WO2017167834A1 - Mutant bordetella strains and methods for use - Google Patents

Mutant bordetella strains and methods for use Download PDF

Info

Publication number
WO2017167834A1
WO2017167834A1 PCT/EP2017/057468 EP2017057468W WO2017167834A1 WO 2017167834 A1 WO2017167834 A1 WO 2017167834A1 EP 2017057468 W EP2017057468 W EP 2017057468W WO 2017167834 A1 WO2017167834 A1 WO 2017167834A1
Authority
WO
WIPO (PCT)
Prior art keywords
subject
pertactin
deficient
respiratory tract
live attenuated
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2017/057468
Other languages
English (en)
French (fr)
Inventor
Luis SOLANS
Camille Locht
Anne TSICOPOULOS
Saliha AIT YAHIA SENDID
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Institut Pasteur de Lille
Institut National de la Sante et de la Recherche Medicale INSERM
Institut Pasteur
Original Assignee
Institut Pasteur de Lille
Institut National de la Sante et de la Recherche Medicale INSERM
Institut Pasteur
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to CN202210315642.5A priority Critical patent/CN114767718A/zh
Priority to CN201780021384.7A priority patent/CN109069535B/zh
Priority to DK17715426.7T priority patent/DK3436034T3/da
Priority to FIEP17715426.7T priority patent/FI3436034T3/fi
Priority to ES17715426T priority patent/ES3027194T3/es
Priority to EP17715426.7A priority patent/EP3436034B1/en
Priority to SG11201807783UA priority patent/SG11201807783UA/en
Priority to JP2018551960A priority patent/JP6993984B2/ja
Application filed by Institut Pasteur de Lille, Institut National de la Sante et de la Recherche Medicale INSERM, Institut Pasteur filed Critical Institut Pasteur de Lille
Priority to CA3018126A priority patent/CA3018126C/en
Priority to EP25158892.7A priority patent/EP4541809A3/en
Priority to AU2017242541A priority patent/AU2017242541B2/en
Publication of WO2017167834A1 publication Critical patent/WO2017167834A1/en
Anticipated expiration legal-status Critical
Priority to AU2022221438A priority patent/AU2022221438B2/en
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/42Respiratory system, e.g. lungs, bronchi or lung cells
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/66Microorganisms or materials therefrom
    • A61K35/74Bacteria
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/02Bacterial antigens
    • A61K39/099Bordetella
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/0012Galenical forms characterised by the site of application
    • A61K9/007Pulmonary tract; Aromatherapy
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00Drugs for disorders of the respiratory system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00Drugs for disorders of the respiratory system
    • A61P11/06Antiasthmatics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04Antibacterial agents
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/235Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Bordetella (G)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00Microorganisms; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/36Adaptation or attenuation of cells
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/02Bacterial antigens
    • A61K2039/10Brucella; Bordetella, e.g. Bordetella pertussis; Not used, see subgroups
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/51Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/51Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/52Bacterial cells; Fungal cells; Protozoal cells
    • A61K2039/522Bacterial cells; Fungal cells; Protozoal cells avirulent or attenuated
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/54Medicinal preparations containing antigens or antibodies characterised by the route of administration
    • A61K2039/541Mucosal route
    • A61K2039/543Mucosal route intranasal
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/57Medicinal preparations containing antigens or antibodies characterised by the type of response, e.g. Th1, Th2
    • A61K2039/575Medicinal preparations containing antigens or antibodies characterised by the type of response, e.g. Th1, Th2 humoral response
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/58Medicinal preparations containing antigens or antibodies raising an immune response against a target which is not the antigen used for immunisation

Definitions

  • the invention relates generally to the fields of microbiology, immunology, allergy, and medicine. More particularly, the invention relates to live attenuated Bordetella pertussis strains deficient in pertactin, and their use as prophylactic and therapeutic agents in various disease settings.
  • Microbial organisms and their components have long been known to affect the immune systems of mammals. Infection with virulent bacteria and viruses can cause severe illness or death. Contributing toward this, purified components of bacteria and viruses can also cause pathology by inducing inflammatory responses or otherwise causing the immune system to behave in an undesirable manner. Despite this, vaccines including whole bacteria, viruses, or parts thereof have not only proven to be one of the most powerful tools that medicine has developed to prevent serious infections, but also can cause other beneficial effects.
  • BPZE1 live attenuated pertussis vaccine candidate named BPZE1 (see WO2007104451A1) was found to not only protect against virulent Bordetella pertussis, but also to exert potent anti-allergic and anti-asthma effects by dampening hyperimmune responses to allergens (see WO2013066272A1).
  • Pertactin an outer membrane protein of Bordetella bacteria, serves as a virulence factor by promoting adhesion to a variety of cells.
  • BPZE1P pertactin-deficient mutant of BPZE1
  • CNCM Collection Nationale de Cultures de Microorganismes
  • Rue du Dondel Roux Paris Cedex 15, 75724, France on December 12, 2016 under accession number CNCM-I-5150
  • CNCM Collection Nationale de Cultures de Microorganismes
  • the discovery was surprising because as others have shown that pertactin was required for Bordetella to resist neutrophil-mediated clearance, B. pertussis deficient in this virulence factor would have been expected to be cleared too rapidly to allow the induction of a protective immune responses. See, Inatsuka et al. Infect. Immun. 2010; 78: 2901-2909.
  • BPZE1P colonized lungs as efficiently as BPZE1 and induced protective immunity against B. pertussis challenge as efficiently as BPZE1.
  • BPZE1P colonized the mouse lungs significantly better than BPZE1. Therefore, pertactin-deficient B. pertussis strains such as BPZE1P may be advantageous in protecting against respiratory tract inflammation in subjects with high pre-existing titers of pertactin antibodies, including those previously vaccinated with pertactin-containing acellular vaccines.
  • the airway inflammation can be associated with one or more of airway resistance, eosinophil infiltration in the lungs of the subject, and/or increased amounts of inflammatory cytokines in the lungs of the subject. Colonization of the respiratory tract of the subject can result in reduction or prevention of such airway resistance, eosinophil infiltration, and/or increased amounts of inflammatory cytokines.
  • compositions including a pharmaceutically acceptable carrier and live pertactin-deficient Bordetella bacteria capable of colonizing the respiratory tract of a subject and reducing or preventing the development of airway inflammation in the subject.
  • the live pertactin-deficient Bordetella bacteria can lack a functional gene encoding pertactin, also be deficient in tracheal cytotoxin (TCT), pertussis toxin (PTX), and/or dermonecrotic toxin (DNT).
  • TCT tracheal cytotoxin
  • PTX pertussis toxin
  • DNT dermonecrotic toxin
  • the live pertactin-deficient Bordetella bacteria can be BPZE1P.
  • the airway inflammation can be caused by exposure to an allergen, and the subject can be one diagnosed with asthma, interstitial lung disease, or allergic rhinitis; one having greater than 10 ng per ml of anti- pertactin antibodies in its serum; or one that has previously been immunized with a vaccine containing pertactin or a pertactin-like antigen.
  • pertactin is the outer surface membrane protein produced by Bordetella pertussis and its close relatives, such as Bordetella parapertussis that is involved in the binding of Bordetella bacteria to host cells as described in Leininger et al., Proc. Nat'l. Acad. Sci. USA, 1991, 88:345-9. conserveed regions in this protein, such as its passenger and autotransporter domains, contribute directly to the overall virulence and pathogenicity of these organisms.
  • PTX pertussis toxin, a major virulence factor of B. pertussis, which induces metabolic changes and alters immune responses in the host as described in Saukkonen et al, Proc. Natl. Acad. Sci. USA., 1992, 89: 118-122.
  • DNT pertussis dermonecrotic toxin (also called lethal toxin), a toxin found in B. pertussis which induces inflammation, vasoconstriction and dermonecrotic lesions in sites where B. pertussis colonize the respiratory tract. See Fukui-Miyazaki et al., BMC Microbiol. 2010, 10:247.
  • TCT refers to tracheal cytotoxin, a disaccharide tetrapeptide derivative of peptidoglycan synthesized by bordetellae, which induces the production of interleukin-1 and nitric oxide synthase, and causes stasis of cilia and lethal effects on respiratory epithelial cells.
  • a "pertactin-deficient" Bordetella strain is one that exhibits at least less than 50% (e.g., less than 50, 40, 30, 20, 10, 5, 4, 3, 2, or 1%) of the pertactin activity found in BPZE1 under the conditions described in the Examples section below, one that exhibits no detectable pertactin activity, or one that exhibits not detectable expression of pertactin as determined by Western blotting.
  • the term "functional" when referring to a toxin or virulence factor in a bacterial strain means that (i) the toxin/virulence factor expressed by the strain has not been mutated to eliminate or at least reduce by greater than 50% its enzymatic activity compared to the non- mutated version of the toxin/factor, and/or (ii) that a bacterial strain expressing the toxin/factor has not been engineered or selected to eliminate or at least reduce by greater than 50% the number of molecules of that toxin/factor compared to the starting strain from which the engineered or selected strain was derived.
  • mammalian subject encompasses any of various warm-blooded vertebrate animals of the class Mammalia, including human beings.
  • Figure 1 A is a diagram showing the structure of a plasmid used in the construction of BPZE1P.
  • Figure IB is another diagram showing the construction of BPZE1P, and photographs of gels showing the results of PCR amplification of the prn UPg and prn Log fragments.
  • Figure 1C is photographs of immunoblots showing the presence of pertactin in BPZEl, but not in BPZE1P lysates and supernatants.
  • Figure 2 is a graph showing the results of lung colonization in Balb/c mice using either BPZEl or BPZEl P.
  • Figure 3 is a graph showing total IgG titers after BPZE1P or BPZEl administration to mice.
  • Figure 4 A is a graph showing BPZEl- and BPZElP-mediated protection in Balb/c mice challenged intranasally with 10 6 viable B. pertussis bacteria of the BPSM strain.
  • Figure 4B is a graph showing BPZEl- and BPZElP-mediated protection in Balb/c mice challenged intranasally with 10 6 viable B. pertussis bacteria of the BPSMP strain.
  • Figure 4C is a graph showing BPZEl- and BPZElP-mediated protection in Balb/c mice challenged intranasally with 10 6 viable B. pertussis bacteria of the B1917 strain.
  • Figure 5 is a graph showing the fitness of BPZEl and BPZE1P in mice preimmunized with an acellular B. pertussis vaccine (aPv).
  • Figure 6 is a diagram of the experimental protocol of an assay for airway responsiveness in allergic mice vaccinated with BPZEl, BPZE1P or left unvaccinated, and a graph showing the results of the assay.
  • Figure 7A is a graph showing the total airway cell population infiltration in the bronchoalveolar (BAL) fluid of the allergic mice of the experiments shown in Fig. 6.
  • Figure 7B is a graph showing the percentage of eosinophils in the cells in the BAL fluid of the allergic mice of the experiments shown in Fig. 6.
  • Figure 7C is a graph showing the percentage of neutrophils in the cells in the BAL fluid of the allergic mice of the experiments shown in Fig. 6.
  • Figure 7D is a graph showing the percentage of lymphocytes in the cells in the BAL fluid of the allergic mice of the experiments shown in Fig. 6.
  • Figure 7E is a graph showing the percentage of macrophages in the cells in the BAL fluid of the allergic mice of the experiments shown in Fig. 6.
  • Figure 8 A is a graph showing the amount of IL-la normalized against total proteins measured in the lung lobe in the allergic mice of the experiments shown in Fig. 6.
  • Figure 8B is a graph showing the amount of IL- ⁇ ⁇ normalized against total proteins measured in the lung lobe in the allergic mice of the experiments shown in Fig. 6.
  • Figure 8C is a graph showing the amount of IL-6 normalized against total proteins measured in the lung lobe in the allergic mice of the experiments shown in Fig. 6.
  • Figure 8D is a graph showing the amount of IL-13 normalized against total proteins measured in the lung lobe in the allergic mice of the experiments shown in Fig. 6.
  • Figure 8E is a graph showing the amount of CXCL1 normalized against total proteins measured in the lung lobe in the allergic mice of the experiments shown in Fig. 6.
  • Figure 8F is a graph showing the amount of CXCL9 normalized against total proteins measured in the lung lobe in the allergic mice of the experiments shown in Fig. 6.
  • Figure 8G is a graph showing the amount of CXCL10 normalized against total proteins measured in the lung lobe in the allergic mice of the experiments shown in Fig. 6.
  • Figure 8H is a graph showing the amount of GM-CSF normalized against total proteins measured in the lung lobe in the allergic mice of the experiments shown in Fig. 6.
  • Figure 9 is a diagram of the experimental protocol of an assay for airway responsiveness in a therapeutic model of allergic mice vaccinated with BPZEl, BPZEIP or left unvaccinated, and a graph showing the results of the assay.
  • Bordetella species such as Bordetella pertussis, Bordetella parapertussis, and Bordetella bronchiseptica that are deficient in pertactin expression (e.g., those that express at least 50, 60, 70, 80, 90, 95, 96, 97, 98, or 99% less pertactin than do corresponding strains) can be used to generate immune responses against Bordetella species, as well as to treat and/or prevent respiratory tract inflammation such as that which occurs in allergic asthma.
  • Bordetella species such as Bordetella pertussis, Bordetella parapertussis, and Bordetella bronchiseptica that are deficient in pertactin expression (e.g., those that express at least 50, 60, 70, 80, 90, 95, 96, 97, 98, or 99% less pertactin than do corresponding strains) can be used to generate immune responses against Bordetella species, as well as to treat and/or prevent respiratory tract inflammation such as that
  • Live, attenuated, pertactin-deficient Bordetella pertussis and live, attenuated, pertactin- deficient Bordetella parapertussis are preferred for use for treating or preventing allergic respiratory tract inflammation in human subjects.
  • the live attenuated pertactin-deficient Bordetella strains described herein can be made by adapting methods known in the art such as those described in the Examples section below.
  • the starting strain can be any suitable Bordetella species. Examples of Bordetella species include B. pertussis, B. parapertussis, and B. bronchiseptica. B. pertussis is preferred for use as the starting strain for vaccines and methods for preventing pertussis infection.
  • Bordetella strains for use as starting strains are available from established culture collections (e.g., the American Type Culture Collection in Manassas, Virginia) or can be isolated from natural reservoirs (e.g., a patient having pertussis) by known techniques (e.g., as described in Aoyama et al, Dev. Biol. Stand, 73: 185-92, 1991).
  • Bordetella strains which express functional pertactin can be made deficient in this molecule or its activity by selection or, preferably for stability purposes, mutagenesis (e.g., deletion of the native prn gene as described below).
  • Bordetella species deficient in pertactin can also be isolated from natural sources (e.g., human subjects or other mammals infected or colonized with such strains). Because insufficient attenuation of a pathogenic strain of Bordetella might cause a pathological infection in a subject, it is preferred that the pertactin-deficient Bordetella strain used also have lower levels of other functional virulence factors.
  • pertactin-deficient Bordetella strain retains the ability to colonize a subject and exert a protective effect on respiratory tract inflammation, it must not be overly attenuated. Attenuation might be achieved by mutating the strain to reduce its expression of pertactin and one or more (e.g., 1, 2, 3, 4, 5 or more) of the following: pertussis toxin (PTX), dermonecrotic toxin (DNT), tracheal cytotoxin (TCT), adenylate cyclase (AC), lipopolysaccharide (LPS), filamentous hemagglutinin (FHA), or any of the bvg-regulated components.
  • PTX pertussis toxin
  • DNT dermonecrotic toxin
  • TCT tracheal cytotoxin
  • AC adenylate cyclase
  • LPS lipopolysaccharide
  • FHA filamentous hemagglutinin
  • Attenuation might also be achieved by mutating the strain to reduce the biological activity of pertactin and one or more (e.g., 1, 2, 3, 4, 5 or more) of the following: pertussis toxin (PTX), dermonecrotic toxin (DNT), tracheal cytotoxin (TCT), adenylate cyclase (AC), lipopolysaccharide (LPS), filamentous hemagglutinin (FHA), or any of the bvg-regulated components.
  • PTX pertussis toxin
  • DNT dermonecrotic toxin
  • TCT tracheal cytotoxin
  • AC adenylate cyclase
  • LPS lipopolysaccharide
  • FHA filamentous hemagglutinin
  • Bordetella strain deficient in functional pertactin, functional PTX, functional DNT, and functional TCT was able to colonize the respiratory tract of subjects, induce immune responses against Bordetella, and reduce or prevent the development of allergic and inflammatory responses.
  • Bordetella strains such as BPZE1P, which are deficient in these four virulence factors and can colonize a subject and induce immune responses targeting Bordetella strains and/or reduce or prevent the development of allergic and inflammatory responses are preferred.
  • a variety of methods are known in the art for attenuating an infectious bacterial strain. These include passaging the strain in vitro until virulence is lost, non-specific chemical mutagenesis followed by screening and selection based on phenotype, and using targeted molecular biology techniques such as those described in the Examples section below (including allelic exchange) and in Methods for General and Molecular Microbiology (3d Ed), Reddy et al, ed., ASM Press. Using these methods, the genes encoding pertactin, PTX, and/or DNT can be deleted or mutated to an enzymatically inactive form (which is preferred where it is desired to retain the toxin's antigenicity).
  • TCT production can be significantly (e.g., > than 99.99, 99.90, 99.8, 99.7, 99.6, 99.5, 99.0, 98, 97, 96, 95, or 90%) reduced by replacing the native ampG gene (unlike other species, B. pertussis ampG does not actively recycle TCT-containing peptidoglycan) with a heterologous (e.g., from E. coli or another gram-negative species) ampG gene, or by mutating the native ampG gene such that it is active at recycling peptidoglycan.
  • native ampG gene unlike other species, B. pertussis ampG does not actively recycle TCT-containing peptidoglycan
  • a heterologous ampG gene e.g., from E. coli or another gram-negative species
  • Modification of a starting strain to reduce or remove toxin/virulence factor activity can be confirmed by sequencing the genomic DNA or genes encoding the toxins of the modified strains. Southern, Northern, and/or Western blotting might also be used to confirm that the target genes have been deleted or that expression of the target factors has been reduced or removed. Biological activity can also be evaluated to confirm reduction or removal of toxin/virulence factor activity. Once the modifications have been confirmed, the modified strains can be tested for the ability to colonize a subject and to induce protective immunity against Bordetella infection or to reduce or prevent the development of allergic and inflammatory responses by known methods such as those described in the Examples section below.
  • the live attenuated Bordetella strains described herein can be used in compositions that protect a mammalian subject from developing a Bordetella infection (e.g., pertussis), or to reduce the symptoms of such an infection. They can also be used to reduce or prevent the development of allergic and inflammatory responses in a subject such as asthma, allergic rhinitis, interstitial lung disease, food allergies, peanut allergy, venom allergies, atopic dermatitis, contact hypersensitivity, and anaphylaxis.
  • the live attenuated Bordetella strains are typically formulated with a pharmaceutically acceptable excipient.
  • pharmaceutically acceptable excipients include, e.g., buffered saline solutions, distilled water, emulsions such as an oil/water emulsion, various types of wetting agents, sterile solutions, and the like.
  • the vaccines can be packaged in unit dosage form for convenient administration to a subject.
  • a single dose of between l lO 4 to l lO 9 e.g., l x lO 4 , 5> ⁇ 10 4 , l x lO 5 , 5x l0 5 , l x lO 6 , 5x l0 6 , l x lO 7 , 5x l0 7 , l x lO 8 , 5x l0 8 , or l xl0 9 +/- 10, 20, 30, 40, 50, 60, 70, 80, or 90%) live bacteria of the selected attenuated Bordetella strain and any excipient can be separately contained in packaging or in an administration device.
  • the vaccine can be contained within an administration device such as a syringe, spraying device, or insufflator.
  • compositions described herein can be administered to a mammalian subject (e.g., a human being, a human child or neonate, a human adult, a human being at high risk from developing complications from pertussis, a human being with lung disease, a human being that is or will become immunosuppressed, and a human being having or at high risk for developing respiratory tract inflammation such as asthma, allergic rhinitis, or interstitial lung disease) by any suitable method that deposits the bacteria within the composition in the respiratory tract or other mucosal compartment.
  • a mammalian subject e.g., a human being, a human child or neonate, a human adult, a human being at high risk from developing complications from pertussis, a human being with lung disease, a human being that is or will become immunosuppressed, and a human being having or at high risk for developing respiratory tract inflammation such as asthma, allergic rhinitis, or interstitial lung disease
  • the compositions may be administered by inhalation or intranas
  • the pertactin-deficient Bordetella strains described herein can be formulated as compositions for administration to a subject.
  • a suitable number of live bacteria are mixed with a pharmaceutically suitable excipient or carrier such as phosphate buffered saline solutions, distilled water, emulsions such as an oil/water emulsions, various types of wetting agents, sterile solutions and the like.
  • the vaccine can be lyophilized and then reconstituted prior to administration.
  • pharmaceutically suitable excipients or carriers which are compatible with mucosal (particularly nasal, bronchial, or lung) administration are preferred for colonizing the respiratory tract. See Remington's Pharmaceutical Sciences, a standard text in this field, and USP/NF.
  • each dose of a composition can include a sufficient number of live pertactin-deficient Bordetella bacteria to result in colonization of
  • the dose can include approximately 1 x 10 6 , 5 ⁇ 10 6 , l x l 0 7 , 5x l0 7 , l x lO 8 , 5x l0 8 , l x lO 9 , 5x l0 9 , or l xlO 10 live pertactin-deficient Bordetella bacteria.
  • the dose may be given once or on multiple (2, 3, 4, 5, 6, 7, 8 or more) occasions at intervals of 1, 2, 3, 4, 5, or 6 days or 1, 2, 3, 4, 5, or 6 weeks, or 1, 2, 3, 4, 5, 6, or 12 months.
  • compositions are administered to result in colonization and the protective and/or anti-inflammatory response. Additional amounts are administered after the induced protective and/or anti-inflammatory response wanes (e.g., after the subject resumes suffering from the symptoms of respiratory tract inflammation).
  • Subjects which can be administered a composition containing live pertactin-deficient Bordetella bacteria can include any capable of being colonized with a selected live pertactin- deficient Bordetella bacterial strain.
  • the subject can be a mammal such as a human being.
  • Human subjects having, or at high risk of developing, respiratory tract inflammation such as those having or prone to developing allergic asthma or allergic rhinitis are preferred recipients of the composition.
  • compositions can be used in subjects regardless of their titers of anti-pertactin antibodies, the composition may be used in those having measurable titers (e.g., greater than 10, 20, 50, 100, 200, or 500 ng per ml of serum) of anti-pertactin antibodies and those having previously been immunized with a vaccine containing pertactin or a pertactin-like antigen because pertactin-deficient Bordetella bacterial strains are not subject to pertactin-targeting immune responses.
  • measurable titers e.g., greater than 10, 20, 50, 100, 200, or 500 ng per ml of serum
  • compositions in dampening respiratory tract inflammation can be assessed by known methods, e.g., measuring the number of inflammatory cells, IgE titers, levels of pro-inflammatory cytokines/chemokines (such as eotaxin, GM-CSF, IFNy, IL-4, IL-5, IL-8, IL-10, IL-12, IL-13, IL-17A, IL-17F, IL-18, and TNFa) in fluid taken from the respiratory tract (e.g., bronchoalveolar lavage fluid), or clinical parameters such as spirometry or the level of dyspnea, coughing, wheezing, or respiratory capacity.
  • cytokines/chemokines such as eotaxin, GM-CSF, IFNy, IL-4, IL-5, IL-8, IL-10, IL-12, IL-13, IL-17A, IL-17F, IL-18, and TNFa
  • fluid taken from the respiratory tract e.g., bron
  • Improvement in any of one or more of these parameters indicates that the composition is effective.
  • Animal models of allergic respiratory tract inflammation can also be used to assess the effectiveness of a composition, see e.g., U.S. patent no. 8,986,709.
  • Example 1 Construction and characterization of a pertactin-deficient strain of B. pertussis.
  • Escherichia coli DH5a, SM10 and B. pertussis BPZE1, BPSM (Menozzi et al, Infect Immun 1994;62:769-778) and B1917 (Bart et al. Genome Announc 2014;2(6)) were used in this study.
  • the Bordetella strains were cultured at 37°C on Bordet-Gengou agar (BG), supplemented with 1% glycerol and 10 % defibrinated sheep blood. After growth, the bacteria were harvested by scraping the plates and resuspended in phosphate-buffered saline (PBS) at the desired density.
  • PBS phosphate-buffered saline
  • Bordetella strains were grown at 37° C in modified Stainer-Scholte medium ( Imaizumi et al. Infect Immun 1983;41 : 1138-1143) containing 1 g/1 heptakis (2.6-di-o-methyl ) ⁇ -cyciodextrin (Sigma).
  • E. coli strains used fo cloning procedures were growth in LB broth or LB agar plates. When required, streptomycin (Sm) was used at 100 ⁇ g/ml, gentamycin (Gm) at 10 ⁇ g/ml and ampicillin (Amp) at 100 ⁇ g/ml.
  • the gene coding for pertactin, in BPZE1, a 739-bp fragment downstream (prn LO) of the prn gene and a 759-bp fragment upstream (prn UP) of the prn gene were cloned into pSS4940 to introduce the prn deletion in the BPZE1 and BPSM genomes by homologous recombination. Referring to Figs.
  • the upstream and downstream prn flanking region were PCR amplified using prn KO fw (ATCCTCAAGCAAGACTGCGAGCTG) (SEQ ID NO: l)) and OL_prn_KO_rv (GGGGATAGACCCTCCTCGCTTGGATGCCAGGTGGAGAGCA) (SEQ ID NO:2)), and OL_prn _KO _fw (TGCTCTCCACCTGGCATCCAAGCGAGGAGGGTCTATCCCC) (SEQ ID NO:3)) and prn KO rv (CCATCATCCTGTACGACCGCCT) (SEQ ID NO:4)), respectively, as primers.
  • prn KO fw ATCCTCAAGCAAGACTGCGAGCTG
  • OL_prn_KO_rv GGGGATAGACCCTCCTCGCTTGGATGCCAGGTGGAGAGCA
  • OL_prn _KO _fw TGCTCTCCACCTGGCATCCAAGCGAGGAGGG
  • the resulting fragment (containing the prn deletion) was inserted into the TOPO blunt ® vector (ThermoFisher Scientific) and then excised as a Kpnl-Notl fragment.
  • the excised Kpnl-Notl fragment was inserted into Kpnl- and Notl- digested pSS4940, a pSS4245 (Inatsuka et al, Infect Immun 2010;78 2901-2909) derivative.
  • the resulting plasmid was transformed into E. coli SM10, which was then conjugated with BPZE1.
  • PCR was used to confirm deletion of the entire prn gene by amplifying the flanking regions covering the construction using prnKO UP (TTCTTGCGCGAACAGATCAAAC) (SEQ ID NO:5)) - prnKOin UPrv (CTGCTGGTCATCGGCGAAGT) (SEQ ID NO:6)) for the 5' region and prnKOin LOfw (CGCCCATTCTTCCCTGTTCC) (SEQ ID NO:7))- prnKO _LO
  • the supernatants were recovered and treated with trichloroacetic acid (TCA) as described previously (Solans et al., PLoS Pathog 2014; 10:e 10041 ) for protein concentration.
  • TCA trichloroacetic acid
  • the bacterial pellets were resuspended in PBS complemented with an EDTA-free protease inhibitor cocktail (Roche) and lysed using a French pressure cell. Bacterial debris were removed by centrifugation for 30 minutes at 1 5,000 x g, and the supernatants were recovered for immunoblotting. Proteins were separated by 12% SDS-PAGE and then transferred onto a Nitrocellulose membrane using the Criterion TM cell system (Bio-Rad ).
  • Example 2 - BPZE1P colonizes mice as well as BPZE1.
  • mice Groups of 18 six -week old mice were inoculated intranasally with 20 ⁇ PBS containing 10 6 viable bacteria as described previously (Mielcarek et al., supra). At the indicated time points (3 hours, 3 days, 7 days, 14 days, 21 days and 28 days), 3 mice per group were sacrificed, and lungs were harvested and homogenized for measuring total number of colony formation units (CFU). Statistical analysis was done by a 2-way ANOVA test, using post hoc comparison Bonferroni test with confidence intervals of 95%. Referring to Fig. 2, both BPZE1 and BPZE1P colonized the animals equally well. Both strains exhibited a peak of multiplication 3 days post vaccination and colonization persisted for 4 weeks. No statistically significant difference was observed between these strains in their ability to colonize the mouse lungs.
  • Example 3 - BPZE1P is as immunogenic and protective against challenge with virulent B. pertussis as BPZE1.
  • Immunity induced by BPZE1P in comparison with BPZE1 was measured by antibody titration of mouse immune serum after nasal vaccination.
  • Groups of 8 mice were vaccinated intranasally with 10 5 viable BPZE1 or BPZE1P.
  • the mice were bled, and total IgG titers were measured against total BPSM lysate. Blood was centrifuged for 5 min. at 5,000 x g to separate the serum from the cells.
  • Antibody titers against B. pertussis were estimated using enzyme-linked immunosorbent assays (ELISA) as described previously (Mielcarek et al, supra), using total B.
  • BPSM lysate at 1 ⁇ g of total protein per well BPSM lysate at 1 ⁇ g of total protein per well.
  • Statistical analysis was performed using GraphPad Prism software. As shown in Fig. 3, BPZE1- and BPZElP-vaccinated mice exhibited much higher antibody titers than did naive control mice. No significant difference in antibody titers between BPZE1- and BPZElP-vaccinated mice was detected.
  • mice per group were sacrificed 7 days after challenge for CFU counting. Three hours post infection, 3 mice were euthanized, and their lungs were harvested to determine the CFU counts shortly after challenge. Seven days post-infection, the remaining 5 mice were euthanized, their lungs were harvested, and the CFU counts were measured.
  • Statistical analysis was done applying a parametric 2-way ANOVA test, using post hoc Bonferroni comparison test with a confidence interval of 95%. *, p ⁇ 0.005; **, p ⁇ 0.001; p ⁇ 0.0001.
  • vaccination with either strain protected against challenge with BPSM, BPSMP and B1917 equally well.
  • Example 4 - BPZEIP increases pulmonary vaccine uptake in aPv- vaccinated mice.
  • mice having pre-existing antibodies against pertactin were vaccinated subcutaneously with 1/5 of the human dose of the acellular pertussis vaccine (aPv; Infanrix, GSK; containing inactivated pertussis toxin, filamentous hemagglutinin and pertactin).
  • aPv acellular pertussis vaccine
  • GSK acellular pertussis vaccine
  • the mice were boosted with the same dose of aPv.
  • the mice were infected intranasally with 10 6 BPZEl or BPZEIP.
  • mice Seven days post-infection, the remaining 5 mice were euthanized, the lungs harvested, and the CFU counts were measured. Statistical analysis was done applying a parametric 2-way ANOVA test, using post hoc Bonferroni comparison test with a confidence interval of 95%. p ⁇ 0.0001. Referring to Fig, 5, at 3 hours post-administration, no significant difference in colonization was seen between the two strains. In contrast, seven days after inoculation, BPZEIP colonized the lungs significantly better than BPZEl . Mice infected with BPZEIP had almost 10 4 CFU in the lungs 7 days after administration, while the CFU counts in the lungs of the mice given BPZEl reached 10 CFU. These data show that the deletion of the prn gene improves BPZEl pulmonary take in mice pre-immunized with pertactin-containing aP vaccine.
  • Example 5 - BPZEIP and BPZEl protect equally well against allergic airway inflammation.
  • mice were vaccinated intranasally with 20 ⁇ PBS containing 10 6 viable BPZEl or BPZEIP, or were left unvaccinated. Four weeks later, the mice were sensitized intranasally with 20 ⁇ of house dust mite (HDM; Stallergenes S.A.) of 5 index of reactivity (IR) of Dermatophagoides farinae extract (Derf 5IR) or 20 ⁇ of PBS as control.
  • HDM house dust mite
  • IR index of reactivity
  • Dermatophagoides farinae extract Dermatophagoides farinae extract
  • mice Ten days later, the mice where challenged intranasally with 20 ⁇ of Derf 5IR or PBS daily for 5 days, and two days later, the mice were anesthetized and intubated intratracheally for mechanical ventilation using the FlexiVent (SCIREQ ®) device. The mice were then exposed to increasing concentrations of nebulized methacholine (0-50 mg/mL in PBS) (Sigma-Aldrich) to determine the resistance in their respiratory airways using plethysmography. Statistical analysis was done by applying a parametric 2-way ANOVA test, using the post hoc Bonferroni comparison test with a confidence interval of 95%. ***, p ⁇ 0.0001; **, p ⁇ 0.001; *, p ⁇ 0.005.
  • Example 6 Measurement of lung cell infiltration and cytokine profiles.
  • BAL Bronchoalveolar lavage
  • lymphocytes Fig. 7D
  • macrophages Fig. 7E
  • Statistical analysis was done by applying a parametric one-way ANOVA test, using the post hoc Bonferroni comparison test with a confidence interval of 95%. ***, p ⁇ 0.0001; *, p ⁇ 0.005.
  • BPZE1 or BPZE1P vaccination significantly reduced the recruitment of total cells in the airways after allergen exposure and challenge, compared to the non- vaccinated mice ( Figure 7A).
  • the right lung lobes were harvested and directly frozen in liquid Nitrogen for protein extraction.
  • the lung lobes were resuspended in 1 mL of lysis buffer, PBS with 0.5% nonidet P40 and protease inhibitor cocktail (Roche ®), and homogenized at 4°C using T-18 Ultra-Turrax (Ika ®).
  • the samples were centrifuged, and the supernatants were collected for total protein quantification using the PierceTM BCA protein assay (Thermo Fisher Scientific), and for cytokine and chemokine measurements using the Cytokine 20-Plex Mouse Panel (InvitrogenTM, Thermo Fisher Scientific) per the manufacturer's specifications. Referring to Fig.
  • cytokine levels are represented as the normalization of the cytokine/chemokine quantification against total proteins measured in the lung lobe.
  • Statistical analysis was done by applying a parametric one-way ANOVA test, using the post hoc Bonferroni comparison test with a confidence interval of 95%. **, p ⁇ 0.001. *; p ⁇ 0.005.
  • Example 7 - Vaccination of pre-sensitized subjects with either BPZE1 or BPZE1P present significantly lower levels of airway resistance compared to those that were not vaccinated.
  • groups of 5-week-old mice were either sensitized intranasally with Derf 5IR or administrated PBS, and then either vaccinated with 10 6 BPZE1 or BPZEIP, or left unvaccinated.
  • the mice were challenged intranasally with Derf 5IR or PBS during 5 days.
  • Two days after last challenge the mice were anesthetized, and their resistance in the respiratory airway was measured by plethysmography as described above.
  • mice vaccinated with either BPZE1 or BPZEIP present significantly lower levels of airway resistance compared to those that were not vaccinated. Again, the airway resistance of the vaccinated mice was indistinguishable from that of the control group, which were not sensitized nor challenged with Derf 5IR.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Organic Chemistry (AREA)
  • Epidemiology (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Pulmonology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Mycology (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • Immunology (AREA)
  • Biochemistry (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Cell Biology (AREA)
  • Biophysics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biomedical Technology (AREA)
  • Virology (AREA)
  • Rheumatology (AREA)
  • Wood Science & Technology (AREA)
  • Pain & Pain Management (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Oncology (AREA)
  • Physiology (AREA)
  • Communicable Diseases (AREA)
  • General Engineering & Computer Science (AREA)
  • Developmental Biology & Embryology (AREA)
PCT/EP2017/057468 2016-03-29 2017-03-29 Mutant bordetella strains and methods for use Ceased WO2017167834A1 (en)

Priority Applications (12)

Application Number Priority Date Filing Date Title
SG11201807783UA SG11201807783UA (en) 2016-03-29 2017-03-29 Mutant bordetella strains and methods for use
DK17715426.7T DK3436034T3 (da) 2016-03-29 2017-03-29 Muterede bordetella-stammer og fremgangsmåder til brug
FIEP17715426.7T FI3436034T3 (fi) 2016-03-29 2017-03-29 Mutantteja bordetella-kantoja ja käyttömenetelmiä
ES17715426T ES3027194T3 (en) 2016-03-29 2017-03-29 Mutant bordetella strains and methods for use
EP17715426.7A EP3436034B1 (en) 2016-03-29 2017-03-29 Mutant bordetella strains and methods for use
JP2018551960A JP6993984B2 (ja) 2016-03-29 2017-03-29 変異ボルデテラ菌株および使用方法
CA3018126A CA3018126C (en) 2016-03-29 2017-03-29 Mutant bordetella strains and methods of use
CN202210315642.5A CN114767718A (zh) 2016-03-29 2017-03-29 突变型博德特氏菌属菌株及其使用方法
CN201780021384.7A CN109069535B (zh) 2016-03-29 2017-03-29 突变型博德特氏菌属菌株及其使用方法
EP25158892.7A EP4541809A3 (en) 2016-03-29 2017-03-29 Mutant bordetella strains and methods of use
AU2017242541A AU2017242541B2 (en) 2016-03-29 2017-03-29 Mutant bordetella strains and methods for use
AU2022221438A AU2022221438B2 (en) 2016-03-29 2022-08-24 Mutant bordetella strains and methods for use

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201662314843P 2016-03-29 2016-03-29
US62/314,843 2016-03-29

Publications (1)

Publication Number Publication Date
WO2017167834A1 true WO2017167834A1 (en) 2017-10-05

Family

ID=58488973

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2017/057468 Ceased WO2017167834A1 (en) 2016-03-29 2017-03-29 Mutant bordetella strains and methods for use

Country Status (10)

Country Link
US (4) US10682377B2 (cg-RX-API-DMAC7.html)
EP (2) EP4541809A3 (cg-RX-API-DMAC7.html)
JP (1) JP6993984B2 (cg-RX-API-DMAC7.html)
CN (2) CN114767718A (cg-RX-API-DMAC7.html)
AU (2) AU2017242541B2 (cg-RX-API-DMAC7.html)
DK (1) DK3436034T3 (cg-RX-API-DMAC7.html)
ES (1) ES3027194T3 (cg-RX-API-DMAC7.html)
FI (1) FI3436034T3 (cg-RX-API-DMAC7.html)
SG (1) SG11201807783UA (cg-RX-API-DMAC7.html)
WO (1) WO2017167834A1 (cg-RX-API-DMAC7.html)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11446372B2 (en) 2017-10-18 2022-09-20 Institut Pasteur De Lille Bordetella strains expressing serotype 3 fimbriae
WO2024018061A1 (en) 2022-07-22 2024-01-25 Institut National de la Santé et de la Recherche Médicale Use of bordetella strains for the treatment of chronic obstructive pulmonary disease
WO2025257397A1 (en) 2024-06-14 2025-12-18 Institut National de la Santé et de la Recherche Médicale Live attenuated bordetella vaccines capable of producing and secreting heterologous antigens

Families Citing this family (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9119804B2 (en) 2006-03-10 2015-09-01 Institut Pasteur De Lille Live attenuated bordetella strains as a single dose vaccine against whooping cough
SG175803A1 (en) 2009-04-28 2011-12-29 Pasteur Institut Vaccine for prophylaxis or treatment of an allergen-driven airway pathology
EP4541809A3 (en) * 2016-03-29 2025-06-25 Institut Pasteur de Lille Mutant bordetella strains and methods of use
AU2021325149A1 (en) 2020-08-14 2023-03-02 ILiAD Biotechnologies, Inc. Lyophilized live bordetella vaccines
EP4247397A4 (en) * 2020-11-17 2024-11-06 Iliad Biotechnologies, LLC TREATMENT AND PREVENTION OF NEUROPATHOLOGY ASSOCIATED WITH NEURODEGENERATIVE DISEASES

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6660261B1 (en) * 1996-10-11 2003-12-09 Institut Pasteur De Lille Bordetella strain expressing the FHA hybrid, liposomes and vaccines
WO2007104451A1 (en) 2006-03-10 2007-09-20 Institut Pasteur De Lille Live attenuated bordetella strains as a single dose vaccine against whooping cough
WO2010125014A1 (en) * 2009-04-28 2010-11-04 INSERM (Institut National de la Santé et de la Recherche Médicale) Vaccine for prophylaxis or treatment of an allergen-driven airway pathology
WO2013066272A1 (en) 2011-11-02 2013-05-10 National University Of Singapore Effect of an attenuated bordetella strain against allergic disease

Family Cites Families (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6713072B1 (en) 1987-11-02 2004-03-30 Chiron S.R.L. Immunologically active polypeptides with altered toxicity useful for the preparation of an antipertussis vaccine
GB9115332D0 (en) * 1991-07-16 1991-08-28 Connaught Lab Manipulation of gene copy number in bordetella
FR2718750B1 (fr) 1994-04-19 1996-06-14 Pasteur Institut Protéines recombinantes de l'hémagglutinine filamenteuse de Bordetella, notamment, B. Pertussis, production et application à la production de protéines étrangères ou de principes actifs vaccinants.
KR100266556B1 (ko) * 1994-04-28 2000-09-15 다께다구니오 백일해균의 방어성분의 분리방법
FR2840319B1 (fr) 2002-05-30 2004-08-20 Pasteur Institut Souches de bordetella rendues deficientes par attenuation genetique
EP1617805A4 (en) 2003-04-11 2012-07-04 Medimmune Llc METHODS FOR PREVENTING OR TREATING RESPIRATORY CONDITIONS
CA2669485C (en) 2006-11-15 2017-01-03 Folia Biotech Inc. Papaya mosaic virus-based vaccines for influenza
EP2134359A4 (en) 2007-02-23 2010-06-16 Penn State Res Found USE OF A NONVIRULENT BORDETELLA MUTANT AS LIVING VACCINE VECTOR
WO2008156753A1 (en) 2007-06-18 2008-12-24 Hemispherx Biopharma Early intervention of viral infections with immune activators
DK2442826T3 (en) 2009-06-15 2015-09-21 Univ Singapore Influenza vaccine, composition and methods of using
CN102793915B (zh) * 2012-07-25 2013-10-23 天津康希诺生物技术有限公司 一种无细胞百日咳疫苗的生产方法
EP2722338A1 (en) 2012-10-17 2014-04-23 INSERM (Institut National de la Santé et de la Recherche Médicale) Novel recombinant Bordetella strains
EP4541809A3 (en) * 2016-03-29 2025-06-25 Institut Pasteur de Lille Mutant bordetella strains and methods of use

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6660261B1 (en) * 1996-10-11 2003-12-09 Institut Pasteur De Lille Bordetella strain expressing the FHA hybrid, liposomes and vaccines
WO2007104451A1 (en) 2006-03-10 2007-09-20 Institut Pasteur De Lille Live attenuated bordetella strains as a single dose vaccine against whooping cough
US9119804B2 (en) 2006-03-10 2015-09-01 Institut Pasteur De Lille Live attenuated bordetella strains as a single dose vaccine against whooping cough
WO2010125014A1 (en) * 2009-04-28 2010-11-04 INSERM (Institut National de la Santé et de la Recherche Médicale) Vaccine for prophylaxis or treatment of an allergen-driven airway pathology
US8986709B2 (en) 2009-04-28 2015-03-24 Inserm (Institut National De La Sante Et De La Recherche Medicale) Vaccine for prophylaxis or treatment of an allergen-driven airway pathology
WO2013066272A1 (en) 2011-11-02 2013-05-10 National University Of Singapore Effect of an attenuated bordetella strain against allergic disease

Non-Patent Citations (20)

* Cited by examiner, † Cited by third party
Title
A ZEDDEMAN ET AL: "INVESTIGATIONS INTO THE EMERGENCE OF PERTACTIN-DEFICIENT BORDETELLA PERTUSSIS ISOLATES IN SIX EUROPEAN COUNTRIES, 1996 TO 2012", EUROSURVEILLANCE, 21 August 2014 (2014-08-21), Saint-Maurice, pages 1, XP055374175, Retrieved from the Internet <URL:http://www.eurosurveillance.org/images/dynamic/EE/V19N33/art20881.pdf> *
AOYAMA ET AL., DEV. BIOL. STAND, vol. 73, 1991, pages 185 - 92
AUSUBEL ET AL.: "Current Protocols in Molecular Biology", GREENE PUBLISHING AND WILEY- INTERSCIENCE
BART ET AL., GENOME ANNOUNC, vol. 2, no. 6, 2014
COLIGAN ET AL.,: "Current Protocols in Immunology", JOHN WILEY & SONS
FAUCI ET AL.: "Harrison's Principles of Internal Medicine 17th Edition,", 2008, MCGRAW-HILL PROFESSIONAL
FUKUI-MIYAZAKI ET AL., BMC MICROBIOL., vol. 10, 2010, pages 247
IMAIZUMI ET AL., INFECT IMMUN, vol. 41, 1983, pages 1138 - 1143
INATSUKA ET AL., INFECT IMMUN, vol. 78, 2010, pages 2901 - 2909
INATSUKA ET AL., INFECT. IMMUN., vol. 78, 2010, pages 2901 - 2909
LEININGER ET AL., PROC. NAT'L. ACAD. SCI. USA, vol. 88, 1991, pages 345 - 9
LUKER ET AL., PROC. NATL. ACAD. SCI. USA., vol. 90, 1993, pages 2365 - 2369
MCPHEE; PAPADAKIS: "Current Medical Diagnosis and Treatment, 49th Edition,", 2010, MCGRAW-HILL MEDICAL
MENOZZI ET AL., NFECT IMMUN, vol. 62, 1994, pages 769 - 778
MIELCAREK ET AL., PLOS PATHOG, vol. 2, 2006, pages E65
REDDY ET AL.,: "Methods for General and Molecular Microbiology (3d Ed),", ASM PRESS
RIGMOR THORSTENSSON ET AL: "A Phase I Clinical Study of a Live Attenuated Bordetella pertussis Vaccine - BPZE1; A Single Centre, Double-Blind, Placebo-Controlled, Dose-Escalating Study of BPZE1 Given Intranasally to Healthy Adult Male Volunteers", PLOS ONE, vol. 9, no. 1, 8 January 2014 (2014-01-08), pages e83449, XP055374316, DOI: 10.1371/journal.pone.0083449 *
SAMBROOK ET AL.,: "Molecular Cloning: A Laboratory Manual, 2nd ed.", vol. 1-3, 2001, COLD SPRING HARBOR LABORATORY PRESS
SAUKKONEN ET AL., PROC. NATL. ACAD. SCI. USA., vol. 89, 1992, pages 118 - 122
SOLANS ET AL., PLOS PATHOG, vol. 10, 2014, pages EL004183

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11446372B2 (en) 2017-10-18 2022-09-20 Institut Pasteur De Lille Bordetella strains expressing serotype 3 fimbriae
WO2024018061A1 (en) 2022-07-22 2024-01-25 Institut National de la Santé et de la Recherche Médicale Use of bordetella strains for the treatment of chronic obstructive pulmonary disease
WO2025257397A1 (en) 2024-06-14 2025-12-18 Institut National de la Santé et de la Recherche Médicale Live attenuated bordetella vaccines capable of producing and secreting heterologous antigens

Also Published As

Publication number Publication date
CA3018126A1 (en) 2017-10-05
JP2019513722A (ja) 2019-05-30
US20170283890A1 (en) 2017-10-05
DK3436034T3 (da) 2025-05-12
AU2022221438A1 (en) 2022-10-06
EP4541809A3 (en) 2025-06-25
US20230381224A1 (en) 2023-11-30
AU2017242541A1 (en) 2018-10-11
US20210290667A1 (en) 2021-09-23
FI3436034T3 (fi) 2025-05-08
EP3436034A1 (en) 2019-02-06
US10682377B2 (en) 2020-06-16
ES3027194T3 (en) 2025-06-13
AU2022221438B2 (en) 2024-10-03
AU2017242541B2 (en) 2022-06-30
US11065276B2 (en) 2021-07-20
CN109069535B (zh) 2022-03-18
CN109069535A (zh) 2018-12-21
EP4541809A2 (en) 2025-04-23
JP6993984B2 (ja) 2022-02-03
EP3436034B1 (en) 2025-03-26
CN114767718A (zh) 2022-07-22
SG11201807783UA (en) 2018-10-30
US20200323901A1 (en) 2020-10-15

Similar Documents

Publication Publication Date Title
AU2022221438B2 (en) Mutant bordetella strains and methods for use
Garcia-Crespo et al. Lactobacillus priming of the respiratory tract: Heterologous immunity and protection against lethal pneumovirus infection
JP2019513722A5 (cg-RX-API-DMAC7.html)
US20080254062A1 (en) Use of an avirulent bordetella mutant as a live vaccine vector
US12403188B2 (en) Bordetella strains expressing serotype 3 fimbriae
EP2453913A1 (en) A temperature sensitive vaccine strain of mycoplasma hyopneumoniae and uses thereof
WO2020049133A1 (en) Adenylate cyclase catalytic domain deficient bordetella strains
Mann et al. Use of a genetically defined double mutant strain of Bordetella bronchiseptica lacking adenylate cyclase and type III secretion as a live vaccine
CA3018126C (en) Mutant bordetella strains and methods of use
Hur et al. Immunologic study and optimization of Salmonella delivery strains expressing adhesin and toxin antigens for protection against progressive atrophic rhinitis in a murine model
HK1262896B (zh) 突变型博德特氏菌属菌株及其使用方法
HK1262896A1 (en) Mutant bordetella strains and methods for use
TW202214294A (zh) 具有hyaC及nanP缺失之新穎多殺性巴斯德氏菌株及疫苗
Byeon et al. Generation of an attenuated Salmonella-delivery strains expressing adhesin and toxin antigens for progressive atrophic rhinitis, and evaluation of its immune responses in a murine model
HK40121137A (zh) 鲍特氏菌属菌株在治疗慢性阻塞性肺疾病中的使用
HK40115864A (zh) 表达血清3型菌毛的鲍特菌属菌株
Verma et al. Comparative Study of the Adjuvanticity of FIA and Phosphatidylcholine Liposomes for Purified Mycobacterial RNA
HK40026630B (zh) 表达血清3型菌毛的鲍特菌属菌株
Pilione et al. Use of a Genetically Defined Double Mutant
Goel Interleukin-6 Contributes To Immunity Against Bordetella Pertussis.

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 11201807783U

Country of ref document: SG

ENP Entry into the national phase

Ref document number: 3018126

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2018551960

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2017242541

Country of ref document: AU

Date of ref document: 20170329

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2017715426

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2017715426

Country of ref document: EP

Effective date: 20181029

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17715426

Country of ref document: EP

Kind code of ref document: A1