salmonella spp.; preferably S. thyhimurium; and
S. choleraesuis; Staph, hyicus; Staphylococcus spp. preferably Streptococcus spp., preferably Strep, suis; Swine herpes virus; Swine Influenza Virus; Swine pox virus; Swine pox virus; Vesicular stomatitis virus; Virus of vesicular exanthema of swine; Leptospira Hardjo; Mycoplasma hyosynoviae; Poliovirus; Rhinovirus; hepatitis A virus; foot-and-mouth disease virus (FMDV); swine vesicular disease (SVDV), and combinations thereof.
[0037] In a preferred embodiment, the at least one further pathogen is selected from, but not limited to, Poliovirus; Rhinovirus; hepatitis A virus; foot-and-mouth disease virus (FMDV); swine vesicular disease (SVDV), and combinations thereof.
[0038] According to a further embodiment, the combination vaccine is administered to pigs in one or two doses at an interval of about 2 to 4 weeks. For example, the first administration is performed when the animal is about 2 to 3 weeks to about 8 weeks of age. The second administration is performed about 1 to about 4 weeks after the first administration of the first vaccination. According to a further embodiment, revaccination is performed in an interval of 3 to 12 months after administration of the second dose. Administration of subsequent vaccine doses is preferably done on a 6 month to an annual basis. In another preferred embodiment, animals vaccinated before the age of about 2 to 3 weeks should be revaccinated. Administration of subsequent vaccine doses is preferably done on an annual basis.
[0039] According to a further embodiment, the combination vaccine is administered to pigs in a single dose and the single dose is effective to lessen the severity or incidence of clinical symptoms of infection without any subsequent administration.
[0040] Definitions
[0041] For purposes of the present disclosure, "site directed mutagenesis" refers to an in vitro procedure that uses oligonucleotide primers to confer a mutation in a double-stranded nucleic acid plasmid. Such site directed mutagenesis can be accomplished using inverse PCR using standard primers. Primers can be developed in either an overlapping (QuikChange®, Agilent) or back-to-back orientation (Q5® Site-Directed Mutagenesis kit). It is preferred that the result of site directed mutagenesis is a strain of SVV that is infectious, but does not produce clinical symptoms or produces clinical symptoms that are reduced in severity or prevalence.
[0042] An "attenuated" virus, for purposes of the present disclosure, is a virus that is no longer virulent and can be used to make a modified live vaccine. In one aspect, an attenuated
virus can be attenuated by serial passaging; however, any method for attenuating viruses including site directed mutagenesis will work for purposes of the present disclosure.
[0043] "Homologous nucleotide sequence" or "having sequence homology" in the sense of the present disclosure is understood as meaning a nucleotide sequence having at least a percentage identity with the bases of a nucleotide sequence according to the disclosure of at least 80%, where ranges and values, including but not limited to, from 80% to 85%, 85% to 96%, 80% or 95%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.5%, 99.9%, and higher are envisioned for the present disclosure, where this percentage being purely statistical and it being possible to distribute the differences between the two nucleotide sequences at random and over the whole of their length.
[0044] An "immunogenic composition" as used herein, means a SVV composition which elicits an "immunological response" in the host of a cellular and/or antibody-mediated immune response to the SVV sequence, whether the sequence is killed/inactivated, modified live, a subunit of the nucleotide sequence or peptide expressed by that sequence, or in a vector. Preferably, this immunogenic composition is capable of conferring protective immunity against SVV infection and the clinical symptoms associated therewith.
[0045] "Sequence Identity" as it is known in the art refers to a relationship between two or more polypeptide sequences or two or more polynucleotide sequences, namely a reference sequence and a given sequence to be compared with the reference sequence. Sequence identity is determined by comparing the given sequence to the reference sequence after the sequences have been optimally aligned to produce the highest degree of sequence similarity, as determined by the match between strings of such sequences. Upon such alignment, sequence identity is ascertained on a position-by-position basis, e.g., the sequences are "identical" at a particular position if at that position, the nucleotides or amino acid residues are identical. The total number of such position identities is then divided by the total number of nucleotides or residues in the reference sequence to give % sequence identity. Sequence identity can be readily calculated by known methods, including but not limited to, those described in Computational Molecular Biology, Lesk, A. N., ed., Oxford University Press, New York (1988), Biocomputing: Informatics and Genome Projects, Smith, D.W., ed., Academic Press, New York (1993);
Computer Analysis of Sequence Data, Part I, Griffin, A.M., and Griffin, H. G., eds., Humana Press, New Jersey (1994); Sequence Analysis in Molecular Biology, von Heinge, G., Academic Press (1987); Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., M. Stockton Press, New York (1991); and Carillo, H., and Lipman, D., SIAM J. Applied Math., 48: 1073 (1988), the teachings of which are incorporated herein by reference. Preferred methods to determine the sequence identity are designed to give the largest match between the sequences tested. Methods to determine sequence identity are codified in publicly available computer programs which determine sequence identity between given sequences. Examples of such programs include, but are not limited to, the GCG program package (Devereux, J., et al., Nucleic Acids Research, 12(1):387 (1984)), BLASTP, BLASTN and FASTA (Altschul, S. F. et al., J. Molec. Biol., 215 :403-410 (1990). The BLASTX program is publicly available from NCBI and other sources (BLAST Manual, Altschul, S. et al., NCVI NLM NIH Bethesda, MD 20894, Altschul, S. F. et al., J. Molec. Biol., 215:403-410 (1990), the teachings of which are incorporated herein by reference). These programs optimally align sequences using default gap weights in order to produce the highest level of sequence identity between the given and reference sequences. As an illustration, by a polynucleotide having a nucleotide sequence having at least, for example, 85%, preferably 90%, even more preferably 95% "sequence identity" to a reference nucleotide sequence, it is intended that the nucleotide sequence of the given polynucleotide is identical to the reference sequence except that the given polynucleotide sequence may include up to 15, preferably up to 10, even more preferably up to 5 point mutations per each 100 nucleotides of the reference nucleotide sequence. In other words, in a polynucleotide having a nucleotide sequence having at least 85%, preferably 90%, even more preferably 95% identity relative to the reference nucleotide sequence, up to 15%, preferably 10%), even more preferably 5%> of the nucleotides in the reference sequence may be deleted or substituted with another nucleotide, or a number of nucleotides up to 15%>, preferably 10%>, even more preferably 5%> of the total nucleotides in the reference sequence may be inserted into the reference sequence. These mutations of the reference sequence may occur at the 5' or 3' terminal positions of the reference nucleotide sequence or anywhere between those terminal positions, interspersed either individually among nucleotides in the reference sequence or in one or more contiguous groups within the reference sequence. Analogously, by a polypeptide having
a given amino acid sequence having at least, for example, 85%, preferably 90%, even more preferably 95% sequence identity to a reference amino acid sequence, it is intended that the given amino acid sequence of the polypeptide is identical to the reference sequence except that the given polypeptide sequence may include up to 15, preferably up to 10, even more preferably up to 5 amino acid alterations per each 100 amino acids of the reference amino acid sequence. In other words, to obtain a given polypeptide sequence having at least 85%, preferably 90%, even more preferably 95% sequence identity with a reference amino acid sequence, up to 15%, preferably up to 10%, even more preferably up to 5% of the amino acid residues in the reference sequence may be deleted or substituted with another amino acid, or a number of amino acids up to 15%), preferably up to 10%, even more preferably up to 5% of the total number of amino acid residues in the reference sequence may be inserted into the reference sequence. These alterations of the reference sequence may occur at the amino or the carboxy terminal positions of the reference amino acid sequence or anywhere between those terminal positions, interspersed either individually among residues in the reference sequence or in the one or more contiguous groups within the reference sequence. Preferably, residue positions which are not identical differ by conservative amino acid substitutions. However, conservative substitutions are not included as a match when determining sequence identity.
[0046] The definition of sequence identity given above is the definition that would be used by one of skill in the art. The definition by itself does not need the help of any algorithm, said algorithms being helpful only to achieve the optimal alignments of sequences, rather than the calculation of sequence identity.
[0047] From the definition given above, it follows that there is a well-defined and only one value for the sequence identity between two compared sequences which value corresponds to the value obtained for the best or optimal alignment.
[0048] In the BLAST N or BLAST P "BLAST 2 sequence", software which is available in html at the web site ncbi.nlm.nih.gov/gorf/bl2, and habitually used by the inventors and in general by the skilled man for comparing and determining the identity between two sequences, gap cost which depends on the sequence length to be compared is directly selected by the software (i.e. 11.2 for substitution matrix BLOSUM-62 for length >85).
[0049] A "conservative substitution" refers to the substitution of an amino acid residue or nucleotide with another amino acid residue or nucleotide having similar characteristics or properties including size, hydrophobicity, etc., such that the overall functionality does not change significantly.
[0050] "Isolated" means altered "by the hand of man" from its natural state, i.e., if it occurs in nature, it has been changed or removed from its original environment, or both. For example, a polynucleotide or polypeptide naturally present in a living organism is not "isolated," but the same polynucleotide or polypeptide separated from the coexisting materials of its natural state is "isolated", as the term is employed herein.
DESCRIPTION OF FIGURES
[0051] Figure 1: Schematic diagram of the full-length SVV genome and construction of the full-length cDNA clones. (A) SVV genome organization and strategies of assembling the full-length cDNA clone. Top scheme: Genome organization of SVV. The ORFs are flanked by 5'- and 3'-UTR followed by poly(A) tails at the 3'-end. Arrows indicate the polyprotein processing site by 3C protease. Dotted line showing the Sacl restriction enzyme site for introducing the mutation in cloned virus in panel B. Bottom scheme: Five separate genomic fragments were amplified and assembled into the pACYC177 vector using the unique restriction enzyme sites and Gibson assembly cloning method. The full-length viral genome is under the control of a cytomegalovirus (CMV) promoter and followed by a HDV ribozyme. (B) Genome organization of the cloned virus vKS 15-01 -Clone with Sacl site inactivated in 2C region. (C) A scheme of the reporter virus genome with an EGFP-T2A fusion gene inserted between 2A/2B. T2A: teschovirus 2 A peptide, where *** represents the poly A (AAAAn) tail, % represents the Restriction sites joining fragments, and # represents the Gibson assembly joining fragments;
[0052] Fig. 2: Differentiation of the parental virus from the cloned virus and EGFP -tagged virus in infected cells. (A) Agarose gel picture showing the Sacl enzyme digested DNA fragments generated by RT-PCR amplification of viral genomic region nt 3551-5227 from the SVV KS 15-01 (parental virus) and vKS 15-01 -Clone (cloned virus). (B) DNA sequencing result of PCR products generated in panel A. Gray box showing the Sacl enzyme site being mutated (C350 to T350) in the cloned virus. (C) Agarose gel picture showing the DNA fragments generated by RT-PCR amplification of the viral genomic region containing the EGFP insertion site;
[0053] Fig. 3: Detection of the viral protein and EGFP expression in parental and recombinant virus- infected cells. (A) Immunofluorescent assay for detecting SVV VPl and EGFP expression. PK-15 cells were infected with SVV KS 15-01 (parental virus), vKS 15-01 - Clone (cloned virus) or vKS 15-01 -EGFP (EGFP virus) at an MOI of 0.01; mock-infected cells (PK-15) were used as the negative control. At 12 hpi, cell monolayers were fixed and stained with anti-VPl mAb 135-48. the SVV VPl is labeled red fluorescence and EGFP is shown as green fluorescence. Cell nucleus DNA is stained by DAPI (blue). (B) Western blot analysis of VPl and EGFP expression. Cell lysates from PK-15 cells infected with SVV KS 15-01 (parental virus), vKS 15-01 -Clone (cloned virus) vKS 15-01 -EGFP (EGFP virus), or mock-infected cells (PK-15) were harvested at 18 hpi and subjected to western blot analysis using mAbs against VPl and EGFP. The expression of housekeeping gene β-tubulin was detected as a loading control;
[0054] Fig. 4: In vitro growth characterization of the parental virus, cloned virus and EGFP -tagged virus. (A) Multiple-step virus growth curve. Each data point shown represents a mean value from duplicates, and error bars showing standard errors of the mean (SEM). (B) Plaque morphology of SVV KS 15-01 (parental virus), vKS 15-01 -Clone (cloned virus) vKS15- 01 -EGFP (EGFP virus);
[0055] Fig. 5: Clinical signs and surface lesions observed on infected pigs. (A) Comparison of rectal temperatures among different groups of pigs. Fever is defined as temperature above 104° F. (B) Comparison of clinical scores among different groups of pigs. Clinical score of each pig was generated by scoring clinical observations of pig attitude, respiratory signs, abdominal appearance, snout lesion, oral mucosa lesion, and coronary band lesion. See details of the scoring system in Table S2. Each data point shown in (A) and (B) represents the mean value + SEM from each pig group. (C-D). Surface lesions observed on pigs infected with the parental virus. (C) Vesicular lesion observed on the dorsal snout at 9 dpi. (D) Coronary band lesion on the left front lateral claw at 9 dpi; (E) Healing scar from the vesicular ulcer observed on the dorsal snout at 14 dpi. (F) Erosive lesion of the left front lateral claw observed during necropsy (14 dpi);
[0056] Fig. 6: Comparison of viral load in pigs inoculated with the parental virus, cloned virus, and EGFP -tagged virus. Serum, fecal swab, and nasal swab samples were collected from each individual pig at the indicated dpi, and pen (group)-based oral fluid samples were also
collected at the indicated dpi. Viral loads in samples were quantified by qRT-PCR and calculated equivalent to log TCID50/mL. (A) serum; (B) fecal swab; (C) nasal swab; (D) oral fluid. Statistical significance between different groups was determined by one-way ANOVA and Tukey's test and indicated with asterisks (*, P<0.05; ***, P<0.001).
[0057] Fig. 7: Analysis the stability of molecular marker or reporter gene in recombinant viruses from infected pigs. (A) Stability of the Sacl enzyme site mutation in infected pigs. Agarose gel picture showing the Sacl enzyme digested DNA fragments generated by RT-PCR amplification of viral genomic region nt 3551-5227. Viral RNA was extracted from serum sample of pigs inoculated with the SVV KS 15-01 (parental virus) or vKS 15-01 -Clone (cloned virus) at 3 dpi. Each individual pig number is shown on top of the panel. (B-E) Stability of the EGFP reporter gene in pigs infected with EGFP -tagged virus. Agrose gel pictures showing the DNA fragment covering the EGFP insertion region generated by RT-PCR using the RNA extracted from serum (B), oral fluid (C), fecal swab (D), and nasal swab (E) samples collected at 3 dpi. Each lane was labeled with a pig number on top of the panel. Pig#25 from mock-infected group of pigs was included as a control. (F) DNA sequencing result showing EGFP deletion in virus from serum and fecal swab samples of pig #34;
[0058] Fig. 8: IFN-a response in serum samples from pigs inoculated with the parental virus, cloned virus, and EGFP-tagged virus. IFN-a production in serum was quantified by using a ProcartaPlex Porcine IFN alpha Simplex kit (eBioscience, San Diego, CA). Samples from mock-infected pigs were included as a control. Each data point shown represents the mean value + SEM from each pig group; and
[0059] Fig. 9: Neutralizing antibody titers in serum samples from pigs inoculated with the parental virus, cloned virus, and EGFP-tagged virus. Neutralizing antibody assay was performed using the parental virus KS 15-01; and an immunofluorescence focus assay with anti-VP2 mAb was used to determine the serum neutralizing antibody titer. The neutralizing antibody titer was defined as the highest serum dilution at which more than 90% of viral growth was inhibited. Samples from mock-infected pigs were included as a control. Each data point shown represents the mean value + SEM from each group of pigs.
EXAMPLES
[0060] All ranges provided herein include each and every value in the range as well as all sub-ranges there-in-between as if each such value or sub-range was disclosed. Further, all aspects and embodiments of the disclosure comprise, consist essentially of, or consist of any aspect or embodiment, or combination of aspects and embodiments disclosed herein.
[0061] The following examples are simply intended to further illustrate and explain the present disclosure. The invention, therefore, should not be limited to any of the details in these examples.
[0062] EXAMPLE 1:
[0063] A full-length cDNA infectious clone, pKS 15-01 -Clone, was constructed from a newly emerging Seneca valley virus (SVV; strain KS15-01). To explore the potential use as a viral backbone for expressing marker genes, the enhanced green fluorescent protein (EGFP)- tagged reporter virus (vKS 15-01 -EGFP) was generated using reverse genetics. In comparison to that of parental virus, the pKS 15-01 -Clone derived SVV (vKS 15-01 -Clone) replicated efficiently in vitro and in vivo, and induced similar levels of neutralizing antibody and cytokine response in infected animals; in contrast, the vKS 15-01 -EGFP showed impaired growth ability and induced lower level of immune response in infected animals. The incidence of vesicular lesions produced in vKS 15-01 -Clone-infected pigs was lower than those in parental virus-infected pigs, while no vesicular lesion was detected in vKS15-01-EGFP-infected pigs. These results demonstrated that the infectious clone and EGFP reporter virus will be important tools in further characterizing the SVV pathogenesis and development of control measures.
[0064] Materials and Methods
[0065] Cells and virus. PK-15 and BFD -21 cells were cultured in Modified Eagle medium (MEM) (Gibco) supplemented with 10% fetal bovine serum (Sigma), antibiotics (100 units/mL of penicillin and 100 μg/mL of streptomycin (Gibco)) and 0.25μg/mL fungizone at 37°C and 5% C02. The wild-type SVV, strain KS 15-01, was isolated from a pig nasal swab sample submitted to Kansas Veterinary Diagnostic Laboratory (KSVDL) and isolated virus was cultured on PK-15 cells. Recombinant viruses, vKS 15-01 -Clone and vKS 15-01 -EGFP, were rescued from transfected BFIK-21 cells and passaged on PK-15 cells (see details below). The passage two viruses were used for in vitro and in vivo characterization.
[0066] mAb production:
[0067] Construction of full-length cDNA clones of SVV KS 15-01. To obtain full-length viral genome sequence, a set of primers (Table 1) targeting conserved genomic regions of a Canadian virus strain (GenBank accession #: KC667560) were used to RT-PCR amplify viral RNA genome of SVV KS15-01. The PCR products were the sequenced. The 5'- and 3 '-end genomic sequences were further determined using GeneRacer® core Kit (Invitrogen) with specific primers (Table 1). To construct a full-length cDNA clone, five separate fragments flanked with unique enzyme restriction sites were amplified using PfuUltra High-fidelity DNA Polymerase (Agilent) and assembled together. As shown in Figure 1, a CMV promoter was inserted in front of the fragment A, while a hepatitis delta virus ribozyme element was incorporated at the 3 '-terminus of the SVV genome, following the fragment E. Both fragments A and E were cloned into pACYC177 vector through a standard DNA cloning procedure using unique restriction enzyme sites. Subsequently, fragments B, C, and D were assembled into pACYC177 vector with fragments A and E using DNA recombination method following the instruction of NEBuilder® HiFi DNA Assembly Cloning Kit (New England BioLabs). To create a molecular maker for differentiating cloned virus from parental virus, a Sacl site was inactivated with C4216 to T4216 mutation using site-directed mutagenesis method. The resulted full-length cDNA clone was designated as pKS 15-01 -Clone. To construct a full-length cDNA clone expressing EGFP, the EGFP gene (GenBank accession No. U55762; Clontech Laboratories) was synthesized and fused with a Teschovirus 2A element (T2A) at its C-terminus. The EGFP-T2A fusion gene was inserted between viral genes 2A and 2B using overlap extension PCR method (Ho et al., 1989). This full-length cDNA clone was designated as pKS 15-01 -EGFP. Primers utilized for construction of SVV cDNA clones were listed in Table 1.
[0068] Recovery of recombinant viruses. BHK-21 cells seeded in 6-well plate were transfected with the plasmid DNA of a SVV full-length cDNA clone using Lipofectamine 3000 transfection reagent following the manufacturer's instructions (Invitrogen). At 48h post- transfection, cell cultural supernatant from BHK-21 cells was transferred to PK-15 cells. Cytopathic effect (CPE) was monitored daily after infection. Recombinant viruses were harvested during 18-48 hours post infection (hpi) when significant CPE was observed. The clone SVV recovered from cDNA infectious clone of pKS 15-01 -Clone was designated as
vKS 15-01 -Clone, while the EGFP-tagged virus recovered from cDNA infectious clone of pKS15-01-EGFP was designated as vKS15-01-EGFP.
[0069] Identification of recombinant viruses. To confirm the presence of designed molecular marker (C4216 to T42i6 mutation in Sacl site) in cloned virus, vKS 15-01 -Clone, RT- PCR was performed to amplify the genomic region (nt 3551-5227) containing the specific mutation. Initially, viral RNA was extracted passage 2 of vKS 15-01 -Clone virus using the QIAamp viral RNA mini kit (Qiagen) following the manufacturer's instructions. After RNA extraction, cDNA was generated with Superscript III reverse transcriptase (Invitrogen), and the corresponding viral genomic region was amplified by PCR using the primer pair, SVV- 3547F/SVV-5200R (Table 1). Subsequently, PCR product was gel-purified and digested by Sacl. The PCR product was also subjected to DNA sequencing to confirm the presence of C42i6 to T4216 mutation. To confirm the presence of EGFP insertion in vKS15-01-EGFP, the corresponding viral genomic region (nt 3242-3700) was amplified by RT-PCR using the primer pair, SVV-6757F and SVV-7191R (Table 1), and PCR product was sent to DNA sequencing analysis.
[0070] Western blot analysis. PK-15 cells in 6-well plate were infected at a multiply of infection (MOI) of 0.01 with parental virus (KS15-01), cloned virus (vKS 15-01 -Clone), or EGFP virus (vKS 15-01 -EGFP), or mock-infected. At 18 hpi, cell lysates were harvested with 200μ1Λνε11 Pierce™ IP Lysis Buffer (Pierce). After removing cell debris by centrifuge at 1,5000 g for 15 min, cell lysate was mixed with 4x Laemmli loading buffer (Bio-Rad) containing 5% β- mercaptoethanol and denatured at 95°C for 6 min. Proteins were separated in 12.5% SDS-PAGE gel, and blotted onto nitrocellulose membrane. Before antigen detection, the membrane was blocked with 5% skim milk in lx phosphate-buffered saline (PBS) at 4°C overnight. To detect the expression of SVV VP1 and housekeeping gene β-tubulin, the membrane was incubated at room temperature with a mixture of primary antibodies, including a monoclonal antibody against VP1 (mAbl35-48) and a rabbit polyclonal antibody (abm, Canada) again β-tubulin. To detect the expression of EGFP and β-tubulin, a mixture of primary antibodies of anti-EGFP (Sigma, St. Louis, MO) and anti-B-tubulin was used. Antibodies were diluted with lx PBS supplemented with 0.1%) tween 20 (PBST). After 1 h incubation, the membrane was washed with PBST three times, and then probed with secondary antibodies, IRDye® 680LT Donkey anti-Rabbit IgG (H +
L) and IRDye® 800CW Donkey anti-Mouse IgG (H + L). The membrane was further incubated in room temperature for 1 h, and target proteins were visualized using the Odyssey Fc Infrared Imaging System (LI-COR Biosciences, Lincoln, E).
[0071] Immunofluorescence assay. PK-15 cells in 12-well plate were infected with parental virus, cloned virus, or EGFP virus at an MOI of 0.01. At 12 hpi, cell monolayers were fixed with 4% formaldehyde in PBS (pH 7.4) for 10 min, permeabilized with 0.1% Trition X- 100. After lh incubation with primary anti-VPl mAb 135-48, cell monolayers were washed with PBS for three times and further incubated for lh with Alexa Fluor® 594 AffiniPure Donkey Anti-Mouse IgG (H+L) (Jackson ImmunoResearch Inc., West Grove, PA) secondary antibody. After extensive wash, cells were analyzed under a fluorescent microscope, and pictures were taken with EVOS FL Cell Imaging System (Life technologies, Carlsbad, CA).
[0072] Virus growth kinetics and plaque forming assay. PK-15 cells around 100% confluency in 24-well culture plate were infected with 0.01 MOI of SVV KS 15-01 (parental virus), vKS 15-01 -Clone (cloned virus), or vKS 15-01 -EGFP (EGFP virus), or mock-infected. Cell cultural supernatant was harvested at 6, 12, 24, 36, 48 hpi. The virus titer was further determined by virus titration using PK-15 cells and calculated as 50% tissue culture infective doses per milliliter (TCID50/mL) according to the method of Reed and Muench (Reed and Muench, 1938). To determine the plaque morphology of the parental virus, the cloned virus and EGFP virus, a plaque assay was performed by using PK-15 cells as described previously (Fang et al., 2006).
[0073] Animal study. A total of eighteen 3-week-old pigs were housed in a large animal facility of Midwest Veterinary Service (MVS, Oakland, NE). Pigs were randomly assigned into four groups, with group 1 pigs (n=5) infected with the parental virus (KS15-01), group 2 pigs infected with the cloned virus (vKS 15-01 -Clone), group 3 pigs infected with EGFP-tagged virus (vKS 15-01 -EGFP), and group 5 pigs (n=3) mock-infected with cell culture medium. Pigs were intranasally inoculated with 5 ml/pig of the virus (or culture medium) at a dose of lxlO8 TCID50/mL. Clinical observations and rectal temperature data were recorded daily from 0-14 days post infection (dpi). Serum, oral fluid, nasal swab and fecal swab samples were collected at 0, 3, 7 and 14 dpi. The pig experiment was terminated at 14 dpi. During necropsy, gross pathology for each pig was evaluated and abnormal tissue and skin samples were collected.
[0074] Quantitative RT-PCR determining viral load in clinical samples. To evaluate viral load in serum, fecal swab, nasal swab and oral fluid samples, SVV real-time quantitative RT- PCR (qRT-PCR) was performed by Kansas Veterinary Diagnostic Laboratory (KSVDL). Briefly, viral genomic RNA was prepared using a MagMAX-96 viral RNA isolation kit (Life Technologies, Carlsbad, CA) according to the manufacturer's instructions. Subsequently, realtime RT-PCR was performed using Path-ID™ Multiplex One-Step RT-PCR Kit (Applied Biosystems, Foster City, CA) in the CFX96 Touch Real-Time PCR Detection System with the following cycling parameters: 48°C for 10 min, 95°C for 10 min, 45 cycles of 95°C for 15 sec and 60°C for 60 sec. A standard curve was established by using serial 10-fold diluted KS 15-01 virus from lxlO6 TCID50/mL to lxlO1 TdD50/mL. Viral RNA load equivalent to TdD50/mL was determined based on the standard curve.
[0075] Neutralizing antibody assay. Serum neutralizing antibody assay was performed using the parental virus KS 15-01, and the neutralizing antibody titer was determined by immunofluorescence focus assay. Briefly, serum samples were heat-inactivated at 56°C for 30 min, and then 2-fold serially diluted with MEM containing 2% horse serum (HS). The diluted serum (ΙΟΟμΙ/well) was mixed with equal volume of KS15-01 virus (200 TCID50) and incubated at 37°C. After lh incubation, 150 μΐ of the serum-virus mixture was added to a 96-well microtiter plate containing 90-100% confluent PK-15 cells and incubated at 37°C. At 18 hpi, cells were fixed using ice cold methanol at -20°C for 30 min. Fixed cells were stained with VP2 specific mAb30-158, and Alexa Fluor® 488 AffiniPure goat anti-mouse IgG (H+L) (Jackson ImmunoResearch Inc., West Grove, PA) was used as a secondary antibody. Cells in each individual wells were examined using EVOS FL Cell Imaging System (Life technologies, Carlsbad, CA). The neutralizing antibody titer was defined as the highest serum dilution at which more than 90% of virus growth was inhibited.
[0076] Analysis of swine cytokine response. The expression levels of IFN-a and IFN-γ in serum samples were determined using ProcartaPlex Porcine IFN alpha Simplex kit and ProcartaPlex Porcine IFN gamma Simplex kit (eBioscience, San Diego, CA) following the manufacturer's instructions.
[0077] Results and Conclusions
[0078] Construction of an infectious clone of a newly emerging SVV isolate KS 15-01
[0079] The parental SVV was obtained from a diagnostic case. Initially, the nasal swab samples were analyzed by next generation sequencing and Senecavirus A genome sequence was detected (Hause et al., 2016). Subsequently, the virus was isolated from a Senecavirus A positive nasal swab sample and plaque purified, designated as SVV KS 15-01. In order to construct a full- length cDNA clone, the SVV KS 15-01 isolate was re-sequenced using Sanger sequencing method. The complete genome sequence of SVV KS 15-01 (GenBank Accession # KC667560) shared a 93.9%~99.4% nucleotide sequence identity to nine complete Senecavirus A genomes in GenBank (as of March 17, 2016). Phylogenetic analysis showed that the SVV KS15-01 closely related to the recently reported US and Brazilian strains (Zhang et al., 2015; Hause et al., 2016) (data not shown).
[0080] With the availability of the complete genome sequence of KS15-01 strain, a full- length genomic cDNA clone of the virus (pKS 15-01 -Clone) was constructed using the strategy shown in Figure 1. This pKS 15-01 -Clone construct contains a CMV promoter at the 5' terminus of the viral genome, the 7281 -nucleotide full-length genome of KS 15-01, and a poly(A) tail of 22 residues incorporated at the 3' end of the genome. Compared to the genome sequence of the parental virus, the DNA sequence of pKS 15-01 -Clone contained 4 nucleotide differences (Table 2), including an additional T at 5' end, a G7 to T7 mutation at the 5'-UTR, T7234 to C7234 and C7262 to T7262 mutations at the 3'-UTR; a mutation at nucleotide C42i6 to T42i6 was introduced to inactivate the Sacl restriction enzyme site in 2C region for differentiating the cloned virus from the parental virus (Fig. 1 A-B). The C42i6 to T42i6 mutation is a silent mutation with no change on the encoded amino acid sequence.
[0081] In vitro recovery and characterization of cloned virus derived from pKS 15-01 - Clone
[0082] To rescue the cloned virus, plasmid DNA of pKS 15-01 -Clone was transfected into BHK-21 cells. At 48 h post-transfection, supernatants from the transfected cells were passaged onto PK-15 cells. At 12 h post-infection, PK-15 cells were stained using the VP2-specific mAb 30-158 (Fig. 3A). The results showed that SVV VP2 protein was specifically detected in PK-15 cells inoculated with supernatant from the transfected BHK-21 cells. Upon further passage of the supernatant onto fresh PK-15 cells (passage 2 on PK-15 cells), cytopathic effects were observed within 18 to 24h post-infection (hpi). The passage 2 viruses collected from PK-15 cells
showed an average titer of 1x10 TCID50/ml. These results indicate that viable and infectious cloned virus (vKS 15-01 -Clone) was recovered from the full-length cDNA infectious clone pKS 15-01 -Clone.
[0083] The growth kinetics of the cloned and parental viruses was compared. PK-15 cells were infected with each of the viruses at an MOI of 0.01 and harvested at 6, 12, 24, 36, 48 hpi. The results showed that the cloned virus possessed growth kinetics similar to those of the parental virus (Fig. 4 A). The peak viral titers reached at 36 hpi for both viruses, in which the peak titer of the cloned virus was 108 0 TCID50/ml, while the peak titer of the parental virus was 108 4 TCID50/ml. Plaque morphology of these viruses was further determined. As shown in Fig. 4B, the plaque size produced by the cloned virus was similar to that of the parental virus. These results indicate that the cloned virus possesses in vitro growth properties similar to those of the parental virus.
[0084] To differentiate the cloned virus from the parental virus, a Sacl restriction enzyme site was inactivated in 2C region (Figure 1). As shown in Figure 2A, a 1677-bp RT-PCR fragment derived from amplifying nucleotides 3551 to 5227 of the viral genome was cleaved by Sacl in the parental virus. In contrast, the corresponding RT-PCR product amplified from the cloned virus was not cleaved by Sacl.
[0085] SVV infectious clone as a vector for expressing the enhanced green fluorescent reporter protein
[0086] With the availability of this infectious clone, its potential in expressing a reporter gene was further explored. A synthetic gene encoding a fusion protein of EGFP and teschovirus 2A peptide (T2A) was cloned into the 2A/2B junction of pKS 15-01 backbone and generated the plasmid pKS15-01-EGFP (Fig. 1). The T2A is a "self-cleaving" peptide allowing highly efficient cleavage between genes upstream and downstream of the 2A peptide. This construct allows ribosome skipping events occurring at the SVV 2A and the engineered T2A regions during translation of SVV polyprotein, leading to release EGFP-2A protein without affecting the functions of other SVV proteins.
[0087] The plasmid DNA of the construct pKS 15-01 -EGFP was transfected into BHK-21 cells, and the cell culture supernatant from transfected BFD cells was passaged onto PK-15 cells at 48h post transfection. The live EGFP-expressing cells were visible as early as 6 h post
infection (Fig. 3A). To confirm the expression of viral proteins, at 12 hpi, cells were fixed and stained with anti-VP2 mAb 30-158. An Alexa Fluor® 594 AffiniPure Donkey Anti-mouse IgG (H+L) was used as the secondary antibody. Immunofluore scent microscopy showed the expression of both EGFP and VPl proteins (Fig. 3 A). To determine if the expression of EGFP affected virus replication, the growth kinetics of the EGFP-tagged virus (vKS 15-01 -EGFP) was compared to those of the parental wild-type and cloned viruses. The vKS15-01-GFP displayed a similar growth behavior as the parental virus and cloned virus (Fig. 4A-B). To determine the stability of the EGFP gene at the insertion site, the genomic region containing EGFP insertion of passage 2 virus as amplified by RT-PCR and subjected for sequencing. The results confirmed the existence of intact EGFP in vKS 15-01 -EGFP (Fig. 2C). The expression of EGFP protein in vKS 15-01 -EGFP infected cells using western blot was further analyzed, and the vKS 15-01 - Clone and parental viruses were included as comparison. The result confirmed the presence of the EGFP with ~27-kDa and a cleaved VPl with ~32-kDa in cells infected with vKS 15-01 - EGFP, while only VPl with ~32-kDa was detected in cells infected with the parental and cloned viruses (Fig. 3B).
[0088] Clinical Symptoms in nursery pigs infected with parental and cloned SVVs
[0089] A total of eighteen 3 -week-old pigs, divided into four groups, were infected with parental virus KS 15-01 (group 1, n=5), cloned virus vKS 15-01 -Clone (group 2, n=5), EGFP- tagged virus vKS15-01-EGFP (group 3, n=5), or mock-infected with cell cultural medium (group 4, n=3). As shown in Table 3, all pigs in group 1 and group 2 developed clinical signs with respiratory distress and lethargy (Fig. 5B), and three pigs in group 1 and three pigs in group 2 had rectal temperature over 40°C during the first 6 days post inoculation (Fig. 5A, Table 5). Fluid filled vesicles on the snout started appearing at dpi 1 on 5 pigs from group 1 (Fig 5C, Table 4). These vesicles progressed into ulcerative lesions and resolved in 3-4 days (Fig. 5A). Gross ulcerative lesions on distal limbs, especially around the coronary bands, were also observed on two pigs in group 1, which started at dpi 7 (Fig. 5D, Table 4). In contrast, no apparent clinical signs were observed in group 3 pigs and group 4 pigs. Through the time course of this study, rectal temperature was normal for all pigs in groups 3 and 4 except one pig in group 3 whose temperature is over 40°C at 2, 3, and 14 dpi (Table 5). At 14 dpi, one pig from group 1 shown healing scar from the vesicular ulcer on the snout (Fig. 5E); all five pigs from group 1 showed
round, discrete erosive lesions around the coronary bands of the lateral claws (Fig. 5F), and lesions on any combination of legs with front leg injury being more common. In one of the group 3 pigs, a footpad erosive lesion was observed on the right front leg during necropsy, but no dorsal snout lesion and coronary band lesion were observed in this group of pigs through time course of study. At necropsy (14 dpi), enlarged mesenteric lymph nodes were observed on two pigs in group 2. Mild lung lesions were observed in seven pigs, including two pigs from group 1, three pigs from group 2, and three pigs from group 3. One pig from group 1 showed severe multifocal lung lesions, which was suspected to be associated with bacterial infection but not due to SVV infection, since the similar type of lung lesion was not observed from other four pigs in group 1. Gross pathology was also performed on tonsil, heart, liver, spleen, kidney, and intestine; no gross lesion was observed on these internal organs from group 1-4 pigs.
[0090] In vivo growth property of parental and cloned virus in pigs
[0091] Serum, nasal swab, oral fluid and fecal swab samples were collected to determine the level of viral replication/shedding in pigs. At 3 and 7 dpi, qRT-PCR results showed that SVV RNA was detected in all the samples from pigs of groups 1 and 2. In comparison to that of group 1 pigs, a higher level of viral RNA was detected in serum and fecal samples from group 2 pigs at 3 dpi, but the amount of viral RNA reached the similar level for both groups of pigs at 7 dpi (Fig. 6A-B). At 14 dpi, both groups of pigs almost cleared out of the viruses, in which minimal amount of viral RNA was detected in serum, fecal and nasal swab sample (Fig. 6A-C); however, low levels of viral RNA (equivalent to 102 0 TCID50/ml) still remained in oral fluid samples (Fig. 6D). In group 3 pigs, at 3 and 7 dpi, only one pig (#34) showed positive qRT-PCR result in the serum sample, but four out of five pigs showed positive qRT-PCR result in nasal swab, and all five pigs showed positive qRT-PCR result in oral fluid and fecal swab samples (Fig. 6). At 14 dpi, viral RNA was not detected in serum and nasal swab samples, and only a minimal amount (equivalent to 10° 91 TCID50/ml) was detected in one of the fecal samples (Fig. 6B). In comparison to that of groups 1 and 2 pigs, viral RNA levels are lower in all samples (except oral fluid at 14 dpi) from group 3 pigs; and some differences were statistically significant at 3 dpi in serum, nasal swab and fecal swab samples (Fig. 6A-C), suggesting that the EGFP insertion impaired the in vivo growth ability of the virus.
[0092] In vivo stability of mutations or insertions introduced in SVV
[0093] As indicated above, to differentiate the cloned virus from the parental virus, C to T mutation was introduced to inactive the Sacl restriction enzyme site. To determine the stability of the Sacl mutation in pigs, the corresponding region (nt 3551 - 5227) was RT-PCR amplified using RNA extracted from serum samples of group 2 pigs that inoculated with the cloned virus. As a comparison, serum samples from group 1 pigs that inoculated with the parental virus were included in the analysis. The PCR product was subjected to DNA sequencing analysis. The result confirmed the presence of the Sacl mutation in all five group 2 pigs, but not in any of the group 1 pigs. The PCR product was further verified by restriction enzyme digestion using Sacl enzyme. As shown in Fig. 7 A, a 1677-bp PCR fragment derived from each of group 2 pigs was not cleaved by Sacl; in contrast, the PCR fragment derived from the group 1 pigs was cleaved by Sacl. The same method was used to verify the EGFP insertion in the virus from group 3 pigs. Initially, viral RNA from the serum of pig #34 (showed positive qRT-PCR result) was used to RT-PCR amplify the EGFP insertion region, and the PCR product was subjected to sequence analysis. The pair of primers was design to cover the 3487- 4472 nucleotide region of the viral genome. With the 720-bp EGFP insertion in this region, a 986-bp PCR product was expected. However, a PCR product close to 500 bp was obtained and the sequencing result revealed that the amino acids 63 to 237 of EGFP were deleted (Fig. 7B and 7F). The corresponding EGFP insertion region using viral RNA from oral fluid, nasal swab and fecal swab samples was further amplified. Interestingly, a 986-bp PCR product was obtained from all of these samples except two nasal swab samples with very low viral loads (10° 6 TdD5o/ml) and sequencing result confirmed the existence of full-length intact EGFP gene in the virus from each of the group 3 pigs (Fig. 7C-E). In additional, a PCR product around 500 bp was also amplified from the fecal swab sample of pig #34, and the sequencing result indicated that the EGFP deletion was exactly the same as that from the serum sample.
[0094] Immune responses stimulated by parental and cloned viruses
[0095] The host immune responses stimulated by SVV parental and cloned viruses were further analyzed. Because IFN-a is an indicator of early innate immune response, IFN-a expression was initially measured in serum samples from infected and control pigs through the time course of study. Overall, only a minimal level of IFN-a was stimulated in all the pigs and there is no significant difference on the IFN-a expression levels between different groups of pigs
(Fig. 8). At 3 dpi, mean IFN-a concentration is slightly higher in groups 1 (9.8 pg/ml) and 2 pigs (14.0 pg/ml) compared to that of group 3 (1.8 pg/ml) and group 4 pigs (6.9 pg/ml) (Fig. 8B), but the difference is not statistically significant. The expression level of IFN-γ as an indicator as cell-mediated immune response was measured, but IFN-γ was un-detectable in all groups of pigs through the time course of the study. In contrast, SVV infection stimulated a rapid robust serum neutralizing (SN) antibody response (Fig. 9). The SN antibody response can be observed at 3 dpi in group 1 and group 2 pigs. At 7 and 14 dpi, the SN titer reached more than 1 :2000 in some of the pigs from group 1 and 2. The SN titers in group 3 pigs are consistently lower in comparison to these two groups (groups 1 and 2). Among the five pigs in group 3, pig #34 consistently showed the highest SN titers with the titer of 1 :256 at 7 dpi, and 1 : 1024 at 14 dpi. The SN titers of the other four pigs in group 3 were at the lower levels, but were still 2-100-fold higher than those of Mock-infected pigs.
[0096] Discussion
[0097] In this study, a reverse-genetics system for a newly emerging SVV isolate KS 15-01 was established. It was demonstrated that the full-length cDNA clone (pKS15-01) was replication competent when transfected into BHK-21 cells; and was also infectious when passaged onto PK-15 cells. Experimental infection of pigs with the cloned virus (vKS 15-01 - Clone) further confirmed that the cDNA clone was infectious in vivo. In comparison to the parental virus, the cDNA clone contains three nucleotide mutations, including an additional U at 5' end, a G7 to U7 mutation at the 5' -UTR, U7234 to C7234 and C7262 to U7262 mutations at the 3'- UTR. These mutations may reflect quasispecies in the virus stock or may have been introduced by cloning procedures. In infected PK-15 cells, the cloned virus showed similar growth kinetics and plaque morphology to those of the parental virus. However, the pig experiment showed that the cloned virus caused slightly less clinical symptoms than that of the parental virus. Four pigs in group 2 showed fever and/or depression, while all pigs in group 1 showed fever and/or depression. In the group 2 pigs, no vesicular lesion was observed, but skin lesions were observed in all five of group 1 pigs. Whether these in vivo pathogenic differences that were observed were due to those nucleotide changes at 5'- and 3'- UTRs is a subject of investigation in the future. In previous studies, the impact of 5' -UTR on the virulence of coxsackievirus B, a member of the Enterovirus genus in the Picornaviridae family, has been demonstrated (Dunn et
al., 2000; M'Hadheb-Gharbi et al., 2007; Rinehart et al., 1997; Zhong et al., 2008). In addition, it was reported that the enhanced IRES activity by the 3'-UTR element of FMDV determines the virulence of different isolates (Garcia-Nunez et al., 2014). As an initial analysis for the potential effect of SVV 5'- and 3'- UTR on the viral pathogenesis/virulence, the SVV full-length genome sequences that are available in the Genbank were searched. All three nucleotides changes that were observed in this study are able to be found in field strains. An additional U at the 5' end and U7 at the 5' -UTR are contained in the genome of SVV-001 strain and a newly emerging Chinese strain (CH-01-2015; Wu et al., 2016), while C7234 is observed in the genomes of three newly emerging strains in Brazil (Leme et al., 2015) and one US strain (USA/IA40380/2015; Zhang et al., 2015), and U7262 exists in the genomes of SVV-001 strain and most newly emerging strains. These data do not appear to provide a direct correlation between the viral pathogenesis and a specific nucleotide mutation in 5' -UTR or 3' -UTR region. However, to the best of our knowledge, the authentic 5' - end sequence of SVV was determined for the first time in this study using 5' RACE method. For future in depth analysis, more accurate 5' -UTR (and 3' -UTR) sequences are required for field SVV strains, especially for those strains with different pathogenic/virulence properties. In addition, it is worth to note here that the cloned virus contains the nucleotide C42i6 to T42i6 to inactivate the Sacl restriction enzyme site in 2C. Although this is a silent mutation, it is unknown whether this mutation has the effect on viral RNA structure and expression level(s) of certain viral protein(s), which may ultimately affect the pathogenesis of the virus. Nevertheless, the SVV infectious clone generated in this study will be a useful tool allowing us to introduce site-directed mutations to the 5'-, 3' -UTR or other genomic regions to identify the key nucleotide(s) that might affect the pathogenesis of the virus.
[0098] One of the important applications of the infectious clone is to serve as viral backbone for expression of foreign genes. Green fluorescent protein (GFP) is commonly used as a foreign reporter gene and the EGFP -tagged virus is an important tool to study the basic viral biology and pathogenesis (Fukuyama et al., 2015; Zhao et al., 2015). On the other hand, modified live virus expressing a foreign marker protein that generated from the reverse genetics could be used in future marker vaccine development (Fang et al., 2008; Fang et al., 2006). In a previous study (Poirier et al., 2012), recombinant EGFP-expressing reporter virus, SVV-EGFP, was constructed using prototypic strain SVV-001. The reporter virus was used for developing a
SVV-based oncolytic agent, which was only characterized in lung cancer cell lines and tumor- bearing mice, but not in the natural host cells and animals. In this study, EGFP-tagged SVV was generated using the strain KS 15-01 that was isolated from infected pigs, and the EGFP-SVV was characterized in PK-15 cells (porcine kidney cell line) and nursery pigs. The foreign gene insertion site identified previously (Poirier et al., 2012) was adapted, in which a GFP gene was inserted between 2 A and 2B. In vitro growth characterization showed that the recombinant EGFP-SVV had similar growth kinetics and plaque morphology as those of parental virus (Fig. 4). This result is consistent with the previous report that proliferation kinetics of SVV-001 and SVV-GFP were indistinguishable (Poirier et al., 2012). However, when EGFP-SVV was inoculated into the pigs, EGFP-SVV was only detected in serum samples from one of the five inoculated pigs (pig #34 in group 3). Sequencing results showed that viral RNA from the serum of pig #34 contains a 525-bp deletion in the EGFP gene, and resulted in the recombinant virus expressing a 195-bp fragment of EGFP. The partial EGFP insertion appeared to attenuate the in vivo growth ability of the virus, in which the virus titer in serum was about 653-fold and 3-fold lower than that of parental virus at 3 dpi and 7 dpi, respectively. Interestingly, intact full-length EGFP was detected in nasal swab and fecal materials from all five pigs inoculated with EGFP- SVV. This result suggested that SVV carrying 195-bp fragment of EGFP is capable to infect the pig systemically and the viral particles were able to enter into the blood circulation system; the recombinant virus carrying intact full-length EGFP had limited ability to cause systemic infection in pigs, but its infectivity at the local site is unknown. The intact EGFP-SVV could be trapped at certain sites inside the pig, and then be expelled out from the body through nasal secretion and fecal discharge. The impaired growth ability reflects to the attenuated pathogenic properties of the virus, in which no clinical signs and vesicular lesions were observed in EGFP- SVV inoculated pigs. Taken together, the data demonstrated the flexibility of the viral genomic region around 2A and 2B; however, the SVV genome may have a size limitation for a foreign gene insertion. The mechanism for tolerating foreign gene insertion in between 2A and 2B (or other alternative sites) of SVV genome remains to be determined. Furthermore, foreign gene insertion impaired the viral growth ability at certain level in vivo, resulting in attenuated pathogenic properties.
[0099] The data from immunological analysis suggested that the humeral immunity plays an important role for SVV clearance. Innate and cell mediated immunity was analyzed by measuring the expression levels of two representative IFNs, IFN-a and IFN-γ. Only minimal levels of IFN-a were detected in serum samples from pigs of group 1 (9.8 pg/mL) and group 2 (14.0 pg/mL) at 3 dpi, but the levels are not significant from that of Mock-control group (6.9 pg/mL). IFN-γ was un-detectable in all groups of pigs through the time course of study. In contrast to IFN response, both group 1 and 2 pigs developed rapid neutralizing antibody response with high levels of SN titers being detected as early as 3 dpi. At 7 dpi, a significant increase in neutralizing antibodies were observed with the mean SN titers reaching 1 :2779 in group 1 pigs and 1 : 1642 in group 2 pigs; such a high level of SN titers remained at 14 dpi. The increased SN titer correlates well with the decreased viral titer in serum, nasal secretion and fecal material through the time course of study, in which the virus appeared to be cleared out from blood circulation and other local sites at 14 dpi. In group 3 pigs, a certain level of SN antibodies were induced in 4 of the pigs, especially in pig #34 with SN titer reached 1 :256 at 7 dpi and 1 : 1024 at 14 dpi, suggesting that active viral replication is required to stimulate high level of SN response. The level of SN Ab seems also correlated to the viral clearance in group 3 pigs. However, EGFP specific antibody response was not detected in serum samples from all pigs in group 3 (data not shown). For those 4 pigs with a maintained full-length EGFP gene but no virus detected in serum, it is unknown how much viral replication occurred at local tissue sites and whether EGFP protein was expressed to a level capable to stimulate antibody response. Initially, a certain level of EGFP-specific antibody to be detected in pig#34 was expected, but there was no significant difference on the antibody titers between pig#34 and other pigs in group 3 and group 4. The data could be explained by quickly clearing virus from infected animals or antibody response lower than the detection limit. Other the other hand, the truncated EGFP peptide (aa 1-62 and aa 237- 239) remaining in pig#34 may not be antigenic. Taken together, the data suggest that the SVV 2A and 2B junction could be a potential site for introducing a foreign marker gene; however, future studies are needed to manipulate the size of the foreign gene and insertion strategies to optimize the growth ability and immunogenicity of the recombinant virus.
[00100] In conclusion, a reverse genetic system for an emerging SVV and exploring the in vivo growth and pathogenic properties of the parental and cloned viruses was developed. The
SVV infectious clones and the information generated from this study has significant contributions for the future study of basic viral biology and development of control measures for SVV.
• An infectious clone (pKS 15-01 -Clone) of newly emerging strain of SVV was constructed.
• Cloned virus replicated efficiently in vitro and in vivo.
• Cloned virus induced similar immunological response as that of parental virus.
• Pigs infected with cloned virus displayed lower incidence of vesicular lesion than those infected with parental virus.
• EGFP -tagged SVV showed impaired replication ability and attenuated pathogenic properties.
[00101] Table 1. Primers for constructing full-length cDNA clone and sequencing viral genome.
SW-7191R GTTAGATAGCGTGGCGGCCAAGGC (SEQ ID No. 35) DNA sequencing
[00102] Table 2. Nucleotide differences between parental KS 15-01 isolate and full-length cDNA clone
Nucleotide
Nucleotide in Nucleotide in
position within Gene position
parental virus cDNA clone
KS 15-01 genome
N/A N/A T 5' UTR
7 G T 5' UTR
7234 T C 3' UTR
7262 C T 3' UTR
[00103] Table 3. Daily clinical observation from dpi 0 to dpi 14.
Coronary band lesion 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 dpi Attitude 0 1 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0
Respiratory 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
Abdominal appearance 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
Snout lesion 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
Oral Mucosa lesion 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
Coronary band lesion 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 dpi Attitude 0 0 1 1 1 1 1 2 2 0 0 0 0 0 0 0 0 0
Respiratory 0 0 0 1 0 0 0 0 1 0 0 0 0 0 0 0 0 0
Abdominal appearance 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
Snout lesion 0 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
Oral Mucosa lesion 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
Coronary band lesion 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 dpi Attitude 0 0 1 2 0 0 1 1 1 0 0 0 0 0 0 0 0 0
Respiratory 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
Abdominal appearance 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
Snout lesion 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
Oral Mucosa lesion 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
Coronary band lesion 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 dpi Attitude 0 0 2 2 0 0 1 1 0 0 0 0 0 0 0 0 0 0
Respiratory 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
Abdominal appearance 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
Snout lesion 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
Oral Mucosa lesion 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
Coronary band lesion 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 dpi Attitude 0 0 2 2 0 0 1 1 0 0 0 0 0 0 0 0 0 0
Respiratory 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
Abdominal appearance 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
Snout lesion 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
Oral Mucosa lesion 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
Coronary band lesion 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 dpi Attitude 0 0 1 1 0 0 1 1 0 0 0 0 0 0 0 0 0 0
Respiratory 0 0 1 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0
Abdominal appearance 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
Snout lesion 0 0 0 0 3 0 0 0 0 0 0 0 0 0 0 0 0 0
Oral Mucosa lesion 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
Coronary band lesion 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 dpi Attitude 1 0 1 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0
Respiratory 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
Abdominal appearance 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
Snout lesion 0 0 0 0 3 0 0 0 0 0 0 0 0 0 0 0 0 0
Oral Mucosa lesion 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
Coronary band lesion 0 0 3 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 dpi Attitude 1 0 1 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0
Respiratory 0 0 1 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0
Abdominal appearance 0 1 1 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0
Snout lesion 0 0 1 0 3 0 0 0 0 0 0 0 0 0 0 0 0 0
Oral Mucosa lesion 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
Coronary band lesion 0 0 3 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0
10 dpi Attitude 0 0 0 1 0 1 0 1 0 0 0 0 0 0 0 0 0 0
Respiratory 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0
Abdominal appearance 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
Snout lesion 0 0 0 0 3 0 0 0 0 0 0 0 0 0 0 0 0 0
Oral Mucosa lesion 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
Coronary band lesion 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0
11 dpi Attitude 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0
Respiratory 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0
Abdominal appearance 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
Snout lesion 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
Oral Mucosa lesion 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
Coronary band lesion 0 0 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
12 dpi Attitude 1 0 1 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0
Respiratory 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0
Abdominal appearance 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
Snout lesion 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
Oral Mucosa lesion 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
Coronary band lesion 0 0 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
13 dpi Attitude 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
Respiratory 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
Abdominal appearance 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
Snout lesion 0 0 0 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0
Oral Mucosa lesion 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
Coronary band lesion 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
14 dpi Attitude 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0
Respiratory 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
Abdominal appearance 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
Snout lesion 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
Oral Mucosa lesion 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
Coronary band lesion 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 a: attitude score. 0, normal; 1, mildly depressed; 2, moderately depressed; 3, moribund.
b: respiratory score. 0, normal; 1, mildly abnormal respiratory character; 2, severely abnormal respiratory character (eg: dyspnea), c: abdominal appearance score. 0, normal; 1, gaunt.
d, e, f: surface lesion score on snout, oral mucosa and coronary band. 0, normal surfaces; 1, hyperemia; 2, blister (vesicle formation); 3, ulcerative lesion
[00104] Table 4. Rectal temperature record from dpi 0 to dpi 14.
5 104.6 104.5 106.3 104.3 104.2 102 103.9 104.1 103 103.6 103.3 102.9 102.9 103.4 102.8 102.5 102.7 103
6 104.8 104.7 104.1 103.2 103.7 102.8 103.6 104.1 103.2 103.7 102.2 103.7 102.9 104.2 102.9 102.6 102.6 102.3
7 103.8 104 103.7 103.2 103.4 103.3 103.5 103.5 103.3 103.7 102.4 103.1 102.3 103.3 102.8 103 102.5 102.1
8 103.8 103.9 103.6 103.4 104.4 102.9 103.8 102.8 103.2 102.4 103.1 102.9 103 102.7 103.2 102.5 103.1 103
9 104.2 103.6 104.2 103.6 103.4 102 104 103.2 103.6 103.7 102.1 103.6 103.2 103 103.3 102.2 102.8 103.7
10 104 103.6 103.2 103.4 104.1 103.1 103.5 104.6 103.7 103.4 103.1 103.3 103.5 103.3 102.6 103.4 103 103.1
11 103.9 103.1 103.9 103.3 103.6 104.4 103.4 102.6 102.9 103.2 103.2 102.8 102.8 103.3 103.4 103 103.3 102.2
12 104.4 104.3 103.6 103.8 104.1 104.3 104.8 103.1 102.4 103.1 102.7 104 103 102.5 102.9 102.4 102.2 103.4
13 104.6 104.2 104.2 104.3 103.8 103 103.1 103.1 102.7 103.5 103.5 103 102.8 103.5 102.8 103.3 103 102.7
14 103 103.2 103.2 103.2 103.6 102 103.7 103.4 102.9 103.3 105.4 102.8 102.8 103.1 102.4 102.4 102.9 103.2 a: temperature in Fahrenheit (°F).
[0100] Table 5. Surface lesions on snout and coronary band of the parental virus infected animals.
dpi l/2cm x l/2cm central dorsal part of snout dpi Snout lesions resolved
Claims
What is claimed is:
An immunogenic composition comprising a Seneca Valley Virus (SVV) antigen selected from the group consisting of a killed virus, live virus, modified live virus, modified killed virus, a nucleic acid composition, a protein composition, and a chimeric composition. The immunogenic composition of claim 1, wherein the Seneca Valley virus has a sequence with at least 80% sequence homology with a sequence from the group consisting of Genbank Accession No. KC667560, SEQ ID No. 1, SEQ ID No. 2, SEQ ID NO. 3, SEQ ID No. 36, SEQ ID No. 37, SEQ ID No. 38, and combinations thereof.
The immunogenic composition of claim 1, further comprising an additional element selected from the group consisting of a pharmaceutical carrier, an adjuvant, an antigen from at least one additional pathogen other than SVV, a preservative, a stabilizer, a color, a flavor, and any combination thereof.
The immunogenic composition of claim 3, wherein the antigen from at least one additional pathogen other than SVV is selected from the group consisting of Actinobacillus pleuropneumonia; Adenovirus; Alphavirus such as Eastern equine encephalomyelitis viruses; Bordetella bronchiseptica; Brachyspira spp., preferably B. hyodyentheriae; B. piosicoli, Brucella suis, preferably biovars 1, 2, and 3; Clasical swine fever virus; Clostridium spp., preferably CI. difficile, CI. perfringens types A, B, and C, CI. novyi, Cl.septicum, CI. tetani; Coronavirus, preferably Porcine Respiratory Corona virus; Eperythrozoonosis suis; Erysipelothrix rhsiopathiae; Escherichia coli; Haemophilus parasuis, preferably subtypes 1, 7 and 14: Hemagglutinating encephalomyelitis virus; Japanese Encephalitis Virus; Lawsonia intracellularis; Leptospira spp.; preferably Leptospira australis; Leptospira canicola; Leptospira grippotyphosa; Leptospira icterohaemorrhagicae; and Leptospira interrogans; Leptospira pomona; Leptospira tarassovi; Mycobacterium spp. preferably M. avium; M. intracellulare; and M.bovis; Mycoplasma hyopneumoniae (M hyo); Pasteurella multocida; Porcine cytomegalovirus; Porcine Parvovirus; Porcine Reproductive and Respiratory Syndrome (PRRS) Virus; Pseudorabies virus; Rotavirus; Salmonella spp.; preferably S. thyhimurium; and S. choleraesuis; Staph, hyicus; Staphylococcus spp. preferably Streptococcus spp., preferably Strep, suis; Swine herpes virus; Swine
Influenza Virus; Swine pox virus; Swine pox virus; Vesicular stomatitis virus; Virus of vesicular exanthema of swine; Leptospira Hardjo; Mycoplasma hyosynoviae; Poliovirus; Rhinovirus; hepatitis A virus; foot-and-mouth disease virus (FMDV); swine vesicular disease (SVDV), and any combination thereof.
5. A method for reducing the incidence or severity of clinical symptoms of SVV comprising the step of administering the immunogenic composition of claim 1 to an animal or human.
6. The method of claim 5, wherein the clinical symptoms of SVV are selected from the group consisting of lesions, skin surface lesions, vesicular lesions on oral mucosa, snout lesions, nares lesions, distal limb coronary band lesions, anorexia, lameness, lethargy, fever, decreased viral load, respiratory distress, and any combination thereof.
7. The method of claim 5, wherein the immunogenic composition is administered to each animal or human one time, two times, three times, four times, or five times.
8. The method of claim 5, wherein the immunogenic composition is effective after administration of a single dose of said immunogenic composition.
9. The method of claim 5, wherein the immunogenic composition is administered in a dose of from about 0.1 to lOOC^g per kilogram of weight of the animal or human.
10. The method of claim 5, wherein the immunogenic composition is administered by a systemic route selected from the group consisting of intravenous, intramuscular, intradermal, subcutaneous, oral, nasal, and any combination thereof.
11. A method for reducing the incidence or severity of clinical symptoms of idiopathic vesicular disease comprising the step of administering the immunogenic composition of claim 1 to an animal or human.
12. The method of claim 11, wherein the clinical symptoms of idiopathic vesicular disease are selected from the group consisting of lesions, skin surface lesions, vesicular lesions on oral mucosa, snout lesions, nares lesions, distal limb coronary band lesions, anorexia, lameness, lethargy, fever, decreased viral load, respiratory distress, and any combination thereof.
13. The method of claim 11, wherein the immunogenic composition is administered to each animal or human one time, two times, three times, four times, or five times.
14. The method of claim 11, wherein the immunogenic composition is effective after administration of a single dose of said immunogenic composition.
15. The method of claim 11, wherein the immunogenic composition is administered in a dose of from about 0.1 to lOOC^g per kilogram of weight of the animal or human.
16. The method of claim 11, wherein the immunogenic composition is administered by a systemic route selected from the group consisting of intravenous, intramuscular, intradermal, subcutaneous, oral, nasal, and any combination thereof.
17. A method for reducing the incidence or severity of clinical symptoms of a pathogen selected from the group consisting of Poliovirus, Rhinovirus, hepatitis A virus, foot-and- mouth disease virus (FMDV), swine vesicular disease (SVDV), and any combination thereof comprising the step of administering the immunogenic composition of claim 1 to an animal or human.
18. The method of claim 17, wherein the clinical symptoms of said pathogen are selected from the group consisting of lesions, skin surface lesions, vesicular lesions on oral mucosa, snout lesions, nares lesions, distal limb coronary band lesions, anorexia, lameness, lethargy, fever, respiratory distress, decreased viral load, and any combination thereof.
19. The method of claim 17, wherein the immunogenic composition is administered to each animal or human one time, two times, three times, four times, or five times.
20. The method of claim 17, wherein the immunogenic composition is effective after administration of a single dose of said immunogenic composition.
21. The method of claim 17, wherein the immunogenic composition is administered in a dose of from about 0.1 to 1000μg per kilogram of weight of the animal or human.
22. The method of claim 17, wherein the immunogenic composition is administered by a systemic route selected from the group consisting of intravenous, intramuscular, intradermal, subcutaneous, oral, nasal, and any combination thereof.
23. An immunogenic composition comprising a killed Seneca Valley Virus having at least 90% sequence homology or identity with a sequence selected from the group consisting of GenBank Accession # KC667560, SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 3, SEQ ID No. 36, SEQ ID No. 37, and SEQ ID No. 38.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201662323339P | 2016-04-15 | 2016-04-15 | |
| US62/323,339 | 2016-04-15 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2017181070A1 true WO2017181070A1 (en) | 2017-10-19 |
Family
ID=60042230
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2017/027708 Ceased WO2017181070A1 (en) | 2016-04-15 | 2017-04-14 | Vaccine against seneca valley virus |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2017181070A1 (en) |
Cited By (13)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109097495A (en) * | 2018-08-16 | 2018-12-28 | 金宇保灵生物药品有限公司 | Senecan virus and foot and mouth disease virus dual real-time fluorescence quantitative PCR detection kit |
| WO2019014144A1 (en) * | 2017-07-12 | 2019-01-17 | Boehringer Ingelheim Vetmedica, Inc. | Senecavirus a immunogenic compositions and methods thereof |
| CN109321683A (en) * | 2018-12-24 | 2019-02-12 | 湖南新南方养殖服务有限公司 | A kind of A type Sai Nika viral diagnosis primer, kit, method for detecting virus and application |
| CN109498727A (en) * | 2018-12-28 | 2019-03-22 | 舞钢市畜产品质量检测中心 | A kind of Chinese medicine composition and preparation method thereof for treating eperythrozoonosis |
| CN110205405A (en) * | 2017-12-25 | 2019-09-06 | 中国农业科学院兰州兽医研究所 | A kind of kit and primer and probe of detection and identification Seneca Valley virus, foot and mouth disease virus O, A and Asial type |
| CN110317278A (en) * | 2019-08-02 | 2019-10-11 | 天康生物(上海)有限公司 | The fusion protein and its encoding gene of SVV and FMDV, expression vector, cell line, engineering bacteria and vaccine and application |
| CN110542755A (en) * | 2018-05-28 | 2019-12-06 | 金宇保灵生物药品有限公司 | kit for detecting Selenecar valley virus by using immune labeling method and detection method thereof |
| CN111118040A (en) * | 2020-02-01 | 2020-05-08 | 青岛农业大学 | A recombinant type A Seneca virus expressing luciferase |
| WO2021011619A1 (en) * | 2019-07-15 | 2021-01-21 | South Dakota Board Of Regents | Senecavirus a virus strains and immunogenic compositions therefrom |
| CN112390861A (en) * | 2020-09-30 | 2021-02-23 | 信阳农林学院 | Cell line for expressing porcine Saxifraga vallismortis VP1 protein, construction method and application |
| CN113308480A (en) * | 2021-06-17 | 2021-08-27 | 河北农业大学 | A-type seneca virus SVA/HeB full-length infectious cDNA clone and preparation method and application thereof |
| CN116459355A (en) * | 2020-05-15 | 2023-07-21 | 金宇保灵生物药品有限公司 | Method for distinguishing Sein card virus from foot-and-mouth disease virus symptomatically by using domestic rabbits |
| WO2026006491A1 (en) * | 2024-06-25 | 2026-01-02 | Cornell University | Senecavirus a (sva) vaccine compositions and methods thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20140348798A1 (en) * | 2003-09-26 | 2014-11-27 | Novartis Ag | Seneca valley virus based compositions and methods for treating disease |
-
2017
- 2017-04-14 WO PCT/US2017/027708 patent/WO2017181070A1/en not_active Ceased
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20140348798A1 (en) * | 2003-09-26 | 2014-11-27 | Novartis Ag | Seneca valley virus based compositions and methods for treating disease |
Non-Patent Citations (2)
| Title |
|---|
| DATABASE GenBank 26 May 2013 (2013-05-26), "Seneca valley virus strain 11-55910-3, complete genome", XP055433454, retrieved from NCBI Database accession no. KC667560.1 * |
| UDDOWLA ET AL.: "A Safe Foot-and-Mouth Disease Vaccine Platform with Two Negative Markers for Differentiating Infected from Vaccinated Animals", JOURNAL OF VIROLOGY, vol. 86, no. 21, 2012, pages 11675 - 11685, XP055433459 * |
Cited By (18)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11179457B2 (en) | 2017-07-12 | 2021-11-23 | Boehringer Ingelheim Animal Health USA Inc. | Senecavirus a immunogenic compositions and methods thereof |
| WO2019014144A1 (en) * | 2017-07-12 | 2019-01-17 | Boehringer Ingelheim Vetmedica, Inc. | Senecavirus a immunogenic compositions and methods thereof |
| CN110205405A (en) * | 2017-12-25 | 2019-09-06 | 中国农业科学院兰州兽医研究所 | A kind of kit and primer and probe of detection and identification Seneca Valley virus, foot and mouth disease virus O, A and Asial type |
| CN110205405B (en) * | 2017-12-25 | 2022-09-23 | 中国农业科学院兰州兽医研究所 | Kit, primer and probe for detecting and identifying O, A and Asial types of Seneca Valley virus, foot-and-mouth disease virus |
| CN110542755A (en) * | 2018-05-28 | 2019-12-06 | 金宇保灵生物药品有限公司 | kit for detecting Selenecar valley virus by using immune labeling method and detection method thereof |
| CN109097495A (en) * | 2018-08-16 | 2018-12-28 | 金宇保灵生物药品有限公司 | Senecan virus and foot and mouth disease virus dual real-time fluorescence quantitative PCR detection kit |
| CN109321683A (en) * | 2018-12-24 | 2019-02-12 | 湖南新南方养殖服务有限公司 | A kind of A type Sai Nika viral diagnosis primer, kit, method for detecting virus and application |
| CN109498727A (en) * | 2018-12-28 | 2019-03-22 | 舞钢市畜产品质量检测中心 | A kind of Chinese medicine composition and preparation method thereof for treating eperythrozoonosis |
| WO2021011619A1 (en) * | 2019-07-15 | 2021-01-21 | South Dakota Board Of Regents | Senecavirus a virus strains and immunogenic compositions therefrom |
| US12514917B2 (en) | 2019-07-15 | 2026-01-06 | South Dakota Board Of Regents | Senecavirus A virus strains and immunogenic compositions therefrom |
| CN110317278B (en) * | 2019-08-02 | 2021-01-01 | 天康生物(上海)有限公司 | Fusion protein of SVV and FMDV, encoding gene, expression vector, cell line, engineering bacterium, vaccine and application thereof |
| CN110317278A (en) * | 2019-08-02 | 2019-10-11 | 天康生物(上海)有限公司 | The fusion protein and its encoding gene of SVV and FMDV, expression vector, cell line, engineering bacteria and vaccine and application |
| CN111118040A (en) * | 2020-02-01 | 2020-05-08 | 青岛农业大学 | A recombinant type A Seneca virus expressing luciferase |
| CN116459355A (en) * | 2020-05-15 | 2023-07-21 | 金宇保灵生物药品有限公司 | Method for distinguishing Sein card virus from foot-and-mouth disease virus symptomatically by using domestic rabbits |
| CN112390861A (en) * | 2020-09-30 | 2021-02-23 | 信阳农林学院 | Cell line for expressing porcine Saxifraga vallismortis VP1 protein, construction method and application |
| CN113308480A (en) * | 2021-06-17 | 2021-08-27 | 河北农业大学 | A-type seneca virus SVA/HeB full-length infectious cDNA clone and preparation method and application thereof |
| CN113308480B (en) * | 2021-06-17 | 2022-07-29 | 河北农业大学 | A Seneca virus type A SVA/HeB full-length infectious cDNA clone and its preparation method and application |
| WO2026006491A1 (en) * | 2024-06-25 | 2026-01-02 | Cornell University | Senecavirus a (sva) vaccine compositions and methods thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2017181070A1 (en) | Vaccine against seneca valley virus | |
| JP7661552B2 (en) | Porcine circovirus type 3 immunogenic composition, method for producing same, and method for using same | |
| Chen et al. | Construction and characterization of a full-length cDNA infectious clone of emerging porcine Senecavirus A | |
| US20220031831A1 (en) | Immunogenic compositions for african swine fever virus | |
| KR101721090B1 (en) | Porcine torque teno virus vaccines and diagnosis | |
| Ju et al. | Immunogenicity of a recombinant pseudorabies virus expressing ORF1–ORF2 fusion protein of porcine circovirus type 2 | |
| Sun et al. | Isolation and characterization of Chinese porcine epidemic diarrhea virus with novel mutations and deletions in the S gene | |
| US10918710B2 (en) | Temperature-sensitive attenuated FMDV strains, construction method and application thereof | |
| Wang et al. | Recombinant adenovirus expressing F and H fusion proteins of peste des petits ruminants virus induces both humoral and cell-mediated immune responses in goats | |
| US8846057B2 (en) | Recombinant live attenuated foot-and-mouth disease (FMD) vaccine containing mutations in the L protein coding region | |
| EP3177714A1 (en) | Mutant porcine epizootic diarrhea virus for use in a vaccine | |
| Maurer et al. | Oronasal vaccination with classical swine fever virus (CSFV) replicon particles with either partial or complete deletion of the E2 gene induces partial protection against lethal challenge with highly virulent CSFV | |
| EP3280438B1 (en) | Recombinant lumpy skin disease virus knock-out mutant and uses thereof | |
| EP3880804A1 (en) | Novel porcine rotavirus | |
| US12453767B2 (en) | Development of mosaic vaccines against foot and mouth disease virus serotype O | |
| Al-Kubati et al. | The efficacy of the prime-boost regimen for heterologous infectious bronchitis vaccines mandates the administration of homologous vaccines | |
| CN103933581A (en) | Preparation method of engineered vaccine based on CSF-FMD duplex gene | |
| Li et al. | Effects of the nuclear localization of the Npro protein of classical swine fever virus on its virulence in pigs | |
| US20220193220A1 (en) | Immunogenic compositions for novel reassortant mammalian ortheovirus from pigs | |
| Yuan | Construction and characterization of a full-length complementary DNA infectious clone of emerging porcine Senecavirus A | |
| Sharma | Development and Evaluation of Vaccine Candidates for Senecavirus A | |
| OA19861A (en) | Recombinant lumpy skin disease virus knock-out mutant and uses thereof. | |
| AU2014262215A1 (en) | Porcine Torque teno virus vaccines and diagnosis |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 17783281 Country of ref document: EP Kind code of ref document: A1 |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 17783281 Country of ref document: EP Kind code of ref document: A1 |




