WO2017156166A1 - Microorganisms and methods for the co-production of ethylene glycol and three carbon compounds - Google Patents
Microorganisms and methods for the co-production of ethylene glycol and three carbon compounds Download PDFInfo
- Publication number
- WO2017156166A1 WO2017156166A1 PCT/US2017/021421 US2017021421W WO2017156166A1 WO 2017156166 A1 WO2017156166 A1 WO 2017156166A1 US 2017021421 W US2017021421 W US 2017021421W WO 2017156166 A1 WO2017156166 A1 WO 2017156166A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- nucleic acid
- conversion
- catalyzes
- recombinant microorganism
- acid molecule
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/24—Preparation of oxygen-containing organic compounds containing a carbonyl group
- C12P7/26—Ketones
- C12P7/28—Acetone-containing products
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/52—Genes encoding for enzymes or proenzymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0008—Oxidoreductases (1.) acting on the aldehyde or oxo group of donors (1.2)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1025—Acyltransferases (2.3)
- C12N9/1029—Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
- C12N9/1205—Phosphotransferases with an alcohol group as acceptor (2.7.1), e.g. protein kinases
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/13—Transferases (2.) transferring sulfur containing groups (2.8)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/88—Lyases (4.)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/90—Isomerases (5.)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P5/00—Preparation of hydrocarbons or halogenated hydrocarbons
- C12P5/02—Preparation of hydrocarbons or halogenated hydrocarbons acyclic
- C12P5/026—Unsaturated compounds, i.e. alkenes, alkynes or allenes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
- C12P7/04—Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
- C12P7/04—Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic
- C12P7/18—Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic polyhydric
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/24—Preparation of oxygen-containing organic compounds containing a carbonyl group
- C12P7/26—Ketones
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y102/00—Oxidoreductases acting on the aldehyde or oxo group of donors (1.2)
- C12Y102/01—Oxidoreductases acting on the aldehyde or oxo group of donors (1.2) with NAD+ or NADP+ as acceptor (1.2.1)
- C12Y102/01021—Glycolaldehyde dehydrogenase (1.2.1.21)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y203/00—Acyltransferases (2.3)
- C12Y203/01—Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
- C12Y203/01009—Acetyl-CoA C-acetyltransferase (2.3.1.9)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
- C12Y207/01—Phosphotransferases with an alcohol group as acceptor (2.7.1)
- C12Y207/01047—D-Ribulokinase (2.7.1.47)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y208/00—Transferases transferring sulfur-containing groups (2.8)
- C12Y208/03—CoA-transferases (2.8.3)
- C12Y208/03008—Acetate CoA-transferase (2.8.3.8)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y401/00—Carbon-carbon lyases (4.1)
- C12Y401/02—Aldehyde-lyases (4.1.2)
- C12Y401/02013—Fructose-bisphosphate aldolase (4.1.2.13)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P2203/00—Fermentation products obtained from optionally pretreated or hydrolyzed cellulosic or lignocellulosic material as the carbon source
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y401/00—Carbon-carbon lyases (4.1)
- C12Y401/01—Carboxy-lyases (4.1.1)
- C12Y401/01004—Acetoacetate decarboxylase (4.1.1.4)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y501/00—Racemaces and epimerases (5.1)
- C12Y501/03—Racemaces and epimerases (5.1) acting on carbohydrates and derivatives (5.1.3)
Definitions
- This application relates to recombinant microorganisms useful in the biosynthesis of monoethylene glycol and one or more three-carbon compounds.
- the application further relates to methods of producing monoethylene glycol and one or more three-carbon compound using the recombinant microorganisms, as well as compositions comprising one or more of these compounds and/or the recombinant microorganisms.
- the present application relates to recombinant microorganisms having one or more biosynthesis pathways for the production of monoethylene glycol and one or more three-carbon compounds.
- the present disclosure provides a combination of an easy to implement, high yield C2 branch pathway for MEG production from xylose with an easy to implement C3 branch pathway for production of one or more three-carbon compounds from DHAP or pyruvate.
- the presently disclosed process of co-producing MEG and one or more three-carbon compounds is synergistic by utilizing the excess NADH produced in the C3 branch pathway to feed the NADH requirement of the C2 branch pathway.
- the present application provides a recombinant microorganism co-producing monoethylene glycol (MEG) and one or more three- carbon compounds, in one embodiment, the MEG and one or more three-carbon compounds are co-produced from xylose, in another embodiment, the recombinant microorganism comprises a deletion, insertion, or loss of function mutation in a gene encoding a D-xyiuiose-5-kinase and/or in a gene encoding a glycoaldehyde dehydrogenase, in some embodiments, the gene encoding the D-xyiulose-5-kinase is xylB.
- MEG monoethylene glycol
- the recombinant microorganism comprises a deletion, insertion, or loss of function mutation in a gene encoding a D-xyiuiose-5-kinase and/or in a gene encoding a glycoaldehyde dehydrogenase, in some embodiment
- the gene encoding the glycoaldehyde dehydrogenase is aidA.
- MEG is produced through the conversion of giycoiaidehyde in a C2 branch pathway and one or more three-carbon compounds is produced through the conversion of DHAP or pyruvate in a C3 branch pathway.
- at least a portion of the excess NADH produced in the C3 branch pathway is used as a source of reducing equivalents in the C2 branch pathway.
- at least a portion of the excess NADH produced in the C3 branch pathway is used to produce ATP.
- excess biomass formation is minimized and production of MEG and one or more three- carbon compounds is maximized,
- MEG is produced from xylose via ribulose-1- phosphate. In another embodiment, MEG is produced from xylose via xylulose-1- phosphate. In a further embodiment, MEG is produced from xylose via xylonafe.
- the one or more three-carbon compounds is acetone. In another embodiment, the one or more three-carbon compounds is isopropanol. In a further embodiment, the one or more three-carbon compounds is propene.
- MEG and acetone are co-produced from xylose using a ribulose-1 -phosphate pathway for the conversion of xylose to MEG and a C3 branch pathway for the conversion of dihydroxyacetone-phosphate (DHAP) to acetone.
- a ribulose-1 -phosphate pathway for the conversion of xylose to MEG
- a C3 branch pathway for the conversion of dihydroxyacetone-phosphate (DHAP) to acetone.
- the present application relates to a recombinant microorganism capable of co-producing monoethylene glycol (MEG) and acetone from exogenous D-xylose, wherein the recombinant microorganism expresses one or more of the following:
- the produced intermediate DHAP is converted to acetyl-CoA through the endogenous glycolysis pathway in the microorganism, and wherein MEG and acetone are co-produced.
- the enzyme that catalyzes the conversion of D- xylulose to D-ribulose is a D-tagatose 3-epimerase.
- the enzyme that catalyzes the conversion of D-xylulose to D-ribulose is encoded by one or more endogenous nucleic acid molecules.
- the enzyme that catalyzes the conversion of D-xylulose to D-ribulose is encoded by one or more exogenous nucleic acid molecules.
- the enzyme is a D-tagatose 3-epimerase that is encoded by a nucleic acid molecule obtained from a microorganism selected from Pseudomonas sp., Mesorhizobium sp. and Rhodobacter sp.
- the nucleic acid molecule encoding D- tagatose 3-epimerase is obtained from a microorganism selected from Pseudomonas cichorii, Pseudomonas sp. ST-24, Mesorhizobium lots and Rhodobacter sphaeroides.
- the nucleic acid molecule encoding D-tagatose 3-epimerase is dte, C1 KKR1 , or homolog thereof.
- the one or more nucleic acid molecules is FJ851309.1 or homolog thereof, in a further embodiment, the D-tagatose 3-epimerase comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 3 and 5.
- the D-tagatose 3-epimerase is encoded by a nudeic acid sequence selected from the group consisting of SEQ ID NOs: 1 , 2 and 4.
- the enzyme that catalyzes the conversion of D- ribulose to D-ribulose-1-phosphate is a D-ribulokinase.
- the enzyme that catalyzes the conversion of D-ribulose to D-ribulose- -phosphate is encoded by one or more endogenous nucleic acid molecules.
- the enzyme that catalyzes the conversion of D-ribulose to D-ribulose-1 - phosphate is encoded by one or more exogenous nucleic acid molecules.
- the enzyme is a D-ribulokinase that is encoded by a nucleic acid molecule obtained from E. coii.
- the nudeic acid molecule encoding D-ribulokinase is fucK, or homolog thereof, in a further embodiment, the D- ribulokinase comprises an amino acid sequence set forth in SEQ ID NO: 8. in yet a further embodiment, the D-ribulokinase is encoded by a nudeic acid sequence selected from the group consisting of SEQ ID NQs: 8 and 7.
- the enzyme that catalyzes the conversion of D- ribulose-1 -phosphate to giycolaldehyde and dihydroxyacetonephosphate (DHAP) is a D-ribulose-1-phosphate aldolase, in a further embodiment, the enzyme that catalyzes the conversion of D-ribulose-1 -phosphate to giycolaldehyde and DHAP is encoded by one or more endogenous nucleic acid molecules.
- the enzyme that catalyzes the conversion of D-ribuiose-1 -phosphate to giycolaldehyde and DHAP is encoded by one or more exogenous nucleic acid molecules
- the enzyme is a D-ribuiose- -phosphate aldolase that is encoded by a nucleic acid molecule obtained from E. co!i.
- the nudeic acid molecule encoding D-ribulose-1-phosphate aldolase is fucA, or homolog thereof
- the D-ribulose-1-phosphate aldolase comprises an amino acid sequence set forth in SEQ ID NO: 11.
- the D-ribuiose-1 -phosphate aldolase is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 9 and 10.
- the enzyme that catalyzes the conversion of giycolaldehyde to MEG is a giycolaldehyde reductase or aldehyde reductase.
- the enzyme that catalyzes the conversion of giycolaldehyde to MEG is encoded by one or more endogenous nucleic acid molecules.
- the enzyme that catalyzes the conversion of glycolaldehyde to MEG is encoded by one or more exogenous nucleic acid molecules.
- the enzyme is a glycolaldehyde reductase or aldehyde reductase that is encoded by a nucleic acid molecule obtained from a microorganism selected from E. coli or S. cerevisiae.
- the nucleic acid molecule encoding glycolaldehyde reductase or aldehyde reductase is selected from fucO, yqhD, dkgA (yqhE), dkgB (yafB), yeaE, yghZ, gldA, GRE2, or homoiog thereof, in another embodiment, the one or more nucleic acid molecules is yqhD.
- the yqhD comprises a G149E mutation
- the glycolaldehyde reductase comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 13, 15, 17, 20, 23, 25, 28, 30 and 32.
- the glycolaldehyde reductase is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 12, 14, 16, 18, 19, 21 , 22, 24, 26, 27, 29 and 31.
- the enzyme that catalyzes the conversion of acetyl- CoA to acetoacetyi-CoA is a thiolase or acetyl coenzyme A acetyitransferase.
- the enzyme that catalyzes the conversion of acetyl-CoA to acetoacetyi-CoA is encoded by one or more endogenous nucleic acid molecules, in an alternative embodiment, the enzyme that catalyzes the conversion of acetyl-CoA to acetoacetyi-CoA is encoded by one or more exogenous nucleic acid molecules.
- the enzyme is a thiolase or acetyl coenzyme A acetyitransferase that is encoded by a nucleic acid molecule obtained from a microorganism selected from Clostridium sp., Bacillus sp., E, coli, Saccharomyces sp. and Marinobacter sp.
- the nucleic acid molecule encoding thiolase or acetyl coenzyme A acetyitransferase is obtained from a microorganism selected from Clostridium acetobutyiicum, Clostridium thermosaccharo!yticum, Bacillus cereus, E.
- the nucleic acid molecule encoding thiolase or acetyl coenzyme A acetyitransferase is thIA, atoB and/or ERG10, or homoiog thereof.
- the thiolase or acetyl coenzyme A acetyitransferase comprises an amino acid sequence selected from the group consisting of SEQ ID NQs: 35, 37 and 40.
- the thiolase or acetyl coenzyme A acetyltransferase is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 33, 34, 36, 38 and 39.
- the enzyme that catalyzes the conversion of acetoacetyl-CoA to acetoacetate is an acetate: acetoacetyl-CoA transferase or hydrolase.
- the transferase is an acetyl-CoA:acetoacetate- CoA transferase.
- the enzyme that catalyzes the conversion of acetoacetyl-CoA to acetoacetate is encoded by one or more endogenous nucleic acid molecules.
- the enzyme that catalyzes the conversion of acetoacetyl-CoA to acetoacetate is encoded by one or more exogenous nucleic acid molecules.
- the enzyme is an acetate: acetoacetyl-CoA transferase or hydrolase that is encoded by a nucleic acid molecule obtained from a microorganism selected from Clostridium sp. and E, coii.
- the nucleic acid molecule encoding acetate: acetoacetyl-CoA hydrolase is obtained from Clostridium acetobutylicum.
- the nucleic acid molecules encoding acetate :acetoacetyl-CoA transferase is obtained from E. coii.
- the nucleic acid molecules encoding acetate: acetoacetyl-CoA transferase subunits are atoA and atoD, or homologs thereof.
- the nucleic acid molecules encoding acetate: acetoacetyl-CoA hydrolase subunits are ctfA and ctfB, or homologs thereof.
- the acetyl-CoA:acetoacetate-CoA transferase or acetate: acetoacetyl-CoA hydrolase comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 43, 46, 97, 99, 01 and 103.
- the acety!-CoA:acetoacetate-CoA transferase or acetate: acetoacetyl-CoA hydrolase is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 41 , 42, 44, 45, 96, 98, 100 and 102.
- the enzyme that catalyzes the conversion of acetoacetate to acetone is an acetoacetate decarboxylase
- the enzyme that catalyzes the conversion of acetoacetate to acetone is encoded by one or more endogenous nucleic acid molecules
- the enzyme that catalyzes the conversion of acetoacetate to acetone is encoded by one or more exogenous nucleic acid molecules.
- the enzyme is an acetoacetate decarboxylase that is encoded by a nucleic acid molecule obtained from a microorganism selected from Clostridium sp., Bacillus sp., Chromobacterium sp.
- the nucleic acid molecule encoding acetoacetate decarboxylase is obtained from a microorganism selected from Clostridium acetobutylicum, Clostridium beijerinckii, Clostridium celluiolyticum, Bacillus polymyxa, Chromobacterium violaceum and Pseudomonas putida.
- the nucleic acid molecule encoding acetoacetate decarboxylase is adc, or homolog thereof.
- the acetoacetate decarboxylase comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 49 and 52.
- the acetoacetate decarboxylase is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 47, 48, 50 and 51.
- the recombinant microorganism further comprises one or more modifications selected from the group consisting of:
- the enzyme that catalyzes the conversion of D- xyiulose to D-xylulose-5-phosphate is a D-xylulose-5-kinase.
- the D-xylulose-5-kinase is from Escherichia coli, in some embodiments, the D ⁇ xyiulose-5-kinase is encoded by the xyiB gene, or homolog thereof.
- a recombinant microorganism producing MEG and a three-carbon compound comprises a deletion, insertion, or loss of function mutation in a gene encoding a D-xyluiose-5-kinase to prevent the conversion of D- xyiulose to D-xylulose-5-phosphate and instead shunt the reaction toward conversion of D-xyiuiose to D-xyluiose- -phosphate.
- the enzyme that catalyzes the conversion of giycolaldehyde to glycolic acid is a glycolaldehyde dehydrogenase
- the glycolaldehyde dehydrogenase is from Escherichia coii.
- the glycolaldehyde dehydrogenase is encoded by the aldA gene, or homolog thereof.
- a recombinant microorganism producing MEG and a three-carbon compound comprises a deletion, insertion, or loss of function mutation in a gene encoding a giycolaldehyde dehydrogenase to prevent the production of glycolic acid from giycolaldehyde and instead shunt the reaction toward conversion of giycolaldehyde to MEG.
- the enzyme that catalyzes the conversion of pyruvate to lactate is a lactate dehydrogenase.
- the enzyme converts pyruvate to lactate.
- the lactate dehydrogenase is from Escherichia coii.
- the lactate dehydrogenase is encoded by the IdhA gene, or homolog thereof.
- a recombinant microorganism producing MEG and a three-carbon compound comprises a deletion, insertion, or loss of function mutation in a gene encoding a lactate dehydrogenase to prevent the production of lactate from pyruvate and instead shunt the reaction toward production of a three- carbon compound.
- the recombinant microorganism further comprises an endogenous enzyme that catalyzes the conversion of D-xylose to D-xyiuiose.
- MEG and acetone are co-produced from xylose using a xylulose-1-phosphate pathway for the conversion of xylose to MEG and a C3 branch pathway for the conversion of dihydroxyacetone-phosphate (DHAP) to acetone.
- DHAP dihydroxyacetone-phosphate
- the present application relates to a recombinant microorganism capable of co-producing monoethylene glycol (MEG) and acetone from exogenous D-xylose, wherein the recombinant microorganism expresses one or more of the following: (a) at least one endogenous or exogenous nucleic acid molecule encoding an enzyme that catalyzes the conversion of D ⁇ xylulose to D-xylu!ose-1- phosphate;
- the produced intermediate DHAP is converted to acetyl-CoA through the endogenous glycolysis pathway in the microorganism, and wherein MEG and acetone are co-produced.
- the enzyme that catalyzes the conversion of D- xyiulose to D ⁇ xyluiose- -phosphate is a D ⁇ xyluiose 1-kinase.
- the enzyme that catalyzes the conversion of D-xylulose to D-xylulose- 1 -phosphate is encoded by one or more endogenous nucleic acid molecules.
- the enzyme that catalyzes the conversion of D-xylulose to D-xylulose-1-phosphate is encoded by one or more exogenous nucleic acid molecules.
- the enzyme is a D-xyiulose 1-kinase that is encoded by a nucleic acid molecule obtained from Homo sapiens.
- the Homo sapiens D-xyiuiose 1-kinase is a ketohexokinase C.
- the nucleic acid molecule encoding human ketohexokinase C is khk- C, or hornolog thereof.
- the one or more nucleic acid molecules encoding the D ⁇ xylulose -kinase comprises an amino acid sequence set forth in SEQ ID NO: 55.
- the one or more nucleic acid molecules encoding the D-xylulose 1 -kinase is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 53 and 54.
- the enzyme that catalyzes the conversion of D- xyiulose- -phosphate to giycolaldehyde and dihydroxyacetonephosphate (DHAP) is a D-xylulose-1-phosphate aldolase, in a further embodiment, the enzyme that catalyzes the conversion of D-xylulose-1 -phosphate to giycolaldehyde and DHAP is encoded by one or more endogenous nucleic acid molecules.
- the enzyme that catalyzes the conversion of D-xylulose-1-phosphate to giycolaldehyde and DHAP is encoded by one or more exogenous nucleic acid molecules
- the enzyme is a D-xylulose-1 -phosphate aldolase that is encoded by a nucleic acid molecule obtained from Homo sapiens.
- the Homo sapiens D-xyiulose 1 -phosphate aldolase is an aldolase B.
- the nucleic acid molecule encoding human aldolase B is ALDOB, or hornolog thereof, in some embodiments, the one or more nucleic acid molecules encoding the D-xyiuiose ⁇ 1 -phosphate aldolase comprises an amino acid sequence set forth in SEQ ID NO: 58. In some embodiments, the one or more nucleic acid molecules encoding the D-xyluiose-1 -phosphate aldolase is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 58 and 57.
- the enzyme that catalyzes the conversion of giycolaldehyde to MEG is a giycolaldehyde reductase or aldehyde reductase.
- the enzyme that catalyzes the conversion of giycolaldehyde to MEG is encoded by one or more endogenous nucleic acid molecules.
- the enzyme that catalyzes the conversion of giycolaldehyde to MEG is encoded by one or more exogenous nucleic acid molecules
- the enzyme is a giycolaldehyde reductase or aldehyde reductase that is encoded by a nucleic acid molecule obtained from a microorganism selected from E. coii or S. cerevisiae.
- the nucleic acid molecule encoding giycolaldehyde reductase or aldehyde reductase is selected from fucO, yqhD, dkgA (yqhE), dkgB (yafB), yeaE, yghZ, gldA, GRE2, or homolog thereof.
- the one or more nucleic acid molecules is yqhD, In some embodiments, the yqhD comprises a G149E mutation.
- the giycolaidehyde reductase comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 13, 15, 17, 20, 23, 25, 28, 30 and 32.
- the giycolaidehyde reductase is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 12, 14, 16, 18, 19, 21 , 22, 24, 26, 27, 29 and 31.
- the enzyme that catalyzes the conversion of acetyl- CoA to acetoacetyi-CoA is a thiolase or acetyl coenzyme A acetyltransferase.
- the enzyme that catalyzes the conversion of acetyl ⁇ CoA to acetoacetyi-CoA is encoded by one or more endogenous nucleic acid molecules, in an alternative embodiment, the enzyme that catalyzes the conversion of acetyi-CoA to acetoacetyi-CoA is encoded by one or more exogenous nucleic acid molecules.
- the enzyme is a thiolase or acetyl coenzyme A acetyltransferase that is encoded by a nucleic acid molecule obtained from a microorganism selected from Clostridium sp., Bacillus sp., E. coli, Saccharomyces sp. and Marinobacter sp.
- the nucleic acid molecule encoding thiolase or acetyl coenzyme A acetyltransferase is obtained from a microorganism selected from Clostridium acetobutylicum, Clostridium thermosaccharo!yiicum, Bacillus cereus, E.
- the nucleic acid molecule encoding thiolase or acetyl coenzyme A acetyltransferase is thIA, atoB and/or ERG10, or homolog thereof.
- the thiolase or acetyl coenzyme A acetyltransferase comprises an amino acid sequence selected from the group consisting of SEQ ID NQs: 35, 37 and 40.
- the thiolase or acetyl coenzyme A acetyltransferase is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NQs: 33, 34, 36, 38 and 39.
- the enzyme that catalyzes the conversion of acetoacetyi-CoA to acetoacetate is a acetate: acetoacetyi-CoA transferase or hydrolase, in some embodiments, the transferase is an acetyl-CoA:acetoacetate- CoA transferase.
- the enzyme that catalyzes the conversion of acetoacetyl-CoA to acetoacetate is encoded by one or more endogenous nucleic acid molecules.
- the enzyme that catalyzes the conversion of acetoacetyl-CoA to acetoacetate is encoded by one or more exogenous nucleic acid molecules.
- the enzyme is an acetate: acetoacetyl-CoA transferase or hydrolase that is encoded by a nucleic acid molecule obtained from a microorganism selected from Clostridium sp. and E, coii.
- the nucleic acid molecule encoding acetate: acetoacetyl-CoA hydrolase is obtained from Clostridium acetobutyiicum.
- the nucleic acid molecules encoding acetate:acetoacetyl-CoA transferase is obtained from E. coli.
- the nucleic acid molecules encoding acetate: acetoacetyl-CoA transferase subunits are atoA and atoD, or homologs thereof.
- the nucleic acid molecules encoding acetate: acetoacetyl-CoA hydrolase subunits are ctfA and ctfB, or homologs thereof.
- the acetyl-CoA:acetoacetate-CoA transferase or acetate: acetoacetyl-CoA hydrolase comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 43, 46, 97, 99, 101 and 103.
- acetyl-CoA:acetoacetafe-CoA transferase or acetate: acetoacetyl-CoA hydrolase is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 41 , 42, 44, 45, 98, 98, 100 and 102.
- the enzyme that catalyzes the conversion of acetoacetate to acetone is an acetoacetate decarboxylase
- the enzyme that catalyzes the conversion of acetoacetate to acetone is encoded by one or more endogenous nucleic acid molecules
- the enzyme that catalyzes the conversion of acetoacetate to acetone is encoded by one or more exogenous nucleic acid molecules.
- the enzyme is an acetoacetate decarboxylase that is encoded by a nucleic acid molecule obtained from a microorganism selected from Clostridium sp., Bacillus sp., Chromobacterium sp.
- the nucleic acid molecule encoding acetoacetate decarboxylase is obtained from a microorganism selected from Clostridium acetobutyiicum, Clostridium beijerinckii, Clostridium DCiuloiyticum, Bacillus polymyxa, Chromobacterium vioiaceum and Pseudomonas putida.
- the nucleic acid molecule encoding acetoacetate decarboxylase is adc, or homoiog thereof.
- the acetoacetate decarboxylase comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 49 and 52.
- the acetoacetate decarboxylase is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 47, 48, 50 and 51.
- the recombinant microorganism further comprises one or more modifications selected from the group consisting of:
- the enzyme that catalyzes the conversion of D- xyiulose to D-xylulose-5-phosphate is a D-xylulose-5-kinase.
- the D-xylulose-5-kinase is from Escherichia coii, in some embodiments, the D ⁇ xyiulose-5-kinase is encoded by the xyiB gene, or homoiog thereof.
- a recombinant microorganism producing MEG and a three-carbon compound comprises a deletion, insertion, or loss of function mutation in a gene encoding a D-xyluiose-5-kinase to prevent the conversion of D- xyiulose to D-xylulose-5-phosphate and instead shunt the reaction toward conversion of D-xyiuiose to D-xyluiose- -phosphate.
- the enzyme that catalyzes the conversion of glycolaldehyde to glycolic acid is a glycolaldehyde dehydrogenase
- the glycolaldehyde dehydrogenase is from Escherichia coii.
- the glycolaldehyde dehydrogenase is encoded by the aidA gene, or homoiog thereof.
- a recombinant microorganism producing MEG and a three-carbon compound comprises a deletion, insertion, or loss of function mutation in a gene encoding a giyco!aldehyde dehydrogenase to prevent the production of glycolic acid from giycolaldehyde and instead shunt the reaction toward conversion of giycolaldehyde to MEG.
- the enzyme that catalyzes the conversion of pyruvate to lactate is a lactate dehydrogenase.
- the enzyme converts pyruvate to lactate.
- the lactate dehydrogenase is from Escherichia coii.
- the lactate dehydrogenase is encoded by the IdhA gene, or homolog thereof.
- a recombinant microorganism producing MEG and a three-carbon compound comprises a deletion, insertion, or loss of function mutation in a gene encoding a lactate dehydrogenase to prevent the production of lactate from pyruvate and instead shunt the reaction toward production of a three- carbon compound.
- the recombinant microorganism further comprises an endogenous enzyme that catalyzes the conversion of D-xylose to D-xyiuiose.
- the present application relates to a recombinant microorganism capable of co-producing monoethyiene glycol (MEG) and acetone from exogenous D-xylose and glucose, wherein the recombinant microorganism expresses one or more of the following:
- microorganism further expresses one or more of the following: (c) at least one endogenous or exogenous nucleic acid molecule encoding a D-tagatose 3 ⁇ epimerase that catalyzes the conversion of D ⁇ xyluiose from (a) or (b) to D-ribulose;
- DHAP dihydroxyacetonephosphate
- the produced intermediate DHAP is converted to acetyl-CoA through the endogenous glycolysis pathway in the microorganism, and wherein MEG and acetone are co-produced.
- the enzyme that catalyzes the conversion of D-xylose to xylitoi is a xylose reductase or aldose reductase.
- the enzyme that catalyzes the conversion of D-xylose to xylitoi is encoded by one or more endogenous nucleic acid molecules.
- the enzyme that catalyzes the conversion of D-xyiose to xylitoi is encoded by one or more exogenous nucleic acid molecules.
- the enzyme is a xylose reductase or aldose reductase that is encoded by a nucleic acid molecule obtained from a microorganism selected from Hypocrea sp., Scheffersomyces sp,, Saccharomyces sp., Pachysoien sp., Pichia sp., Candida sp., Aspergillus sp., Neurospora sp., and Cryptococcus sp.
- the nucleic acid molecule encoding the xylose reductase or aldose reductase is obtained from a microorganism selected from Hypocrea jecorina, Scheffersomyces stipitis, S. cerevisiae, Pachysoien tannophiius, Pichia stipitis, Pichia quercuum, Candida shehatae, Candida tenuis, Candida tropica!is, Aspergillus niger, Neurospora crassa and Cryptococcus iactaiivorus.
- a microorganism selected from Hypocrea jecorina, Scheffersomyces stipitis, S. cerevisiae, Pachysoien tannophiius, Pichia stipitis, Pichia quercuum, Candida shehatae, Candida tenuis, Candida tropica!is, Aspergillus niger, Neurospora crassa and Cryptococcus iactaiivorus
- the nucleic acid molecule encoding xylose reductase or aldose reductase is xyl1 , GKE3, or homoiog thereof.
- the one or more nucleic acid molecules encoding the xylose reductase or aldose reductase comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 84 and 87.
- the one or more nucleic acid molecules encoding the xylose reductase or aldose reductase is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 82, 83, 85 and 86.
- the enzyme that catalyzes the conversion of xyiitol to D-xyiuiose is a xyiitol dehydrogenase.
- the enzyme that catalyzes the conversion of xyiitol to D-xyiulose is encoded by one or more endogenous nucleic acid molecules.
- the enzyme that catalyzes the conversion of xyiitol to D-xyiulose is encoded by one or more exogenous nucleic acid molecules
- the enzyme is a xyiitol dehydrogenase that is encoded by a nucleic acid molecule obtained from a microorganism selected from Scheffersomyces sp., Trichoderma sp., Pichia sp., Saccharomyces sp., Gluconobacter sp., Gaiactocandida sp., Neurospora sp., and Serratia sp.
- the nucleic acid molecule encoding the xyiitol dehydrogenase is obtained from a microorganism selected from Scheffersomyces stipitis, Trichoderma reesei, Pichia stipitis, S. cerevisiae, Gluconobacter oxydans, Gaiactocandida mastotermitis, Neurospora crassa and Serratia marcescens.
- the one or more nucleic acid molecule encoding xyiitol dehydrogenase is xy!2, xdhl , or homoiog thereof, in some embodiments, the one or more nucleic acid molecules encoding the xyiitol dehydrogenase comprises an amino acid sequence selected from the group consisting of SEQ I D NQs: 90 and 92. In some embodiments, the one or more nucleic acid molecules encoding the xylitol dehydrogenase is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 88, 89 and 91.
- the enzyme that catalyzes the conversion of D-xylose to D-xylulose is a D-xyiose isomerase.
- the enzyme that catalyzes the conversion of D-xylose to D-xylulose is encoded by one or more endogenous nucleic acid molecules.
- the enzyme that catalyzes the conversion of D-xylose to D-xylulose is encoded by one or more exogenous nucleic acid molecules.
- the enzyme is a D- xyiose isomerase that is encoded by a nucleic acid molecule obtained from E. coli.
- the xylose isomerase is encoded by one or more nucleic acid molecules obtained from Pyromyces sp.
- the nucleic acid molecule encoding D-xylose isomerase is xylA, or homolog thereof
- the one or more nucleic acid molecules encoding the xylose isomerase comprises an amino acid sequence set forth in SEQ ID NO: 95
- the one or more nucleic acid molecules encoding the xylose isomerase is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 93 and 94.
- the enzyme that catalyzes the conversion of D- xyiulose to D-ribulose is a D-tagatose 3-epimerase.
- the enzyme that catalyzes the conversion of D-xylulose to D-ribulose is encoded by one or more endogenous nucleic acid molecules, in an alternative embodiment, the enzyme that catalyzes the conversion of D-xylulose to D-ribulose is encoded by one or more exogenous nucleic acid molecules.
- the enzyme is a D-tagatose 3-epimerase that is encoded by a nucleic acid molecule obtained from a microorganism selected from Pseudomonas sp., Mesorhizobium sp. and Rhodobacter sp.
- the nucleic acid molecule encoding D- tagatose 3-epimerase is obtained from a microorganism selected from Pseudomonas cichorii, Pseudomonas sp. ST-24, Mesorhizobium ioti and Rhodobacter sphaeroides.
- the nucleic acid molecule encoding D-tagatose 3-epimerase is dte, C1 KKR1 , or homolog thereof.
- the one or more nucleic acid molecules is FJ851309.1 or homolog thereof.
- the D-tagatose 3-epimerase comprises an amino acid sequence selected from the group consisting of SEQ I D NOs: 3 and 5.
- the D-tagatose 3-epimerase is encoded by a nudeic acid sequence selected from the group consisting of SEQ I D NOs: 1 , 2 and 4.
- the enzyme that catalyzes the conversion of D ⁇ ribulose to D-ribulose-1-phosphate is a D-ribulokinase
- the enzyme that catalyzes the conversion of D-ribulose to D-ribulose-1 -phosphate is encoded by one or more endogenous nucleic acid molecules.
- the enzyme that catalyzes the conversion of D-ribulose to D-ribulose-1 - phosphate is encoded by one or more exogenous nucleic acid molecules.
- the enzyme is a D-ribulokinase that is encoded by a nucleic acid molecule obtained from E.
- the nudeic acid molecule encoding D-ribulokinase is fucK, or homolog thereof.
- the D ⁇ ribulokinase comprises an amino acid sequence set forth in SEQ I D NO: 8.
- the D-ribulokinase is encoded by a nucleic acid sequence selected from the group consisting of SEQ I D NOs: 6 and 7.
- the enzyme that catalyzes the conversion of D- ribulose-1 -phosphate to glycolaidehyde and dihydroxyacetonephosphate (DHAP) is a D-ribu!ose-1-phosphate aldolase.
- the enzyme that catalyzes the conversion of D-ribuiose-1 -phosphate to glycolaidehyde and DHAP is encoded by one or more endogenous nucleic acid molecules.
- the enzyme that catalyzes the conversion of D-ribuiose-1 -phosphate to glycolaidehyde and DHAP is encoded by one or more exogenous nudeic acid molecules
- the enzyme is a D-ribulose- -phosphate aldolase that is encoded by a nudeic acid molecule obtained from E. co/7.
- the nudeic acid molecule encoding D-ribuiose-1-phosphate aldolase is fucA, or homolog thereof
- the D-ribulose-1-phosphate aldolase comprises an amino acid sequence set forth in SEQ ID NO: 1 1 .
- the D-ribulose- -phosphate aldolase is encoded by a nucleic acid sequence selected from the group consisting of SEQ I D NOs: 9 and 10.
- the enzyme that catalyzes the conversion of glycolaidehyde to EG is a glycolaidehyde reductase or aldehyde reductase.
- the enzyme that catalyzes the conversion of giycoialdehyde to MEG is encoded by one or more endogenous nucleic acid molecules.
- the enzyme that catalyzes the conversion of giycoialdehyde to MEG is encoded by one or more exogenous nucleic acid molecules.
- the enzyme is a giycoialdehyde reductase or aldehyde reductase that is encoded by a nucleic acid molecule obtained from a microorganism selected from E. coii or S. cerevisiae.
- the nucleic acid molecule encoding giycoialdehyde reductase or aldehyde reductase is selected from fucO, yqhD, dkgA (yqhE), dkgB (yafB), yeaE, yghZ, gidA, GRE2, or homoiog thereof, in another embodiment, the one or more nucleic acid molecules is yqhD, In some embodiments, the yqhD comprises a G149E mutation, in a further embodiment, the giycoialdehyde reductase comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 13, 15, 17, 20, 23, 25, 28, 30 and 32.
- the giycoialdehyde reductase is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 12, 14, 16, 18, 19, 21 , 22, 24, 26, 27, 29 and 31.
- the enzyme that catalyzes the conversion of acetyl- CoA to acetoacetyl-CoA is a thiolase or acetyl coenzyme A acetyltransferase.
- the enzyme that catalyzes the conversion of acetyl-CoA to acetoacetyl-CoA is encoded by one or more endogenous nucleic acid molecules, in an alternative embodiment, the enzyme that catalyzes the conversion of acetyl-CoA to acetoacetyl-CoA is encoded by one or more exogenous nucleic acid molecules.
- the enzyme is a thiolase or acetyl coenzyme A acetyltransferase that is encoded by a nucleic acid molecule obtained from a microorganism selected from Clostridium sp., Baciiius sp,, E. coii, Saccharomyces sp, and Marinobacter sp.
- the nucleic acid molecule encoding thiolase or acetyl coenzyme A acetyltransferase is obtained from a microorganism selected from Clostridium acetohuty!icum, Clostridium thermosaccharoiyticum, Bacillus cereus, E.
- the nucleic acid molecule encoding thiolase or acetyl coenzyme A acetyltransferase is thIA, atoB and/or ERG10, or homoiog thereof.
- the thiolase or acetyl coenzyme A acetyltransferase comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 35, 37 and 40.
- the thioiase or acetyl coenzyme A acefyltransferase is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 33, 34, 36, 38 and 39.
- the enzyme that catalyzes the conversion of acetoacetyl-CoA to acetoacetate is a acetate: acetoacetyl-CoA transferase or hydrolase, in some embodiments, the transferase is an acetyl-CoA:acetoacetate- CoA transferase.
- the enzyme that catalyzes the conversion of acetoacetyl-CoA to acetoacetate is encoded by one or more endogenous nucleic acid molecules
- the enzyme that catalyzes the conversion of acetoacetyl-CoA to acetoacetate is encoded by one or more exogenous nucleic acid molecules.
- the enzyme is an acetate: acetoacetyl-CoA transferase or hydrolase that is encoded by one or more nucleic acid molecule obtained from a microorganism selected from Clostridium sp. and E. co!i.
- the nucleic acid molecules encoding acetate: acetoacetyl-CoA hydrolase is obtained from Clostridium acetobutyiicum.
- the nucleic acid molecules encoding acetate:acetoacetyi-CoA transferase is obtained from E. coii.
- the nucleic acid molecules encoding acetate:acetoacetyl ⁇ CoA transferase subunits are atoA and atoD, or homologs thereof.
- the nucleic acid molecules encoding acetate :acetoacety!-CoA hydrolase subunits are ctfA and ctfB, or homologs thereof.
- the acetyl-CoA:acetoacetate-CoA transferase or acetate: acetoacetyl-CoA hydrolase comprises an amino acid sequence selected from the group consisting of SEQ ID NQs: 43, 46, 97, 99, 101 and 103.
- the acetyi-CoA:acetoacetate-CoA transferase or acetate: acetoacetyl-CoA hydrolase is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 41 , 42, 44, 45, 96, 98, 100 and 102.
- the enzyme that catalyzes the conversion of acetoacetate to acetone is an acetoacetate decarboxylase.
- the enzyme that catalyzes the conversion of acetoacetate to acetone is encoded by one or more endogenous nucleic acid molecules, in an alternative embodiment, the enzyme that catalyzes the conversion of acetoacetate to acetone is encoded by one or more exogenous nucleic acid molecules.
- the enzyme is an acetoacetaie decarboxylase that is encoded by a nucleic acid molecule obtained from a microorganism selected from Clostridium sp., Bacillus sp., Chromobacterium sp. and Pseudomonas sp.
- the nucleic acid molecule encoding acetoacetate decarboxylase is obtained from a microorganism selected from Clostridium acetobutyiicum, Clostridium beijerinckii, Clostridium cellulolyticum, Bacillus polymyxa, Chromobacterium violaceum and Pseudomonas putida.
- the nucleic acid molecule encoding acetoacetate decarboxylase is adc, or homoiog thereof.
- the acetoacetate decarboxylase comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 49 and 52,
- the acetoacetate decarboxylase is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 47, 48, 50 and 51.
- the recombinant microorganism further comprises one or more modifications selected from the group consisting of:
- the enzyme that catalyzes the conversion of D- xyiulose to D-xylulose-5-phosphate is a D-xylulose-5-kinase.
- the D-xyiuiose-5-kinase is from Saccharomyces cerevisiae.
- the D-xylulose-5-kinase is encoded by the XKS1 gene, or homoiog thereof.
- the D-xylulose-5-kinase is from Pichia stipitis.
- the D-xyiulose-5-kinase is encoded by the XYL3 gene, or homoiog thereof.
- a recombinant microorganism producing MEG and a three-carbon compound comprises a deletion, insertion, or loss of function mutation in a gene encoding a D-xylulose-5-kinase to prevent the conversion of D- xyiulose to D-xylulose-5-phosphate and instead shunt the reaction toward conversion of D-xyiulose to D-xyluiose-1 -phosphate.
- the enzyme that catalyzes the conversion of D- xyluiose-5 ⁇ phosphate to D-xylulose is an alkaline phosphatase.
- the alkaline phosphatase is from S. cerevisiae. in some embodiments, the alkaline phosphatase is encoded by the PH0 3 gene, or homolog thereof.
- a recombinant microorganism producing MEG and a three-carbon compound comprises a deletion, insertion, or loss of function mutation in a gene encoding an alkaline phosphatase to prevent the production of D- xylulose from D-xylulose-5-phosphate.
- the recombinant microorganism capable of co- producing monoethylene glycol (MEG) and acetone from exogenous D-xylose and glucose is a fungus.
- MEG and acetone are co-produced from xylose using a xylonate pathway for the conversion of xylose to MEG and a C3 branch pathway for the conversion of dihydroxyacetone-phosphate (DHAP) to acetone.
- DHAP dihydroxyacetone-phosphate
- the present application relates to a recombinant microorganism capable of co-producing monoethylene glycol (MEG) and acetone from exogenous D-xylose, wherein the recombinant microorganism expresses one or more of the following:
- the enzyme that catalyzes the conversion of D-xylose to D-xylonoiactone is a xylose dehydrogenase.
- the enzyme that catalyzes the conversion of D-xylose to D-xylonoiactone is encoded by one or more endogenous nucleic acid molecules.
- the enzyme that catalyzes the conversion of D-xylose to D-xyionoiactone is encoded by one or more exogenous nucleic acid molecules.
- the enzyme is a xylose dehydrogenase that is encoded by a nucleic acid molecule obtained from a microorganism selected from Cau!obacter sp., Haloarcu!a sp., Haioferax sp,, Haiorubrum sp. and Trichoderma sp.
- the nucleic acid molecule encoding the xylose dehydrogenase is obtained from a microorganism selected from Cau!obacter crescentus, Ha!oarcuia marismortui, Haioferax vo!canii, Haiorubrum iacusprofundi and Trichoderma reesei.
- the nucleic acid molecule encoding xylose dehydrogenase is selected from xylB, xdh (HVO__B0028), xydl , or homoiog thereof, in a further embodiment, the one or more nucleic acid molecules encoding the xylose dehydrogenase comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 61 , 63 and 65. In yet another embodiment, the one or more nucleic acid molecules encoding the xylose dehydrogenase is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 59, 60, 62 and 64.
- the enzyme that catalyzes the conversion of D- xyionolactone to D-xyionate is a xylonolactonase.
- the enzyme that catalyzes the conversion of D-xyionolactone to D-xylonate is encoded by one or more endogenous nucleic acid molecules.
- the enzyme that catalyzes the conversion of D-xylonolactone to D-xylonate is encoded by one or more exogenous nucleic acid molecules.
- the enzyme is a xylonolactonase that is encoded by a nucleic acid molecule obtained from a microorganism seiected from Caulobacter sp. and Haioferax sp.
- the nucleic acid molecule encoding the xylonolactonase is obtained from a microorganism selected from Caulobacter crescentus, Haioferax volcanii and Haioferax gibbonsil.
- the nucleic acid molecule encoding xylonolactonase is xylC, or homoiog thereof.
- the one or more nucleic acid molecules encoding the xylonolactonase comprises an amino acid sequence set forth in SEQ ID NO: 67. In yet another embodiment, the one or more nucleic acid molecules encoding the xylonolactonase is encoded by a nucleic acid sequence set forth in SEQ ID NO: 66.
- the enzyme that catalyzes the conversion of D- xyionate to 2-keto-3-deoxy-xylonate is a xylonate dehydratase
- the enzyme that catalyzes the conversion of D-xyionate to 2-keto-3- deoxy-xylonate is encoded by one or more endogenous nucleic acid molecules.
- the enzyme that catalyzes the conversion of D-xylonate to 2-keto-3-deoxy-xylonate is encoded by one or more exogenous nucleic acid molecules.
- the enzyme is a xylonate dehydratase that is encoded by a nucleic acid molecule obtained from a microorganism selected from Caulobacter sp., Haioferax sp., Su!fo!obus sp. and E. coli.
- the nucleic acid molecule encoding the xylonate dehydratase is obtained from a microorganism seiected from Caulobacter crescentus, Haioferax volcanii, E. coli and Sulfolobus solfataricus.
- the nucleic acid molecule encoding xylonate dehydratase is seiected from xylD, yjhG, yagF, xad, or homoiog thereof.
- the one or more nucleic acid molecules encoding the xylonate dehydratase comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 69, 72 and 75,
- the one or more nudeic acid molecules encoding the xylonate dehydratase is encoded by a nudeic acid sequence selected from the group consisting of SEQ ID NOs: 88, 70, 71 , 73 and 74.
- the enzyme that catalyzes the conversion of 2-keto-3- deoxy-xyionate to glycolaidehyde and pyruvate is a 2 ⁇ keto-3-deoxy ⁇ D ⁇ pentonate aldolase.
- the enzyme that catalyzes the conversion of 2- keto-3-deoxy-xyionate to glycolaidehyde and pyruvate is encoded by one or more endogenous nucleic acid molecules.
- the enzyme that catalyzes the conversion of 2-keto-3-deoxy-xylonate to glycolaidehyde and pyruvate is encoded by one or more exogenous nucleic acid molecules
- the enzyme is a 2-keto-3-deoxy-D-pentonate aldolase that is encoded by a nucleic acid molecule obtained from a microorganism selected from Pseudomonas sp. and E. coll.
- the nucleic acid molecule encoding 2-keto-3-deoxy-D-pentonate aldolase is selected from yjhH, yagE, or homolog thereof.
- the one or more nucleic acid molecules encoding the 2-keto-3-deoxy-D-pentonate aldolase comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 78 and 81.
- the one or more nucleic acid molecules encoding the 2-keto-3- deoxy-D-pentonate aldolase is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 76, 77, 79 and 80.
- the enzyme that catalyzes the conversion of glycolaidehyde to MEG is a glycolaidehyde reductase or aldehyde reductase.
- the enzyme that catalyzes the conversion of glycolaidehyde to EG is encoded by one or more endogenous nucleic acid molecules.
- the enzyme that catalyzes the conversion of glycolaidehyde to MEG is encoded by one or more exogenous nucleic acid molecules
- the enzyme is a glycolaidehyde reductase or aldehyde reductase that is encoded by a nucleic acid molecule obtained from a microorganism selected from E. coll or S. cerevlslae.
- the nucleic acid molecule encoding glycolaidehyde reductase or aldehyde reductase is selected from fucO, yqhD, dkgA (yqhE), dkgB (yafB), yeaE, yghZ, gldA, GRE2, or homolog thereof.
- the one or more nucleic acid molecules is yqhD, In some embodiments, the yqhD comprises a G149E mutation.
- the giycolaidehyde reductase comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 13, 15, 17, 20, 23, 25, 28, 30 and 32.
- the giycolaidehyde reductase is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 12, 14, 16, 18, 19, 21 , 22, 24, 26, 27, 29 and 31.
- the enzyme that catalyzes the conversion of acetyl- CoA to acetoacetyl-CoA is a thiolase or acetyl coenzyme A acetyltransferase.
- the enzyme that catalyzes the conversion of acetyl-CoA to acetoacetyi-CoA is encoded by one or more endogenous nucleic acid molecules.
- the enzyme that catalyzes the conversion of acety!-CoA to acetoacetyl-CoA is encoded by one or more exogenous nucleic acid molecules.
- the enzyme is a thiolase or acetyl coenzyme A acetyltransferase that is encoded by a nucleic acid molecule obtained from a microorganism selected from Clostridium sp., Bacillus sp., E. coii, Saccharomyces sp. and Marinobacter sp.
- the nucleic acid molecule encoding thiolase or acetyl coenzyme A acetyltransferase is obtained from a microorganism selected from Clostridium acetobutyiicum, Clostridium thermosaccharolyticum, Bacillus cereus, E.
- the nucleic acid molecule encoding thiolase or acetyl coenzyme A acetyltransferase is thIA, atoB and/or ERG10, or homolog thereof.
- the thiolase or acetyl coenzyme A acetyltransferase comprises an amino acid sequence selected from the group consisting of SEQ ID NQs: 35, 37 and 40.
- the thiolase or acetyl coenzyme A acetyltransferase is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NQs: 33, 34, 36, 38 and 39.
- the enzyme that catalyzes the conversion of acetoacetyl-CoA to acetoacetate is a acetate: acetoacetyi-CoA transferase or hydrolase, in some embodiments, the transferase is an acetyl-CoA:acetoacetate- CoA transferase.
- the enzyme that catalyzes the conversion of acetoacetyi-CoA to acetoacetate is encoded by one or more endogenous nucleic acid molecules
- the enzyme that catalyzes the conversion of acetoacefyi-CoA to acetoacetate is encoded by one or more exogenous nucleic acid molecules.
- the enzyme is an acetate: acetoacetyl-CoA transferase or hydrolase that is encoded by one or more nucleic acid molecules obtained from a microorganism selected from Clostridium sp. and E, coli.
- the nucleic acid molecules encoding acetate: acetoacetyl-CoA hydrolase are obtained from Clostridium acelobutyiicum.
- the nucleic acid molecules encoding acetate: a cetoacetyi-CoA transferase are obtained from E, coli, in some embodiments, the nucleic acid molecules encoding acetate: acetoacetyl-CoA transferase subunits are atoA and atoD, or homologs thereof, in some embodiments, the one or more nucleic acid molecules encoding acetate: acetoacetyl-CoA hydrolase subunits are ctfA and ctfB, or homologs thereof, in a further embodiment, the acetyi-CoA:acetoacetate-CoA transferase or acetate: acetoacetyl-CoA hydrolase comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 43, 46, 97, 99, 101 and 103.
- the acetyl-CoA:acetoacetate-CoA transferase or acetate :acetoacetyl-CoA hydrolase is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 41 , 42, 44, 45, 96, 98, 100 and 102.
- the enzyme that catalyzes the conversion of acetoacetate to acetone is an acetoacetate decarboxylase
- the enzyme that catalyzes the conversion of acetoacetate to acetone is encoded by one or more endogenous nucleic acid molecules
- the enzyme that catalyzes the conversion of acetoacetate to acetone is encoded by one or more exogenous nucleic acid molecules.
- the enzyme is an acetoacetate decarboxylase that is encoded by one or more nucleic acid molecule obtained from a microorganism selected from Clostridium sp., Bacillus sp., Chromobacterium sp.
- the nucleic acid molecule encoding acetoacetate decarboxylase is obtained from a microorganism selected from Clostridium acetobutylicum, Clostridium beijerinckii, Clostridium DCiuloiyticum, Bacillus polymyxa, Chromobacterium violaceum and Pseudomonas putida.
- the nucleic acid molecule encoding acetoacetate decarboxylase is adc, or homolog thereof.
- the acetoacetate decarboxylase comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 49 and 52.
- the acetoacetate decarboxylase is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 47, 48, 50 and 51.
- the recombinant microorganism further comprises one or more modifications selected from the group consisting of:
- the enzyme that catalyzes the conversion of D-xylose to D-xylulose is a D-xylose isomerase.
- the D-xylose isomerase is from Escherichia coli.
- the D-xyiose isomerase is encoded by the xylA gene, or homolog thereof.
- a recombinant microorganism producing MEG and a three-carbon compound comprises a deletion, insertion, or loss of function mutation in a gene encoding a D-xylose isomerase to prevent conversion of D-xylose to D-xyiuiose and instead shunt the reaction toward the conversion of D-xyiose to D- xylonate.
- the enzyme that catalyzes the conversion of giycolaidehyde to glycoiic acid is a giycolaidehyde dehydrogenase.
- the giycolaidehyde dehydrogenase is from Escherichia coli.
- the giycolaidehyde dehydrogenase is encoded by the aidA gene, or homolog thereof.
- a recombinant microorganism producing MEG and a three-carbon compound comprises a deletion, insertion, or loss of function mutation in a gene encoding a giycolaidehyde dehydrogenase to prevent the production of giycolic acid from glycolaidehyde and instead shunt the reaction toward conversion of glycolaidehyde to MEG.
- the enzyme that catalyzes the conversion of pyruvate to lactate is a lactate dehydrogenase.
- the enzyme converts pyruvate to lactate.
- the lactate dehydrogenase is from Escherichia coli.
- the lactate dehydrogenase is encoded by the IdhA gene, or homoiog thereof.
- a recombinant microorganism producing MEG and a three-carbon compound comprises a deletion, insertion, or loss of function mutation in a gene encoding a lactate dehydrogenase to prevent the production of lactate from pyruvate and instead shunt the reaction toward production of a three- carbon compound.
- the present application relates to a recombinant microorganism capable of co-producing monoethylene glycol (MEG) and acetone from exogenous D-xylose, wherein the recombinant microorganism expresses one or more of the following:
- the enzyme that catalyzes the conversion of D-xylose to D-xyionate is a xylose dehydrogenase
- the enzyme that catalyzes the conversion of D-xylose to D-xyionate is encoded by one or more endogenous nucleic acid molecules.
- the enzyme that catalyzes the conversion of D-xyiose to D-xylonate is encoded by one or more exogenous nucleic acid molecules.
- the enzyme is a xylose dehydrogenase that is encoded by a nucleic acid molecule obtained from a microorganism selected from Cau!obacter sp., Ha!oarcu!a sp., Haloferax sp., Halorubrum sp. and Trichoderma sp.
- the nucleic acid molecule encoding the xylose dehydrogenase is obtained from a microorganism selected from Caulobacter crescentus, Haloarcula marismortui, Haloferax vo!canii, Halorubrum lacusprofundi and Trichoderma reesei.
- the nucleic acid molecule encoding xylose dehydrogenase is selected from xylB, xdh (HVO m B0028), xydl , or homolog thereof, in a further embodiment, the one or more nucleic acid molecules encoding the xylose dehydrogenase comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 61 , 63 and 65. In yet another embodiment, the one or more nucleic acid molecules encoding the xylose dehydrogenase is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 59, 60, 62 and 64.
- the enzyme that catalyzes the conversion of D- xyionate to 2-keto-3-deoxy-xylonate is a xylonate dehydratase.
- the enzyme that catalyzes the conversion of D-xyionate to 2 ⁇ keto ⁇ 3 ⁇ deoxy-xylonate is encoded by one or more endogenous nucleic acid molecules.
- the enzyme that catalyzes the conversion of D-xylonate to 2-keto-3-deoxy-xylonate is encoded by one or more exogenous nucleic acid molecules.
- the enzyme is a xyionate dehydratase that is encoded by a nucleic acid molecule obtained from a microorganism selected from Caulobacter sp., Haloferax sp., Su!fo!obus sp. and E, coll.
- the nucleic acid molecule encoding the xyionate dehydratase is obtained from a microorganism selected from Caulobacter crescentus, Haloferax volcanli, E. coll and Sulfolobus solfataricus.
- the nucleic acid molecule encoding xyionate dehydratase is selected from xylD, yjhG, yagF, xad, or homolog thereof.
- the one or more nucleic acid molecules encoding the xyionate dehydratase comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 89, 72 and 75.
- the one or more nucleic acid molecules encoding the xyionate dehydratase is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 68, 70, 7 , 73 and 74.
- the enzyme that catalyzes the conversion of 2-keto-3- deoxy-xyionate to giycoiaidehyde and pyruvate is a 2-keto-3-deoxy-D-pentonate aldolase, in a further embodiment, the enzyme that catalyzes the conversion of 2- keto-3-deoxy-xyionate to giycoiaidehyde and pyruvate is encoded by one or more endogenous nucleic acid molecules.
- the enzyme that catalyzes the conversion of 2-keto-3-deoxy-xylonate to giycoiaidehyde and pyruvate is encoded by one or more exogenous nucleic acid molecules
- the enzyme is a 2-keto-3-deoxy-D-pentonate aldolase that is encoded by a nucleic acid molecule obtained from a microorganism selected from Pseudomonas sp. and E. coll.
- the nucleic acid molecule encoding the 2-keto-3-deoxy-D-pentonate aldolase is obtained from a microorganism selected from £. coll.
- the nucleic acid molecule encoding 2- keto-3-deoxy-D-pentonate aldolase is selected from yjhH, yagE, or homolog thereof.
- the one or more nucleic acid molecules encoding the 2- keto-3-deoxy-D-pentonate aldolase comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 78 and 81.
- the one or more nucleic acid molecules encoding the 2-keto-3-deoxy-D-pentonate aldolase is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 76, 77, 79 and 80.
- the enzyme that catalyzes the conversion of giycoiaidehyde to MEG is a giycolaldehyde reductase or aldehyde reductase.
- the enzyme that catalyzes the conversion of giycolaldehyde to MEG is encoded by one or more endogenous nucleic acid molecules.
- the enzyme that catalyzes the conversion of giycolaldehyde to MEG is encoded by one or more exogenous nucleic acid molecules.
- the enzyme is a giycolaldehyde reductase or aldehyde reductase that is encoded by a nucleic acid molecule obtained from a microorganism selected from £. coli or S. cerevisiae.
- the nucleic acid molecule encoding giycoiaidehyde reductase or aldehyde reductase is selected from fucO, yqhD, dkgA (yqhE), dkgB (yafB), yeaE, yghZ, gidA, GRE2, or homoiog thereof, in another embodiment, the one or more nucleic acid molecules is yqhD.
- the yqhD comprises a G149E mutation
- the giycolaldehyde reductase comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 13, 15, 17, 20, 23, 25, 28, 30 and 32.
- the giycoiaidehyde reductase is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 12, 14, 18, 18, 19, 21 , 22, 24, 26, 27, 29 and 31.
- the enzyme that catalyzes the conversion of acetyl- CoA to acetoacetyi-CoA is a thiolase or acetyl coenzyme A acetyltransferase.
- the enzyme that catalyzes the conversion of acetyl-CoA to acetoacetyi-CoA is encoded by one or more endogenous nucleic acid molecules.
- the enzyme that catalyzes the conversion of acetyl-CoA to acetoacetyl-CoA is encoded by one or more exogenous nucleic acid molecules.
- the enzyme is a thiolase or acetyl coenzyme A acetyltransferase that is encoded by a nucleic acid molecule obtained from a microorganism selected from Clostridium sp., Baciiius sp., E. coii, Saccharomyces sp. and Marinobacter sp.
- the nucleic acid molecule encoding thiolase or acetyl coenzyme A acetyltransferase is obtained from a microorganism selected from Clostridium acetobutylicum, Clostridium thermosaccharolyticum, Bacillus cereus, E.
- nucleic acid molecule encoding thiolase or acetyl coenzyme A acetyltransferase is thlA, atoB and/or ERG10, or homolog thereof.
- the thiolase or acetyl coenzyme A acefyltransferase comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 35, 37 and 40, In yet a further embodiment, the thiolase or acetyl coenzyme A acefyltransferase is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 33, 34, 36, 38 and 39.
- the enzyme that catalyzes the conversion of acetoacetyl-CoA to acetoacetate is a acetate: acetoacetyl-CoA transferase or hydrolase.
- the transferase is an acetyl-CoA:acetoacetate- CoA transferase.
- the enzyme that catalyzes the conversion of acetoacetyl-CoA to acetoacetate is encoded by one or more endogenous nucleic acid molecules
- the enzyme that catalyzes the conversion of acetoacetyl-CoA to acetoacetate is encoded by one or more exogenous nucleic acid molecules.
- the enzyme is an acetate: acetoacetyl-CoA transferase or hydrolase that is encoded by one or more nucleic acid molecules obtained from a microorganism selected from Clostridium sp. and E. co!i.
- the nucleic acids molecule encoding acetate: acetoacetyl-CoA hydrolase are obtained from Clostridium acetobutyiicum.
- the nucleic acid molecules encoding acetate:acetoacetyi-CoA transferase are obtained from E. coli.
- the nucleic acid molecules encoding acetate: acetoacetyl-CoA transferase subunits are atoA and atoD, or homologs thereof, in some embodiments, the nucleic acid molecules encoding acetate :acetoacetyi-CoA hydrolase subunits are ctfA and ctfB, or homologs thereof.
- the acetyl-CoA:acetoacetate-CoA transferase or acetate: acetoacetyl-CoA hydrolase comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 43, 48, 97, 99, 101 and 103.
- the acetyi-CoA:acetoacetate-CoA transferase or acetate: acetoacetyl-CoA hydrolase is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 41 , 42, 44, 45, 96, 98, 100 and 102.
- the enzyme that catalyzes the conversion of acetoacetate to acetone is an acetoacetate decarboxylase
- the enzyme that catalyzes the conversion of acetoacetate to acetone is encoded by one or more endogenous nucleic acid molecules
- the enzyme that catalyzes the conversion of acetoacetate to acetone is encoded by one or more exogenous nucleic acid molecules.
- the enzyme is an acetoacetate decarboxylase that is encoded by a nucleic acid molecule obtained from a microorganism selected from Clostridium sp., Bacillus sp., Chromobacterium sp.
- the nucleic acid molecule encoding acetoacetate decarboxylase is obtained from a microorganism selected from Clostridium acetobutylicum, Clostridium beijerinckii, Clostridium celiulolyticum, Bacillus polymyxa, Chromobacterium violaceum and Pseudomonas putida.
- the nucleic acid molecule encoding acetoacetate decarboxylase is adc, or homolog thereof.
- the acetoacetate decarboxylase comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 49 and 52.
- the acetoacetate decarboxylase is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 47, 48, 50 and 51.
- the recombinant microorganism further comprises one or more modifications selected from the group consisting of:
- the enzyme that catalyzes the conversion of D-xylose to D-xylulose is a D-xylose isomerase.
- the D-xylose isomerase is from Escherichia coli.
- the D-xyiose isomerase is encoded by the xylA gene, or homolog thereof.
- a recombinant microorganism producing MEG and a three-carbon compound comprises a deletion, insertion, or loss of function mutation in a gene encoding a D-xylose isomerase to prevent conversion of D-xylose to D-xyiuiose and instead shunt the reaction toward the conversion of D-xylose to D- xylonate.
- the enzyme that catalyzes the conversion of glycolaidehyde to glycolic acid is a glycolaldehyde dehydrogenase.
- the glycolaldehyde dehydrogenase is from Escherichia co!i.
- the glycolaldehyde dehydrogenase is encoded by the aldA gene, or homolog thereof.
- a recombinant microorganism producing MEG and a three-carbon compound comprises a deletion, insertion, or loss of function mutation in a gene encoding a glycolaldehyde dehydrogenase to prevent the production of glycolic acid from glycolaldehyde and instead shunt the reaction toward conversion of glycolaldehyde to MEG.
- the enzyme that catalyzes the conversion of pyruvate to lactate is a lactate dehydrogenase.
- the enzyme converts pyruvate to lactate.
- the lactate dehydrogenase is from Escherichia coii.
- the lactate dehydrogenase is encoded by the IdhA gene, or homolog thereof.
- a recombinant microorganism producing MEG and a three-carbon compound comprises a deletion, insertion, or loss of function mutation in a gene encoding a lactate dehydrogenase to prevent the production of lactate from pyruvate and instead shunt the reaction toward production of a three- carbon compound.
- the recombinant microorganism may further comprise at least one nucleic acid molecule encoding an enzyme that catalyzes the conversion of acetone to isopropanol.
- the enzyme that catalyzes the conversion of acetone to isopropanol is encoded by one or more endogenous nucleic acid molecules.
- the enzyme that catalyzes the conversion of acetone to isopropanol is encoded by one or more exogenous nucleic acid molecules.
- the enzyme that catalyzes the conversion of acetone to isopropanol is a secondary alcohol dehydrogenase (S-ADH).
- the enzyme is a secondary alcohol dehydrogenase that is encoded by a nucleic acid molecule obtained from a microorganism selected from Burkho!deria sp, Alcaligenes sp,, Clostridium sp,, Thermoanaerobacter sp,, Phytomonas sp,, Rhodococcus sp,, Methanobacierium sp., Methanogenium sp., Entamoeba sp., Trichomonas sp., and Tritrichomonas sp.
- a secondary alcohol dehydrogenase that is encoded by a nucleic acid molecule obtained from a microorganism selected from Burkho!deria sp, Alcaligenes sp,, Clostridium sp,, Thermoanaerobacter sp,, Phytomonas sp,, Rhodococcus sp,, Methanobacier
- the nucleic acid molecule encoding the secondary alcohol dehydrogenase is obtained from a microorganism selected from Burkholderia sp, AiU 652, Aica!igenes eutrophus, Clostridium ragsdalei, Clostridium beijerinckii, Clostridium carboxidivorans, Thermoanaerobacter brockii, Thermoanaerobacter ethanolicus (Clostridium thermohydrosulfuricum), Rhodococcus ruber, Methanobacierium paiustre, methanogenie archaea Methanogenium iiminatans, parasitic protist Entamoeba histolytica, parasitic protozoan Tritrichomonas foetus and human parasite Trichomonas vaginalis.
- a microorganism selected from Burkholderia sp, AiU 652, Aica!igenes eutrophus, Clostridium
- the one or more nucleic acid molecule encoding secondary alcohol dehydrogenase is adh, adhB, EhAdhl , or homolog thereof.
- the S-ADH is predicted from homology and can be from Thermoanaerobacter mathranii, Micrococcus luteus, Nocardiopsis alba, Mycobacterium hassiacum, Helicobacter suis, Candida albicans, Candida parapsilosis, Candida orthopsilosis, Candida metapsiiosis, Grosmannia clavigera and Scheffersomyces stipitis.
- the alcohol dehydrogenase comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 106 and 108.
- the alcohol dehydrogenase is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 104, 105 and 107.
- the recombinant microorganism may further comprise at least one nucleic acid molecule encoding an enzyme that catalyzes the conversion of isopropanoi to propene.
- the enzyme that catalyzes the conversion of isopropanoi to propene is encoded by one or more endogenous nucleic acid molecules.
- the enzyme that catalyzes the conversion of isopropanoi to propene is encoded by one or more exogenous nucleic acid molecules.
- the enzyme that catalyzes the conversion of isopropanoi to propene is a dehydratase.
- MEG is produced through the conversion of giycoialdehyde in a C-2 branch pathway and acetone is produced through the conversion of DHAP or pyruvate in a C-3 branch pathway.
- MEG is produced through the conversion of giycoialdehyde in a C-2 branch pathway and IPA is produced through the conversion of DHAP or pyruvate in a C-3 branch pathway.
- MEG is produced through the conversion of giycoialdehyde in a C-2 branch pathway and propene is produced through the conversion of DHAP or pyruvate in a C-3 branch pathway.
- At least a portion of the excess NADH produced in the C-3 branch is used as a source of reducing equivalents in the C-2 branch, in another embodiment, at least a portion of the excess NADH produced in the C-3 branch is used to produce ATP.
- the co-produced MEG and acetone comprise a yield potential greater than 90% of the theoretical maximum yield potential without carbon fixation
- the co-produced MEG and IPA comprise a yield potential greater than 90% of the theoretical maximum yield potential without carbon fixation
- the co-produced MEG and propene comprise a yield potential greater than 90% of the theoretical maximum yield potential without carbon fixation.
- excess biomass formation is minimized and production of MEG and acetone is maximized
- excess biomass formation is minimized and production of MEG and IPA is maximized
- excess biomass formation is minimized and production of MEG and propene is maximized.
- the present application provides a method of producing MEG and a three carbon compound using a recombinant microorganism as described above, wherein the method comprises cultivating the recombinant microorganism in a culture medium containing a feedstock providing a carbon source until the MEG and the three carbon compound is produced, in some embodiments, the three carbon compound is selected from acetone, isopropanoi, and propene.
- the present application provides a method of producing a recombinant microorganism that co-produces, produces or accumulates MEG and a three carbon compound. In some embodiments, the three carbon compound is selected from acetone, isopropanol, and propene.
- the present application provides a recombinant microorganism co-producing monoethyiene glycol (MEG) and a three carbon compound.
- MEG monoethyiene glycol
- the three carbon compound is selected from acetone, isopropanol, and propene.
- FIG. 1 illustrates MEG and isopropanol co-production pathway via ribulose-1-phosphate
- FIG. 2 illustrates MEG and isopropanol co-production pathway via xyiulose-1 -phosphate.
- FIG. 3 illustrates MEG and isopropanol co-production pathway via xylonate.
- FIG. 4 illustrates possible three carbon co-products for MEG.
- FIG. 5 illustrates MEG and isopropanol co-production pathway from xylose and glucose, via ribulose-1-phosphate, in S. cerevisiae.
- FIG. 6 illustrates MEG and isopropanol co-production from xylose and glucose in S, cerevisiae.
- FIG. 7 illustrates MEG production from xylose in E. coli.
- FIG. 8 illustrates improved MEG production from xylose in E. coli.
- FIG. 9 illustrates overall yield (g products/g xylose) of ethylene glycol, isopropanol and/or acetone produced using a ribulose- -phosphate pathway in six E. coii strains described in Example 3 and Table 2,
- FIG. 10 illustrates co-production of MEG, isopropanol and acetone using a xyiulose-1 -phosphate pathway in E. coii as described in Example 4.
- FIG. 11 illustrates overall yield (g products/g xylose) of ethylene glycol, isopropanol and acetone produced using a xyiulose- -phosphate pathway as described in Example 4.
- FIG. 12 illustrates co-production of MEG, isopropanol and acetone using a xyionate pathway in E. coii as described in Example 5.
- FIG. 13 illustrates overall yield (g products/g xylose) of ethylene glycol, isopropanol and acetone produced using a xyionate pathway as described in Example 5,
- FIG. 14 shows an SDS-PAGE of soluble fraction of assays (a) to (e) as described in Example 6, The arrow indicates LinD expression in (b), (c), (d) and (e),
- FIG. 15 illlustrates that assays (d) and (e) showed the production of propylene and isopropanol in IPA+LinD candidates.
- Assay (a) showed isopropanol production of pZs*13JPA and a small amount of propylene.
- Assays (b) and (c) showed propylene production in medium supplemented with 3,0g/L isopropanol using glycerol and glucose as carbon source, respectively,
- SEQ ID NO: 1 - SEQ ID NO: 120 A sequence listing for SEQ ID NO: 1 - SEQ ID NO: 120 is part of this application and is incorporated by reference herein. The sequence listing is provided at the end of this document. DETAILED DESCRIPTION
- compositions comprising, “comprising,” “includes,” “including,” “has,” “having, “contains,” “containing,” or any other variation thereof, are intended to cover a non-exclusive inclusion.
- a composition, mixture, process, method, article, or apparatus that comprises a list of elements is not necessarily limited to only those elements but may include other elements not expressly listed or inherent to such composition, mixture, process, method, article, or apparatus.
- “or” refers to an inclusive “or” and not to an exclusive “or.”
- microbial As used herein, the terms "microbial,” “microbial organism,” and “microorganism” include any organism that exists as a microscopic cell that is included within the domains of archaea, bacteria or eukarya, the latter including yeast and filamentous fungi, protozoa, algae, or higher Protista. Therefore, the term is intended to encompass prokaryotic or eukaryotic cells or organisms having a microscopic size and includes bacteria, archaea, and eubacteria of ail species as well as eukar otic microorganisms such as yeast and fungi. Also included are cell cultures of any species that can be cultured for the production of a chemical.
- the recombinant microorganisms are prokaryotic microorganism.
- the prokaryotic microorganisms are bacteria.
- Bacteria or “eubacteria”, refers to a domain of prokaryotic organisms.
- Bacteria include at least eleven distinct groups as follows: (1) Gram-positive (gram ⁇ ) bacteria, of which there are two major subdivisions: (1) high G+C group ⁇ Actinomycetes, Mycobacteria, Micrococcus, others) (2) low G+C group (Bacillus, Clostridia, Lactobacillus, Staphylococci, Streptococci, Mycoplasmas); (2) Proteobacteria, e.g., Purple photosynthetic ⁇ non- photosynthetic Gram-negative bacteria (includes most "common" Gram-negative bacteria); (3) Cyanobacteria, e.g., oxygenic phototrophs; (4) Spirochetes and related species; (5) Planctomyces; (6) Bacteroides, F!avobacteria; (7) Chlamydia; (8) Green sulfur bacteria; (9) Green non-sulfur bacteria (also anaerobic phototrophs); (10) Radioresistant micrococci and relatives; (11) Thermotog
- Gram-negative bacteria include cocci, nonenteric rods, and enteric rods.
- the genera of Gram-negative bacteria include, for example, Neisseria, Spirillum, Pasteurella, Brucella, Yersinia, Francisei!a, Haemophilus, Bordetella, Escherichia, Salmonella, Shigella, Klebsiella, Proteus, Vibrio, Pseudomonas, Bacteroides, Acetobacter, Aerobacter, Agrobacterium, Azotobacter, Spirilla, Serratia, Vibrio, Rhizobium, Chlamydia, Rickettsia, Treponema, and Fusobacterium.
- Gram positive bacteria include cocci, nonsporulating rods, and sporulating rods.
- the genera of gram positive bacteria include, for example, Actinomyces, Bacillus, Clostridium, Corynebacterium, Erysipelothrix, Lactobacillus, Listeria, Mycobacterium, Myxococcus, Nocardia, Staphylococcus, Streptococcus, and Streptomyces.
- recombinant microorganism and “recombinant host cell” are used interchangeably herein and refer to microorganisms that have been genetically modified to express or to overexpress endogenous enzymes, to express heterologous enzymes, such as those included in a vector, in an integration construct, or which have an alteration in expression of an endogenous gene.
- alteration it is meant that the expression of the gene, or level of a RNA molecule or equivalent RNA molecules encoding one or more polypeptides or polypeptide subunits, or activity of one or more polypeptides or polypeptide subunits is up regulated or down regulated, such that expression, level, or activity is greater than or less than that observed in the absence of the alteration.
- alter can mean “inhibit,” but the use of the word “alter” is not limited to this definition. It is understood that the terms “recombinant microorganism” and “recombinant host eel! refer not only to the particular recombinant microorganism but to the progeny or potential progeny of such a microorganism. Because certain modifications may occur in succeeding generations due to either mutation or environmental influences, such progeny may not, in fact, be identical to the parent ceil, but are still included within the scope of the term as used herein.
- expression refers to transcription of the gene and, as appropriate, translation of the resulting mRNA transcript to a protein.
- expression of a protein results from transcription and translation of the open reading frame sequence.
- the level of expression of a desired product in a host cell may be determined on the basis of either the amount of corresponding mRNA that is present in the ceil, or the amount of the desired product encoded by the selected sequence.
- mRNA transcribed from a selected sequence can be quantitated by qRT-PCR or by Northern hybridization (see Sambrook et a/., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press (1989)).
- Protein encoded by a selected sequence can be quantitated by various methods, e.g., by EL!SA, by assaying for the biological activity of the protein, or by employing assays that are independent of such activity, such as western blotting or radioimmunoassay, using antibodies that recognize and bind the protein. See Sambrook et a!., 1989, supra.
- polynucleotide is used herein interchangeably with the term “nucleic acid” and refers to an organic polymer composed of two or more monomers including nucleotides, nucleosides or analogs thereof, including but not limited to single stranded or double stranded, sense or antisense deoxyribonucleic acid (DNA) of any length and, where appropriate, single stranded or double stranded, sense or antisense ribonucleic acid (RNA) of any length, including siRNA.
- DNA single stranded or double stranded
- RNA ribonucleic acid
- nucleotide refers to any of several compounds that consist of a ribose or deoxyribose sugar joined to a purine or a pyrimidine base and to a phosphate group, and that are the basic structural units of nucleic acids.
- nucleoside refers to a compound (as guanosine or adenosine) that consists of a purine or pyrimidine base combined with deoxyribose or ribose and is found especially in nucleic acids.
- nucleotide analog or “nucleoside analog” refers, respectively, to a nucleotide or nucleoside in which one or more individual atoms have been replaced with a different atom or with a different functional group. Accordingly, the term polynucleotide includes nucleic acids of any length, DNA, RNA, analogs and fragments thereof. A polynucleotide of three or more nucleotides is also called nucieotidic oligomer or oligonucleotide.
- the polynucleotides described herein include “genes” and that the nucleic acid molecules described herein include “vectors” or “plasmids.”
- the term “gene”, also called a “structural gene” refers to a polynucleotide that codes for a particular sequence of amino acids, which comprise ail or part of one or more proteins or enzymes, and may include regulatory (non- transcribed) DNA sequences, such as promoter sequences, which determine for example the conditions under which the gene is expressed.
- the transcribed region of the gene may include untranslated regions, including introns, 5'-untransiated region (UTR), and 3'-UTR, as well as the coding sequence.
- enzyme refers to any substance that catalyzes or promotes one or more chemical or biochemical reactions, which usually includes enzymes totally or partially composed of a polypeptide or polypeptides, but can include enzymes composed of a different molecule including polynucleotides.
- non-naturally occurring when used in reference to a microorganism organism or enzyme activity of the disclosure, is intended to mean that the microorganism organism or enzyme has at least one genetic alteration not normally found in a naturally occurring strain of the referenced species, including wild-type strains of the referenced species.
- Genetic alterations include, for example, modifications introducing expressible nucleic acids encoding metabolic polypeptides, other nucleic acid additions, nucleic acid deletions and/or other functional disruption of the microorganism's genetic material.
- modifications include, for example, coding regions and functional fragments thereof, for heterologous, homologous, or both heterologous and homologous polypeptides for the referenced species.
- Additional modifications include, for example, non- coding regulatory regions in which the modifications alter expression of a gene or operon.
- Exemplary non-naturally occurring microorganism or enzyme activity includes the hydroxyiation activity described above.
- exogenous refers to molecules that are not normally or naturally found in and/or produced by a given yeast, bacterium, organism, microorganism, or cell in nature.
- endogenous or “native” as used herein with reference to various molecules refers to molecules that are normally or naturally found in and/or produced by a given yeast, bacterium, organism, microorganism, or cell in nature.
- heterologous refers to various molecules, e.g., polynucleotides, polypeptides, enzymes, etc., wherein at least one of the following is true: (a) the mo!eeule(s) is/are foreign ("exogenous") to (i.e., not naturally found in) the host cell; (b) the molecule(s) is/are naturally found in (e.g., is "endogenous to") a given host microorganism or host cell but is either produced in an unnatural location or in an unnatural amount in the cell; and/or (c) the moiecule(s) differ(s) in nucleotide or amino acid sequence from the endogenous nucleotide or amino acid sequence(s) such that the molecule differing in nucleotide or amino acid sequence from the endogenous nucleotide or amino acid as found endogenously is produced in an unnatural (e.g.
- homolog refers to distinct enzymes or genes of a second family or species which are determined by functional, structural, or genomic analyses to be an enzyme or gene of the second family or species which corresponds to the original enzyme or gene of the first family or species. Homologs most often have functional, structural, or genomic similarities. Techniques are known by which homologs of an enzyme or gene can readily be cloned using genetic probes and PGR. Identity of cloned sequences as homologs can be confirmed using functional assays and/or by genomic mapping of the genes.
- a protein has "homology” or is “homologous” to a second protein if the amino acid sequence encoded by a gene has a similar amino acid sequence to that of the second gene.
- a protein has homology to a second protein if the two proteins have "similar” amino acid sequences.
- the term “homologous proteins” is intended to mean that the two proteins have similar amino acid sequences. In certain instances, the homology between two proteins is indicative of its shared ancestry, related by evolution.
- the terms “homologous sequences" or “homoiogs” are thought, believed, or known to be functionally related.
- a functional relationship may be indicated in any one of a number of ways, including, but not limited to: (a) degree of sequence identity and/or (b) the same or similar biological function. Preferably, both (a) and (b) are indicated.
- the degree of sequence identify may vary, but in one embodiment, is at least 50% (when using standard sequence alignment programs known in the art), at least 60%, at least 85%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least about 91 %, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least 98.5%, or at least about 99%, or at least 99.5%, or at least 99.8%, or at least 99.9%.
- Homology can be determined using software programs readily available in the art, such as those discussed in Current Protocols in Molecular Biology (FM. Ausubel et al., eds., 1987) Supplement 30, section 7.718, Table 7.71.
- Some alignment programs are MacVector (Oxford Molecular Ltd, Oxford, U.K.) and ALIGN Pius (Scientific and Educational Software, Pennsylvania).
- Other non-limiting alignment programs include Sequencher (Gene Codes, Ann Arbor, Michigan), AlignX, and Vector NT! (Invitrogen, Carlsbad, CA).
- a similar biological function may include, but is not limited to: catalyzing the same or similar enzymatic reaction; having the same or similar selectivity for a substrate or co-factor; having the same or similar stability; having the same or similar tolerance to various fermentation conditions (temperature, pH, etc.); and/or having the same or similar tolerance to various metabolic substrates, products, by-products, intermediates, etc.
- the degree of similarity in biological function may vary, but in one embodiment, is at least 1 %, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least about 91 %, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least 98.5%, or at least about 99%, or at least 99.5%, or at least 99.8%, or at least 99.9%, according to one or more assays known to one skilled in the art to determine a given biological function.
- variant refers to any polypeptide or enzyme described herein.
- a variant also encompasses one or more components of a muitimer, multimers comprising an individual component, multimers comprising multiples of an individual component (e.g., multimers of a reference molecule), a chemical breakdown product, and a biological breakdown product, in particular, non-limiting embodiments, a linalool dehydratase/isomerase enzyme may be a "variant" relative to a reference linalool dehydratase/isomerase enzyme by virtue of aiteration(s) in any part of the polypeptide sequence encoding the reference linalool dehydratase/isomerase enzyme.
- a variant of a reference linalool dehydratase/isomerase enzyme can have enzyme activity of at least 10%, at least 30%, at least 50%, at least 80%, at least 90%, at least 100%, at least 105%, at least 110%, at least 120%, at least 130% or more in a standard assay used to measure enzyme activity of a preparation of the reference linalool dehydratase/isomerase enzyme.
- a variant may also refer to polypeptides having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the full-length, or unprocessed linalool dehydratase/isomerase enzymes of the present disclosure.
- a variant may also refer to polypeptides having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the mature, or processed linalool dehydratase/isomerase enzymes of the present disclosure.
- signal sequence refers to an amino acid sequence that targets peptides and polypeptides to cellular locations or to the extracellular environment. Signal sequences are typically at the N-terminal portion of a polypeptide and are typically removed enzymatically. Polypeptides that have their signal sequences are referred to as being full-length and/or unprocessed. Polypeptides that have had their signal sequences removed are referred to as being mature and/or processed. [00143] The term “yield potential” as used herein refers to a yield of a product from a biosynthetic pathway. In one embodiment, the yield potential may be expressed as a percent by weight of end product per weight of starting compound,
- thermodynamic maximum yield refers to the maximum yield of a product obtained from fermentation of a given feedstock, such as glucose, based on the energetic value of the product compared to the feedstock.
- a given feedstock such as glucose
- the product cannot contain more energy than the feedstock.
- the thermodynamic maximum yield signifies a product yield at which all energy and mass from the feedstock is converted to the product. This yield can be calculated and is independent of a specific pathway. If a specific pathway towards a product has a lower yield than the thermodynamic maximum yield, then it loses mass and can most likely be improved upon or substituted with a more efficient pathway towards the product.
- redox balanced refers to a set of reactions, which taken together produce as much redox cofactors as they consume. Designing metabolic pathways and engineering an organism such that the redox cofactors are balanced or close to being balanced usually results in a more efficient, higher yield production of the desired compounds. Redox reactions always occur together as two half- reactions happening simultaneously, one being an oxidation reaction and the other a reduction reaction. In redox processes, the reducfant transfers electrons to the oxidant. Thus, in the reaction, the reductant or reducing agent loses electrons and is oxidized, and the oxidant or oxidizing agent gains electrons and is reduced. In one embodiment, the redox reactions take place in a biological system.
- Photosynthesis involves the reduction of carbon dioxide into sugars and the oxidation of water into molecular oxygen.
- the reverse reaction respiration, oxidizes sugars to produce carbon dioxide and water.
- the reduced carbon compounds are used to reduce nicotinamide adenine dinucleotide (NAD+), which then contributes to the creation of a proton gradient, which drives the synthesis of adenosine triphosphate (ATP) and is maintained by the reduction of oxygen.
- NAD+ nicotinamide adenine dinucleotide
- ATP adenosine triphosphate
- the term redox state is often used to describe the balance of GSH/GSSG, NAD+/NADH and NADP+/NADPH in a biological system such as a cell or organ.
- the redox state is reflected in the balance of several sets of metabolites (e.g., lactate and pyruvate, beta-hydroxybutyrate, and acetoacetate), whose interconversion is dependent on these ratios.
- An abnormal redox state can develop in a variety of deleterious situations, such as hypoxia, shock, and sepsis.
- C2 pathway refers to a biochemical pathway wherein MEG can be produced via giycoiaidehyde.
- C3 pathway refers to a biochemical pathway wherein MEG or one or more three-carbon compounds can be produced via pyruvate or dihydroxyacetonephosphate (DHAP).
- DHAP dihydroxyacetonephosphate
- the present disclosure combines the production of monoethyiene glycol (MEG) and one or more three carbon compounds in different hosts.
- the three carbon compound is isopropanol (IPA).
- the present disclosure thereby avoids some of the biggest pathway engineering challenges for known MEG and IPA pathways demonstrated so far.
- the combination of a pathway for MEG production and a pathway for production of a three carbon compound complements each other and is highly synergistic, avoiding or overcoming the biggest challenges and shortcomings of each pathway alone, establishing a good redox balance but also delivering required ATP, without production of excess ATP.
- MEG is produced via two different pathways which are active in parallel, a 2-carbon (C2) stream (via giycoiaidehyde) and a 3-carbon (C3) stream (via dihydroxyacetonephosphate (DHAP)).
- C2 stream is easy to implement at high efficiency, but the C3 stream is very difficult to implement at high efficiency via metabolic engineering.
- DHAP ⁇ MEG Several pathway options for DHAP ⁇ MEG exist, ail of which are difficult to implement.
- a further fermentative production of MEG was demonstrated from glucose (Chen et a/., Met. Eng. (2016) 33: 12-13). It uses exclusively a pathway identical to one of the C3 stream solutions of WO2013126721 A1 , going via DHAP and then ethanolamine to glyceraidehyde to MEG. Only in this case, DHAP is derived from glucose, not from xylose. Thus it suffers even more from the technical difficulty to implement a high productivity and high yield pathway from DHAP to MEG. It furthermore has a reduced total yield potential of 69 wt% versus the thermodynamic maximum yield for the product MEG derived from glucose (82 wt%).
- the pathway is furthermore ATP neutral, not generating any ATP that the cells need for growth and maintenance.
- This pathway is also not redox balanced and has a high excess of 2 mol NADH per mol of consumed glucose, all of which needs to be re-oxidized for the cell to be viable, in an aerobic fermentation, this NADH can be used to generate ATP, which however would be in high excess (2 NADH ⁇ 6 ATP), leading to excess biomass formation during the production phase and therefore reduced product formation and yield.
- the only described solution for the loss of yield potential for MEG production from glucose is the production of MEG from xylose with a high yield potential.
- the only described solution for the excess NADH production in the MEG from glucose process is the production of MEG from xylose which can be redox neutral.
- a demonstrated fermentative production of I PA via acetoacetyl-CoA (US 2010/03 1 135, which is herein referenced in its entirety) has excess NADH (2 mol per mol of consumed glucose) and low yield potential (34 wt%).
- This pathway has excess ATP (2 mol per mol of consumed glucose), more than is required for cell maintenance during the production phase, thereby favoring biomass formation over production, if the NADH is not utilized via carbon fixation, it needs to be re-oxidized for the cell to stay viable, further losing glucose in this process.
- NADH can be oxidized through ATP production, which would lead to even more unwanted excess ATP.
- the present disclosure combines one of three easy to implement, high yield C2-streams for MEG production from xylose with an easy to implement IPA production stream via the DHAP pathway.
- the problem of the IPA pathway, excess NADH production complements the NADH requiring C2 part of MEG production.
- the combination of these pathways leads to a high total yield potential of 61 wt%, which is close to the maximum energetic yield of 65 wt% for degradation of xylose into MEG and IPA, assuming these products are produced in a 2:1 ratio.
- This high yield potential stems from the synergies of coupling the IPA pathway with the C2-branch of MEG production from xylose.
- the proposed pathway in its basic form is not redox neutral, but has a small excess of 0.5 mol NADH per mol of consumed xylose.
- oxidation of NADH can deliver just enough ATP to obtain sufficient, but not excessive, ATP required for growth and maintenance during the production phase without having a significantly negative impact on product formation.
- the present disclosure solves a number of problems associated with MEG and/or IPA production.
- the problem of a difficult to implement C3 pathway in production of MEG from xylose is solved.
- the problem of ATP shortage in production of MEG from xylose is solved.
- the problem of loss of yield potential in production of MEG from glucose is solved.
- the problem of ATP shortage in production of MEG from glucose is solved.
- the problem of excess NADH production in production of MEG from glucose is solved, in another embodiment, the problem of loss of yield potential in production of IPA from glucose is solved.
- the problem of excess NADH production in production of IPA from glucose is solved.
- the pathway for MEG + IPA co-production in E. coli comprises the following enzymes for IPA production: thiolase, acetate :acetoacetyi- CoA transferase or hydrolase, acetoacetate decarboxylase and secondary alcohol dehydrogenase.
- the MEG pathway via ribulose-1-phosphate comprises the following enzymes: D-tagatose 3-epimerase, D-ribulokinase, D-ribulose-phosphate aldolase and glycoiaidehyde reductase.
- xyiB gene coding for a xylulokinase this enzyme can divert carbon flux into the pentose phosphate pathway
- aldA gene coding for aldehyde dehydrogenase A can divert carbon flux from glycoiaidehyde to glycolate instead of to MEG
- IdhA gene coding for lactate dehydrogenase this enzyme can divert carbon flux from pyruvate to lactate instead of to acetyi-CoA.
- the first step of the pathway is the natural conversion of D-xylose into D-xyluiose.
- D-xylulose normally enters the pentose phosphate pathway for energy and biomass generation, which is inhibited by the deletion of the xylB gene.
- ail carbon will be re-directed to D-ribulose by the D- tagatose 3-epimerase enzyme.
- D-ribulose is them converted to D-Ribulose-1- phosphate by the native E. co!i enzyme D-ribuiokinase.
- D-Ribulose-1 -phosphate is cleaved into glycoiaidehyde and di hydroxy acetone phosphate (DHAP) by D ⁇ ribulose-phosphate aldolase.
- DHAP di hydroxy acetone phosphate
- the further degradation of DHAP is termed the C3 branch, leading to IPA production.
- Degradation of glycoiaidehyde, termed the C2- branch can lead to ethylene glycol or glycolate formation.
- Glycolate is the undesired by-product that can be produced by the aldA gene product.
- Ethylene glycol can be produced from glycoiaidehyde using the enzyme glycoiaidehyde reductase.
- DHAP conversion of DHAP to acetyl-CoA (through glyceraidehyde-3-phosphate and pyruvate) is part of natural E. cols metabolism.
- One molecule of acetyi-CoA is condensed to another molecule of acetyl-CoA by the enzyme thiolase to produce acetoacefyl-CoA.
- the CoA from acetoacetyl-CoA is recycled to a molecule of acetate by acetate: acetoacetyl-CoA transferase or hydrolase, generating acetyi-CoA and acetoacetate.
- Acetoacetate is decarboxyiated by acetoacetate decarboxylase to acetone which is further reduced to IPA by a secondary alcohol dehydrogenase enzyme.
- IPA can further be converted to propene by a dehydratase (F!G, 4).
- the pathway for MEG + IPA co-production in E. coli comprises the foliowing enzymes for iPA production: thiolase, acetate: acetoacetyl-CoA transferase or hydrolase, acetoacetate decarboxylase and secondary alcohol dehydrogenase.
- the MEG pathway via D-xylulose-1 -phosphate comprises the following enzymes: D-xylulose 1 -kinase, D-xyluiose-1 -phosphate aldolase and glycoiaidehyde reductase.
- xyiB gene coding for a xylu!okinase this enzyme can divert carbon flux into the pentose phosphate pathway
- aldA gene coding for aldehyde dehydrogenase A can divert carbon flux from glycoiaidehyde to glycolate instead of to MEG
- IdhA gene coding for lactate dehydrogenase this enzyme can divert carbon flux from pyruvate to lactate instead of to acetyi-CoA.
- the first step of the pathway (FIG. 2) is the natural conversion of D-xylose into D-xyiuiose.
- D-xylulose normally enters the pentose phosphate pathway for energy and biomass generation, which is inhibited by the deletion of the xylB gene.
- ail carbon will be re-directed to D ⁇ xylulose-1 -phosphate by the D-xylulose 1 -kinase enzyme.
- D-xyluiose-1-phosphate is then cleaved into glycoiaidehyde and dihydroxy acetone phosphate (DHAP) by D-xylulose-1 - phosphate aldolase.
- DHAP dihydroxy acetone phosphate
- the pathway for MEG + IPA co-production in E. coli comprises the following enzymes for IPA production: thiolase, acetate: acetoacetyl-CoA transferase or hydrolase, acetoacetate decarboxylase and secondary alcohol dehydrogenase.
- the MEG pathway via D-xyionate comprises the following enzymes: xylose dehydrogenase, optionally xylonolactonase, xylonate dehydratase, 2-keto-3-deoxy-D-xyionate aldolase and glycoiaidehyde reductase.
- xy!A gene coding for a D-xylose isomerase this enzyme can divert carbon flux from D-xyiose to D-xylulose instead of to D-xylonate or D-xylonoiactone
- aldA gene coding for aldehyde dehydrogenase A can divert carbon flux from glycoiaidehyde to glycolate instead of to MEG
- IdhA gene coding for lactate dehydrogenase this enzyme can divert carbon flux from pyruvate to lactate instead of to acetyl-CoA.
- the first step of the pathway is the conversion of D-xyiose into D- xylonate, either by a two-step process using a xylose dehydrogenase to convert D- xyiose to D-xyionolactone followed by conversion of D-xylonolactone to D-xylonate with a xylonolactonase enzyme, or by a one-step process using a xylose dehydrogenase to convert D-xylose directly to D-xylonate.
- the conversion of D- xyiose to D-xylulose is inhibited by the deletion of the xylA gene.
- D-xylonate is then converted to 2-keto-3-deoxy-xylonate by a xylonate dehydratase.
- 2-keto-3-deoxy- xyionate is then cleaved into giycolaldehyde and pyruvate by 2-keto-3-deoxy-D- xyionate aldolase.
- Production of MEG from giycolaldehyde and a three carbon compound from pyruvate (for example, acetone, I PA and/or propene) proceeds as described for FIG. 1.
- the pathway for MEG + I PA co-production in S. cerevisiae comprises the following enzymes for I PA production: thioiase, acetate: acetoacetyi- CoA transferase or hydrolase, acetoacetate decarboxylase and secondary alcohol dehydrogenase.
- the MEG pathway via D-ribulose-1 -phosphate comprises the following enzymes: D-tagatose 3-epimerase, D-ribulokinase, D-ribulose-phosphate aldolase and giycolaldehyde reductase. Besides the two main pathways, S.
- Pathway 1 comprises 2 genes: Xyl1 converts D-Xylose to xylitol, and Xyl2 converts Xylitol to D-xylulose.
- Pathway 2 comprises only one gene: XylA that directly converts D-xylose to D-xylulose.
- XKS1 gene coding for a xyiuiokinase this enzyme can divert carbon flux into the pentose phosphate pathway
- PH013 gene coding for alkaline phosphatase can divert carbon from pentose phosphate pathway
- the first step of the pathway is the conversion of D-xylose into D-xylulose, directly or via the intermediate xylitol.
- D-xyluiose is converted to D-ribuiose by the D- tagatose 3-epimerase enzyme.
- D-ribuiose is then converted to D-Ribulose-1- phosphate by D-ribulokinase.
- D-Ribulose-1-phosphate is cleaved into giycolaldehyde and DHAP by D-ribulose-phosphate aldolase.
- DHAP enters the C3 branch for I PA production and giycolaldehyde can be converted to ethylene glycol using giycoiaidehyde reductase.
- the conversion of DHAP to acetyl-CoA (through giycera!dehyde-3-phosphate and pyruvate) is part of the natural S, cerevisiae metabolism.
- One molecule of acetyl-CoA is condensed to another molecule of acetyl-CoA by thiolase, producing acetoacetyl-CoA.
- the CoA from acetoacetyl-CoA is recycled to a molecule of acetate by acetate: acetoacetyl-CoA transferase or hydrolase, generating one molecule of acetyl-CoA and one of acetoacetate.
- Acetoacetate is further decarboxyiated by acetoacetate decarboxylase to acetone, which is further converted to I PA by a secondary alcohol dehydrogenase enzyme.
- I PA can further be converted to propene by a dehydratase-isomerase (RG. 4).
- the inventive co-production pathway from xylose is implemented in an organism with natural or added capability to fix CO2 using excess reducing agents, thereby providing even higher yield potential.
- Various CO2 fixation pathways are known and have been implemented in E. coii or other hosts.
- Acetogens such as Clostridium ijungdah!ii, can naturally utilize excess NADH generated in the presented xylose fermentation pathway especially efficient to recapture released CO2 in the Wood-Ljungdahl pathway to produce the intermediate acetyl-CoA, which can then be used to produce more acetone or related products.
- CO2 is released for instance in the pyruvate +CoA ⁇ NAD+ ⁇ acetyi-CoA ⁇ C02 +2 NADH or acetoacetone ⁇ actone ⁇ C02 reactions.
- a second feedstock such as hydrogen gas (H2) or syngas (a composition of H2, CO, CO2) or methanol, can provide more reducing agents and even allow acetogens or similarly enabled organisms to re-capture ail CO2 released in the xylose fermentation pathway or CO2 present in the second feedstock.
- Such a mixotrophic fermentation can thus further increase yield potential, in the case of MEG + acetone from xylose, CO2 fixation can lead to an increase of 25% relative acetone or 8% total MEG+ acetone product yield.
- the yield potential is +100% for acetone which equals +32% total product yield.
- MEG is produced through the conversion of giycoiaidehyde in a C-2 branch pathway and acetone is produced through the conversion of DHAP or pyruvate in a C-3 branch pathway
- MEG is produced through the conversion of giycoiaidehyde in a C-2 branch pathway and IPA is produced through the conversion of DHAP or pyruvate in a C-3 branch pathway
- MEG is produced through the conversion of giycoiaidehyde in a C-2 branch pathway and propene is produced through the conversion of DHAP or pyruvate in a C-3 branch pathway.
- At least a portion of the excess NADH produced in the C-3 branch is used as a source of reducing equivalents in the C ⁇ 2 branch. In another embodiment, at least a portion of the excess NADH produced in the C-3 branch is used to produce ATP.
- the co-produced MEG and acetone comprise a yield potential greater than 90% of the theoretical maximum yield potential without carbon fixation
- the co-produced MEG and I PA comprise a yield potential greater than 90% of the theoretical maximum yield potential without carbon fixation.
- the co-produced MEG and propene comprise a yield potential greater than 90% of the theoretical maximum yieid potential without carbon fixation.
- excess biomass formation is minimized and production of MEG and acetone is maximized.
- excess biomass formation is minimized and production of MEG and IPA is maximized, in a further embodiment, excess biomass formation is minimized and production of MEG and propene is maximized.
- MEG Monoefhylene glycol
- PET polyethylene terephthaiate
- MEG is important in the production of antifreezes, coolants, aircraft anti-icer and deicers and solvents.
- EG is also known as ethane-1 ,2-diol.
- Ethylene glycol is also used as a medium for convective heat transfer in, for example, automobiles and liquid cooled computers.
- ethylene glycol is a useful desiccant. Ethylene glycol is widely used to inhibit the formation of natural gas ciathrates (hydrates) in long multiphase pipelines that convey natural gas from remote gas fields to a gas processing facility. Ethylene glycol can be recovered from the natural gas and reused as an inhibitor after purification treatment that removes water and inorganic salts.
- Minor uses of ethylene glycol include in the manufacture of capacitors, as a chemical intermediate in the manufacture of 1 ,4-dioxane, and as an additive to prevent corrosion in liquid cooling systems for personal computers. Ethylene glycol is also used in the manufacture of some vaccines; as a minor ingredient in shoe polish, inks and dyes; as a rot and fungal treatment for wood; and as a preservative for biological specimens.
- Acetone also known as propanone
- CH32CO organic compound with the formula (CH3)2CO. It is a colorless, volatile, flammable liquid, and is the simplest ketone.
- Acetone is miscible with water and serves as an important solvent, typically for cleaning purposes in the laboratory. Over 6.7 million tonnes are produced worldwide, mainly for use as a solvent and production of methyl methacrylate and bisphenoi A. it is a common building block in organic chemistry. Familiar household uses of acetone are as the active ingredient in nail polish remover and as paint thinner.
- isopropyl alcohol (lUPAC name 2-propanol), also called isopropanol, is a compound with the chemical formula C3H8O or C3H7OH or CH3CHOHCH3. It is a colorless, flammable chemical compound with a strong odor, it is the simplest example of a secondary alcohol, where the alcohol carbon atom is attached to two other carbon atoms sometimes shown as (CH3)2CHOH. It is a structural isomer of propanol. It has a wide variety of industrial and household uses.
- Propene also known as propylene or methyl ethylene, is an unsaturated organic compound having the chemical formula C3H6. It has one double bond, and is the second simplest member of the aikene class of hydrocarbons.
- Propene is produced from fossil fuels— petroleum, natural gas, and, to a much lesser extent, coal. Propene is a byproduct of oil refining and natural gas processing. [00191] Propene is the second most important starting product in the petrochemical industry after ethylene. If is the raw material for a wide variety of products. Manufacturers of the plastic polypropylene account for nearly two thirds of all demand. Polypropylene is, for example, needed for the production of films, packaging, caps and closures as well as for other applications. Propene is also used for the production of important chemicals such as propylene oxide, acrylonitrile, cumene, butyraldehyde, and acrylic acid. Over 85 million tonnes of propene is processed worldwide.
- the present disclosure describes enzymes that can catalyze the epimerization of various ketoses at the C-3 position, interconverting D-fructose and D-psicose, D-tagatose and D-sorbose, D-ribulose and D-xylu!ose, and L-ribulose and L-xyluiose,
- the specificity depends on the species.
- the enzymes from Pseudomonas cichorii and Rhodobacter sphaeroides require n 2+ ,
- the enzyme is D-tagatose 3-epimerase (dte).
- the D-tagatose 3-epimerase catalyzes the conversion of D-xyluiose to D-ribulose.
- the D-fagatose 3-epimerase is from Pseudomonas spp. In another embodiment, the D-tagatose 3-epimerase is from Pseudomonas cichorii. In another embodiment, the D-tagatose 3-epimerase is from Pseudomonas sp. ST-24. In another embodiment, the D-tagatose 3-epimerase is from Mesorhizobium ioti. In another embodiment, the D-tagatose 3-epimerase is from Rhodobacter sphaeroides (C 1 KKR 1 ) .
- the D-tagatose 3-epimerase is encoded by one or more nucleic acid molecules obtained from a microorganism selected from the group consisting of Pseudomonas sp., Mesorhizobium sp. and Rhodobacter sp.
- the D-tagatose 3-epimerase is encoded by one or more nucleic acid molecules obtained from a microorganism selected from the group consisting of Pseudomonas cichorii, Pseudomonas sp. ST-24, Mesorhizobium ioti and Rhodobacter sphaeroides.
- the one or more nucleic acid molecules is dte and/or FJ851309.1 , or homo!og thereof.
- the D-tagatose 3-epimerase comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 3 and 5.
- the D- tagatose 3-epimerase is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1 , 2 and 4. [00198] D-tagatose 3-epimerase may also be known as L-ribulose 3-epimerase or ketose 3-epimerase.
- D-ribuiokinase may also be known as L-fucuiokinase, fuculokinase, ATP: L-fuculose 1 -phosphotransferase or L-fuculose kinase.
- the disclosure provides for an enzyme that plays roles in the fucose degradation pathway, the super pathway of fucose and rhamnose degradation and/or the D-arabinose degradation I pathway.
- the enzyme can function as both an L-fucolokinase and a D-ribuiokinase, the second enzyme of the L-fucose and D-arabinose degradation pathways, respectively.
- the enzyme converts D-ribu!ose to D-ribulose- 1 -phosphate.
- the D-ribulokinase is from Escherichia co/7.
- the D-ribulokinase is encoded by the fucK gene.
- the D-ribuiokinase is encoded by one or more nucleic acid molecules obtained from E, co!i.
- the one or more nucleic acid molecules is fucK, or homoiog thereof, in a further embodiment, the D-ribulokinase comprises an amino acid sequence set forth in SEQ ID NO: 8. in yet a further embodiment, the D-ribulokinase is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 6 and 7.
- the present disclosure describes enzymes that can catalyze the following reversible reactions: [00207] L-fuculose 1 -phosphate ?t (S)-lactalclehyde + dihydroxy acetone phosphate (DHAP)
- D-ribuiose- -phosphate aldolase may also be known as L-fuculose- phosphate aldolase, L-fucuiose 1 -phosphate aldolase or L-fuculose ⁇ -phosphate (S) ⁇ lactaldehyde-lyase,
- the disclosure provides for an enzyme that plays roles in the fucose degradation pathway, the super pathway of fucose and rhamnose degradation and/or the D-arabinose degradation I pathway.
- the enzyme may use Zn 2+ as a cofactor.
- an inhibitor of this enzyme may be phosphoglycolohydroxamate.
- the enzyme can function as both an L-fuculose- phosphate aldolase and a D-ribulose-phosphate aldolase, the third enzyme of the L- fucose and D-arabinose degradation pathways, respectively.
- the substrate specificity of the enzyme has been tested with a partially purified preparation from an E. co// strain.
- the enzyme converts D-ribuiose-1-phosphate to giycolaldehyde and DHAP.
- the D-ribulose-1-phosphate aldolase is from Escherichia coii.
- the D-ribulose-1-phosphate aldolase is encoded by the fucA gene, in one embodiment, the D-ribulose-1 - phosphate aldolase is encoded by one or more nucleic acid molecules obtained from E, coii.
- the one or more nucleic acid molecules is fucA, or homolog thereof, in a further embodiment, the D-ribuiose-1 -phosphate aldolase comprises an amino acid sequence set forth in SEQ ID NO: 11. In yet a further embodiment, the D-ribulose-1 -phosphate aldolase is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 9 and 10. GlycolaSdehyde reductase (EC 1.1.1.77)
- the present disclosure describes enzymes that can catalyze the following reversible reactions:
- Glycolaldehyde reductase may also be known as iactaidehyde reductase, propanediol oxidoreductase, (R) [or(S)]-propane-1 ,2-diol:NAD+ oxidoreductase or L- 1 ,2-propanediol oxidoreductase.
- the disclosure provides for an enzyme that plays roles in the ethylene glycol degradation pathway, the super pathway of glycol metabolism and degradation, the anaerobic L-lactaldehyde degradation pathway and/or the super pathway of fucose and rhamnose degradation.
- the enzyme may use Fe 2+ as a cofactor.
- L-1 ,2-propanedioi oxidoreductase is an iron-dependent group IN dehydrogenase. It anaerobically reduces L-lactaldehyde, a product of both the L- fucose and L-rhamnose catabolic pathways, to L-1 ,2-propanediol, which is then excreted from the cell.
- the enzyme in vitro, can be reactivated by high concentrations of NAD+ and efficiently inactivated by a mixture of Fe 3+ and ascorbate or Fe 2 ⁇ and H2O2.
- Metal-catalyzed oxidation of the conserved His277 residue is proposed to be the cause of the inactivation.
- FucO enables engineered one-turn reversal of the ⁇ - oxidation cycle. FucO activity contributes to the conversion of isobufyraidehyde to isobutanol in an engineered strain.
- the enzyme converts glycolaldehyde to MEG.
- the glycolaidehyde reductase is from Escherichia coli.
- the glycolaldehyde reductase is encoded by the fucO gene, in one embodiment, the glycolaldehyde reductase is encoded by one or more nucleic acid molecules obtained from a microorganism selected from E. coli and S.
- the one or more nucleic acid molecules is selected from gldA, GRE2, GRE3, yqhD, ydjG, fucO, yafB (dkgB), and/or yqhE (dkgA), or homoiog thereof, in another embodiment, the one or more nucleic acid molecules is yqhD. In some embodiments, the yqhD comprises a G149E mutation.
- the glycolaldehyde reductase comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 13, 15, 17, 20, 23, 25, 28, 30 and 32. in yet a further embodiment, the glycolaldehyde reductase is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 12, 14, 16, 18, 19, 21 , 22, 24, 26, 27, 29 and 31.
- aldehyde reductases may be used to convert glycolaldehyde to MEG.
- YqhD NADPH-dependent aldehyde reductase
- YqhD is an NADPH-dependent aldehyde reductase that may be involved in glyoxai detoxification and/or be part of a glutathione-independent response to lipid peroxidation.
- phenyiacetaldehyde and 4-hydroxyphenylacetaldehyde are reduced to 2-phenylethanoi and 2-(4-hydroxyphenyl)ethanol by the endogenous aldehyde reductases YqhD, YjgB, and YahK.
- YqhD Overexpression of YqhD increases 1 ,3-propanediol oxidoreductase activity of the ceil.
- E, co!i has been engineered to express YqhD for the industrial production of 1 ,3-propanediol.
- YqhD activity contributes to the production of isobutanol, 1 ,2- propanediol, 1 ,2,4-butanetrioi and acetol as well.
- Mutation of yqhD enables production of butanol by an engineered one-turn reversal of the ⁇ -oxidation cycle.
- YqhD has furfural reductase activity, which appears to cause growth inhibition due to depletion of NADPH in metabolicaliy engineered strains that produce alcohol from iignoceliulosic biomass.
- YqhD is an asymmetric dimer of dimers, and the active site contains a Zn 2+ ion.
- the NADPH cofactor is modified by hydroxyl groups at positions 5 and 6 in the nicotinamide ring.
- yqhD deletion mutant shows increased sensitivity to these compounds and to glyoxai, and contains increased levels of reactive aldehydes that are generated during lipid peroxidation. Conversely, yqhD deletion leads to increased furfural tolerance,
- an NADPH-dependent aldehyde reductase converts giycolaldehyde to MEG.
- the NADPH-dependent aldehyde reductase is from Escherichia coli.
- the NADPH-dependent aldehyde reductase is encoded by the yqhD gene.
- a multi-functional methylglyoxal reductase (DkgA) can catalyze the following reactions:
- DkgA belongs to the aldo-keto reductase (AKR) family and has been shown to have methylglyoxal reductase and beta-keto ester reductase activity.
- dkgA is reported to encode a 2,5-diketo-D-giuconate reductase (25D GR) A, one of two 25DKG reductases in E. coli.
- the enzyme uses NADPH as the preferred electron donor and is thought to be involved in ketogluconate metabolism.
- the specific activity of the enzyme towards 2,5-diketo-D-gluconate is reported to be almost 1000-fold lower than its activity towards methylglyoxal.
- DkgA Due to its low Km for NADPH, reduction of furans by DkgA may deplete NADPH pools and thereby limit cellular biosynthesis.
- a broad survey of aldehyde reductases showed that DkgA was one of several endogenous aldehyde reductases that contribute to the degradation of desired aldehyde end products of metabolic engineering.
- a multi-functional methylglyoxal reductase converts giycoialdehyde to MEG.
- the multi-functional methylglyoxal reductase is from Escherichia coii. in some embodiments, the multifunctional methylglyoxal reductase is encoded by the dkgA gene.
- DkgB A multi-functional methylgiyoxal reductase (DkgB) can catalyze the following reactions:
- DkgB (YafB) is a member of the aldo-keto reductase (AKR) subfamily 3F. DkgB was shown to have 2,5-diketo-D-gluconate reductase, methylgiyoxal reductase and 4 ⁇ nitrobenzaldehyde reductase activities.
- dkgB is reported to encode 2,5-diketo-D-gluconate reductase (25DKGR) B, one of two 25DKG reductases in E. co!i.
- the enzyme uses NADPH as the preferred electron donor and is thought to be involved in ketogiuconate metabolism.
- NADPH the preferred electron donor
- the specific activity of the enzyme towards 2,5-diketo-D-gluconate is reported to be almost 000-fold lower than its activity towards methylgiyoxal.
- a multi-functional methylgiyoxal reductase converts glycoiaidehyde to MEG.
- the multi-functional methylgiyoxal reductase is from Escherichia coli. in some embodiments, the multifunctional methylgiyoxal reductase is encoded by the dkgB gene.
- a methylgiyoxal reductase (YeaE) can catalyze the following reaction:
- YeaE has been shown to have methylgiyoxal reductase activity.
- a methylgiyoxal reductase converts glycoiaidehyde to MEG.
- the methylgiyoxal reductase is from Escherichia coli.
- the methyigiyoxal reductase is encoded by the yeaE gene,
- a L-glyceraldehyde 3-phosphate reductase (yghZ) can catalyze the following reactions:
- YghZ is an L-glyceraldehyde 3-phosphate (L-GAP) reductase.
- the enzyme is also able to detoxify methyigiyoxal at a low rate.
- YghZ defines the AKR 4 (aldo-keto reductase 14) protein family.
- L-GAP is not a natural metabolite and is toxic to E. coli.
- L-GAP is a substrate of both the glycerol-3-phosphate and hexose phosphate transport systems of E.coli K-12. it has been postulated that the physiological role of YghZ is the detoxification of L-GAP, which may be formed by non-enzymatic racemization of GAP or by an unknown cellular process.
- a L-glyceraldehyde 3-phosphate reductase converts glycoialdehyde to MEG.
- the L-glyceraldehyde 3- phosphate reductase is from Escherichia coli.
- the L- giyceraldehyde 3-phosphate reductase is encoded by the yghZ gene.
- GldA glycerol + NAD+ ? ⁇ dihydroxyacetone + NADH + H+ (reversible reaction, EC 1.1.1.6)
- the physiological function of the GldA enzyme has long been unclear. The enzyme was independently isolated as a glycerol dehydrogenase and a D-1-amino- 2-propanol:NAD+ oxidoreductase. At that time, D-1-amino-2-propanoi was thought to be an intermediate for the biosynthesis of vitamin B12, and although E. coli is unable to synthesize vitamin B12 de novo, enzymes catalyzing the synthesis of this compound were sought. It was later found that GldA was responsible for both activities.
- GldA The primary in vivo role of GldA was recently proposed to be the removal of dihydroxyacetone by converting it to glycerol.
- a dual role in the fermentation of glycerol has also recently been established.
- Glycerol dissimilation in E. coli can be accomplished by two different pathways.
- the glycerol and glycerophosphodiesfer degradation pathway requires the presence of a terminal electron acceptor and utilizes an ATP-dependent kinase of the Glp system, which phosphorylates glycerol to giycerol-3-phosphate.
- GldA NAD-Hinked dehydrogenase
- the enzyme is found in two catalyticaliy active forms, a large form of eight subunits and a small form of two subunits.
- the large form appears to be the major species.
- an L-1 ,2-propanedioi dehydrogenase/glycerol dehydrogenase converts giycolaldehyde to MEG.
- the L-1 ,2- propanediol dehydrogenase/glycerol dehydrogenase is from Escherichia coli.
- the L-1 ,2-propanediol dehydrogenase/glycerol dehydrogenase is encoded by the gldA gene.
- GRE2 NADPH-dependent methylglyoxal reductase
- Gre2 is a versatile enzyme that catalyzes the stereoselective reduction of a broad range of substrates including aliphatic and aromatic ketones, diketones, as well as aldehydes, using NADPH as the cofactor.
- Gre2 catalyzes the irreversible reduction of the cytotoxic compound methylglyoxa! (MG) to (S)-lactaldehyde as an alternative to detoxification of G by giyoxalase I GL01.
- MG is synthesized via a bypath of glycolysis from dihydroxyacetone phosphate and is believed to play a role in cell cycle regulation and stress adaptation.
- GRE2 also catalyzes the reduction of isovaleraldehyde to isoamylalcohoi. The enzyme serves to suppress isoamylalcohol-induced filamentation by modulating the levels of isovaleraldehyde, the signal to which cells respond by filamentation.
- GRE2 is also involved in ergosterol metabolism.
- an NADPH-dependent methyiglyoxal reductase converts giycolaldehyde to MEG.
- the NADPH-dependent methyiglyoxal reductase is from S. cerevisiae.
- the NADPH-dependent methyiglyoxal reductase is encoded by the GRE2 gene.
- Thioiase/Acetyl coenzyme A aceiyltransferase may also be known as acetyl-CoA-C-acetyltransferase, acetoacetyl ⁇ CoA thiolase, acety!-CoA:acetyl-CoA C- acetyltransferase or thiolase ⁇ .
- the disclosure provides for an enzyme that plays a role in aceioaceiate degradation (to acetyl CoA).
- an inhibitor of this enzyme may be acetoacetyl-CoA,
- the enzyme converts acetyi-CoA to acetoacetyl-CoA
- the thioiase/acetyl coenzyme A aceiyltransferase is from Clostridium spp.
- the thiolase/acetyi coenzyme A acetyitransferase is from Clostridium acetobutyiicum.
- the ihiolase/acetyl coenzyme A aceiyltransferase is from Clostridium thermosaccharolyticum.
- the thioiase/acetyl coenzyme A aceiyltransferase is from Bacillus cereus.
- the ihiolase/acetyl coenzyme A acetyitransferase is from Marinobacter hydrocarbonociasticus ATCC 49840,
- the thiolase/acetyi coenzyme A acetyitransferase is encoded by the ihlA gene.
- the ihiolase/acetyl coenzyme A aceiyltransferase is from Escherichia coli.
- the thiolase/acetyi coenzyme A aceiyltransferase is encoded by the atoB gene.
- the thiolase or acetyl coenzyme A acetyitransferase is encoded by one or more nucleic acid molecules obtained from a microorganism selected from the group consisting of Clostridium sp., Bacillus sp., E, coli, Saccharomyces sp. and Marinobacter sp.
- the thiolase or acetyl coenzyme A acetyliransferase is encoded by one or more nucleic acid molecules obtained from a microorganism selected from the group consisting of Clostridium acetobutyiicum, Clostridium thermosaccharolyticum, Bacillus cereus, E. coli, Saccharomyces cerevisiae and Marinobacter hydrocarbonociasticus.
- the one or more nucleic acid molecules is thIA, atoB and/or ERG10, or homolog thereof, in a further embodiment, the thiolase or acetyl coenzyme A aceiyltransferase comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 35, 37 and 40. In yet a further embodiment, the thiolase or acetyl coenzyme A aceiyltransferase is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 33, 34, 36, 38 and 39. Acetate :Acetoacety!-CoA transferase (EC 2.8 tenu3.-3 ⁇ 4
- Acetate:Acetoacetyl-CoA transferase may also be known as acetoacetyl- CoA transferase or acetyi-CoA:acetoacetate-CoA transferase.
- the disclosure provides for an enzyme that plays a role in acetoacetate degradation (to acetyl CoA).
- inhibitors of this enzyme may include acetyl-CoA and coenzyme A.
- the enzyme converts acetoacetyl-CoA to acetoacetate.
- the acetate:acetoacetyl-CoA transferase is from Clostridium spp.
- the acetate: acetoacetyl-CoA transferase is from Clostridium acetobuiy!icum.
- the acetate: acetoacetyl-CoA transferase is from Escherichia coli.
- the acetate:acetoacetyi-CoA transferase is encoded by the afoA and atoD genes
- the subunit composition of acetoacetyl-CoA transferase is [(AtoA)2][(AtoD)2], with (AtoA)2 being the ⁇ complex and (AtoD)2 being the a complex.
- the acetate: acetoacetyl-CoA transferase is a fused acetate: acetoacetyl-CoA transferase: a subunit/ ⁇ subunit.
- the acetate: acetoacetyl-CoA transferase is encoded by the ydiF gene.
- Acetoacetyl-CoA hydrolase may also be known as acetoacetyl coenzyme A hydrolase, acetoacetyl CoA deacyiase or acetoacetyl coenzyme A deacylase,
- This enzyme belongs to the family of hydrolases, specifically those acting on thioester bonds.
- the enzyme converts acetoacetyl-CoA to acetoacetate.
- the acetate: acetoacetyl-CoA hydrolase is from Clostridium spp.
- the acetate :acetoacetyl-CoA hydrolase is from Clostridium acetobutyiicum.
- the Acetoacetyl-CoA hydrolase is encoded by the ctfA (subunit A) and/or ctfB (subunit B) genes.
- the acetyl-CoA:acetoacetate-CoA transferase or acetate:acetoacetyi-CoA hydrolase comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 43, 48, 97, 99, 101 and 103.
- the acetyi-CoA:acetoacetate-CoA transferase or acetate: acetoacetyl-CoA hydrolase is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 41 , 42, 44, 45, 98, 98, 100 and 102.
- Acetoacetate decarboxylase (EC 4.1.1.4]
- the present disclosure describes enzymes that can catalyze the following reaction:
- Acetoacetate decarboxylase may also be known as ADC, AADC or acetoacetate carboxy-iyase.
- the disclosure provides for an enzyme that plays roles in isopropanol biosynthesis, pyruvate fermentation to acetone, the super pathway of Clostridium acetobutyiicum acidogenic and solventogenic fermentation and/or the super pathway of Clostridium acetobutyiicum solventogenic fermentation.
- ADC Acetoacetate decarboxylase
- Clostridium acetobutylicum ATCC 824 has been purified and the adc gene encoding it cloned.
- the enzyme has also been purified from the related strain Clostridium acetobutylicum DS 792 and the gene cloned and sequenced.
- the decarboxylation reaction proceeds by the formation of a Schiff base intermediate.
- ADC is a key enzyme in acid uptake, effectively pulling the CoA- transferase reaction in the direction of acetoacetate formation.
- the enzyme converts acetoacetate to acetone.
- the acetoacetate decarboxylase is from Clostridium spp. In some embodiments, the acetoacetate decarboxylase is from Clostridium acetobutylicum. in some embodiments, the acetoacetate decarboxylase is from Clostridium beijerinckii. In some embodiments, the acetoacetate decarboxylase is from Clostridium cellulolyticum. In some embodiments, the acetoacetate decarboxylase is from Bacillus polymyxa. In some embodiments, the acetoacetate decarboxylase is from Chromobacterium vioiaceum. in some embodiments, the acetoacetate decarboxylase is from Pseudomonas putida. in another embodiment, the acetoacetate decarboxylase is encoded by the adc gene.
- the acetoacetate decarboxylase is encoded by one or more nucleic acid molecules obtained from a microorganism selected from the group consisting of Clostridium sp., Bacillus sp., Chromobacterium sp. and Pseudomonas sp.
- the acetoacetate decarboxylase is encoded by one or more nucleic acid molecules obtained from a microorganism selected from the group consisting of Clostridium acetobutylicum, Clostridium beijerinckii, Clostridium cellulolyticum, Bacillus polymyxa, Chromobacterium vioiaceum and Pseudomonas putida.
- the one or more nucleic acid molecules encoding the acetoacetate decarboxylase is adc, or homolog thereof, in a further embodiment, the acetoacetate decarboxylase comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 49 and 52. In yet another embodiment, the acetoacetate decarboxylase is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 47, 48, 50 and 51.
- the present disclosure describes enzymes that can catalyze the reversible oxidation of primary or secondary alcohols to aldehydes or ketones, respectively, in one embodiment, the enzyme is a secondary alcohol dehydrogenase (S-ADH) and catalyzes the reduction of ketones such as acetone into secondary alcohols such as 2-propanol (isopropanol).
- S-ADH secondary alcohol dehydrogenase
- the S-ADH is from Burkhoideria sp. In some embodiments, the S-ADH is from Burkhoideria sp. AIU 852. In some embodiments, the S-ADH is from A!ca!igenes sp. in some embodiments, the S-ADH is from A!caligenes eutrophus. in some embodiments, the S-ADH is from Clostridium sp. in some embodiments, the S-ADH is from Clostridium ragsdaiei. In some embodiments, the S-ADH is from Clostridium beijerinckii. in some embodiments, the S-ADH is from Thermoanaerobacter sp.
- the S-ADH is from Thermoanaerobacter brockii. In some embodiments, the S-ADH is from Thermoanaerobacter ethano!icus (Clostridium thermohydrosulfuricum). In some embodiments, the S-ADH is encoded by the adhB gene, in some embodiments, the S-ADH is from the trypanosomatid Phytomonas sp. In some embodiments, the S- ADH is from Rhodococcus sp. in some embodiments, the S-ADH is from Rhodococcus ruber, in some embodiments, the S-ADH is from Methanobacterium palustre.
- the S-ADH is from methanogenic archaea Methanogenium liminatans. In some embodiments, the S-ADH is from the parasitic protist Entamoeba histolytica (EhAdhl ). in some embodiments, the S-ADH is from parasitic protozoan Tritrichomonas foetus, in some embodiments, the S-ADH is from human parasite Trichomonas vaginalis.
- the S-ADH is predicted from homology and can be from Thermoanaerobacter mathranii, Micrococcus luteus, Nocardiopsis alba, Mycobacterium hassiacum, Helicobacter suis, Candida albicans, Candida parapsilosis, Candida orthopsilosis, Candida rnetapsilosis, Grosmannia ciavigera and Scheffersomyces stipitis.
- the alcohol dehydrogenase comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 106 and 108.
- the alcohol dehydrogenase is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 104, 105 and 107.
- the present disclosure describes enzymes that can catalyze the conversion of D-xyiuiose to D-xyiuiose-1 -phosphate.
- the conversion can be catalyzed by a human ketohexokinase C (khk-C), also known as fructokinase.
- khk-C human ketohexokinase C
- Ketohexokinase or fructokinase, phosphoryiates fructose to fructose-1- phosphate.
- the enzyme is involved in fructose metabolism, which is part of carbohydrate metabolism. It is found in the liver, intestine and kidney cortex.
- fructokinase when coupled with aldolase, has been discovered to contribute to an alternative mechanism to produce oxalate from xyiitol.
- fructokinase and aldolase produce glycoialdehyde, a precursor to oxalate, from D-xyiulose via D-xylulose 1 ⁇ phosphate.
- the enzyme converts D-xylulose to D-xylulose- 1-phosphate.
- the D-xyiulose 1-kinase is a ketohexokinase C.
- the ketohexokinase C is from Homo sapiens.
- the human ketohexokinase C is encoded by the khk-C gene.
- the D-xyiulose 1-kinase is encoded by one or more nucleic acid molecules obtained from Homo sapiens.
- the one or more nucleic acid molecules encoding the D-xylulose 1-kinase is ketohexokinase C (khk-C), or homolog thereof, in another embodiment, the one or more nucleic acid molecules encoding the D-xyiuiose 1-kinase comprises an amino acid sequence set forth in SEQ ID NO: 55. In a further embodiment, the one or more nucleic acid molecules encoding the D-xyluiose 1-kinase is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 53 and 54.
- the present disclosure describes enzymes that can catalyze the conversion of D-xylulose-1 -phosphate to glycoiaidehyde and DHAP.
- the conversion can be catalyzed by a human aldolase B, which is also known as fructose-bisphosphate aldolase B or liver-type aldolase.
- Aldolase B is one of three isoenzymes (A, B, and C) of the class I fructose 1 ,6-bisphosphate aldolase enzyme (EC 4.1.2.13), and plays a key role in both glycolysis and gluconeogenesis.
- the generic fructose 1 ,6-bisphosphate aldolase enzyme catalyzes the reversible cleavage of fructose 1 ,6-bisphosphate (FBP) into glyceraldehyde 3-phosphafe and dihydroxyacetone phosphate (DHAP) as well as the reversible cleavage of fructose 1-phosphate (F1 P) into glyceraldehyde and dihydroxyacetone phosphate.
- FBP fructose 1 ,6-bisphosphate
- DHAP dihydroxyacetone phosphate
- F1 P reversible cleavage of fructose 1-phosphate
- Aldolase B is a homotetrameric enzyme, composed of four subunits. Each subunit has a molecular weight of 36 kDa and contains an eight-stranded ⁇ / ⁇ barrel, which encloses lysine 229 (the Schiff-base forming amino acid that is key for catalysis).
- the enzyme converts D-xylulose- 1 -phosphate to glycoiaidehyde and DHAP.
- the D-xylulose-1-phosphate aldolase is an aldolase B.
- the aldolase B is from Homo sapiens, in some embodiments, the human aldolase B is encoded by the ALDOB gene,
- the D-xyluiose-1-phosphate aldolase is encoded by one or more nucleic acid molecules obtained from Homo sapiens.
- the one or more nucleic acid molecules encoding the D-xylulose-1- phosphate aldolase is aldolase B (ALDOB), or homo!og thereof.
- the one or more nucleic acid molecules encoding the D-xylulose-1- phosphate aldolase comprises an amino acid sequence set forth in SEQ ID NO: 58.
- the one or more nucleic acid molecules encoding the D- xylulose-1 -phosphate aldolase is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 58 and 57.
- the present disclosure describes enzymes that can catalyze the following reversible reaction:
- D-xylose isomerase may also be known as xylose isomerase or D-xylose ketoi-isomerase.
- the disclosure provides for an enzyme that plays a role in xylose degradation.
- Xylose isomerase catalyzes the first reaction in the cataboiism of D-xylose.
- the enzyme converts D-xylose to D-xylulose.
- the D-xyiose isomerase is from Escherichia coii.
- the D-xylose isomerase is encoded by the xylA gene.
- a recombinant microorganism producing MEG and a three-carbon compound comprises a deletion, insertion, or loss of function mutation in a gene encoding a D-xylose isomerase to prevent conversion of D-xylose to D-xyiuiose and instead shunt the reaction toward the conversion of D-xyiose to D- xylonate.
- the recombinant microorganism comprises an endogenous or exogenous xylose isomerase that catalyzes the conversion of D- xyiose to D-xylulose.
- the xylose isomerase is exogenous, in another embodiment, the xylose isomerase is encoded by one or more nucleic acid molecules obtained from Pyromyces sp.
- the one or more nucleic acid molecules encoding the xylose isomerase is xylA, or homolog thereof.
- the one or more nucleic acid molecules encoding the xylose isomerase comprises an amino acid sequence set forth in SEQ ID NO: 95.
- the one or more nucleic acid molecules encoding the xylose isomerase is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 93 and 94.
- D-xylulose- 5-kinase may also be known as xylulose kinase or xylulokinase.
- Xylulokinase catalyzes the phosphorylation of D-xylulose, the second step in the xylose degradation pathway, producing D-xylulose-5-phosphate, an intermediate of the pentose phosphate pathway.
- xyluiokinase in the absence of substrate, xyluiokinase has weak ATPase activity.
- Xyluiokinase can also catalyze the phosphorylation of -deoxy-D-xyiulose. This would allow a potential salvage pathway for generating 1-deoxy-D-xy!ulose 5- phosphate for use in the biosynthesis of terpenoids, thiamine and pyridoxal.
- the rate of phosphorylation of 1-deoxy-D-xylulose is 32-fold lower than the rate of phosphorylation of D-xylulose.
- the enzyme converts D-xylulose to D-xylulose- 5-phosphate.
- the D-xylulose- 5-kinase is from Escherichia coli.
- the D-xyluiose- 5-kinase is encoded by the xylB gene, in some embodiments, the D-xylulose-5-kinase is from Saccharomyces cerevisiae, in some embodiments the D-xylulose-5-kinase is encoded by the XKS1 gene.
- the D-xyluiose-5-kinase is from Pichia stipitis.
- the D-xyiuiose-5-kinase is encoded by the XYL3 gene.
- a recombinant microorganism producing MEG and a three-carbon compound comprises a deletion, insertion, or loss of function mutation in a gene encoding a D-xylulose-5-kinase to prevent the conversion of D ⁇ xylulose to D-xylulose-5-phosphate and instead shunt the reaction toward conversion of D-xyiuiose to D-xylulose- 1 -phosphate.
- Xylose dehydrogenase (EC 1.1.1.175 or EC 1.1.1.179)
- Xylose dehydrogenase may also be known as D-xylose dehydrogenase, D-xyiose 1 -dehydrogenase, (NAD+)-linked D-xylose dehydrogenase, NAD+-D- xylose dehydrogenase, D-xylose: NAD ⁇ 1-oxidoreductase
- D-Xylose dehydrogenase catalyzes the NAD+-dependent oxidation of D- xyiose to D-xylonolactone. This is the first reaction in the oxidative, non- phosphoryiative pathway for the degradation of D-xylose in Caulobacter crescentus. This pathway is similar to the pathway for L-arabinose degradation in Azospiri!lum brasiiense.
- the amino acid sequence of the C. crescentus enzyme is unrelated to that of xylose dehydrogenase from the archaeon Haloarcu!a marismortui, or the L- arabinose 1 -dehydrogenase of Azospiri!um brasiiense.
- D-xylose is the preferred substrate for recombinant D-xylose dehydrogenase from Caulobacter crescentus.
- the enzyme can use L-arabinose, but if is a poorer substrate.
- the Km for L-arabinose is 166 mM.
- Other substrates such as D-arabinose, L-xylose, D-ribose, D-gaiactose, D-glucose and D-glucose-6- phosphate showed little or no activity in the assay, as measured by NADH production.
- C. crescentus D-xylose dehydrogenase can convert D-xylose to D- xyionate directly.
- the D-Xylose dehydrogenase is from the halophilic archaeon Haloferax volcanii.
- the Haloferax vo!canii D-Xyiose dehydrogenase catalyzes the first reaction in the oxidative xylose degradation pathway of the halophilic archaeon Haloferax volcanii.
- volcanii D-Xyiose dehydrogenase shows 59% amino acid sequence identity to a functionally characterized xylose dehydrogenase from Haloarcuia marismortui and 56% identity to an ortholog in Ha!orubrum lacusprofundi, but is only 1 1 % identical to the bacterial NAD+-dependent xylose dehydrogenase from Caulobacter crescentus CB15.
- the enzyme converts D-xylose to D- xyionolactone.
- the D-Xyiose dehydrogenase is from Caulobacter crescentus.
- the D-Xylose dehydrogenase is encoded by the xy!B gene.
- the D-Xylose dehydrogenase is from Ha!oferax vo!canii.
- the D-Xylose dehydrogenase is from Haloarcula marismortui.
- the D-Xylose dehydrogenase is from Ha!oruhrum !acusprofundi.
- the D-Xylose dehydrogenase is encoded by the xdh gene.
- the xylose dehydrogenase is encoded by one or more nucleic acid molecules obtained from a microorganism selected from the group consisting of Caulobacter sp., Haloarcula sp., Haloferax sp., Haiorubrum sp. and Trichoderma sp.
- the xylose dehydrogenase is encoded by one or more nucleic acid molecules obtained from a microorganism selected from the group consisting of Caulobacter crescentus, Haloarcula marismortui, Haloferax vo!canii, Haiorubrum lacusprofundi and Trichoderma reesei.
- the one or more nucleic acid molecules encoding the xylose dehydrogenase is selected from xy!B, xdhl (HVO__B0028) and/or xydl , or homolog thereof, in a further embodiment, the one or more nucleic acid molecules encoding the xylose dehydrogenase comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 81 , 63 and 65. in yet another embodiment, the one or more nucleic acid molecules encoding the xylose dehydrogenase is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 59, 60, 62 and 84.
- This enzyme belongs to the family of hydrolases, specifically those acting on carboxyiic ester bonds. This enzyme participates in pentose and giucuronate interconversions.
- Xyionoiactonase may also be known as D-xylonoiactonase, xyiono-1 ,4- lactonase, xyiono-gamma-lactonase or D-xylono-1 , 4-lactone lactonohydrolase.
- the enzyme converts D-xylonoiactone to D- xylonate.
- the D-xyionolactonase is from Haloferax sp.
- the D-xylonolactonase is from Haloferax voicanii.
- the D-xylonolactonase is from Haloferax gibbonsii. in some embodiments, the D-xylonoiactonase is from Caulobacier crescenius. In some embodiments, the D-xyionolactonase is encoded by the xyiC gene,
- the xylonolactonase is encoded by one or more nucleic acid molecules obtained from a microorganism selected from Caulobacier sp. and Haloferax sp. in another embodiment, the xylonolactonase is encoded by one or more nucleic acid molecules obtained from a microorganism selected from the group consisting of Caulobacier crescenius, Haloferax voicanii and Haloferax gibbonsii.
- the one or more nucleic acid molecules encoding the xylonolactonase is xyiC, or homoiog thereof, in a further embodiment, the one or more nucleic acid molecules encoding the xylonolactonase comprises an amino acid sequence set forth in SEQ ID NO: 87, In yet another embodiment, the one or more nucleic acid molecules encoding the xylonolactonase is encoded by a nucleic acid sequence set forth in SEQ ID NO: 66.
- This enzyme belongs to the family of lyases, specifically the hydro-iyases, which cleave carbon-oxygen bonds. This enzyme participates in pentose and glucuronate interconversions.
- Xylonate dehydratase may also be known as D-xylonate hydro-iyase, D- xylo-aidonate dehydratase or D-xylonafe dehydratase.
- the enzyme converts D-xylonate to 2-keto-3- deoxy-D-xyionate.
- the xylonate dehydratase is from Caulobacier crescenius.
- the xylonate dehydratase is encoded by the xylD gene.
- the xylonate dehydratase is from Escherichia coll.
- the xylonate dehydratase is encoded by the yjhG gene.
- the xylonate dehydratase is encoded by the yagF gene, in some embodiments, the xylonate dehydratase is from Haioferax voicanii, in some embodiments, the xylonate dehydratase is encoded by the xad gene. In some embodiments, the xylonate dehydratase is from Su!fo!obus so!fataricus.
- the xylonate dehydratase is encoded by one or more nucleic acid molecules obtained from a microorganism selected from the group consisting of Cau!obacter sp., Su!fo!obus sp. and £, co!i.
- the xylonate dehydratase is encoded by one or more nucleic acid molecules obtained from a microorganism selected from the group consisting of Caulobacier crescentus, Su!folobus so!fataricus and E. co!i.
- the one or more nucleic acid molecules encoding the xylonate dehydratase is selected from xylD, yjhG and/or yagF, or homolog thereof.
- the one or more nucleic acid molecules encoding the xylonate dehydratase comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 69, 72 and 75.
- the one or more nucleic acid molecules encoding the xylonate dehydratase is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 68, 70, 71 , 73 and 74.
- This enzyme belongs to the family of lyases, specifically the aldehyde- lyases, which cleave carbon-carbon bonds. This enzyme participates in pentose and glucuronate interconversions.
- 2-keto-3-deoxy-D-pentonate aldolase may also be known as 2-dehydro-3- deoxy-D-pentonate giycolaidehyde-iyase (pyruvate-forming), 2-dehydro-3-deoxy-D- pentonate aldolase, 3-deoxy-D-pentuiosonic acid aldolase, and 2-dehydro-3-deoxy- D-pentonate giycoiaidehyde-iyase.
- YjhH appears to be a 2-dehydro-3-deoxy-D-pentonate aldolase. Genetic evidence suggests that YagE may also function as a 2-dehydro ⁇ 3-deoxy-D- pentonate aldolase. yagE is part of the prophage CP4-6.
- a yjhH yagE double mutant cannot use D-xylonate as the sole source of carbon, and crude cell extracts do not contain 2-dehydro-3-deoxy-D-pentonate aldolase activity. Both phenotypes are complemented by providing yjhH on a piasmid.
- ArcA appears to activate yjhH gene expression under anaerobiosis. Two putative ArcA binding sites were identified 21 1 and 597 bp upstream of this gene, but no promoter upstream of it has been identified.
- the enzyme converts 2-keto-3-deoxy-xylonate to glycolaldehyde and pyruvate.
- the 2-keto-3-deoxy-D- pentonate aldolase is from Pseudomonas sp.
- the 2 ⁇ keto-3- deoxy-D-pentonate aldolase is from Escherichia co!i.
- the 2- keto-3-deoxy-D-pentonate aldolase is encoded by the yjhH gene.
- the 2-keto-3-deoxy-D-pentonate aldolase is encoded by the yagE gene
- the 2-keto-3-deoxy-D-pentonate aldolase is encoded by one or more nucleic acid molecules obtained from a microorganism selected from Pseudomonas sp. and E. coii.
- the 2-keto-3-deoxy-D- pentonate aldolase is encoded by one or more nucleic acid molecules obtained from E, coii.
- the one or more nucleic acid molecules encoding the 2-keto-3-deoxy-D-pentonate aldolase is selected from yjhH and/or yagE, or homo!og thereof.
- the one or more nucleic acid molecules encoding the 2-keto-3-deoxy-D-pentonate aldolase comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 78 and 81.
- the one or more nucleic acid molecules encoding the 2-keto-3-deoxy- D-pentonate aldolase is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 76, 77, 79 and 80.
- Gfycolajdehyde dehydrogenase (1.2.1.21 )
- This enzyme belongs to the family of oxidoreductases, specifically those acting on the aldehyde or oxo group of donor with NAD+ or NADP+ as acceptor. This enzyme participates in glyoxylate and dicarboxylate metabolism.
- Glycolaldehyde dehydrogenase may also be known as glycolaldehyde: AD+ oxidoreductase or glycol aldehyde dehydrogenase.
- aldehyde dehydrogenase A is an enzyme of relatively broad substrate specificity for small a-hydroxyaldehyde substrates, it is thus utilized in several metabolic pathways.
- L-fucose and L-rhamnose are metabolized through parallel pathways which converge after their corresponding aldolase reactions yielding the same products: dihydoxy-acetone phosphate and L-lactaldehyde. Aerobicaily, aldehyde dehydrogenase A oxidizes L-lactaldehyde to L-lactate.
- D-arabinose and L-xylose can be metabolized to dihydoxy-acetone phosphate and glycolaldehyde, which is oxidized to glycolate by aldehyde dehydrogenase A,
- Aldehyde dehydrogenase A is only present under aerobic conditions and is most highly induced by the presence of fucose, rhamnose or glutamate.
- the enzyme is inhibited by NADH, which may act as a switch to shift from oxidation of lactaldehyde to its reduction by propanediol oxidoreductase.
- AldA is upregulated during short-term adaptation to glucose limitation.
- AldA was predicted to be a succinate- semialdehyde dehydrogenase.
- Regulation of aldA expression has been investigated. The gene is regulated by catabolite repression, repression under anaerobic conditions via ArcA, and induction by the carbon source.
- the enzyme converts glycolaldehyde to glycoiate.
- the glycolaldehyde dehydrogenase is from Escherichia coli. in some embodiments, the glycolaldehyde dehydrogenase is encoded by the aldA gene.
- a recombinant microorganism producing MEG and a three-carbon compound comprises a deletion, insertion, or loss of function mutation in a gene encoding a glycolaldehyde dehydrogenase to prevent the production of glycolic acid from glycolaldehyde and instead shunt the reaction toward conversion of glycolaldehyde to MEG.
- Lactate dehydrogenase is an enzyme found in nearly ail living cells such as in animals, plants and prokaryotes. LDH catalyzes the conversion of lactate to pyruvic acid and back, as it converts NADH to NAD+ and back.
- a dehydrogenase is an enzyme that transfers a hydride from one molecule to another.
- LDH exist in four distinct enzyme classes. The most common one is NAD(P)-dependent L-iactate dehydrogenase. Other LDHs act on D-lactate and/or are dependent on cytochrome c: D-iactate dehydrogenase (cytochrome) and L- lactate dehydrogenase (cytochrome).
- LDH has been of medical significance because it is found extensively in body tissues, such as blood cells and heart muscle. Because it is released during tissue damage, it is a marker of common injuries and disease such as heart failure.
- Lactate dehydrogenase may also be known as lactic acid dehydrogenase, (R)-lactate:NAD+ oxidoreductase or D-iactate dehydrogenase— fermentative.
- lactate dehydrogenase (LdhA) is a solubie NAD-iinked lactate dehydrogenase (LDH) that is specific for the production of D-lactate.
- LdhA is a homotetramer and shows positive homotropic cooperativity under higher pH conditions.
- E, coli contains two other lactate dehydrogenases: D ⁇ lactate dehydrogenase and L-lactate dehydrogenase. Both are membrane-associated flavoproteins required for aerobic growth on lactate.
- LdhA is present under aerobic conditions but is induced when E. coli is grown on a variety of sugars under anaerobic conditions at acidic pH. Unlike most of the genes involved in anaerobic respiration, IdhA is not activated by Fnr; rather the ArcAB system and several genes involved in the control of carbohydrate metabolism (csrAB and mlc) appear to regulate expression. The expression of IdhA is negatively affected by the transcriptional regulator ArcA. IdhA belongs to the ⁇ 32 regulon.
- the IdhA gene is a frequent target for mutations in metabolic engineering, most often to eliminate production of undesirable fermentation side products, but also to specifically produce D-iactate.
- the enzyme converts pyruvate to lactate.
- the lactate dehydrogenase is from Escherichia co!i.
- the lactate dehydrogenase is encoded by the IdhA gene.
- a recombinant microorganism producing MEG and a three-carbon compound comprises a deletion, insertion, or loss of function mutation in a gene encoding a lactate dehydrogenase to prevent the production of lactate from pyruvate and instead shunt the reaction toward production of a three- carbon compound.
- the present disclosure describes enzymes that can catalyze the lowing reactions:
- Aldose reductase may also be known as alditol:NAD(P)+ 1- oxidoreductase, poiyol dehydrogenase or aldehyde reductase.
- Aldose reductase is a cytosolic oxidoreductase that catalyzes the reduction of a variety of aldehydes and carbonyis, including monosaccharides.
- Aldose reductase may be considered a prototypical enzyme of the aldo- keto reductase enzyme superfamily.
- the enzyme comprises 315 amino acid residues and folds into a ⁇ / ⁇ -barrel structural motif composed of eight parallel ⁇ strands. Adjacent strands are connected by eight peripheral a-helical segments running anti-parallel to the ⁇ sheet.
- the catalytic active site is situated in the barrel core.
- the NADPH cofactor is situated at the top of the ⁇ / ⁇ barrel, with the nicotinamide ring projecting down in the center of the barrel and pyrophosphate straddling the barrel lip.
- the reaction mechanism of aldose reductase in the direction of aldehyde reduction follows a sequential ordered path where NADPH binds, followed by the substrate. Binding of NADPH induces a conformational change (Enzyme « NADPH -> Enzyme**NADPH) that involves hinge-like movement of a surface loop (residues 213-217) so as to cover a portion of the NADPH in a manner similar to that of a safety belt.
- the alcohol product is formed via a transfer of the pro-R hydride of NADPH to the face of the substrate's carbonyl carbon.
- D-xylose-fermenting Pichia stipitis and Candida shehatae were shown to produce one single aldose reductase (ALR) that is active both with NADPH and NADH.
- ALR aldose reductase
- Other yeasts such as Pachysolen tannophiius and C. tropica!is synthesize multiple forms of ALR with different coenzyme specificities. The significant dual coenzyme specificity distinguishes the P. stipitis and the C. shehatae enzymes from most other ALRs so far isolated from mammalian or microbial sources.
- the yeast Candida tenuis CBS 4435 produces comparable NADH- and NADPH-linked aldehyde-reducing activities during growth on D-xylose.
- the enzyme converts D-xyiose to xylitol.
- the xylose reductase or aldose reductase is from Hypocrea jecorina.
- the xylose reductase or aldose reductase is encoded by the xyi1 gene.
- the xylose reductase or aldose reductase is from Saccharomyces cerevisiae.
- the xylose reductase or aldose reductase is encoded by the GRE3 gene.
- the xylose reductase or aldose reductase is from Pachysoien tannophi!us. In some embodiments, the xylose reductase or aldose reductase is from Pichia sp. In some embodiments, the xylose reductase or aldose reductase is from Pichia stipitis. In some embodiments, the xylose reductase or aldose reductase is from Pichia quercuum. In some embodiments, the xylose reductase or aldose reductase is from Candida sp.
- the xylose reductase or aldose reductase is from Candida shehatae. in some embodiments, the xylose reductase or aldose reductase is from Candida tenuis. In some embodiments, the xylose reductase or aldose reductase is from Candida tropicaiis. in some embodiments, the xylose reductase or aldose reductase is from Aspergiiius niger. In some embodiments, the xylose reductase or aldose reductase is from Neurospora crassa. In some embodiments, the xylose reductase or aldose reductase is from Cryptococcus iactativorus.
- the xylose reductase or aldose reductase is encoded by one or more nucleic acid molecules obtained from a microorganism selected from the group consisting of Hypocrea sp., Scheffersomyces sp., Saccharomyces sp., Pachysoien sp., Pichia sp., Candida sp. , Aspergiiius sp., Neurospora sp., and Cryptococcus sp.
- the xylose reductase or aldose reductase is encoded by one or more nucleic acid molecules obtained from a microorganism selected from the group consisting of Hypocrea jecorina, Scheffersomyces stipitis, Saccharomyces cerevisiae, Pachysoien tannophilus, Pichia stipitis, Pichia quercuum, Candida shehatae, Candida tenuis, Candida tropicaiis, Aspergiiius niger, Neurospora crassa and Cryptococcus Iactativorus.
- a microorganism selected from the group consisting of Hypocrea jecorina, Scheffersomyces stipitis, Saccharomyces cerevisiae, Pachysoien tannophilus, Pichia stipitis, Pichia quercuum, Candida shehatae, Candida tenuis, Candida tropicaiis, Aspergiiius niger, Neurospora cra
- the one or more nucleic acid molecules encoding the xylose reductase or aldose reductase is xyi1 and/or GRE3 or homoiog thereof.
- the one or more nucleic acid molecules encoding the xylose reductase or aldose reductase comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 84 and 87,
- the one or more nucleic acid molecules encoding the xylose reductase or aldose reductase is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 82, 83, 85 and 86.
- the present disclosure describes enzymes that can catalyze the following
- Xylitoi dehydrogenase may also be known as D-xyiuiose reductase, NAD+-dependenf xylitoi dehydrogenase, erythritoi dehydrogenase, 2,3-cis- poiyoi(DPN) dehydrogenase (C3-5), pentitol-DPN dehydrogenase, xylitol-2- dehydrogenase or xylitoi: NAD+ 2-oxidoreductase (D-xylulose-forming).
- Xylitoi dehydrogenase is one of several enzymes responsible for assimilating xylose into eukaryotic metabolism and is useful for fermentation of xylose contained in agricultural byproducts to produce ethanol.
- cosubsfrates should be recycled between the NAD+- specific XDH and the NADPH-preferring xylose reductase, another enzyme in the pathway,
- the enzyme converts xylitoi to D-xylulose.
- the xylitoi dehydrogenase is from yeast, in some embodiments, the xylitoi dehydrogenase is from Pichia sp., Saccharomyces sp., Giuconobacter sp., Galaciocandida sp., Neurospora sp. or Serratia sp.
- the xylitoi dehydrogenase is from Pichia stipitis, S.
- the xylitoi dehydrogenase is encoded by xy!2 or dhl
- the xylitoi dehydrogenase is encoded by one or more nucleic acid molecules obtained from a microorganism selected from the group consisting of Scheffersomyces sp., Trichoderma sp., Pichia sp., Saccharomyces sp., Gluconobacter sp., Galactocandida sp., Neurospora sp., and Serratia sp.
- the xylitoi dehydrogenase is encoded by one or more nucleic acid molecules obtained from a microorganism selected from the group consisting of Scheffersomyces stipitis, Trichoderma reesei, Pichia stipitis, Saccharomyces cerevisiae, Gluconobacter oxydans, Galactocandida mastoiermitis, Neurospora crassa and Serratia marcescens.
- the one or more nucleic acid molecules encoding the xylitoi dehydrogenase is xy!2 and/or xdhl , or homoiog thereof.
- the one or more nucleic acid moiecuies encoding the xylitoi dehydrogenase comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 90 and 92. In some embodiments, the one or more nucleic acid molecules encoding the xylitoi dehydrogenase is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 88, 89 and 91.
- Alkaline phosphatase is a hydrolase enzyme responsible for removing phosphate groups from many types of moiecuies, including nucleotides, proteins, and alkaloids. As the name suggests, alkaline phosphatases are most effective in an alkaline environment, it is sometimes used synonymously as basic phosphatase.
- the S. cerevisiae Pho13 alkaline phosphatase enzyme is a monomeric protein with molecular mass of 60 kDa and hydroiyzes p-nitrophenyl phosphate with maximal activity at pH 8.2 with strong dependence on Mg2+ ions and an apparent Km of 3.8 x 10(-5) M. No other substrates tested except phosphorylated histone ii-A and casein were hydrolyzed at any significant rate. These data suggest that the physiological role of the p-nitrophenyi phosphate-specific phosphatase may involve participation in reversible protein phosphorylation.
- the enzyme converts D-xylulose-5-phosphate to D-xyluiose.
- the alkaline phosphatase is from yeast.
- the alkaline phosphatase is from Saccharomyces sp.
- the alkaline phosphatase is from S. cerevisiae.
- the alkaline phosphatase is encoded by the PH013 gene,
- a recombinant microorganism producing MEG and a three-carbon compound comprises a deletion, insertion, or loss of function mutation in a gene encoding an alkaline phosphatase to prevent the conversion of D- xylulose-5 ⁇ phosphate to D-xylulose.
- Soluble pyridine nucleotide transhydrogenase (EC 1.6.1.1.)
- Soluble pyridine nucleotide transhydrogenase may also be known as NAD(P)+ transhydrogenase (B-specific), STH, pyridine nucleotide transhydrogenase, or transhydrogenase.
- E. coii contains both a soluble and a membrane-bound pyridine nucleotide transhydrogenase.
- the soluble pyridine nucleotide transhydrogenase is the sthA or udhA gene product; its primary physiological role appears to be the reoxidation of NADPH (Canonaco F. et al. (2001) Metabolic flux response to phosphoglucose isomerase knock-out in Escherichia coii and impact of overexpression of the soluble transhydrogenase UdhA.
- the soluble and membrane-bound transhydrogenases UdhA and PntAB have divergent functions in NADPH metabolism of Escherichia coii, J Biol Chem 279(8): 8813-6619).
- the membrane-bound proton-translocating transhydrogenase is the pntAB gene product; PntAB is a major source of NADPH (Sauer et al. 2004).
- UdhA contains noncovalently bound FAD and is present in a form consisting of seven or eight monomers (Boonstra B. et al. (1999) The udhA gene of Escherichia coii encodes a soluble pyridine nucleotide transhydrogenase. J Bacterioi 181 (3): 1030-1034).
- expression of a transhydrogenase can increase activity of a NADPH-dependent alcohol dehydrogenase, leading to improved acetone to 2 ⁇ propanol conversion
- the soluble pyridine nucleotide transhydrogenase is encoded by one or more nucleic acid molecules obtained from E, coii. in another embodiment, the one or more nucleic acid molecules encoding the soluble pyridine nucleotide transhydrogenase is udhA, or homoiog thereof, in some embodiments, the one or more nucleic acid molecules encoding the soluble pyridine nucleotide transhydrogenase comprises an amino acid sequence set forth in SEQ ID NO: 1 10. In some embodiments, the one or more nucleic acid molecules encoding the soluble pyridine nucleotide transhydrogenase is encoded by a nucleic acid sequence set forth in SEQ ID NO: 109.
- the present application provides a recombinant microorganism co-producing monoethyiene glycol (MEG) and one or more three- carbon compounds.
- the MEG and one or more three-carbon compounds are co-produced from xylose
- the recombinant microorganism comprises a deletion, insertion, or loss of function mutation in a gene encoding a D-xyiulose-5 ⁇ kinase and/or in a gene encoding a glycoaidehyde dehydrogenase
- the gene encoding the D-xylulose-5-kinase is xylB.
- the gene encoding the glycoaidehyde dehydrogenase is aidA.
- MEG is produced from xylose via ribulose-1- phosphate. In another embodiment, MEG is produced from xylose via xylulose-1- phosphate. In a further embodiment, MEG is produced from xylose via xyionate. [00434] in one embodiment, one or more three-carbon compounds is produced from DHAP or pyruvate. In one embodiment, the one or more three-carbon compounds is acetone. In another embodiment, the one or more three-carbon compounds is isopropanol. in a further embodiment, the one or more three-carbon compounds is propene.
- MEG and one or more three-carbon compounds are produced from xylose using a ribuiose-1-phosphate pathway for the conversion of xylose to MEG and dihydroxyacetone-phosphafe (DHAP), and using a C3 branch pathway for the conversion of DHAP to one or more three-carbon compounds.
- a ribuiose-1-phosphate pathway for the conversion of xylose to MEG and dihydroxyacetone-phosphafe (DHAP)
- DHAP dihydroxyacetone-phosphafe
- the present disclosure relates to a recombinant microorganism capable of co-producing monoethy!ene glycol (MEG) and acetone from exogenous D-xylose, wherein the recombinant microorganism expresses one or more of the following:
- the produced intermediate DHAP is converted to acetyl-CoA through the endogenous glycolysis pathway in the microorganism, and wherein MEG and acetone are co-produced.
- the D-tagatose 3-epimerase is encoded by one or more nucleic acid molecules obtained from a microorganism selected from the group consisting of Pseudomonas sp., Mesorhizobium sp. and Rhodobacter sp.
- the D-tagatose 3-epimerase is encoded by one or more nucleic acid molecules obtained from a microorganism selected from the group consisting of Pseudomonas cichorii, Pseudomonas sp. ST-24, Mesorhizobium ioti and Rhodobacter sphaeroides.
- the one or more nucleic acid molecules is dte and/or FJ851309.1 , or homoiog thereof.
- the D-tagatose 3-epimerase comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 3 and 5.
- the D- tagatose 3-epimerase is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1 , 2 and 4.
- the D-ribulokinase is encoded by one or more nucleic acid molecules obtained from E. coii. in some embodiments, the one or more nucleic acid molecules is fucK, or homoiog thereof. In a further embodiment, the D- ribulokinase comprises an amino acid sequence set forth in SEQ ID NO: 8. In yet a further embodiment, the D-ribuiokinase is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 6 and 7.
- the D-ribulose-1-phosphate aldolase is encoded by one or more nucleic acid molecules obtained from E, coii. In some embodiments, the one or more nucleic acid molecules is fucA, or homoiog thereof. In a further embodiment, the D-ribulose-1-phosphate aldolase comprises an amino acid sequence set forth in SEQ ID NO: 1 1. In yet a further embodiment, the D-ribulose-1- phosphate aldolase is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 9 and 10.
- the recombinant microorganism further comprises at least one endogenous or exogenous nucleic acid molecule encoding a secondary alcohol dehydrogenase that catalyzes the conversion of acetone from (g) to isopropanoi.
- the recombinant microorganism further comprises at least one endogenous or exogenous nucleic acid molecule encoding a dehydratase that catalyzes the conversion of isopropanoi to propene.
- the recombinant microorganism further comprises one or more modifications selected from the group consisting of:
- an endogenous D-xylose isomerase catalyzes the conversion of D-xylose to D-xyiuiose.
- the xylose isomerase is exogenous.
- the xylose isomerase is encoded by one or more nucleic acid molecules obtained from Pyromyces sp.
- the one or more nucleic acid molecules encoding the xylose isomerase is xylA, or homolog thereof.
- the one or more nucleic acid molecules encoding the xylose isomerase comprises an amino acid sequence set forth in SEQ ID NO: 95.
- the one or more nucleic acid molecules encoding the xylose isomerase is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 93 and 94.
- MEG and acetone are co-produced from xylose using a xylulose-1 -phosphate pathway for the conversion of xylose to MEG and a C3 branch pathway for the conversion of dihydroxyacetone-phosphate (DHAP) to acetone.
- DHAP dihydroxyacetone-phosphate
- the present disclosure relates to a recombinant microorganism capable of co-producing monoethyiene glycol (MEG) and acetone from exogenous D-xylose, wherein the recombinant microorganism expresses one or more of the following:
- the D-xyiulose 1-kinase is encoded by one or more nucleic acid moiecuies obtained from Homo sapiens, in some embodiments, the one or more nucleic acid molecules encoding the D-xylulose 1-kinase is ketohexokinase C (khk-C), or homolog thereof, in another embodiment, the one or more nucleic acid molecules encoding the D-xyiuiose 1-kinase comprises an amino acid sequence set forth in SEQ ID NO: 55. In a further embodiment, the one or more nucleic acid moiecuies encoding the D-xylulose 1-kinase is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 53 and 54.
- the D-xylulose-1-phosphafe aldolase is encoded by one or more nucleic acid moiecuies obtained from Homo sapiens.
- the one or more nucleic acid molecules encoding the D-xylulose-1- phosphate aldolase is aldolase B (ALDOB), or homolog thereof.
- the one or more nucleic acid moiecuies encoding the D-xylulose-1- phosphate aldolase comprises an amino acid sequence set forth in SEQ ID NO: 58.
- the one or more nucleic acid molecules encoding the D- xylulose-1 -phosphate aldolase is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 56 and 57.
- the recombinant microorganism further comprises at least one endogenous or exogenous nucleic acid molecule encoding a secondary alcohol dehydrogenase that catalyzes the conversion of acetone from (f) to isopropanoi.
- the recombinant microorganism further comprises at least one endogenous or exogenous nucleic acid molecule encoding a dehydratase-isomerase that catalyzes the conversion of isopropanoi to propene.
- the recombinant microorganism further comprises one or more modifications selected from the group consisting of:
- a recombinant microorganism producing MEG and one or more three-carbon compounds comprises a deletion, insertion, or loss of function mutation in a gene encoding a D- xylulose-5-kinase to prevent the conversion of D-xylulose to D-xyiu!ose-5-phosphate and instead shunt the reaction toward conversion of D-xylulose to D-xylulose-1- phosphate.
- the D-xyluiose-5-kinase is from Escherichia co/7.
- the D-xyluiose-5-kinase is encoded by the xylB gene, or homoiog thereof.
- a recombinant microorganism producing MEG and one or more three-carbon compounds comprises a deletion, insertion, or loss of function mutation in a gene encoding a glycolaldehyde dehydrogenase to prevent the production of giycolic acid from glycolaldehyde and instead shunt the reaction toward conversion of glycolaldehyde to MEG.
- the glycolaldehyde dehydrogenase is from Escherichia co!i.
- the glycolaldehyde dehydrogenase is encoded by the aidA gene, or homoiog thereof.
- a recombinant microorganism producing MEG and one or more three-carbon compounds comprises a deletion, insertion, or loss of function mutation in a gene encoding a lactate dehydrogenase to prevent the production of lactate from pyruvate and instead shunt the reaction toward production of one or more three-carbon compounds.
- the lactate dehydrogenase is from Escherichia coli.
- the lactate dehydrogenase is encoded by the IdhA gene, or homoiog thereof.
- an endogenous D-xylose isomerase catalyzes the conversion of D-xylose to D-xyiulose.
- the xylose isomerase is exogenous.
- the xylose isomerase is encoded by one or more nucleic acid molecules obtained from Pyromyces sp.
- the one or more nucleic acid molecules encoding the xylose isomerase is xy!A, or homolog thereof.
- the one or more nucleic acid molecules encoding the xylose isomerase comprises an amino acid sequence set forth in SEQ ID NO: 95.
- the one or more nucleic acid molecules encoding the xylose isomerase is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 93 and 94.
- the present application relates to a recombinant microorganism capable of co-producing monoethylene glycol (MEG) and acetone from exogenous D-xylose and glucose, wherein the recombinant microorganism expresses one or more of the following:
- the produced intermediate DHAP is converted to acetyl-CoA through the endogenous glycolysis pathway in the microorganism, and wherein MEG and acetone are co-produced.
- the xylose reductase or aldose reductase is encoded by one or more nucleic acid molecules obtained from a microorganism selected from the group consisting of Hypocrea sp., Scheffersomyces sp., Saccharomyces sp., Pachysolen sp,, Pichia sp., Candida sp., Aspergillus sp., Neurospora sp., and Cryptococcus sp.
- the xylose reductase or aldose reductase is encoded by one or more nucleic acid molecules obtained from a microorganism selected from the group consisting of Hypocrea jecorina, Scheffersomyces stipitis, Saccharomyces cerevisiae, Pachysolen tannophiius, Pichia stipitis, Pichia quercuum, Candida shehatae, Candida tenuis, Candida tropicaiis, Aspergillus niger, Neurospora crassa and Cryptococcus lactativorus.
- the one or more nucleic acid molecules encoding the xylose reductase or aldose reductase is xyi1 and/or GRE3 or homoiog thereof.
- the one or more nucleic acid molecules encoding the xylose reductase or aldose reductase comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 84 and 87.
- the one or more nucleic acid molecules encoding the xylose reductase or aldose reductase is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 82, 83, 85 and 88.
- the xylitoi dehydrogenase is encoded by one or more nucleic acid molecules obtained from a microorganism selected from the group consisting of Scheffersomyces sp., Trichoderma sp., Pichia sp., Saccharomyces sp., G!uconobacter sp., Galactocandida sp., Neurospora sp., and Serratia sp.
- the xylitoi dehydrogenase is encoded by one or more nucleic acid moiecuies obtained from a microorganism selected from the group consisting of Scheffersomyces stipitis, Trichoderma reesei, Pichia stipitis, Saccharomyces cerevisiae, Giuconobacter oxydans, Galactocandida mastoiermitis, Neurospora crassa and Serratia marcescens.
- the one or more nucleic acid molecules encoding the xylitoi dehydrogenase is xyl2 and/or xdhl , or homo!og thereof.
- the one or more nucleic acid moiecuies encoding the xylitoi dehydrogenase comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 90 and 92. In some embodiments, the one or more nucleic acid molecules encoding the xylitoi dehydrogenase is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 88, 89 and 91.
- an endogenous D-xyiose isomerase catalyzes the conversion of D-xylose to D-xyiuiose.
- the xylose isomerase is exogenous.
- the xylose isomerase is encoded by one or more nucleic acid molecules obtained from Pyromyces sp.
- the one or more nucleic acid molecules encoding the xylose isomerase is xy!A, or homo!og thereof.
- the one or more nucleic acid moiecuies encoding the xylose isomerase comprises an amino acid sequence set forth in SEQ ID NO: 95.
- the one or more nucleic acid molecules encoding the xylose isomerase is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 93 and 94.
- the recombinant microorganism further comprises at least one endogenous or exogenous nucleic acid molecule encoding a secondary alcohol dehydrogenase that catalyzes the conversion of acetone from (i) to isopropanoi.
- the recombinant microorganism further comprises at least one endogenous or exogenous nucleic acid molecule encoding a dehydratase that catalyzes the conversion of isopropanoi to propene.
- the recombinant microorganism further comprises one or more modifications selected from the group consisting of:
- the enzyme that catalyzes the conversion of D- xylulose to D-xylulose-5-phosphate is a D-xylulose-5-kinase.
- the D-xyiulose-5 ⁇ kinase is from Saccharomyces cerevisiae.
- the D-xylulose-5-kinase is encoded by the XKS1 gene, or homolog thereof.
- the D-xy!u!ose-5-kinase is from Pichia siipitis.
- the D-xyiuiose-5-kinase is encoded by the XYL3 gene, or homolog thereof.
- the microorganism is a fungus.
- MEG and acetone are co-produced from xylose using a xyionate pathway for the conversion of xylose to MEG and a C3 branch pathway for the conversion of dihydroxyacetone-phosphate (DHAP) to acetone.
- DHAP dihydroxyacetone-phosphate
- the present application relates to a recombinant microorganism capable of co-producing monoethyiene glycol (MEG) and acetone from exogenous D-xyiose, wherein the recombinant microorganism expresses one or more of the following:
- the xylose dehydrogenase is encoded by one or more nudeic acid molecules obtained from a microorganism selected from the group consisting of Caulobacter sp,, Haloarcula sp,, Haloferax sp., Ha!orubrum sp. and Trichoderma sp. in another embodiment, the xylose dehydrogenase is encoded by one or more nucleic acid molecules obtained from a microorganism selected from the group consisting of Caulobacter crescentus, Haloarcula marismortui, Haloferax volcanii, Halorubrum lacusprofundi and Trichoderma reesei.
- the one or more nudeic acid molecules encoding the xylose dehydrogenase is selected from xylB, xdhl (HVO__B0028) and/or xydl or homolog thereof.
- the one or more nucleic acid molecules encoding the xylose dehydrogenase comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 61 , 63 and 65.
- the one or more nucleic acid molecules encoding the xylose dehydrogenase is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 59, 60, 62 and 64.
- the xylonoiactonase is encoded by one or more nucleic acid molecules obtained from a microorganism selected from Caulobacier sp. and Ha!oferax sp. in another embodiment, the xylonoiactonase is encoded by one or more nucleic acid molecules obtained from a microorganism selected from the group consisting of Caulobacier crescenius, Haloferax volcanil and Haioferax gibbonsil. in some embodiments, the one or more nucleic acid molecules encoding the xylonoiactonase is xyiC, or homolog thereof.
- the one or more nucleic acid molecules encoding the xylonoiactonase comprises an amino acid sequence set forth in SEQ ID NO: 67. In yet another embodiment, the one or more nucleic acid molecules encoding the xylonoiactonase is encoded by a nucleic acid sequence set forth in SEQ ID NO: 66.
- the xylonafe dehydratase is encoded by one or more nucleic acid molecules obtained from a microorganism selected from the group consisting of Caulobacier sp., Sulfolobus sp. and E. coli.
- the xylonate dehydratase is encoded by one or more nucleic acid molecules obtained from a microorganism selected from the group consisting of Caulobacier crescentus., Sulfolobus solfaiaricus and E. coli.
- the one or more nucleic acid molecules encoding the xylonate dehydratase is selected from xylD, yjhG and/or yagF, or homolog thereof.
- the one or more nucleic acid molecules encoding the xylonate dehydratase comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 69, 72 and 75.
- the one or more nucleic acid molecules encoding the xylonate dehydratase is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 68, 70, 71 , 73 and 74.
- the 2-keto-3-deoxy-D-pentonate aldolase is encoded by one or more nucleic acid molecules obtained from a microorganism selected from Pseudomonas sp. and E, co!i.
- the 2-keto-3-deoxy-D- pentonate aldolase is encoded by one or more nucleic acid molecules obtained from E. co!i.
- the one or more nucleic acid molecules encoding the 2 ⁇ keto-3-deoxy-D-pentonafe aldolase is selected from yjhH and/or yagE, or homolog thereof.
- the one or more nucleic acid molecules encoding the 2-keto-3-deoxy-D-pentonate aldolase comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 78 and 81.
- the one or more nucleic acid molecules encoding the 2-keto-3-deoxy- D-pentonafe aldolase is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 76, 77, 79 and 80.
- the recombinant microorganism further comprises at least one endogenous or exogenous nucleic acid molecule encoding a secondary alcohol dehydrogenase that catalyzes the conversion of acetone from (h) to isopropanoi.
- the recombinant microorganism further comprises at least one endogenous or exogenous nucleic acid molecule encoding a dehydratase that catalyzes the conversion of isopropanoi to propene.
- the recombinant microorganism further comprises one or more modifications selected from the group consisting of:
- a recombinant microorganism producing MEG and one or more three-carbon compounds comprises a deletion, insertion, or loss of function mutation in a gene encoding a D-xylose isomerase to prevent conversion of D-xyiose to D-xyiuiose and instead shunt the reaction toward the conversion of D- xyiose to D-xyionate.
- the enzyme that catalyzes the conversion of D-xylose to D-xylulose is a D-xyiose isomerase.
- the D- xylose isomerase is from Escherichia co/7, in some embodiments, the D-xylose isomerase is encoded by the xylA gene, or homolog thereof.
- a recombinant microorganism producing MEG and one or more three-carbon compounds comprises a deletion, insertion, or loss of function mutation in a gene encoding a glycolaldehyde dehydrogenase to prevent the production of g!ycolic acid from glycolaldehyde and instead shunt the reaction toward conversion of glycolaldehyde to MEG.
- the glycolaldehyde dehydrogenase is from Escherichia coli.
- the glycolaldehyde dehydrogenase is encoded by the aidA gene, or homolog thereof.
- a recombinant microorganism producing MEG and one or more three-carbon compounds comprises a deletion, insertion, or loss of function mutation in a gene encoding a lactate dehydrogenase to prevent the production of lactate from pyruvate and instead shunt the reaction toward production of one or more three-carbon compounds.
- the enzyme that catalyzes the conversion of pyruvate to lactate is a lactate dehydrogenase.
- the enzyme converts pyruvate to lactate, in some embodiments, the lactate dehydrogenase is from Escherichia coii.
- the lactate dehydrogenase is encoded by the IdhA gene, or homolog thereof.
- the present application relates to a recombinant microorganism capable of co-producing monoethyiene glycol (MEG) and acetone from exogenous D-xylose, wherein the recombinant microorganism expresses one or more of the following: (a) at least one endogenous or exogenous nucleic acid molecule encoding a xylose dehydrogenase that catalyzes the conversion of D- xylose to D-xylonate;
- the xylose dehydrogenase is encoded by one or more nucleic acid molecules obtained from a microorganism selected from the group consisting of Caulobacter sp,, Haloarcula sp,, Haloferax sp., Ha!orubrum sp. and Trichoderma sp. in another embodiment, the xylose dehydrogenase is encoded by one or more nucleic acid molecules obtained from a microorganism selected from the group consisting of Caulobacter crescentus, Haloarcula marismortui, Haloferax volcanii, Halorubrum lacusprofundi and Trichoderma reesei.
- the one or more nucleic acid molecules encoding the xylose dehydrogenase is selected from xylB, xdhl (HVO__B0028) and/or xydl or homolog thereof.
- the one or more nucleic acid molecules encoding the xylose dehydrogenase comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 61 , 63 and 65.
- the one or more nucleic acid molecules encoding the xylose dehydrogenase is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 59, 60, 62 and 64.
- the xyionate dehydratase is encoded by one or more nucleic acid molecules obtained from a microorganism selected from the group consisting of Cau!obacter sp., Su!fo!obus sp. and E. co!i. in another embodiment, the xyionate dehydratase is encoded by one or more nucleic acid molecules obtained from a microorganism selected from the group consisting of Cau!obacter crescentus, Sulfolobus solfaiaricus and E. co!i.
- the one or more nucleic acid molecules encoding the xyionate dehydratase is selected from xy!D, yjhG and/or yagF, or homolog thereof.
- the one or more nucleic acid molecules encoding the xyionate dehydratase comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 69, 72 and 75.
- the one or more nucleic acid molecules encoding the xyionate dehydratase is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 68, 70, 71 , 73 and 74.
- the 2-keto-3-deoxy-D-pentonate aldolase is encoded by one or more nucleic acid molecules obtained from a microorganism selected from Pseudomonas sp. and E. co!i.
- the 2-keto-3-deoxy-D- pentonate aldolase is encoded by one or more nucleic acid molecules obtained from E. coli.
- the one or more nucleic acid molecules encoding the 2-keto-3-deoxy-D-pentonate aldolase is selected from yjhH and/or yagE, or homolog thereof.
- the one or more nucleic acid molecules encoding the 2-keto-3-deoxy-D-pentonate aldolase comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 78 and 81.
- the one or more nucleic acid molecules encoding the 2 ⁇ keto-3-deoxy- D-pentonate aldolase is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 76, 77, 79 and 80.
- the recombinant microorganism further comprises at least one endogenous or exogenous nucleic acid molecule encoding a secondary alcohol dehydrogenase that catalyzes the conversion of acetone from (g) to isopropanoi.
- the recombinant microorganism further comprises at least one endogenous or exogenous nucleic acid molecule encoding a dehydratase that catalyzes the conversion of isopropanoi to propene.
- the recombinant microorganism further comprises one or more modifications selected from the group consisting of:
- a recombinant microorganism producing MEG and one or more three-carbon compounds comprises a deletion, insertion, or loss of function mutation in a gene encoding a D-xyiose isomerase to prevent conversion of D-xylose to D-xylulose and instead shunt the reaction toward the conversion of D- xylose to D-xylonate.
- the enzyme that catalyzes the conversion of D-xyiose to D-xylulose is a D-xyiose isomerase.
- the D- xylose isomerase is from Escherichia coii.
- the D-xylose isomerase is encoded by the xylA gene, or homolog thereof.
- a recombinant microorganism producing MEG and one or more three-carbon compounds comprises a deletion, insertion, or loss of function mutation in a gene encoding a glycolaldehyde dehydrogenase to prevent the production of giycolic acid from glycolaldehyde and instead shunt the reaction toward conversion of glycoialdehyde to MEG.
- the giyco!aldehyde dehydrogenase is from Escherichia coii.
- the glycoialdehyde dehydrogenase is encoded by the aldA gene, or homolog thereof.
- a recombinant microorganism producing MEG and one or more three-carbon compounds comprises a deletion, insertion, or loss of function mutation in a gene encoding a lactate dehydrogenase to prevent the production of lactate from pyruvate and instead shunt the reaction toward production of one or more three-carbon compounds.
- the enzyme that catalyzes the conversion of pyruvate to lactate is a lactate dehydrogenase.
- the enzyme converts pyruvate to lactate, in some embodiments, the lactate dehydrogenase is from Escherichia coii.
- the lactate dehydrogenase is encoded by the IdhA gene, or homolog thereof.
- the glycoialdehyde reductase is encoded by one or more nucleic acid molecules obtained from a microorganism selected from E, coii and S. cerevisiae.
- the one or more nucleic acid molecules is selected from gldA, GRE2, GRE3, yqhD, ydjG, fucO, yafB (dkgB), and/or yqhE (dkgA), or homolog thereof, in another embodiment, the one or more nucleic acid molecules is yqhD. in some embodiments, the yqhD comprises a G149E mutation.
- the glycoialdehyde reductase comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 13, 15, 17, 20, 23, 25, 28, 30 and 32.
- the glycoialdehyde reductase is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 12, 14, 16, 18, 19, 21 , 22, 24, 26, 27, 29 and 31.
- the thioiase or acetyl coenzyme A acetyltransferase is encoded by one or more nucleic acid molecules obtained from a microorganism selected from the group consisting of Clostridium sp., Baciiius sp., E. coii, Saccharomyces sp. and Marinobacter sp.
- the thioiase or acetyl coenzyme A acetyltransferase is encoded by one or more nucleic acid molecules obtained from a microorganism selected from the group consisting of Ciostridium acetobutyiicum, Clostridium thermosaccharoiyticum, Baciiius cereus, E. coii, Saccharomyces cerevisiae and Marinobacter hydrocarbonoclasticus.
- the one or more nucleic acid molecules is thIA, atoB and/or ERG10, or homolog thereof, in a further embodiment, the thiolase or acetyl coenzyme A acety!transferase comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 35, 37 and 40. in yet a further embodiment, the thiolase or acetyl coenzyme A acetyitransferase is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 33, 34, 36, 38 and 39.
- the acetyl- CoA:acetoacetate-CoA transferase or acetate :acetoacetyl-CoA hydrolase is encoded by one or more nucleic acid molecules obtained from a microorganism selected from Clostridium sp. and £. coii.
- the acetyl-CoA:acetoacetate- CoA transferase or acetate:acetoacetyl-CoA hydrolase is encoded by one or more nucleic acid molecules obtained from E. coii.
- the one or more nucleic acid molecules encoding the acetyl ⁇ CoA:acetoacetafe-CoA transferase is atoA and/or atoD, or homolog thereof.
- the acetyi- CoA:acetoacetafe-CoA transferase or acetate :acetoacetyl-CoA hydrolase is encoded by one or more nucleic acid molecules obtained from Clostridium acetobutylicum.
- the one or more nucleic acid molecules encoding the acetate: acetoacetyl-CoA hydrolase is ctfA and/or ctfB, or homolog thereof.
- the acetyi-CoA:acetoacetate-CoA transferase or acetate :acetoacetyl-CoA hydrolase comprises an amino acid sequence selected from the group consisting of SEQ ID NQs: 43, 48, 97, 99, 101 and 103.
- the acety!-CoA:acetoacetate-CoA transferase or acetate: acetoacetyl-CoA hydrolase is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 41 , 42, 44, 45, 96, 98, 100 and 102.
- the acetoacetafe decarboxylase is encoded by one or more nucleic acid molecules obtained from a microorganism selected from the group consisting of Clostridium sp., Bacillus sp., Chromobacterium sp. and Pseudomonas sp.
- the acetoacetate decarboxylase is encoded by one or more nucleic acid molecules obtained from a microorganism selected from the group consisting of Clostridium acetobutylicum, Clostridium beijerinckii, Clostridium DCiulolyticum, Bacillus poiymyxa, Chromobacterium vioiaceum and Pseudomonas putida.
- the one or more nucleic acid molecules encoding the acetoacetate decarboxylase is adc, or homolog thereof.
- the acetoacetate decarboxylase comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 49 and 52.
- the acetoacetate decarboxylase is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 47, 48, 50 and 51.
- the enzyme that catalyzes the conversion of acetone to isopropanol is a secondary alcohol dehydrogenase (S-ADH).
- the enzyme is a secondary alcohol dehydrogenase that is encoded by a nucleic acid molecule obtained from a microorganism selected from Burkholderia sp, A!ca!igenes sp., Clostridium sp., Thermoanaerobacter sp., Phytomonas sp., Rhodococcus sp., Methanobacterium sp., Methanogenium sp.
- the nucleic acid molecule encoding the secondary alcohol dehydrogenase is obtained from a microorganism selected from Burkhoideria sp.
- the one or more nucleic acid molecule encoding secondary alcohol dehydrogenase is adh, adhB, EhAdhl , or homolog thereof.
- the S-ADH is predicted from homology and can be from Thermoanaerobacter mathranii, Micrococcus luteus, Nocardiopsis alba, Mycobacterium hassiacum, Helicobacter suis, Candida albicans, Candida parapsi!osis, Candida orthopsilosis, Candida metapsilosis, Grosmannia clavigera and Scheffersomyces stipitis.
- the alcohol dehydrogenase comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 108 and 108.
- the alcohol dehydrogenase is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 104, 105 and 107.
- microorganisms thai can be engineered to express various endogenous or exogenous enzymes.
- the recombinant microorganism is a eukaryotic microorganism.
- the eukaryotic microorganism is a yeast.
- the yeast is a member of a genus selected from the group consisting of Yarrowia, Candida, Saccharomyces, Pichia, Hansenuia, Kluyveromyces, issafchenkia, Zygosaccharomyces, Debaryomyces, Schizosaccharomyces, Pachysolen, Cryptococcus, Trichosporon, Rhodotorula, and Myxozyma.
- the recombinant microorganism is a prokaryotic microorganism.
- the prokaryotic microorganism is a member of a genus selected from the group consisting of Escherichia, Clostridium, Zymomonas, Salmonella, Rhodococcus, Pseudomonas, Bacillus, Lactobacillus, Enterococcus, Alcaligenes, Klebsiella, Paenibacilius, Arihrobacter, Corynebacterium, and Brevibacterium.
- the recombinant microorganism is used to produce monoethylene glycol (MEG) disclosed herein.
- MEG monoethylene glycol
- the present inventions provide a method of producing MEG and one or more three-carbon compounds using a recombinant microorganism described herein, in one embodiment, the method comprises cultivating the recombinant microorganism in a culture medium containing a feedstock providing a carbon source until MEG and one or more three-carbon compounds is produced. In a further embodiment, the MEG and one or more three- carbon compounds is recovered. Recovery can be by methods known in the art, such as distillation, membrane-based separation gas stripping, solvent extraction, and expanded bed adsorption, in an exemplary embodiment, the three carbon compound is selected from acetone, isopropanol, and propene.
- the feedstock comprises a carbon source
- the carbon source may be selected from sugars, glycerol, alcohols, organic acids, aikanes, fatty acids, lignoceiluiose, proteins, carbon dioxide, and carbon monoxide.
- the carbon source is a sugar.
- the sugar is D-xyiose.
- the sugar is selected from the group consisting of glucose, fructose, and sucrose.
- the present application provides a method of producing a recombinant microorganism that produces or accumulates MEG and one or more three-carbon compounds.
- the MEG and one or more three-carbon compounds are co-produced from xylose.
- a method of producing a recombinant microorganism that produces or accumulates MEG and one or more three-carbon compounds from exogenous D- xylose comprises introducing into the recombinant microorganism a deletion, insertion, or loss of function mutation in a gene encoding a D-xylulose-5-kinase and/or in a gene encoding a glycoaldehyde dehydrogenase.
- the gene encoding the D-xyiuiose-5-kinase is xyiB.
- the gene encoding the glycoaldehyde dehydrogenase is aidA.
- MEG is produced from xylose via ribulose-1- phosphate. In another embodiment, MEG is produced from xylose via xylulose-1- phosphate. In a further embodiment, MEG is produced from xylose via xylonate.
- one or more three-carbon compounds is produced from DHAP or pyruvate.
- the one or more three-carbon compounds is acetone.
- the one or more three-carbon compounds is isopropanol.
- the one or more three-carbon compounds is propene.
- the present disclosure provides a method of producing a recombinant microorganism that produces or accumulates MEG and acetone from exogenous D-xylose, comprising introducing into the recombinant microorganism and/or overexpressing one or more of the following:
- the produced intermediate DHAP is converted to acetyl-CoA through the endogenous glycolysis pathway in the microorganism, and wherein MEG and acetone are co-produced.
- the D-tagatose 3-epimerase is encoded by one or more nucleic acid molecules obtained from a microorganism selected from the group consisting of Pseudomonas sp., Mesorhizobium sp. and Rhodobacter sp.
- the D-tagatose 3-epimerase is encoded by one or more nucleic acid molecules obtained from a microorganism selected from the group consisting of Pseudomonas cichorii, Pseudomonas sp. ST-24, Mesorhizobium ioti and Rhodobacter sphaeroides.
- the one or more nucleic acid molecules is dte and/or FJ851309.1 , or homoiog thereof.
- the D-tagatose 3-epimerase comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 3 and 5.
- the D- tagatose 3-epimerase is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: , 2 and 4.
- the D-ribulokinase is encoded by one or more nucleic acid molecules obtained from E. co!i. In some embodiments, the one or more nucleic acid molecules is fucK, or homolog thereof. In a further embodiment, the D- ribulokinase comprises an amino acid sequence set forth in SEQ ID NO: 8. In yet a further embodiment, the D-ribulokinase is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 6 and 7.
- the D-ribulose-1-phosphate aldolase is encoded by one or more nucleic acid molecules obtained from E. coli. In some embodiments, the one or more nucleic acid molecules is fucA, or homolog thereof. In a further embodiment, the D-ribulose-1 -phosphate aldolase comprises an amino acid sequence set forth in SEQ ID NO: 1 1. In yet a further embodiment, the D-ribulose-1 - phosphate aldolase is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 9 and 10.
- the method further comprises introducing into the recombinant microorganism and/or overexpressing at least one endogenous or exogenous nucleic acid molecule encoding a secondary alcohol dehydrogenase that catalyzes the conversion of acetone from (g) to isopropanol.
- the method further comprises introducing into the recombinant microorganism and/or overexpressing at least one endogenous or exogenous nucleic acid molecule encoding a dehydratase that catalyzes the conversion of isopropanol to propene.
- the method further comprises introducing into the recombinant microorganism one or more modifications selected from the group consisting of:
- an endogenous D-xylose isomerase catalyzes the conversion of D-xylose to D-xyiulose.
- the xylose isomerase is exogenous.
- the xylose isomerase is encoded by one or more nucleic acid molecules obtained from Pyromyces sp.
- the one or more nucleic acid molecules encoding the xylose isomerase is xylA, or homoiog thereof.
- the one or more nucleic acid molecules encoding the xylose isomerase comprises an amino acid sequence set forth in SEQ ID NO: 95.
- the one or more nucleic acid molecules encoding the xylose isomerase is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 93 and 94.
- the present disclosure provides a method of producing a recombinant microorganism that produces or accumulates MEG and acetone from exogenous D-xylose, comprising introducing into the recombinant microorganism and/or overexpressing one or more of the following:
- the produced intermediate DHAP is converted to acetyl ⁇ CoA through the endogenous glycolysis pathway in the microorganism, and wherein MEG and acetone are co-produced.
- the D-xyiulose 1-kinase is encoded by one or more nucleic acid molecules obtained from Homo sapiens.
- the one or more nucleic acid molecules encoding the D-xyiulose 1-kinase is ketohexokinase C (khk-C), or homolog thereof, in another embodiment, the one or more nucleic acid molecules encoding the D-xyiuiose 1-kinase comprises an amino acid sequence set forth in SEQ ID NO: 55.
- the one or more nucleic acid molecules encoding the D-xyluiose 1-kinase is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 53 and 54.
- the D-xyiuiose-1-phosphate aldolase is encoded by one or more nucleic acid molecules obtained from Homo sapiens, in another embodiment, the one or more nucleic acid molecules encoding the D-xylulose-1- phosphate aldolase is aldolase B (ALDOB), or homolog thereof. In some embodiments, the one or more nucleic acid molecules encoding the D-xylu!ose-1- phosphate aldolase comprises an amino acid sequence set forth in SEQ ID NO: 58.
- the one or more nucleic acid molecules encoding the D- xylulose-1 -phosphate aldolase is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 56 and 57.
- the method further comprises introducing into the recombinant microorganism and/or overexpressing at least one endogenous or exogenous nucleic acid molecule encoding a secondary alcohol dehydrogenase that catalyzes the conversion of acetone from (f) to isopropanol.
- the method further comprises introducing into the recombinant microorganism and/or overexpressing at least one endogenous or exogenous nucleic acid molecule encoding a dehydratase that catalyzes the conversion of isopropanol to propene.
- the method further comprises introducing into the recombinant microorganism one or more modifications selected from the group consisting of:
- an endogenous D-xyiose isomerase catalyzes the conversion of D-xylose to D-xyiuiose.
- the xylose isomerase is exogenous.
- the xylose isomerase is encoded by one or more nucleic acid molecules obtained from Pyromyces sp.
- the one or more nucleic acid molecules encoding the xylose isomerase is xy!A, or homoiog thereof.
- the one or more nucleic acid molecules encoding the xylose isomerase comprises an amino acid sequence set forth in SEQ ID NO: 95.
- the one or more nucleic acid molecules encoding the xylose isomerase is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 93 and 94.
- a method of producing a recombinant microorganism that produces or accumulates MEG and one or more three-carbon compounds from exogenous D-xyiose comprises introducing into the recombinant microorganism a deletion, insertion, or loss of function mutation in a gene encoding a D-xy!uiose-5-kinase to prevent the conversion of D-xylulose to D-xyiulose-5-phosphate and instead shunt the reaction toward conversion of D-xyluiose to D-xylulose- 1 -phosphate.
- the D-xyluiose-5-kinase is from Escherichia coii, in some embodiments, the D- xyiulose-5-kinase is encoded by the xyiB gene, or homoiog thereof,
- a method of producing a recombinant microorganism that produces or accumulates MEG and one or more three-carbon compounds from exogenous D-xyiose comprises introducing into the recombinant microorganism a deletion, insertion, or loss of function mutation in a gene encoding a glycoialdehyde dehydrogenase to prevent the production of g!ycolic acid from glycoialdehyde and instead shunt the reaction toward conversion of glycoialdehyde to MEG.
- the glycoialdehyde dehydrogenase is from Escherichia coii.
- the glycoialdehyde dehydrogenase is encoded by the aidA gene, or homoiog thereof.
- a method of producing a recombinant microorganism that produces or accumulates MEG and one or more three-carbon compounds from exogenous D-xyiose comprises introducing into the recombinant microorganism a deletion, insertion, or loss of function mutation in a gene encoding a lactate dehydrogenase to prevent the production of lactate from pyruvate and instead shunt the reaction toward production of one or more three-carbon compounds, in some embodiments, the lactate dehydrogenase is from Escherichia coii. In some embodiments, the lactate dehydrogenase is encoded by the IdhA gene, or homoiog thereof.
- the present disclosure provides a method of producing a recombinant microorganism that produces or accumulates MEG and acetone from exogenous D-xylose and glucose, comprising introducing into the recombinant microorganism and/or overexpressing one or more of the following:
- the xylose reductase or aldose reductase is encoded by one or more nucleic acid molecules obtained from a microorganism selected from the group consisting of Hypocrea sp., Scheffersomyces sp., Saccharomyces sp., Pachysoien sp., Pichia sp., Candida sp., Aspergillus sp., Neurospora sp., and Cryptococcus sp.
- the xylose reductase or aldose reductase is encoded by one or more nucleic acid molecules obtained from a microorganism selected from the group consisting of Hypocrea jecorina, Scheffersomyces stipitis, Saccharomyces cerevisiae, Pachysoien tannophilus, Pichia stipitis, Pichia quercuum, Candida shehatae, Candida tenuis, Candida tropicalis, Aspergillus niger, Neurospora crassa and Cryptococcus lactativorus.
- a microorganism selected from the group consisting of Hypocrea jecorina, Scheffersomyces stipitis, Saccharomyces cerevisiae, Pachysoien tannophilus, Pichia stipitis, Pichia quercuum, Candida shehatae, Candida tenuis, Candida tropicalis, Aspergillus niger, Neurospora crassa and Cryptococcus lactativor
- the one or more nucleic acid molecules encoding the xylose reductase or aldose reductase is xyl1 and/or GRE3 or homoiog thereof.
- the one or more nucleic acid molecules encoding the xylose reductase or aldose reductase comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 84 and 87.
- the one or more nucleic acid molecules encoding the xylose reductase or aldose reductase is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 82, 83, 85 and 88.
- the xyiitol dehydrogenase is encoded by one or more nucleic acid molecules obtained from a microorganism selected from the group consisting of Scheffersomyces sp., Trichoderma sp., Pichia sp., Saccharomyces sp., Gluconobacter sp., Gaiactocandida sp., Neurospora sp., and Serratia sp.
- the xylitoi dehydrogenase is encoded by one or more nucleic acid molecules obtained from a microorganism selected from the group consisting of Scheffersomyces stipitis, Trichoderma reesei, Pichia stipitis, Saccharomyces cerevisiae, Gluconobacter oxydans, Gaiactocandida mastotermitis, Neurospora crassa and Serratia marcescens.
- the one or more nucleic acid molecules encoding the xyiitol dehydrogenase is xyi2 and/or xdhl , or homoiog thereof.
- the one or more nucleic acid molecules encoding the xylitoi dehydrogenase comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 90 and 92. In some embodiments, the one or more nucleic acid molecules encoding the xylitoi dehydrogenase is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 88, 89 and 91.
- an endogenous D-xylose isomerase catalyzes the conversion of D-xylose to D-xyiuiose.
- the xylose isomerase is exogenous.
- the xylose isomerase is encoded by one or more nucleic acid molecules obtained from Pyromyces sp.
- the one or more nucleic acid molecules encoding the xylose isomerase is xylA, or homo!og thereof.
- the one or more nucleic acid moiecuies encoding the xylose isomerase comprises an amino acid sequence set forth in SEQ ID NO: 95.
- the one or more nucleic acid molecules encoding the xylose isomerase is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 93 and 94.
- the method further comprises introducing into the recombinant microorganism and/or overexpressing at least one endogenous or exogenous nucleic acid molecule encoding a secondary alcohol dehydrogenase that catalyzes the conversion of acetone from (i) to isopropanoi.
- the method further comprises introducing into the recombinant microorganism and/or overexpressing at least one endogenous or exogenous nucleic acid molecule encoding a dehydratase that catalyzes the conversion of isopropanoi to propene.
- the method further comprises introducing into the recombinant microorganism one or more modifications selected from the group consisting of:
- the enzyme that catalyzes the conversion of D- xyiulose to D-xyiulose-5-phosphate is a D-xylulose- 5-kinase.
- the D-xylulose-5-kinase is from Saccharomyces cerevisiae.
- the D-xylulose-5-kinase is encoded by the XKS1 gene, or homolog thereof.
- the D-xyiulose-5-kinase is from Pichia stipitis.
- the D-xy!ulose-5-kinase is encoded by the XYL3 gene, or homolog thereof.
- the microorganism is a fungus.
- the present application provides a method of producing a recombinant microorganism that produces or accumulates MEG and acetone from exogenous D-xylose, comprising introducing into the recombinant microorganism and/or overexpressing one or more of the following:
- the xylose dehydrogenase is encoded by one or more nucleic acid molecules obtained from a microorganism selected from the group consisting of Caulobacter sp., Haloarcula sp., Haloferax sp., Halorubrum sp. and Trichoderma sp. in another embodiment, the xylose dehydrogenase is encoded by one or more nucleic acid molecules obtained from a microorganism selected from the group consisting of Caulobacter crescentus, Haloarcula marismortui, Haloferax volcanii, Halorubrum lacusprofundi and Trichoderma reesei.
- the one or more nucleic acid molecules encoding the xylose dehydrogenase is selected from xy!B, xdhl (HVQ__BGQ28) and/or xydl , or homolog thereof, in a further embodiment, the one or more nucleic acid molecules encoding the xylose dehydrogenase comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 61 , 63 and 65. in yet another embodiment, the one or more nucleic acid molecules encoding the xylose dehydrogenase is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 59, 60, 62 and 64.
- the xylonoiactonase is encoded by one or more nucleic acid molecules obtained from a microorganism selected from Caulobacter sp. and Haloferax sp. in another embodiment, the xylonoiactonase is encoded by one or more nucleic acid molecules obtained from a microorganism selected from the group consisting of Caulobacter crescentus, Haloferax volcanii and Haloferax gibbonsii. In some embodiments, the one or more nucleic acid molecules encoding the xylonolactonase is xylC, or homolog thereof.
- the one or more nucleic acid molecules encoding the xylonolactonase comprises an amino acid sequence set forth in SEQ ID NO: 67
- the one or more nucleic acid molecules encoding the xylonolactonase is encoded by a nucleic acid sequence set forth in SEQ ID NO: 66.
- the xyionate dehydratase is encoded by one or more nucleic acid molecules obtained from a microorganism selected from the group consisting of Cauiobacter sp., Suifoiobus sp. and E. coii.
- the xyionate dehydratase is encoded by one or more nucleic acid molecules obtained from a microorganism selected from the group consisting of Cauiobacter crescentus, Su!folobus so!fataricus and E, coli.
- the one or more nucleic acid molecules encoding the xyionate dehydratase is selected from xy!D, yjhG and/or yagF, or homolog thereof.
- the one or more nucleic acid molecules encoding the xyionate dehydratase comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 69, 72 and 75.
- the one or more nucleic acid molecules encoding the xyionate dehydratase is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 68, 70, 71 , 73 and 74.
- the 2-keto-3-deoxy-D-pentonate aldolase is encoded by one or more nucleic acid molecules obtained from a microorganism selected from Pseudomonas sp. and E. coli.
- the 2-keto-3-deoxy-D- pentonate aldolase is encoded by one or more nucleic acid molecules obtained from E. co!i.
- the one or more nucleic acid molecules encoding the 2-keto-3-deoxy-D-pentonate aldolase is selected from yjhH and/or yagE, or homolog thereof.
- the one or more nucleic acid molecules encoding the 2-keto-3-deoxy-D-pentonate aldolase comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 78 and 81.
- the one or more nucleic acid molecules encoding the 2-keto-3-deoxy- D-pentonate aldolase is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 76, 77, 79 and 80.
- the method further comprises introducing into the recombinant microorganism and/or overexpressing at least one endogenous or exogenous nucleic acid molecule encoding a secondary alcohol dehydrogenase that catalyzes the conversion of acetone from (h) to isopropanol,
- the method further comprises introducing into the recombinant microorganism and/or overexpressing at least one endogenous or exogenous nucleic acid molecule encoding a dehydratase that catalyzes the conversion of isopropanol to propene.
- the method further comprises introducing into the recombinant microorganism one or more modifications selected from the group consisting of:
- a method of producing a recombinant microorganism that produces or accumulates MEG and one or more three-carbon compounds from exogenous D-xylose comprises introducing into the recombinant microorganism a deletion, insertion, or loss of function mutation in a gene encoding a D-xyiose isomerase to prevent conversion of D-xylose to D-xyluiose and instead shunt the reaction toward the conversion of D-xylose to D-xyionate.
- the enzyme that catalyzes the conversion of D-xylose to D-xylulose is a D-xyiose isomerase.
- the D-xyiose isomerase is from Escherichia co!i. in some embodiments, the D-xyiose isomerase is encoded by the xyiA gene, or homoiog thereof.
- a method of producing a recombinant microorganism that produces or accumulates MEG and one or more three-carbon compounds from exogenous D-xylose comprises introducing into the recombinant microorganism a deletion, insertion, or loss of function mutation in a gene encoding a glycolaidehyde dehydrogenase to prevent the production of glycolic acid from glycolaidehyde and instead shunt the reaction toward conversion of g!ycolaldehyde to MEG.
- the glycolaidehyde dehydrogenase is from Escherichia coli.
- the glycolaidehyde dehydrogenase is encoded by the aldA gene, or homo!og thereof.
- a method of producing a recombinant microorganism that produces or accumulates MEG and one or more three-carbon compounds from exogenous D-xylose comprises introducing into the recombinant microorganism a deletion, insertion, or loss of function mutation in a gene encoding a lactate dehydrogenase to prevent the production of lactate from pyruvate and instead shunt the reaction toward production of one or more three-carbon compounds, in one embodiment, the enzyme that catalyzes the conversion of pyruvate to lactate is a lactate dehydrogenase. In particular embodiments, the enzyme converts pyruvate to lactate. In some embodiments, the lactate dehydrogenase is from Escherichia coii. In some embodiments, the lactate dehydrogenase is encoded by the IdhA gene, or homoiog thereof.
- the present application provides a method of producing a recombinant microorganism that produces or accumuiates MEG and acetone from exogenous D-xylose, comprising introducing into the recombinant microorganism and/or overexpressing one or more of the following:
- the xylose dehydrogenase is encoded by one or more nucleic acid molecules obtained from a microorganism selected from the group consisting of Caulobacter sp., Haloarcula sp., Haloferax sp., Ha!oruhrum sp. and Trichoderma sp.
- the xylose dehydrogenase is encoded by one or more nucleic acid molecules obtained from a microorganism selected from the group consisting of Caulobacter crescentus, Haloarcula marismortui, Haloferax volcanii, Halorubrum lacusprofundi and Trichoderma reesei in some embodiments, the one or more nucleic acid molecules encoding the xylose dehydrogenase is selected from xylB, xdhl (HVO m B0028) and/or xydl , or homoiog thereof, in a further embodiment, the one or more nucleic acid molecules encoding the xylose dehydrogenase comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 61 , 63 and 65. in yet another embodiment, the one or more nucleic acid molecules encoding the xylose dehydrogenase is encoded by a nucleic acid sequence selected from
- the xylonate dehydratase is encoded by one or more nucleic acid molecules obtained from a microorganism selected from the group consisting of Cauiobacter sp., Suifoiobus sp. and E. coii.
- the xyionate dehydratase is encoded by one or more nucleic acid molecules obtained from a microorganism selected from the group consisting of Cauiobacter crescentus, Suifoiobus so!fataricus and E. coii.
- the one or more nucleic acid molecules encoding the xyionate dehydratase is selected from xy!D, yjhG and/or yagF, or homolog thereof.
- the one or more nucleic acid molecules encoding the xyionate dehydratase comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 69, 72 and 75.
- the one or more nucleic acid molecules encoding the xyionate dehydratase is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 68, 70, 71 , 73 and 74.
- the 2-keto-3-deoxy-D-pentonate aldolase is encoded by one or more nucleic acid molecules obtained from a microorganism selected from Pseudomonas sp. and E. coii.
- the 2-keto ⁇ 3-deoxy-D- pentonate aldolase is encoded by one or more nucleic acid molecules obtained from E. coii.
- the one or more nucleic acid molecules encoding the 2-keto-3-deoxy-D-pentonate aldolase is selected from yjhH and/or yagE, or homolog thereof.
- the one or more nucleic acid molecules encoding the 2-keto-3-deoxy-D-pentonate aldolase comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 78 and 81.
- the one or more nucleic acid molecules encoding the 2-keto-3-deoxy- D-pentonate aldolase is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 76, 77, 79 and 80.
- the method further comprises introducing into the recombinant microorganism and/or overexpressing at least one endogenous or exogenous nucleic acid molecule encoding a secondary alcohol dehydrogenase that catalyzes the conversion of acetone from (g) to isopropanol.
- the method further comprises introducing into the recombinant microorganism and/or overexpressing at least one endogenous or exogenous nucleic acid molecule encoding a dehydratase that catalyzes the conversion of isopropanol to propene.
- the method further comprises introducing into the recombinant microorganism one or more modifications selected from the group consisting of:
- a method of producing a recombinant microorganism that produces or accumulates MEG and one or more three-carbon compounds from exogenous D-xylose comprises introducing into the recombinant microorganism a deletion, insertion, or loss of function mutation in a gene encoding a D-xyiose isomerase to prevent conversion of D-xylose to D-xyluiose and instead shunt the reaction toward the conversion of D-xylose to D ⁇ xylonafe.
- the enzyme that catalyzes the conversion of D-xyiose to D-xylulose is a D-xyiose isomerase.
- the D-xylose isomerase is from Escherichia coii. in some embodiments, the D-xyiose isomerase is encoded by the xy!A gene, or homoiog thereof.
- a method of producing a recombinant microorganism that produces or accumulates MEG and one or more three-carbon compounds from exogenous D-xylose comprises introducing into the recombinant microorganism a deletion, insertion, or loss of function mutation in a gene encoding a glycolaldehyde dehydrogenase to prevent the production of giycoiic acid from glycolaldehyde and instead shunt the reaction toward conversion of glycolaldehyde to MEG.
- the glycolaldehyde dehydrogenase is from Escherichia coii.
- a method of producing a recombinant microorganism that produces or accumulates MEG and one or more three-carbon compounds from exogenous D-xylose comprises introducing into the recombinant microorganism a deletion, insertion, or loss of function mutation in a gene encoding a lactate dehydrogenase to prevent the production of lactate from pyruvate and instead shunt the reaction toward production of one or more three-carbon compounds, in one embodiment, the enzyme that catalyzes the conversion of pyruvate to lactate is a lactate dehydrogenase.
- the enzyme converts pyruvate to lactate.
- the lactate dehydrogenase is from Escherichia coli.
- the lactate dehydrogenase is encoded by the IdhA gene, or homoiog thereof.
- the giycolaidehyde reductase is encoded by one or more nucleic acid molecules obtained from a microorganism selected from E. coli and S. cerevisiae.
- the one or more nucleic acid molecules is selected from gldA, GRE2, GRE3, yqhD, ydjG, fucO, yafB (dkgB), and/or yqhE (dkgA), or homoiog thereof, in another embodiment, the one or more nucleic acid molecules is yqhD. in some embodiments, the yqhD comprises a G149E mutation.
- the giycolaidehyde reductase comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 13, 15, 17, 20, 23, 25, 28, 30 and 32.
- the giycolaidehyde reductase is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 12, 14, 16, 18, 19, 21 , 22, 24, 28, 27, 29 and 31.
- the thiolase or acetyl coenzyme A acetyltransferase is encoded by one or more nucleic acid molecules obtained from a microorganism selected from the group consisting of Clostridium sp., Bacillus sp., E. coli, Saccharomyces sp, and Marinobacter sp.
- the thiolase or acetyl coenzyme A acetyltransferase is encoded by one or more nucleic acid molecules obtained from a microorganism selected from the group consisting of Clostridium acetobutyiicum, Clostridium thermosaccharolyticum, Bacillus cereus, E, coli, Saccharomyces cerevisiae and Marinobacter hydrocarbonoc!asticus.
- the one or more nucleic acid molecules is thIA, atoB and/or ERG10, or homoiog thereof, in a further embodiment, the thiolase or acetyl coenzyme A acetyltransferase comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 35, 37 and 40. In yet a further embodiment, the thiolase or acetyl coenzyme A acetyltransferase is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 33, 34, 36, 38 and 39.
- the acetyl- CoA:acetoacetate-CoA transferase or acetate :acetoacetyl-CoA hydrolase is encoded by one or more nucleic acid molecules obtained from a microorganism selected from Clostridium sp. and E, coli.
- the acetyl-CoA:acetoacetate- CoA transferase or acetate:acetoacetyi-CoA hydrolase is encoded by one or more nucleic acid molecules obtained from E. coli.
- the one or more nucleic acid molecules encoding the acetyl-CoA:acetoacetate-CoA transferase is atoA and/or atoD, or homolog thereof.
- the acetyl- CoA:acetoacetate-CoA transferase or acetate :acetoacetyl-CoA hydrolase is encoded by one or more nucleic acid molecules obtained from Clostridium acetobutylicum.
- the one or more nucleic acid molecules encoding the acetate: acetoacetyl-CoA hydrolase is ctfA and/or ctfB, or homolog thereof.
- the acetyi-CoA:acetoacetate-CoA transferase or acetate:acetoacetyl-CoA hydrolase comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 43, 46, 97, 99, 101 and 103.
- the acetyl-CoA:acetoacetate-CoA transferase or acetate: acetoacetyl-CoA hydrolase is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 41 , 42, 44, 45, 96, 98, 100 and 102.
- the acetoacetate decarboxylase is encoded by one or more nucleic acid molecules obtained from a microorganism selected from the group consisting of Clostridium sp,, Bacillus sp,, Chromobacterium sp, and Pseudomonas sp.
- the acetoacetate decarboxylase is encoded by one or more nucleic acid molecules obtained from a microorganism selected from the group consisting of Clostridium acetobutylicum, Clostridium beijerinckii, Clostridium celluiolyticum, Bacillus poiymyxa, Chromobacterium violaceum and Pseudomonas putida.
- the one or more nucleic acid molecules encoding the acetoacetate decarboxylase is adc, or homoiog thereof.
- the acetoacetate decarboxylase comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 49 and 52.
- the acetoacetate decarboxylase is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 47, 48, 50 and 51.
- the enzyme that catalyzes the conversion of acetone to isopropanol is a secondary alcohol dehydrogenase (S-ADH).
- the enzyme is a secondary alcohol dehydrogenase that is encoded by a nucleic acid molecule obtained from a microorganism selected from Burkholderia sp, Alcaligenes sp., Clostridium sp., Thermoanaerobacter sp., Phytomonas sp,, Rhodococcus sp.
- the nucleic acid molecule encoding the secondary alcohol dehydrogenase is obtained from a microorganism selected from Burkholderia sp.
- AIU 652 Alcaligenes eutrophus, Clostridium ragsdaiei, Clostridium beijerinckii, Clostridium carboxidivorans, Thermoanaerobacter brockii, Thermoanaerobacter ethanoiicus (Clostridium thermohydrosulfuricum), Rhodococcus ruber, Methanobacterium palustre, methanogenic archaea Methanogenium liminatans, parasitic protist Entamoeba histolytica, parasitic protozoan Tritrichomonas foetus and human parasite Trichomonas vaginalis.
- the one or more nucleic acid molecule encoding secondary alcohol dehydrogenase is adh, adhB, EhAdhl , or homoiog thereof.
- the S-ADH is predicted from homology and can be from Thermoanaerobacter mathranii, Micrococcus !uteus, Nocardiopsis alba, Mycobacterium hassiacum, Helicobacter suis, Candida albicans, Candida parapsilosis, Candida orthopsilosis, Candida metapsilosis, Grosmannia clavigera and Scheffersomyces stipitis.
- the alcohol dehydrogenase comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 106 and 108.
- the alcohol dehydrogenase is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 104, 105 and 107.
- Non-limiting examples of enzymes that can be further engineered for use in methods of the disclosure include an aldolase, an aldehyde reductase, an acetoacetyl coenzyme A hydrolase, a xylose isomerase, a xylitol dehydrogenase and combinations thereof. These enzymes can be engineered for improved catalytic activity, improved selectivity, improved stability, improved tolerance to various fermentation conditions (temperature, pH, etc.), or improved tolerance to various metabolic substrates, products, by-products, intermediates, etc.
- the term "improved catalytic activity" as used herein with respect to a particular enzymatic activity refers to a higher level of enzymatic activity than that measured relative to a comparable non-engineered enzyme.
- thermostability and solvent tolerance of fructose-1 ,6- bisphosphate aldolase was increased using family DNA shuffling of the fda genes from Escherichia coli and Edwardsieiia ictaluri.
- a fourth generation variant was identified which displayed an average 280-fold higher half-life at 53°C than either parent. The same variant also displayed enhanced activity in various polar and non-polar organic solvents (Hao and Berry 2004 Protein Eng Des Sei 17:689-697).
- acetoacetyl coenzyme A hydrolase can convert acetoacetyl-CoA to acetoacetate.
- the hydrolase is unspecific in that it also reacts with the same magnitude of order with acetyl-CoA, which is the substrate required for acetoacetyl-CoA formation by the enzyme thioiase.
- these enzymes have been engineered to have at least 10x higher activity for the acetoacetyl-CoA substrate than for acetyl-CoA substrate by replacing several glutamic acid residues in the enzyme beta subunit that is important for catalysis (WO 2015/042588).
- the E. coli YqhD enzyme is a broad substrate aldehyde reductase with NADPH-dependent reductase activity for more than 10 aldehyde substrates and is a useful enzyme to produce biorenewable fuels and chemicals (Jarboe 2010 Applied Microbiology and Biotechnology 89:249).
- YqhD enzyme activity is beneficial through its scavenging of toxic aldehydes, the enzyme is also NADPH-dependent and contributes to NADPH depletion and growth inhibition of organisms. Error-prone PGR of YqhD was performed in order to improve 1 ,3-propanediol production from 3-hydroxypropionaldehyde (3-HPA).
- xylose isomerase is a metal-dependent enzyme that catalyzes the interconversion of aldose and ketose sugars, primarily between xylose to xylulose and glucose to fructose. It has lower affinity for lyxose, arabinose and mannose sugars.
- the hydroxyl groups of sugars may define the substrate preference of sugar isomerases.
- the aspartate at residue 258 of Thermus thermophilus xylose isomerase was replaced with arginine (Patel et al. 2012 Protein Engineering, Design & Selection vol. 25 no. 7 pp. 331-338).
- This mutant xylose isomerase exhibited an increase in specificity for D-lyxose, L-arabinose and D- mannose.
- the catalytic efficiency of the D256R xylose isomerase mutant was also higher for these 3 substrates compared to the wild type enzyme. It was hypothesized that the arginine at residue 258 in the mutant enzyme may play a role in the catalytic reaction or influence changes in substrate orientation.
- xylitoi dehydrogenase plays a role in the utilization of xylose along with xylose reductase.
- Xylose reductase XR
- XDH xylitoi dehydrogenase
- the exogenous and endogenous enzymes in the recombinant microorganism participating in the biosynthesis pathways described herein may be overexpressed.
- overexpressed refers to an elevated level (e.g., aberrant level) of mRNAs encoding for a protein(s), and/or to elevated levels of protein(s) in cells as compared to similar corresponding unmodified cells expressing basal levels of mRNAs or having basal levels of proteins.
- mRNA(s) or protein(s) may be overexpressed by at least 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 8-fold, 10-fold, 12-fold, 15-fold or more in microorganisms engineered to exhibit increased gene mRNA, protein, and/or activity.
- a recombinant microorganism of the disclosure is generated from a host that contains the enzymatic capability to synthesize substrates such as D-xylulose, D-ribulose, D-ribuiose- -phosphate, D-xylulose-1- phosphate, D-xyionolactone, D-xylonate, 2-keto-3-deoxy-xyionate, glycolaidehyde, DHAP, pyruvate, acetoacetyl-CoA or acetoacetate.
- substrates such as D-xylulose, D-ribulose, D-ribuiose- -phosphate, D-xylulose-1- phosphate, D-xyionolactone, D-xylonate, 2-keto-3-deoxy-xyionate, glycolaidehyde, DHAP, pyruvate, acetoacetyl-CoA or acetoacetate.
- D-xylulose for example, D-xylulose, D- ribulose, D-ribulose-1-phosphate, D-xyluiose-1-phosphate, D-xylonolactone, D- xylonate, 2 ⁇ keto-3-deoxy-xylonate, glycolaidehyde, DHAP, pyruvate, acetoacetyl- CoA or acetoacetate
- Increased synthesis or accumulation can be accomplished by, for example, overexpression of nucleic acids encoding one or more of the above- described MEG and three-carbon compound biosynthesis pathway enzymes.
- Overexpression of a MEG and three-carbon compound biosynthesis pathway enzyme or enzymes can occur, for example, through increased expression of an endogenous gene or genes, or through the expression, or increased expression, of an exogenous gene or genes.
- Naturally occurring organisms can be readily modified to generate non-natural, MEG and three-carbon compound producing microorganisms through overexpression of one or more nucleic acid molecules encoding a MEG and three-carbon compound biosynthesis pathway enzyme, in addition, a non-naturai!y occurring organism can be generated by mutagenesis of an endogenous gene that results in an increase in activity of an enzyme in the MEG and three-carbon compound biosynthesis pathways.
- Methods for constructing and testing the expression levels of a non- naturally occurring MEG and three-carbon compound-producing host can be performed, for example, by recombinant and detection methods well known in the art. Such methods can be found described in, for example, Sambrook et al., Molecular Cloning: A Laboratory Manual, Third Ed., Cold Spring Harbor Laboratory, New York (2001); Ausubo et al., Current Protocols In Molecular Biology, John Wiley and Sons, Baltimore, Md. (1999).
- an expression vector or vectors can be constructed to harbor one or more MEG and three-carbon compound biosynthesis pathway enzymes encoding nucleic acids as exemplified herein operably linked to expression control sequences functional in the host organism.
- Expression vectors applicable for use in the microbial host organisms of the invention include, for example, plasmids, phage vectors, viral vectors, episomes and artificial chromosomes, including vectors and selection sequences or markers operable for stable integration into a host chromosome.
- Selectable marker genes also can be included that, for example, provide resistance to antibiotics or toxins, complement auxotrophic deficiencies, or supply critical nutrients not in the culture media.
- Expression control sequences can include constitutive and inducible promoters, transcription enhancers, transcription terminators, and the like which are well known in the art.
- both nucleic acids can be inserted, for example, into a single expression vector or in separate expression vectors.
- the encoding nucleic acids can be operationally linked to one common expression control sequence or linked to different expression control sequences, such as one inducible promoter and one constitutive promoter. The transformation of exogenous nucleic acid sequences involved in a metabolic or synthetic pathway can be confirmed using methods well known in the art.
- Optimized coding sequences containing codons preferred by a particular prokaryofic or eukaryotic host can be prepared, for example, to increase the rate of translation or to produce recombinant RNA transcripts having desirable properties, such as a longer half-life, as compared with transcripts produced from a non-optimized sequence.
- Translation stop codons can also be modified to reflect host preference. For example, typical stop codons for S. cerevisiae and mammals are UAA and UGA, respectively. The typical stop codon for monocotyledonous plants is UGA, whereas insects and E. co!i commonly use UAA as the stop codon (Dalphin et al. (1998) Nucl. Acids Res, 24: 216-218).
- nucleic acid sequences can be used to encode a given enzyme of the disclosure.
- the nucleic acid sequences encoding the biosynthetic enzymes are referenced herein merely to illustrate an embodiment of the disclosure, and the disclosure includes any nucleic acid sequences that encode the amino acid sequences of the polypeptides and proteins of the enzymes of the present disclosure.
- a polypeptide can typically tolerate one or more amino acid substitutions, deletions, and insertions in its amino acid sequence without loss or significant loss of a desired activity.
- the disclosure includes such polypeptides with different amino acid sequences than the specific proteins described herein so long as the modified or variant polypeptides have the enzymatic anabolic or catabolic activity of the reference polypeptide.
- the amino acid sequences encoded by the nucleic acid sequences shown herein merely illustrate embodiments of the disclosure.
- Expression control sequences are known in the art and include, for example, promoters, enhancers, polyadenylation signals, transcription terminators, internal ribosome entry sites (IRES), and the like, that provide for the expression of the polynucleotide sequence in a host cell.
- Expression control sequences interact specifically with cellular proteins involved in transcription (Maniatis et al., Science, 236: 1237-1245 (1987)).
- Exemplary expression control sequences are described in, for example, Goeddel, Gene Expression Technology: Methods in Enzymology, Vol. 185, Academic Press, San Diego, Calif. (1990).
- an expression control sequence may be operabiy linked to a polynucleotide sequence.
- operbiy linked is meant that a polynucleotide sequence and an expression control sequence(s) are connected in such a way as to permit gene expression when the appropriate molecules (e.g., transcriptional activator proteins) are bound to the expression control sequence(s).
- Operabiy linked promoters are located upstream of the selected polynucleotide sequence in terms of the direction of transcription and translation.
- Operabiy linked enhancers can be located upstream, within, or downstream of the selected polynucleotide.
- the recombinant microorganism is manipulated to delete, disrupt, mutate, and/or reduce the activity of one or more endogenous enzymes that catalyzes a reaction in a pathway that competes with the biosynthesis pathway for the production of EG and one or more three-carbon compounds.
- the recombinant microorganism is manipulated to delete, disrupt, mutate, and/or reduce the activity of one or more endogenous enzymes that catalyzes the conversion of D-xyluiose to D-xyiuiose-5-phosphate.
- the enzyme that catalyzes the conversion of D-xyluiose to D-xyiuiose-5-phosphate is a D-xylulose-5-kinase.
- the D- xy!ulose-5-kinase is from Escherichia coii.
- the D-xyluiose- 5 ⁇ kinase is encoded by the xylB gene or homologs thereof, in some embodiments, the manipulation prevents the conversion of D ⁇ xyiulose to D ⁇ xyluiose-5-phosphafe and instead shunts the reaction toward conversion of D-xyiuiose to D-xylulose-1- phosphate.
- the recombinant microorganism is manipulated to delete, disrupt, mutate, and/or reduce the activity of one or more endogenous enzymes that catalyzes the conversion of glycolaldehyde to giycolic acid.
- the enzyme that catalyzes the conversion of glycolaldehyde to g!ycoiic acid is a glycolaldehyde dehydrogenase.
- the glycolaldehyde dehydrogenase is from Escherichia coii. in some embodiments, the glycolaldehyde dehydrogenase is encoded by the aldA gene or homologs thereof.
- the manipulation prevents the production of giycolic acid from glycolaldehyde and instead shunts the reaction toward conversion of glycolaldehyde to MEG.
- the recombinant microorganism is manipulated to delete, disrupt, mutate, and/or reduce the activity of one or more endogenous enzymes that catalyzes the conversion of pyruvate to lactate.
- the enzyme that catalyzes the conversion of pyruvate to lactate is a lactate dehydrogenase.
- the lactate dehydrogenase is from Escherichia coii.
- the lactate dehydrogenase is encoded by the IdhA gene or homoiogs thereof, in some embodiments, the manipulation prevents the production of lactate from pyruvate and instead shunts the reaction toward production of a three-carbon compound,
- the recombinant microorganism is manipulated to delete, disrupt, mutate, and/or reduce the activity of one or more endogenous enzymes that catalyzes the conversion of D-xylulose to D-xylulose-5-phosphate
- the enzyme that catalyzes the conversion of D-xylulose to D-xyiulose ⁇ 5 ⁇ phosphate is a D-xylulose- 5-kinase.
- the D- xylulose-5-kinase is from Saccharomyces cerevisiae.
- the D- xylulose-5-kinase is encoded by the XKS1 gene or homoiogs thereof. In some embodiments, the D-xylulose-5-kinase is from Pichia stipitis. In some embodiments the D-xylulose-5-kinase is encoded by the XYL3 gene or homoiogs thereof. In some embodiments, the manipulation prevents the conversion of D-xylulose to D-xylulose- 5-phosphate and instead shunts the reaction toward conversion of D-xylulose to D- xyiulose-1 -phosphate.
- the recombinant microorganism is manipulated to delete, disrupt, mutate, and/or reduce the activity of one or more endogenous enzymes that catalyzes the conversion of D ⁇ xyluiose-5-phosphate to D-xylulose.
- the enzyme that catalyzes the conversion of D-xylulose-5- phosphate to D-xyluiose is an alkaline phosphatase, in some embodiments, the alkaline phosphatase is from S. cerevisiae.
- the alkaline phosphatase is encoded by the PH013 gene or homoiogs thereof, in some embodiments, the manipulation prevents the conversion of D-xyiuiose-5-phosphate to D-xylulose.
- the recombinant microorganism is manipulated to delete, disrupt, mutate, and/or reduce the activity of one or more endogenous enzymes that catalyzes the conversion of D-xylose to D-xyiuiose.
- the enzyme that catalyzes the conversion of D-xylose to D-xylulose is a D-xylose isomerase.
- the D-xyiose isomerase is from E. co!i.
- the D-xylose isomerase is encoded by the xyiA gene or homoiogs thereof.
- the manipulation prevents conversion of D-xyiose to D-xyiulose and instead shunts the reaction toward the conversion of D- xylose to D-xylonate.
- Example 1 a Production of ethylene glycol in E. coli
- the E. coli K 2 strain MG 855 was used as host for the deletion of two genes that could divert the carbon flux from MEG+IPA pathway: aldA and xylB.
- the genes were successfully deleted and deletion confirmed by sequencing.
- the plasmid was constructed using the MoCIo system and confirmed by sequencing. The confirmed plasmid was transformed in the deleted strain.
- Colonies from transformations were inoculated in 3mL of LB media for pre-cuiture. After 16 hours of cultivation 10% of the pre-cuiture was transferred to 50 mL of LB media containing 15g/L of xylose. The flasks were incubated at 37°C, 250 rpm until complete consumption of xylose. The initial OD of the cultivation was 0.4. Xylose was fully consumed after 98 hours of cultivation. Small amounts of MEG were detected after 27 hours of cultivation. The highest MEG concentration was measured after 100 hours of cultivation, reaching 2.1 g/L. The overall yield of MEG production was 13.7 wt% (FIG, 7).
- Example 1 b Improved production of ethylene glycol in E, coli
- the E. coli K 2 strain MG1655 with aidA and xy/S genes deleted was used as host for the implementation of a complete MEG pathway.
- An operon containing die (D-tagatose 3-epimerase enzyme, SEQ ID NO: 3, encoded by nucleic acid sequence SEQ ID NO: 2), fucA (D-ribuiose-1-phosphate aldolase enzyme, SEQ ID NO: 11 , encoded by nucleic acid sequence SEQ ID NO: 10), fucO (aldehyde reductase enzyme, SEQ ID NO: 28, encoded by nucleic acid sequence SEQ ID NO: 27) and fucK (D-ribulokinase enzyme, SEQ ID NO: 8, encoded by nucleic acid sequence SEQ ID NO: 7) genes under the control of the proD promoter was constructed in a pET28a backbone.
- the plasmid was constructed using ln-fusion commercial kit and confirmed by sequencing.
- the confirmed piasmid was transformed in the G1855 mutant strain.
- Coionies from transformation were inoculated in 3 mL of LB media for pre-culture. After 18 hours of cultivation, the pre-cu!ture was transferred to 50 mL of LB media containing 15 g/L of xylose to an initial OD of 0.3. The flasks were incubated at 37°C, 250 rpm until complete consumption of xylose. After 4 hours of cultivation, approximately 100 mg/L of MEG could be detected. After 144 hours of cultivation, 4.3 g/L of MEG were produced and all xylose was consumed (HG. 8). The overall yield and productivity were, respectively, 0.3 g/g and 0.03 g/L.h.
- Example 2 Co-production of ethylene glycol and isopropanol in Saccharomyces cerevisiae
- ADH1 for thi gene thiolase, SEQ ID NO: 35, encoded by nucleic acid sequence SEQ ID NO: 34
- TEF1 for atoA gene PGK1 for atoD gene
- PGK1 for atoD gene acetate: acetoacetyi-CoA transferase, SEQ ID NOs: 43 and 46, encoded by nucleic acid sequences SEQ ID NOs: 42 and 45, respectively
- TDH3 for adc gene acetoacetate decarboxylase, SEQ ID NO: 49, encoded by nucleic acid sequence SEQ ID NO: 48
- TPI 1 for adh gene secondary alcohol dehydrogenase, SEQ ID NO: 108, encoded by nucleic acid sequence SEQ ID NO: 105).
- the integration was confirmed by PGR and sequencing.
- the second step was the introduction of genes capable of consuming xylose in the yeast genome.
- the pathway chosen for xylose consumption is composed of two genes: Xyi1 and Xy/2.
- Three copies of the Xyi1 gene (SEQ ID NO: 84, encoded by nucleic acid sequence SEQ ID NO: 83) under control of TEF1 promoter and three copies of the Xy/2 (SEQ ID NO: 90, encoded by nucleic acid sequence SEQ ID NO: 89) gene also under control of TEF1 promoter were integrated into the yeast genome through homologous recombination.
- the integration was confirmed by PGR and sequencing.
- the third step was the integration of the EG pathway.
- D-tagatose 3-epimerase enzyme (dte gene, SEQ ID NO: 3, encoded by nucleic acid sequence SEQ ID NO: 2) under the control of TEF1 and TDH3 promoters, respectively, were integrated into the genome along with the following genes: one copy of fucO gene (glycolaldehyde reductase, SEQ ID NO: 28, encoded by nucleic acid sequence SEQ ID NO: 27) under control of the PGK1 promoter; one copy of the fucA gene (D-ribulose- phosphate aldolase, SEQ ID NO: 1 1 , encoded by nucleic acid sequence SEQ ID NO: 10) using a PGK1 promoter and one copy of fucK gene (D-ribuiokinase, SEQ ID NO: 8, encoded by nucleic acid sequence SEQ ID NO: 7) under a PGK1 promoter.
- fucO gene glycocolaldehyde reductase, SEQ ID NO: 28, encode
- the final strain was confirmed by PCR and sequencing.
- the strain was inoculated in YPD media containing 20 g/L of glucose and incubated at 30°C, 200 rpm. After 16 hours of growth, the pre ⁇ culture was inoculated in YPDX media containing 30 g/L of glucose and 10 g/L of xylose to an OD 2,0. The flasks were incubated at 30°C, 100 rpm. The typical behavior of C5 and C6 consumption in yeast was observed. 30g/L of glucose was consumed in less than 60 hours, while 90% of the initial xylose was consumed only after 200 hours.
- the OD reached a value of 55 after 200 hours of cultivation, isopropanol was already being produced in the initial 60 hours of cultivation, while MEG was only detected after 160 hours of cultivation.
- the highest co-production was obtained at 83 hours of cultivation, with 58 mg/L of MEG and 2.81 g/L of isopropanol.
- Example 3 Co-production of ethylene glycol (MEG), acetone and isopropanol (IPA) in E. co// using ribuiose-1-phosphate pathway
- E. coli K12 strain G1655 was used as host for the deletion of two genes that could divert the carbon flux from MEG+IPA pathway: a!dA and xylB. The genes were successfully deleted and the deletion was confirmed by sequencing. Ribulose- 1 -phosphate pathway for MEG production was assembled in three different vectors backbones: pZA31 , pZS*13 and pET28a.
- dte D-fagatose 3- epimerase enzyme
- fucA D-ribulose-1 -phosphate aldolase enzyme
- fucO aldehyde reductase enzyme
- fucK D-ribulokinase enzyme
- T (SEQ ID NO: 113) and Reverse Primer: GAGCT CGGTACCCGGGGATCCAAAAAACCCCTCAAGACCC (SEQ ID NO: 1 14)).
- An operon containing dte (D-tagatose 3-epimerase enzyme), fucA (D-ribu!ose-1- phosphate aldolase enzyme), fucO (aldehyde reductase enzyme), fucK (D- ribulokinase enzyme) genes and T7 terminator under the control of proD promoter (constitutive promoter) was constructed in a pET28a backbone. For each gene a specific RBS sequence was utilized. The plasmid was constructed using ln-fusion commercial kit and confirmed by sequencing. The entire operon under the control of proD promoter was subcloned in pZA31 and pZS*13 backbones using restrietion- ligation methodology.
- Isopropanol pathway was also assembled in three different vectors backbones: pZA31 , pZS*13 and pET28a.
- Production of isopropanol requires the expression of five genes: thl (thiolase), atoAD (acetate: acetoacetyi-CoA transferase), adc (acetoacetate decarboxylase) and adh (secondary alcohol dehydrogenase).
- AtoA/D gene is native from E. coli and was PGR amplified (Forward Primer: CTGTTGTTATATTGTAATGATGTATGCAAGAGGGATAAA (SEQ ID NO: 1 15) and Reverse Primer:
- thl (Thl amino acid sequence set forth in SEQ ID NO: 35), adc (Adc amino acid sequence set forth in SEQ ID NO: 49), and adh (Adh amino acid sequence set forth in SEQ ID NO: 106) were codon optimized for E. coli and synthesized.
- thl thiolase
- adh secondary alcohol dehydrogenase
- adc acetoacetate decarboxylase
- atoA/D acetate:acetoacetyl-CoA transferase
- Colonies from transformations were inoculated in 3mL of TB media for pre- culture. After 16 hours of cultivation, 100% of the pre-culture was transferred to 100 mL of TB media containing 15g/L of xylose. The flasks were incubated at 37°C, 250 rpm until complete consumption of xylose. The initial OD of the cultivation was 0.3. For the induction of pLLacO promoter 1 mM of IPTG was added to the culture after 2 hours (OD ⁇ 1).
- Xylose was fully consumed after 32 hours of cultivation for strains 1 to 4. Strain 5 only consumed xylose completely after 55 hours and strain 6 was not able to consume all xylose after 144 hours.
- Strains 2 and 3 co-produced MEG, isopropanol and acetone while strains 1 and 4 co-produced only MEG and acetone. Strains 5 and 6 produced only MEG.
- Strain 2 showed the highest overall yield (0.28 g/g), as well as the highest yield for ethylene glycol (0.25 g/g) and isopropanol (0.03 g/g) production. Strain 4 showed the highest yield for acetone production (0,01 g/g).
- Example 4 Co-production of ethylene glycol (MEG), acetone and isopropanol (IPA) in E. coli using xyiulose-1-phosphate pathway
- E. coli K12 strain MG1855 was used as host for the expression of MEG+IPA pathways.
- Two genes that could divert the carbon flux from EG+1PA pathway were identified as target for deletion: aldA and xylB genes.
- a MEG pathway was integrated at xylB locus, enabling a stable integration concomitantly with xylB deletion.
- Production of MEG through xyiuiose-1-phosphate pathway requires the expression of three genes: khkC (D-xylulose-1-kinase enzyme), a!doB (D-xylulose - 1-phosphate aldolase enzyme) and fucO (aldehyde reductase enzyme).
- khkC (KhkC amino acid sequence set forth in SEQ ID NO: 55) and aidoB (AidoB amino acid sequence set forth in SEQ ID NO: 58) genes were codon optimized for E. coli and synthesized. FucO gene is native from £. coli and was PGR amplified (Forward Primer: ATGGCTAACAGAATGATTCTG (SEQ ID NO: 1 17) and Reverse Primer: TTACCAGGCGGTATGGTAAAGCT (SEQ ID NO: 18)).
- a MEG integration cassette was composed of an operon containing khkC (D-xylulose-1-kinase enzyme), aidoB (D-xylulose- 1 -phosphate aldolase enzyme), fucO (aldehyde reductase enzyme) genes and rplM terminator under the control of proD promoter (constitutive promoter) flanked by regions homologous to upstream and downstream of xylB gene. For each gene a specific RBS sequence was utilized. An antibiotic marker was also added to the cassette for the selection of transformants.
- the cassette was constructed using in-fusion commercial kit, confirmed by sequencing and transformed in E. coli K12 MG 655 strain. The proper integration of a MEG pathway at xylB locus, yielding a deleted xylB strain with a MEG pathway integrated, was confirmed by sequencing.
- the strain harboring a MEG pathway at xylB locus was used as host for integration of an IPA pathway at aldA locus, enabling a stable integration concomitantly with aldA deletion.
- Production of isopropanol requires the expression of five genes: thl (thiolase), atoA/D (acetate: acetoacetyl-CoA transferase), adc facetoacetate decarboxylase) and adh (secondary alcohol dehydrogenase).
- thl thiolase
- atoA/D acetate: acetoacetyl-CoA transferase
- adh secondary alcohol dehydrogenase
- coli and was PGR amplified (Forward Primer: CTGTTGTTATATTGTAATGATGTATGCAAGAGGGATAAA (SEQ ID NO: 119) and Reverse Primer: TATATCTCCTTCTTAAAGTTCATAAATCACCCCGTTGC (SEQ ID NO: 120)).
- thl Thil amino acid sequence set forth in SEQ ID NO: 35
- adc Adc amino acid sequence set forth in SEQ ID NO: 49
- adh Adh amino acid sequence set forth in SEQ ID NO: 106
- An IPA integration cassette was composed of an operon containing thl (thiolase), adh (secondary alcohol dehydrogenase), adc (acetoacetate decarboxylase), atoA/D (acetate :acetoacetyl-CoA transferase) genes and T1 terminator under the control of a medium strength constitutive promoter (modified from RecA) flanked by regions homologous to upstream and downstream of aldA gene. For each gene a specific RBS sequence was utilized. An antibiotic marker was included into the cassette for the selection of transformants.
- the cassette was constructed using ln-fusion commercial kit, confirmed by sequencing and transformed in E. coli K12 MG1655 strain. The proper integration of an IPA pathway at aldA locus, yielding a deleted aldA strain with an IPA pathway integrated, was confirmed by sequencing.
- the xylB aldA deleted strain with MEG and IPA pathways integrated in the genome was inoculated in 3mL of TB media for pre-culture. After 18 hours of cultivation, 100% of the pre-culture was transferred to 100 mL of TB media containing 15g/L of xylose. The flasks were incubated at 37°C, 250 rpm until complete consumption of xylose. The initial OD of the cultivation was 0.3.
- Xylose was fully consumed after 30 hours of cultivation (FIG. 10).
- Ethylene glycol, acetone and isopropanoi reached a maximum titer of 3.5 g/L, 70 mg/L and 400 mg/L respectively.
- the overall yield of co-production was calculated considering the amount of ethylene glycol, isopropanoi and acetone produced per gram of xylose consumed.
- MEG is the product with the highest yield, 0.237 g/g, followed by isopropanoi, 0.029 g/g and acetone, 0.006 g/g (FIG. 11).
- Example 5 Co-production of ethylene glycol (MEG), acetone and isopropanol (I PA) in E. coli using xylonate pathway
- E, coli K12 strain MG1655 was used as host for the expression of MEG+IPA pathways.
- Two genes that could divert the carbon flux from EG+IPA pathway were identified as target for deletion: a!dA and xylA genes.
- a EG pathway was integrated at xy!A locus, enabling a stable integration concomitantly with xy!A deletion.
- Production of MEG through a xylonate pathway requires the expression of two genes: xdh (Xdh amino acid sequence set forth in SEQ ID NO: 81) from Cau!obacter crescentus was codon optimized for E. coli and synthesized. FucO gene is native from E.
- a MEG integration cassette was composed of an operon containing xdh (D-xylose dehydrogenase), fucO (aldehyde reductase enzyme) genes and rnpB terminator under the control of proD promoter (constitutive promoter) flanked by regions homologous to upstream and downstream of xylA gene. For each gene a specific RBS sequence was utilized. An antibiotic marker was also added to the cassette for the selection of transformants. The cassette was constructed using Infusion commercial kit, confirmed by sequencing and transformed in E. coli K12 MG1655 strain. The proper integration of a MEG pathway at xylA locus, yielding a deleted xylA strain with a MEG pathway integrated, was confirmed by sequencing.
- the strain harboring a MEG pathway at xy!A locus was used as host for integration of an IPA pathway at aidA locus, enabling a stable integration concomitantly with aldA deletion.
- Production of isopropanol requires the expression of five genes: th! (thiolase), atoA/D (acetate: acetoacetyi-CoA transferase), adc (acetoacetate decarboxylase) and adh (secondary alcohol dehydrogenase).
- AtoA/D gene is native from E.
- An IPA integration cassette was composed of an operon containing thl (thiolase), adh (secondary alcohol dehydrogenase), adc (acetoacetate decarboxylase), atoA/D (acetate :acetoacetyl-CoA transferase) genes and T1 terminator under the control of a medium strength constitutive promoter (modified from RecA) flanked by regions homologous to upstream and downstream of aldA gene. For each gene a specific RBS sequence was utilized. An antibiotic marker was included into the cassette for the selection of transformants.
- the cassette was constructed using in-fusion commercial kit, confirmed by sequencing and transformed in E. coll K12 MG1855 strain. The proper integration of an IPA pathway at aldA locus, yielding a deleted aldA strain with an IPA pathway integrated, was confirmed by sequencing.
- the xylA aldA deleted strain with MEG and IPA pathways integrated in the genome was inoculated in 3mL of TB media for pre-cuiture. After 16 hours of cultivation, 100% of the pre-cuiture was transferred to 100 mL of TB media containing 15g/L of xylose. The flasks were incubated at 37°C, 250 rpm until complete consumption of xylose. The initial OD of the cultivation was 0.3.
- Xylose was fully consumed before 24 hours of cultivation (FIG. 12).
- Ethylene glycol, acetone and isopropanol reached a maximum titer of 5 g/L, 170 mg/L and 420 mg/L respectively.
- Vectors pZs*13 containing an I PA pathway in an operon under plLacO promoter and pET28a containing LinD gene were co-transformed into BL21 Star (DE3) using eiectroporation.
- Production of isopropanol requires the expression of five genes: thl (thiolase), atoA/D (acetate :acetoacetyl-CoA transferase), adc (acetoacetate decarboxylase) and adh (secondary alcohol dehydrogenase).
- thl thiolase
- atoA/D acetate :acetoacetyl-CoA transferase
- adc acetoacetate decarboxylase
- adh secondary alcohol dehydrogenase
- thl thiolase
- adh secondary alcohol dehydrogenase
- adc acetoacetate decarboxylase
- atoA/D acetate: acetoacety!- CoA transferase
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Medicinal Chemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
Description
Claims
Priority Applications (6)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201780028600.0A CN109312373B (en) | 2016-03-09 | 2017-03-08 | Microorganisms and methods for co-production of ethylene glycol and three carbon compounds |
JP2018547961A JP7050691B2 (en) | 2016-03-09 | 2017-03-08 | Microorganisms and methods for the simultaneous production of ethylene glycol and tricarbon compounds |
AU2017231728A AU2017231728B2 (en) | 2016-03-09 | 2017-03-08 | Microorganisms and methods for the co-production of ethylene glycol and three carbon compounds |
EP17764027.3A EP3426789A4 (en) | 2016-03-09 | 2017-03-08 | Microorganisms and methods for the co-production of ethylene glycol and three carbon compounds |
BR112018067323A BR112018067323A2 (en) | 2016-03-09 | 2017-03-08 | microorganisms and methods for the co-production of ethylene glycol and three carbon compounds |
KR1020187027239A KR20190004258A (en) | 2016-03-09 | 2017-03-08 | Microorganisms and methods for the simultaneous production of ethylene glycol and 3-carbon compounds |
Applications Claiming Priority (4)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US201662305814P | 2016-03-09 | 2016-03-09 | |
US62/305,814 | 2016-03-09 | ||
US201662430742P | 2016-12-06 | 2016-12-06 | |
US62/430,742 | 2016-12-06 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2017156166A1 true WO2017156166A1 (en) | 2017-09-14 |
Family
ID=59786189
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/US2017/021421 WO2017156166A1 (en) | 2016-03-09 | 2017-03-08 | Microorganisms and methods for the co-production of ethylene glycol and three carbon compounds |
Country Status (8)
Country | Link |
---|---|
US (3) | US10774347B2 (en) |
EP (1) | EP3426789A4 (en) |
JP (1) | JP7050691B2 (en) |
KR (1) | KR20190004258A (en) |
CN (1) | CN109312373B (en) |
AU (1) | AU2017231728B2 (en) |
BR (1) | BR112018067323A2 (en) |
WO (1) | WO2017156166A1 (en) |
Cited By (9)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2019092495A1 (en) * | 2017-11-09 | 2019-05-16 | Braskem S.A. | Process for the recovery of ketones and glycols from fermentation |
CN110734479A (en) * | 2019-10-17 | 2020-01-31 | 浙江大学 | Escherichia coli cyclic adenosine monophosphate receptor protein mutants, gene engineering bacteria and application |
WO2020132737A3 (en) * | 2018-12-28 | 2020-08-06 | Braskem S.A. | Modulation of carbon flux through the meg and c3 pathways for the improved production of monoethylene glycol and c3 compounds |
US10774347B2 (en) | 2016-03-09 | 2020-09-15 | Braskem S.A. | Microorganisms and methods for the co-production of ethylene glycol and three carbon compounds |
WO2020198830A1 (en) | 2019-04-04 | 2020-10-08 | Braskem S.A. | Metabolic engineering for simultaneous consumption of xylose and glucose for production of chemicals from second generation sugars |
JP2021506247A (en) * | 2017-12-19 | 2021-02-22 | ランザテク,インコーポレイテッド | Microorganisms and methods for the biological production of ethylene glycol |
CN113710807A (en) * | 2019-02-20 | 2021-11-26 | 布拉斯科公司 | Microorganisms and methods for producing oxygenates from hexoses |
JP2022521905A (en) * | 2019-02-20 | 2022-04-13 | ブラスケム エス.エー. | Degradation pathways for pentose and hexose sugars |
US11952607B2 (en) | 2021-08-06 | 2024-04-09 | Lanzatech, Inc. | Microorganisms and methods for improved biological production of ethylene glycol |
Families Citing this family (10)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2019178135A1 (en) * | 2018-03-12 | 2019-09-19 | Braskem S.A. | Methods for the co-production of ethylene glycol and three carbon compounds |
EP3775178A4 (en) | 2018-04-06 | 2022-01-05 | Braskem S.A. | Novel nadh-dependent enzyme mutants to convert acetone into isopropanol |
CN109554386A (en) * | 2018-12-17 | 2019-04-02 | 山东大学 | A kind of utilizing works Escherichia coli are using Corncob hydrolysate as the method for substrate high yield D- xylonic |
CN110452827B (en) * | 2019-07-24 | 2020-07-31 | 中溶科技股份有限公司 | Gene recombination saccharomyces cerevisiae with detoxification function, construction method and application thereof |
EP4085146A1 (en) | 2020-02-21 | 2022-11-09 | Braskem, S.A. | Production of ethanol with one or more co-products in yeast |
CN114480232B (en) * | 2020-10-26 | 2024-02-02 | 北京化工大学 | Engineering bacterium for producing malonic acid and construction method and application thereof |
CN113234655B (en) * | 2021-05-25 | 2023-09-26 | 北京化工大学 | Recombinant bacterium for producing poly-3-hydroxybutyrate by utilizing xylose, and preparation method and application thereof |
US20240067994A1 (en) | 2022-08-24 | 2024-02-29 | Braskem S.A. | Process for the recovery of low-boiling point components from an ethanol stream |
CN116355821B (en) * | 2023-03-10 | 2023-09-29 | 湖北大学 | Recombinant strain of zymomonas mobilis for producing ethylene glycol, construction method and application thereof |
CN116904382B (en) * | 2023-07-10 | 2024-03-08 | 态创生物科技(广州)有限公司 | Host cell and method for co-producing dihydroxyacetone and bose |
Citations (13)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2006135075A1 (en) * | 2005-06-17 | 2006-12-21 | Ajinomoto Co., Inc. | A method for producing an l-amino acid using a bacterium of the enterobacteriaceae family with enhanced expression of the fucpikur operon |
US20070259411A1 (en) * | 2006-05-05 | 2007-11-08 | Bramucci Michael G | Solvent tolerant microorganisms and methods of isolation |
US20080293125A1 (en) * | 2007-04-18 | 2008-11-27 | Gevo, Inc. | Engineered microorganisms for producing isopropanol |
US20100047878A1 (en) * | 2007-02-22 | 2010-02-25 | Yuri Nagai | Method of producing l-amino acid |
US20100311135A1 (en) | 2007-07-11 | 2010-12-09 | Nozomi Takebayashi | Isopropyl alcohol- producing bacterium and method of producing isopropyl alcohol using the same |
WO2011012697A2 (en) | 2009-07-30 | 2011-02-03 | Metabolic Explorer | Mutant yqhd enzyme for the production of a biochemical by fermentation |
WO2011130378A1 (en) | 2010-04-13 | 2011-10-20 | Genomatica, Inc. | Microorganisms and methods for the production of ethylene glycol |
WO2013126721A1 (en) | 2012-02-23 | 2013-08-29 | Massachusetts Institute Of Technology | Engineering microbes and metabolic pathways for the production of ethylene glycol |
US20130280775A1 (en) * | 2010-10-29 | 2013-10-24 | Novozymes, Inc. | Recombinant N-propanol and Isopropanol Production |
WO2013163230A2 (en) * | 2012-04-24 | 2013-10-31 | Midori Renewables, Inc. | Bio-based polymers and methods of producing thereof |
WO2014004625A1 (en) | 2012-06-26 | 2014-01-03 | Genomatica, Inc. | Microorganisms for producing ethylene glycol using synthesis gas |
WO2015032761A1 (en) * | 2013-09-03 | 2015-03-12 | Roquette Freres | Improved variant of d-psicose 3-epimerase and uses thereof |
WO2015042588A1 (en) | 2013-09-23 | 2015-03-26 | Braskem S.A. | Engineered enzyme having acetoacetyl-coa hydrolase activity, microorganisms comprising same, and methods of using same |
Family Cites Families (12)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP1254244B1 (en) * | 2000-01-21 | 2010-04-14 | Danisco A/S | Manufacture of five-carbon sugars and sugar alcohols |
US7977083B1 (en) | 2006-12-28 | 2011-07-12 | The United States Of America As Represented By The Secretary Of Agriculture | Method for microbial production of xylitol from arabinose |
EP2336341A1 (en) | 2009-12-21 | 2011-06-22 | Philippe Marliere | Method for producing an alkene comprising the step of converting an alcohol by an enzymatic dehydration step |
JP5730668B2 (en) * | 2010-08-20 | 2015-06-10 | 一般財団法人電力中央研究所 | Alcohol production method and apparatus using microorganisms |
WO2012088467A2 (en) | 2010-12-22 | 2012-06-28 | Mascoma Corporation | Genetically modified clostridium thermocellum engineered to ferment xylose |
WO2012174439A2 (en) | 2011-06-17 | 2012-12-20 | Invista Technologies S.A R.L. | Methods of producing four carbon molecules |
KR101351879B1 (en) | 2012-02-06 | 2014-01-22 | 명지대학교 산학협력단 | ethane―1,2-diol producing microorganism and a method for producinig ethane―1,2-diol using the same |
US8703455B2 (en) | 2012-08-29 | 2014-04-22 | Scientist of Fourtune, S.A. | Production of volatile dienes by enzymatic dehydration of light alkenols |
WO2014184345A1 (en) * | 2013-05-17 | 2014-11-20 | Global Bioenergies | Alkenol dehydratase variants |
WO2015002977A1 (en) | 2013-07-01 | 2015-01-08 | Braskem S/A Ap 09 | Modified microorganisms and methods of using same for anaerobic coproduction of isoprene and acetic acid |
FR3028529B1 (en) | 2014-11-19 | 2016-12-30 | Inst Nat De La Rech Agronomique Inra | PROCESS FOR PRODUCING AT LEAST ONE METABOLITE OF INTEREST BY TRANSFORMING A PENTOSE IN A MICROORGANISM |
EP3426789A4 (en) | 2016-03-09 | 2020-01-08 | Braskem S.A. | Microorganisms and methods for the co-production of ethylene glycol and three carbon compounds |
-
2017
- 2017-03-08 EP EP17764027.3A patent/EP3426789A4/en active Pending
- 2017-03-08 KR KR1020187027239A patent/KR20190004258A/en not_active Application Discontinuation
- 2017-03-08 US US15/453,094 patent/US10774347B2/en active Active
- 2017-03-08 JP JP2018547961A patent/JP7050691B2/en active Active
- 2017-03-08 WO PCT/US2017/021421 patent/WO2017156166A1/en active Application Filing
- 2017-03-08 CN CN201780028600.0A patent/CN109312373B/en active Active
- 2017-03-08 BR BR112018067323A patent/BR112018067323A2/en unknown
- 2017-03-08 AU AU2017231728A patent/AU2017231728B2/en not_active Expired - Fee Related
- 2017-10-06 US US15/726,978 patent/US10941424B2/en active Active
- 2017-10-06 US US15/726,983 patent/US10774348B2/en active Active
Patent Citations (13)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2006135075A1 (en) * | 2005-06-17 | 2006-12-21 | Ajinomoto Co., Inc. | A method for producing an l-amino acid using a bacterium of the enterobacteriaceae family with enhanced expression of the fucpikur operon |
US20070259411A1 (en) * | 2006-05-05 | 2007-11-08 | Bramucci Michael G | Solvent tolerant microorganisms and methods of isolation |
US20100047878A1 (en) * | 2007-02-22 | 2010-02-25 | Yuri Nagai | Method of producing l-amino acid |
US20080293125A1 (en) * | 2007-04-18 | 2008-11-27 | Gevo, Inc. | Engineered microorganisms for producing isopropanol |
US20100311135A1 (en) | 2007-07-11 | 2010-12-09 | Nozomi Takebayashi | Isopropyl alcohol- producing bacterium and method of producing isopropyl alcohol using the same |
WO2011012697A2 (en) | 2009-07-30 | 2011-02-03 | Metabolic Explorer | Mutant yqhd enzyme for the production of a biochemical by fermentation |
WO2011130378A1 (en) | 2010-04-13 | 2011-10-20 | Genomatica, Inc. | Microorganisms and methods for the production of ethylene glycol |
US20130280775A1 (en) * | 2010-10-29 | 2013-10-24 | Novozymes, Inc. | Recombinant N-propanol and Isopropanol Production |
WO2013126721A1 (en) | 2012-02-23 | 2013-08-29 | Massachusetts Institute Of Technology | Engineering microbes and metabolic pathways for the production of ethylene glycol |
WO2013163230A2 (en) * | 2012-04-24 | 2013-10-31 | Midori Renewables, Inc. | Bio-based polymers and methods of producing thereof |
WO2014004625A1 (en) | 2012-06-26 | 2014-01-03 | Genomatica, Inc. | Microorganisms for producing ethylene glycol using synthesis gas |
WO2015032761A1 (en) * | 2013-09-03 | 2015-03-12 | Roquette Freres | Improved variant of d-psicose 3-epimerase and uses thereof |
WO2015042588A1 (en) | 2013-09-23 | 2015-03-26 | Braskem S.A. | Engineered enzyme having acetoacetyl-coa hydrolase activity, microorganisms comprising same, and methods of using same |
Non-Patent Citations (16)
Title |
---|
ALKIM ET AL., MICROB CELL FACT, vol. 14, 2015, pages 127 |
BOONSTRA B ET AL.: "The udhA gene of Escherichia coli encodes a soluble pyridine nucleotide transhydrogenase", J BACTERIOL, vol. 181, no. 3, 1999, pages 1030 - 1034 |
CHEN ET AL., MET. ENG., vol. 33, 2016, pages 12 - 18 |
DALPHIN ET AL., NUCL. ACIDS RES., vol. 24, 1996, pages 216 - 218 |
DATABASE UniProtKB [O] 8 November 2005 (2005-11-08), XP055421739, Database accession no. PAB87 * |
EHRENSBERGER ET AL., STRUCTURE, vol. 14, 2006, pages 567 - 575 |
FEMS MICROBIOL LETT, vol. 204, no. 2, pages 247 - 252 |
GOEDDEL: "Gene Expression Technology: Methods in Enzymology", vol. 185, 1990, ACADEMIC PRESS |
HAOBERRY, PROTEIN ENG DES SEL, vol. 17, 2004, pages 689 - 697 |
LI ET AL., PROG. NAT. SCI., vol. 18, no. 12, 2008, pages 1519 - 1524 |
MANIATIS ET AL., SCIENCE, vol. 236, 1987, pages 1237 - 1245 |
MURRAY ET AL., NUCL. ACIDS RES., vol. 17, 1989, pages 477 - 508 |
PATEL ET AL., PROTEIN ENGINEERING, DESIGN & SELECTION, vol. 25, no. 7, 2012, pages 331 - 336 |
SAUER U: "The soluble and membrane-bound transhydrogenases UdhA and PntAB have divergent functions in NADPH metabolism of Escherichia coli", J BIOL CHEM, vol. 279, no. 8, 2004, pages 6613 - 6619, XP002274624, DOI: 10.1074/jbc.M311657200 |
See also references of EP3426789A4 |
SULZENBACHER ET AL., J. MOL. BIOL., vol. 342, no. 2, 2004, pages 489 - 502 |
Cited By (24)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US10941424B2 (en) | 2016-03-09 | 2021-03-09 | Braskem S.A. | Microorganisms and methods for the co-production of ethylene glycol and three carbon compounds |
US10774347B2 (en) | 2016-03-09 | 2020-09-15 | Braskem S.A. | Microorganisms and methods for the co-production of ethylene glycol and three carbon compounds |
US10774348B2 (en) | 2016-03-09 | 2020-09-15 | Braskem S.A. | Microorganisms and methods for the co-production of ethylene glycol and three carbon compounds |
JP2021502088A (en) * | 2017-11-09 | 2021-01-28 | ブラスケム・エス・エー | How to recover ketones and glycols from fermentation |
JP7124075B2 (en) | 2017-11-09 | 2022-08-23 | ブラスケム・エス・エー | Method for recovering ketones and glycols from fermentation |
US10710950B2 (en) | 2017-11-09 | 2020-07-14 | Braskem S.A. | Process for the recovery of ketones and glycols from fermentation |
WO2019092495A1 (en) * | 2017-11-09 | 2019-05-16 | Braskem S.A. | Process for the recovery of ketones and glycols from fermentation |
JP2021506247A (en) * | 2017-12-19 | 2021-02-22 | ランザテク,インコーポレイテッド | Microorganisms and methods for the biological production of ethylene glycol |
JP7304859B2 (en) | 2017-12-19 | 2023-07-07 | ランザテク,インコーポレイテッド | Microorganisms and methods for bioproduction of ethylene glycol |
US11555209B2 (en) | 2017-12-19 | 2023-01-17 | Lanzatech, Inc. | Microorganisms and methods for the biological production of ethylene glycol |
WO2020132737A3 (en) * | 2018-12-28 | 2020-08-06 | Braskem S.A. | Modulation of carbon flux through the meg and c3 pathways for the improved production of monoethylene glycol and c3 compounds |
US12006526B2 (en) | 2019-02-20 | 2024-06-11 | Braskem S.A. | Microorganisms and methods for the production of oxygenated compounds from hexoses |
CN113710807A (en) * | 2019-02-20 | 2021-11-26 | 布拉斯科公司 | Microorganisms and methods for producing oxygenates from hexoses |
JP7463388B2 (en) | 2019-02-20 | 2024-04-08 | ブラスケム エス.エー. | Degradative pathways for pentose and hexose sugars |
JP2022521905A (en) * | 2019-02-20 | 2022-04-13 | ブラスケム エス.エー. | Degradation pathways for pentose and hexose sugars |
JP2022521904A (en) * | 2019-02-20 | 2022-04-13 | ブラスケム エス.エー. | Microorganisms and methods for the production of oxygen-containing compounds from hexose |
JP7504112B2 (en) | 2019-02-20 | 2024-06-21 | ブラスケム エス.エー. | Microorganisms and methods for the production of oxygenates from hexoses - Patents.com |
US11584944B2 (en) | 2019-02-20 | 2023-02-21 | Braskem S.A. | Degradation pathway for pentose and hexose sugars |
WO2020198830A1 (en) | 2019-04-04 | 2020-10-08 | Braskem S.A. | Metabolic engineering for simultaneous consumption of xylose and glucose for production of chemicals from second generation sugars |
US11746361B2 (en) | 2019-04-04 | 2023-09-05 | Braskem S.A. | Metabolic engineering for simultaneous consumption of Xylose and glucose for production of chemicals from second generation sugars |
CN114008197A (en) * | 2019-04-04 | 2022-02-01 | 布拉斯科公司 | Metabolic engineering for simultaneous consumption of xylose and glucose to produce chemicals from second generation sugars |
CN110734479B (en) * | 2019-10-17 | 2021-07-06 | 浙江大学 | Escherichia coli cyclic adenosine monophosphate receptor protein mutant, gene engineering bacteria and application |
CN110734479A (en) * | 2019-10-17 | 2020-01-31 | 浙江大学 | Escherichia coli cyclic adenosine monophosphate receptor protein mutants, gene engineering bacteria and application |
US11952607B2 (en) | 2021-08-06 | 2024-04-09 | Lanzatech, Inc. | Microorganisms and methods for improved biological production of ethylene glycol |
Also Published As
Publication number | Publication date |
---|---|
US20180023101A1 (en) | 2018-01-25 |
EP3426789A1 (en) | 2019-01-16 |
AU2017231728A1 (en) | 2018-08-30 |
AU2017231728B2 (en) | 2021-12-16 |
BR112018067323A2 (en) | 2019-01-29 |
US10774348B2 (en) | 2020-09-15 |
CN109312373B (en) | 2022-07-19 |
KR20190004258A (en) | 2019-01-11 |
JP2019507604A (en) | 2019-03-22 |
US20180179558A1 (en) | 2018-06-28 |
US20170260551A1 (en) | 2017-09-14 |
US10941424B2 (en) | 2021-03-09 |
EP3426789A4 (en) | 2020-01-08 |
US10774347B2 (en) | 2020-09-15 |
JP7050691B2 (en) | 2022-04-08 |
CN109312373A (en) | 2019-02-05 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
AU2017231728B2 (en) | Microorganisms and methods for the co-production of ethylene glycol and three carbon compounds | |
JP7015825B2 (en) | Method of forming alkenes through enzymatic dehydration of alkanols | |
US11584944B2 (en) | Degradation pathway for pentose and hexose sugars | |
US12006526B2 (en) | Microorganisms and methods for the production of oxygenated compounds from hexoses | |
US11384369B2 (en) | Microorganisms and methods for the production of glycolic acid and glycine via reverse glyoxylate shunt | |
WO2014153207A2 (en) | Recombinant microorganisms having a methanol elongation cycle (mec) | |
US20200208160A1 (en) | Modulation of carbon flux through the meg and c3 pathways for the improved production of monoethylene glycol and c3 compounds | |
US20200048662A1 (en) | Microorganisms and methods for the co-production of ethylene glycol and isobutene | |
WO2018122388A1 (en) | Conversion of methylglyoxal into hydroxyacetone using novel enzymes and applications thereof | |
US20240229047A1 (en) | Carboxylic acid platform for fuel and chemical production at high carbon and energy efficiency | |
BR122023027756A2 (en) | MICROORGANISMS AND METHODS FOR THE PRODUCTION OF GLYCOLIC ACID AND GLYCINE THROUGH REVERSE GLYOXYLATE SHIFT | |
Fast | Engineering bacterial CO2 fixation to enhance biofuel and biochemical yields |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
ENP | Entry into the national phase |
Ref document number: 2017231728 Country of ref document: AU Date of ref document: 20170308 Kind code of ref document: A |
|
ENP | Entry into the national phase |
Ref document number: 2018547961 Country of ref document: JP Kind code of ref document: A |
|
NENP | Non-entry into the national phase |
Ref country code: DE |
|
ENP | Entry into the national phase |
Ref document number: 20187027239 Country of ref document: KR Kind code of ref document: A |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2017764027 Country of ref document: EP |
|
ENP | Entry into the national phase |
Ref document number: 2017764027 Country of ref document: EP Effective date: 20181009 |
|
REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112018067323 Country of ref document: BR |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 17764027 Country of ref document: EP Kind code of ref document: A1 |
|
ENP | Entry into the national phase |
Ref document number: 112018067323 Country of ref document: BR Kind code of ref document: A2 Effective date: 20180831 |