WO2017142283A1 - 간암 치료 또는 예방용 조성물 - Google Patents
간암 치료 또는 예방용 조성물 Download PDFInfo
- Publication number
- WO2017142283A1 WO2017142283A1 PCT/KR2017/001575 KR2017001575W WO2017142283A1 WO 2017142283 A1 WO2017142283 A1 WO 2017142283A1 KR 2017001575 W KR2017001575 W KR 2017001575W WO 2017142283 A1 WO2017142283 A1 WO 2017142283A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- hepatocellular carcinoma
- pi3k
- cells
- ros
- tert
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
- A61K31/505—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
- A61K31/519—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with heterocyclic rings
- A61K31/52—Purines, e.g. adenine
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
- A61K31/505—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
- A61K31/517—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with carbocyclic ring systems, e.g. quinazoline, perimidine
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/14—Particulate form, e.g. powders, Processes for size reducing of pure drugs or the resulting products, Pure drug nanoparticles
- A61K9/16—Agglomerates; Granulates; Microbeadlets ; Microspheres; Pellets; Solid products obtained by spray drying, spray freeze drying, spray congealing,(multiple) emulsion solvent evaporation or extraction
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/20—Pills, tablets, discs, rods
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/48—Preparations in capsules, e.g. of gelatin, of chocolate
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
Definitions
- the present application relates to a composition for preventing and treating liver cancer.
- liver cancer is the second leading cause of cancer-related deaths worldwide, with hepatocellular carcinoma (HCC) accounting for 85-90% of liver cancers. Approximately 70-80% of hepatocellular carcinomas are found only after progression to advanced grade. Sorafenib is currently the only drug approved for the treatment of advanced hepatocellular carcinoma.
- HCC hepatocellular carcinoma
- HCC cirrhosis .
- HBV hepatitis virus
- alcohol intake hepatitis hepatitis
- nonalcoholic fatty liver which makes it difficult to formulate strategies for treating HCC patients based on the history of cirrhosis alone.
- HCC development is known to involve a variety of pathways including the Wnt- ⁇ -catenin pathway, p53-Rb pathway, chromatin remodeling, and phosphatidylinositol 3-kinase (PI3K) -AKT (El-Serag HB, Rudolph KL. Hepatocellular carcinoma: epidemiology and molecular carcinogenesis.Gastroenterology. 2007; 132: 2557-76; Schulze K, Imbeaud S, Letouze E, Alexandrov LB, Calderaro J, Rebouissou S, et al. Exome sequencing of hepatocellular carcinomas identifies new mutational signatures and potential therapeutic targets. Nat Genet. 2015; 47: 505-11) Despite these findings, major determinants of progression from early HCC to progressive HCC (GII and GIII HCC) have not yet been identified.
- PI3K phosphatidylinositol 3-kinase
- Idelariship a PI3K inhibitor
- This inhibitor binds to the ATP-binding site of p110 ⁇ to inactivate the PI3K-AKT signaling pathway, where activation of the PI3K pathway is mediated by the class I PI3K catalytic isotypes p110 ⁇ , p110 ⁇ , p110 ⁇ and p110 ⁇ .
- P110 ⁇ is abundantly expressed in hematopoietic stem cells, and PI3K-AKT signaling essentially contributes to immune cell proliferation and stimulation of related cytokines and chemokines.
- the Idelariship has focused on cell survival, particularly on the death of immune cells.
- Korean Patent Laid-Open Publication No. 10-2014-0022836 relates to a combination therapy for hematologic malignancies and discloses the use of idelariship for the treatment of lymphocytic leukemia.
- the present invention is to provide a pharmaceutical composition that inhibits the proliferation of hepatocellular carcinoma by inhibiting TERT expression and telomerase in hepatocellular carcinoma cell line.
- the hepatocellular carcinoma is a hepatocellular carcinoma in which ROS and PI3K isoform p110 delta are overexpressed.
- the hepatocellular carcinoma according to the present application is advanced hepatocellular carcinoma
- the advanced hepatocellular carcinoma may be determined according to the liver cancer classification method according to several advanced stages known in the art, for example, but not limited thereto Advanced hepatocellular carcinoma is stage II or higher hepatocellular carcinoma based on the tumor-node-metastasis (TNM) of the Liver Cancer Study Group of Japan (LCSGJ).
- TNM tumor-node-metastasis
- LCSGJ Liver Cancer Study Group of Japan
- the advanced hepatocellular carcinoma is grade II or higher hepatocellular carcinoma based on the Edmonson Steiner grading system, which is a histological grade of tumor differentiation according to the degree of cancer differentiation.
- the pharmaceutical composition according to the present invention treats hepatocellular carcinoma by inhibiting ROS-PI3K-AKT-TERT signaling.
- the present disclosure provides the compound 5-fluoro-3-phenyl-2-[(1S) -1- (7H-purin-6-ylamino) propyl] -4 (3H) -quinazolinone,
- a kit for inhibiting PI3K isoform p110 delta expression in liver cancer cells or liver cancer cell lines in vivo or in vitro comprising an acceptable salt.
- liver cancer cells having a kit according to the present invention have high ROS levels.
- the present application is also directed to the compound 5-fluoro-3-phenyl-2-[(1S) -1- (7H-purin-6-ylamino) propyl] -4 (3H) -quinazolinone, its pharmaceuticals
- the present disclosure also provides 5-fluoro-3-phenyl-2-[(1S) -1- (7H-purin-6-ylamino) propyl] -4 (3H) -quinazolinone, or It relates to a method for inhibiting PI3K isoform p110 delta expression of the liver cancer cells, comprising the step of treating the salt thereof.
- the present disclosure also provides 5-fluoro-3-phenyl-2-[(1S) -1- (7H-purin-6-ylamino) propyl] -4 (3H) -quinazolinone, Or it provides a method for inhibiting the ROS-PI3K-AKT-TERT signaling pathway of the liver cancer cells comprising the step of treating the salt thereof.
- the liver cancer cells are cells having increased ROS levels, and include all liver cancer cell lines or liver cancer cells or tissues.
- the present disclosure also provides a pharmaceutically effective amount of compound 5-fluoro-3-phenyl-2-[(1S) -1- (7H-purin-6-ylamino) in a subject in need thereof.
- Propyl] -4 (3H) -quinazolinone or a pharmaceutically acceptable salt thereof is provided.
- the hepatocellular carcinoma is a hepatocellular carcinoma in which ROS and PI3K isoform p110 delta are overexpressed.
- the hepatocellular carcinoma according to the present application is advanced hepatocellular carcinoma
- the advanced hepatocellular carcinoma may be determined according to the liver cancer classification method according to several advanced stages known in the art, for example, but not limited thereto Advanced hepatocellular carcinoma is stage II or higher hepatocellular carcinoma based on the tumor-node-metastasis (TNM) of the Liver Cancer Study Group of Japan (LCSGJ).
- TNM tumor-node-metastasis
- LCSGJ Liver Cancer Study Group of Japan
- the advanced hepatocellular carcinoma is grade II or higher hepatocellular carcinoma based on the Edmonson Steiner grading system, which is a histological grade of tumor differentiation according to the degree of cancer differentiation.
- the pharmaceutical composition according to the present invention may inhibit the proliferation of tumors by inhibiting PI3K-AKT-TERT signaling activation activated by ROS in hepatocellular carcinoma (HCC), thereby reducing TERT expression and decreasing telomere length.
- HCC hepatocellular carcinoma
- p110 delta which is a ROS and thus a PIK3 isotype, may be useful for the treatment of advanced liver cancer or malignant liver cancer.
- FIG. 1 shows that Edelarypium according to one embodiment of the present disclosure inhibits HCC cell proliferation, PI3K-AKT-TERT signaling, and telomere length retention.
- AC It demonstrates dose-dependent inhibition of idelarism in two AKT activated HCC cell lines (activated of PI3K / AKT signaling) and non-liver cancer cell lines derived from normal liver (PI3K / AKT signaling is inactivated).
- Two HCC cell lines, Huh7 cells (A) and Hep3B cells (B), and non-hepatic cancer cell lines THLE-3 cells (C) derived from normal livers were treated with a range of doses of Idelariship, and cell proliferation was determined by MTS assay. Analyzed.
- Immunostaining images in the box indicate that the expression of p110 ⁇ , which is selectively targeted by edellaribium, is higher in HCC cells than THLE-3. Scale bar, 10 ⁇ m.
- Target inhibition and downstream signaling after edlarariship treatment in DF AKT activated HCC cell line model and non-hepatic cancer cell line model derived from AKT inactivated normal liver.
- Telomeres were shortened after edlarariship in GI and HCC cell lines. Telomere length was quantified by telomeres Southern blot (G), immunoFISH (H, J, and L), and quantitative PCR (I, K, and M).
- T / S ratio is the ratio of telomere repeat copy number to single-copy gene copy number.
- POC control percent.
- FIG. 2 shows that ROS promotes PI3K-AKT-TERT signaling activation and telomere elongation in HCC cell lines, and edellariship inhibits ROS-mediated PI3K-AKT-TERT signaling activation.
- P110 isotype mRNA levels in A, Huh7, Hep3B, and THLE-3 cells.
- CE cell viability (bright blue), telomere fluorescence (red), and TERT expression (black) and percent of TERT protein immunoassay in the presence of various concentrations of H 2 O 2 and ROS scavenger NAC. Average telomeres length is determined by FlowFISH. Huh7 cells (C), Hep3B cells (D), and THLE-3 cells (E). POC, control percent. NAC, N-acetylcysteine. FH, 300 ⁇ mol / LH 2 O 2 - The HCC cell lines and 150 ⁇ mol / LH 2 O 2 treatment After the treatment of the della risip in THLE-3 cells treated illustrates the target and inhibit downstream signaling.
- TERT expression was normalized to that of ⁇ -actin.
- POC control percent. Shows the telomere activity in the treated THLE-3 cells - IK, the presence or absence della risip treatment under 300 ⁇ mol / LH 2 O 2 - treated HCC cell lines and 150 ⁇ mol / LH 2 O 2.
- FIG. 3 shows that ROS-PI3K-AKT- ⁇ -catenin-TERT activation is inhibited by PI3K-AKT inhibitors.
- FIG. 4 shows that TERT expression and poor survival in HCC patients, HCC tumor tissues are positively associated with expression of the idelariship specific molecule p110 ⁇ .
- P110 ⁇ expression in A, GI, GII, and GIII HCC tumor tissues (n 98).
- B, p110 ⁇ mRNA shows mean TERT expression (horizontal line) in HCC tissues with low or high levels (n 98).
- C survival without relapse proportional to p110 ⁇ expression.
- n 84. Samples were divided into two groups based on mean p110 ⁇ expression. Survival was measured using the Kaplan-Meier method; Differences in survival were compared using a log-rank test. Corresponding risk (HR) is shown as survival plot.
- HR Corresponding risk
- RNA Pol II RNA Polymerase II.
- the present application is directed to the discovery that ROS overexpression of PIK3 isoforms, particularly p110 delta, in hepatocellular carcinoma, especially in advanced stage hepatocellular carcinoma, can be effectively treated for hepatocellular carcinoma, especially advanced stage hepatocellular carcinoma. It is based.
- the present application provides a compound 5-fluoro-3-phenyl-2-[(1S) -1- (7H-purin-6-ylamino) propyl] -4 (3H) -quina based on the identification of the pathogenesis of hepatocellular carcinoma.
- the compound '5-fluoro-3-phenyl-2-[(1S) -1- (7H-purin-6-ylamino) propyl] -4 (3H) -quinazolinone' herein refers to an idelariship ( idelalisib), the compounds are disclosed in International Publication No. WO 2012/152210 which is incorporated herein by reference.
- PI3K-Akt inhibitors in particular selective p110 ⁇ kinase inhibitors
- Huh7 cells and Hep3B cells which are HCC cell lines in one embodiment of the present application (FIGS. 1A and B)
- Telomerase reverse transcriptase expression It has been found herein that it has anti-telomerase efficacy that inhibits elongation and inhibits elongation of telomere length.
- composition herein binds to the ATP-binding site of p110 ⁇ to inactivate the PI3K-AKT signaling pathway.
- PI3K plays an essential role in regulating cell growth, proliferation, and metabolism by activating downstream kinases such as AKT, wherein activation of the PI3K pathway is mediated by class I PI3K catalytic isomers p110 ⁇ , p110 ⁇ , p110 ⁇ , and p110 ⁇ , This class of enzyme phosphorylates phosphatidylinositol 4,5-bisphosphate (PIP2), resulting in the essential second messenger substance, phosphatidylinositol 3,4,5-bisphosphate (PIP3).
- PIP2 phosphatidylinositol 4,5-bisphosphate
- PIP3 phosphatidylinositol 3,4,5-bisphosphate
- composition of the present invention inhibits PI3K-AKT-TERT signaling activated by Reactive Oxygen Species (ROS) (FIG. 2).
- ROS Reactive Oxygen Species
- composition of the present invention inhibits ROS-PI3K-AKT- ⁇ catenin-TERT activation (FIG. 3).
- PI3K-Akt signaling is overactivated by ROS in the present application, it was confirmed that nuclear expression of ⁇ -catenin is increased to increase TERT expression and elongate telomeres (FIG. 3C and FIG. 4).
- telomere shortening can also be caused by oxidative stress, which is mediated by intracellular increases in free radicals (ROS) in vivo.
- ROS free radicals
- telomere reverse transcriptase (TERT) -mediated activity during the course of various human tumors increases the telomere length, allowing tumor cells to grow indefinitely, which is preserved in HCC tumors.
- inhibition of PI3K-AKT signaling inhibited telomerase expression and inhibited telomere elongation.
- the present application includes the antitelomerase 5-fluoro-3-phenyl-2-[(1S) -1- (7H-purin-6-ylamino) propyl] -4 (3H) -quinazolinone It relates to a pharmaceutical composition for preventing and treating liver cancer.
- hepatocellular carcinoma refers to primary malignant tumors that occur in the liver tissue itself that occurs in patients with risk factors such as alcohol abuse, viral hepatitis, and target liver disease. Hepatocellular carcinoma accounts for more than 90% of all liver cancers, with 40-80% of patients recurring, most often recurring in the liver, but may also appear in the medial wall and mediastinum surrounding the lungs, lymph nodes, and abdominal cavity. Included.
- the hepatocellular carcinoma of the composition according to the present application is hepatocellular carcinoma of grade II (grade II) or higher in hepatocellular carcinoma divided into 1 to 4 stages according to the progression stage.
- hepatocellular carcinoma which the composition according to the present invention is effective may be hepatocellular carcinoma of stage 2 (stage II) or more in hepatocellular carcinoma divided into 1 to 4 stages according to the progression stage.
- treatment means any action that improves or beneficially alters the symptoms of a metabolic disease by administration of the present compositions.
- Those skilled in the art to which the present application belongs, will be able to determine the extent to which the composition of the present invention is correct, improved, improved and treated with reference to the data presented by the Korean Medical Association and the like. .
- Pharmaceutically acceptable addition salts used in the present invention include pharmaceutically acceptable acid addition salts.
- the expression pharmaceutically acceptable salt is a concentration that has a relatively nontoxic and harmless effect on the patient and that any side effects due to the salt do not degrade the beneficial efficacy of the base compound of formula 1, or Means inorganic addition salts.
- the acid may be a halogen acid such as hydrochloric acid or bromic acid; Inorganic acids such as sulfuric acid, nitric acid and phosphoric acid; And acetic acid, trifluoroacetic acid, propanoic acid, hydroxyacetic acid, lactic acid, pyruvic acid, oxalic acid, malonic acid, succinic acid (ie, butanedioic acid), maleic acid, fumaric acid, malic acid, tartaric acid, citric acid, methanesulfonic acid, ethane Organic acids such as sulfonic acid, benzenesulfonic acid, p-toluenesulfonic acid, cyclic acid, salicylic acid, p-amino-salicylic acid and pamoic acid.
- halogen acid such as hydrochloric acid or bromic acid
- Inorganic acids such as sulfuric acid, nitric acid and phosphoric acid
- acetic acid trifluoro
- Base salt forms are, for example, ammonium salts, alkali and alkaline earth metal salts, for example lithium, sodium, potassium, magnesium and calcium salts and the like, and also organic bases such as benzatin, N-methyl-D-glucamine, hydramine salts. Salts with, and salts with amino acids such as arginine, lysine and the like.
- the therapeutic or pharmaceutical composition according to the invention may be formulated in a suitable form with the pharmaceutically acceptable carriers generally used.
- 'Pharmaceutically acceptable refers to a composition that is physiologically acceptable and does not cause an allergic or similar reaction, such as gastrointestinal disorders, dizziness or the like, when administered to a human.
- pharmaceutically acceptable carriers include, for example, water, suitable oils, saline, carriers for parenteral administration such as aqueous glucose and glycols, and the like, and may further include stabilizers and preservatives. Suitable stabilizers include antioxidants such as sodium hydrogen sulfite, sodium sulfite or ascorbic acid.
- Suitable preservatives include benzalkonium chloride, methyl- or propyl-paraben and chlorobutanol.
- the composition according to the present invention if necessary according to the administration method or dosage form, suspensions, dissolution aids, stabilizers, isotonic agents, preservatives, adsorption agents, surfactants, diluents, excipients, pH adjusters, analgesics, buffers, Antioxidant etc. can be contained suitably.
- Pharmaceutically acceptable carriers and formulations suitable for the present invention including those exemplified above, are described in detail in Remington's Pharmaceutical Sciences, latest edition.
- compositions herein may be prepared in unit dose form by formulating with a pharmaceutically acceptable carrier and / or excipient, according to methods readily available to those of ordinary skill in the art. It can be prepared by incorporation into a dose container. The formulations can then be in the form of solutions, suspensions or emulsions in oil or aqueous media or in the form of powders, granules, tablets or capsules.
- the method of administering the pharmaceutical composition of the present application may be easily selected according to the formulation, and may be administered to mammals such as domestic animals and humans by various routes.
- it may be formulated in the form of powders, tablets, pills, granules, dragees, hard or soft capsules, liquids, emulsions, suspensions, syrups, elixirs, external preparations, suppositories, sterile injectable solutions, and so on.
- Oral or parenteral administration, in particular parenteral administration may be preferred.
- Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, suppositories.
- non-aqueous solvent and the suspension solvent propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate, and the like can be used.
- base of the suppository witepsol, macrogol, tween 61, cacao butter, laurin butter, glycerol, gelatin and the like can be used.
- compositions herein are administered in pharmaceutically effective amounts.
- a pharmaceutically effective amount is a result of administering a compound according to the present application at a constant dose for a certain period of time, thereby producing a desired effect, that is, treating or alleviating hepatocellular carcinoma.
- the dosage may vary depending on the patient's weight, age, sex, health condition, diet, time of administration, method of administration, rate of excretion, and severity of the disease, but the effective dosage is usually used for adults (60kg).
- As the composition 1 to 500mg preferably 30 to 300mg can be administered once or divided into several times a day.
- the dosage may refer to the dosage of an existing drug, but it will be apparent to those skilled in the art that the dosage may vary depending on various conditions, so that the dosage may vary. It does not limit the scope of the invention.
- the frequency of administration can be administered once a day or divided into several times within the desired range, the administration period is not particularly limited.
- the present disclosure provides the compound 5-fluoro-3-phenyl-2-[(1S) -1- (7H-purin-6-ylamino) propyl] -4 (3H) -quinazolinone, Inhibiting the expression of the PI3K isoform p110 delta in liver cancer cells or hepatocellular cell lines, in particular hepatocellular carcinoma cells overexpressed ROS, in vitro or in vitro using acceptable salts, or ROS-PI3K-AKT-TERT signaling It provides a method and kit for inhibiting. Compounds used in the methods and kits and matters related to the inhibition of the biological phenomena may be referred to the foregoing.
- the compound according to the present invention or a composition comprising the same may be effectively used for the treatment of hepatocellular carcinoma.
- the present application provides a pharmaceutically effective amount of the compound 5-fluoro-3-phenyl-2-[(1S) -1- (7H-purin-6-ylamino) propyl] -4 (3H)-
- a method of treating hepatocellular carcinoma comprising administering quinazolinone or a pharmaceutically acceptable salt thereof to a subject in need thereof.
- HCC cell lines (Huh7 and Hep3B) were obtained from the Korea Cell Line Bank (KCLB, Seoul, Korea).
- THLE-3 cell line (immortalized human liver epithelial cell line produced by infection with the SV40 large T antigen) was obtained from the American Type Culture Collection (ATCC).
- ATCC American Type Culture Collection
- KCLB and ATCC performed cell line authentication using DNA fingerprinting with short tandem repeat analysis. All cell lines were examined for mycoplasma contamination.
- HCC cell lines were grown at 37 ° C. in a humidified 5% CO 2 incubator in DMEM (Welgene, Gyeongsan-si, Korea) supplemented with 10% fetal bovine serum (GenDepot, Barker, TX, USA).
- THLE-3 was incubated in a humidified 5% CO 2 incubator, 37 ° C. in BEGM (Lonza) supplemented with 10% fetal bovine serum as recommended in the ATCC manual.
- H 2 O 2 300 ⁇ mol / L hydrogen peroxide
- H1009 300 ⁇ mol / L hydrogen peroxide
- the cells were treated with 5 mmol / L N-acetylcysteine (NAC) (SigmaAldrich; A7250), 25 ⁇ mol / L idelalisib (LC Laboratoties, Woburn, MA) for 1 hour prior to the addition of H 2 O 2 .
- NAC N-acetylcysteine
- LC Laboratoties, Woburn, MA 25 ⁇ mol / L idelalisib
- the cells were then hybridized with buffer (70% deionized formamide (Amresco, Solon, OH, USA), 20 mmol / L TrisHCl [pH 6.8], 1% BSA, and 1 nmol / L FAM-labeled telomere PNA) nucleic acid) probe (TelGFAM: TTAGGGTTAGGGTTAGGG) (Panagene, Daejeon, Korea) or 1nmol / L FAM-labeled centromere PNA probe (CentFAM:.
- AAACTAGACAGAAGCATT was immersion suspending jaeseo to (Panagene) volume of hybridization buffer of 10 5 cells per The samples were then incubated for 10 minutes in a water bath at 85 ° C. The telomeres were hybridized for 3 hours at room temperature and in the dark, and then each sample was washed with a wash solution (Wash I: 70%).
- Hybridization solutions included 70% formaldehyde in 2 ⁇ SSC, 5% MgCl 2 , 0.25% blocking reagent (Roche, Basel, Switzerland), 15.4 nmol / L of Cy3-labeled telomere PNA probe (TelCCy3: CCCTAACCCTAACCCTAA) (Panagene, Daejeon, Korea), and 18.4 nmol / L FAM-label Centromere PNA probe (CentFAM: AAACTAGACAGAAGCATT) (Panagene). The slides were washed and then rinsed with PBS containing DAPI and then sealed with DAPI mounting medium (Vector Laboratories, Burlingame, CA, USA).
- telomere fluorescence level and the 8-oxo-dG fluorescence level refer to the ratio of telomere fluorescence intensity to centromere fluorescence intensity and the 8-oxo-dG fluorescence intensity to centromere fluorescence intensity ratio, respectively.
- telomere fluorescence intensity was quantified by quantification of telomere fluorescence intensity, centromere fluorescence intensity, and 8-oxo-dG fluorescence intensity.
- Telomere fluorescence levels and 8-oxo-dG fluorescence levels of tumor tissue were calculated by dividing the fluorescence levels of corresponding non-tumor tissues in 5 random fields. Image analysis was performed using Image-Pro plus 6.0 software (Media Cybernetics, Inc., Rockville, MD, USA).
- telomeres length was determined using the non-radioactive chemifluorescence TeloTAGGG telomeres length assay (Roche; Cat. No. 12 209 136 001) according to the manual.
- genomic DNA was isolated from HCC cells using the GeneJET Genomic DNA Purification Kit (Thermo Scientific; # K0721), 4 ⁇ g of genomic DNA was transferred to 16 units at 37 ° C. with 20 units of Hinf 1 (Enzynomics) and Rsa 1 (Enzynomics). Digest for time. The digested DNA was isolated by 0.8% agarose gel electrophoresis and then transferred to a positively charged nylon membrane using capillary transfer.
- DIG digoxigenin
- telomere repeat copy number T and S were determined by quantitative PCR analysis using genomic DNA extracted from the cells, and the previous method (Cawthon RM. Telomere length measurement that modified the T / S ratio in succession) by a novel monochrome multiplex quantitative PCR method.Nucleic Acids Res. 2009; 37: e21).
- p110 ⁇ -specific (1: 500, Abcam; ab32401) antibodies were used.
- the slide was washed and sealed using a medium containing DAPI (Vector Laboratories). Images were acquired using a confocal microscope (LSM 700; Carl Zeiss, Oberkochen, Germany). Image analysis was performed using Image-Pro plus 6.0 software (Media Cybernetics, Inc.).
- TRAP was performed using a TRAPEZE RT Telomerase Detection Kit (Millipore, Darmstadt, Germany; S7710) to quantitatively determine telomerase activity. According to the manual total protein extract (100 ng) was used for each reaction.
- a total of 2 ⁇ 10 5 cells were stored for 5 minutes in 2 ⁇ SDS sample buffer (100 mmol / L TrisHCl [pH 6.8], 4% SDS, 0.2% bromophenol blue, 20% glycerol, and 200 mmol / L ⁇ -mercaptoethanol). Boil and SDS-PAGE and Western blot. To detect TERT, cells were incubated for 15 min at 55 ° C. in 2 ⁇ SDS sample buffer.
- TERT-specific (1: 300, Rockland Immunochemicals, Gilbertsville, PA, USA; 600-401-252), AKT-specific (1: 1000, Cell Signaling Technology; # 9272), phospho-AKT-specific (1 : 2000, Cell Signaling Technology; # 4060), GAPDH-specific (1: 2000, Santa Cruz Biotechnology; sc-47724), or ⁇ -actin-specific (1: 2000, Sigma-Aldrich, St. Louis, MO , USA; A5441) Antibodies were diluted with TBS-Tween 20 in 5% skim milk or bovine serum albumin and incubated overnight at 4 ° C, then washed and HRP-conjugated secondary antibody (1: 1000, Abcam; ab131368 or ab131366) Incubated at. Chemifluorescence images were obtained using a FUSION-SOLO imager (Vilber Lourmat, Marne La Vallee, France).
- Cell viability was measured using Cell Titer 96 MTS (Promega) as described previously (10). 500-1000 cells per well were seeded and treated for 96 hours at drug concentrations as described in each graph. Each assay was repeated at least three times. Data was plotted to perform IC 50 values using GraphPad software. The optical density of formazan production was measured at 490 nm using a Flexstation 3 multimode plate reader (Molecular Devices).
- Huh7 cells were cultured for 4 days with or without 300 ⁇ mol / LH 2 O 2 treatment with or without PI3K inhibitor, AKT inhibitor, or GSK3 ⁇ inhibitor. The cells were fixed using 1% paraformaldehyde with gentle shaking for 20 minutes at room temperature.
- microcoal nuclease buffer 50 mmol / L TrisHCl [pH 8.0], 5 mmol / L CaCl, 100 ⁇ g / mL BSA, 10 mmol / L KCl, and protease inhibitor cocktail [Roche, Basel, Switzerland; 4693159001]).
- microcoal nuclease buffer 50 mmol / L TrisHCl [pH 8.0], 5 mmol / L CaCl, 100 ⁇ g / mL BSA, 10 mmol / L KCl, and protease inhibitor cocktail [Roche, Basel, Switzerland; 4693159001].
- To transfer Disrupted with 2-mm-diameter zirconium beads (Watson); Microcoal nuclease digestes (New England Biolabs, Beverly, MA, USA; M0247S).
- Chromatin (150 ⁇ g) was collected and diluted with dilution buffer 0.1% NP-40, 2 mmol / L EDTA, 150 mmol / L NaCl, 20 mmol / L TrisHCl [pH 8.0], protease inhibitor cocktail [Roche], and phosphatase inhibitor cocktail [Calbiochem]). Pre-cleared at 4 ° C. for 2 hours with 2 ⁇ g cut salmon sperm DNA, 10 ⁇ L preimmune serum (Santa Cruz Biotechnology; sc-2027), and Dynabeads Protein G (Life Technologies; 1004D) after dilution. -clearing).
- Dynabeads Protein G After immunoprecipitation, 20 ⁇ l Dynabeads Protein G was added and incubation was continued for 2 hours.
- the Dynabeads were prepared by TSE 1 (0.1% SDS, 1% Triton X-100, 2mmol / L EDTA, 20mmol / L TrisHCl, and 150mmol / L NaCl), TSE II (0.1% SDS, 1% Triton X-100, 2mmol, respectively).
- PCR amplification products were quantified by qPCR (ABI 7300; Applied Biosystems, Foster City, Calif., USA) using primers specific for the TERT promoter site. PCR amplification was normalized with a TERT intron. Primer sequences are as follows: ⁇ -catenin interaction site for ChIP (forward primer: TCCCGGGTCCCCGGCCCA; reverse primer: CCTCGCGGTAGTGGCTGCGC) and TERT intron for ChIP (forward primer: TGAGGGCTGAGAAGGAGTGT; reverse primer: CACGATAGACGACGACCTCA). On each side of the previously recorded ⁇ -catenin interaction site, 20-22 bp was added.
- the antibodies used were as follows: rabbit polyclonal anti- ⁇ -catenin (1: 200, Abcam, Cambridge, MA, USA; ab6302), mouse monoclonal anti-RNA polymerase II (1:50, Covance , Princeton, NJ, USA; MMS-126R), and rabbit polyclonal anti-SETD1A (1: 100, Novus Biologicals, Littleton, CO, USA; NBP1-81513).
- mice Animal experiments were performed according to protocols approved by Seoul National University Ethics Committee (Approval number: SNU-130225-6). Mice were placed under normal conditions (semi-specific pathogen free) and optionally provided with food and water. Five week old KSN / Slc nude mice were used for all xenografting studies. Mice weighing between 18 g and 20 g were used for the experiment.
- a 1 ⁇ 10 5 Huh7, 1 ⁇ 10 processes the 300 ⁇ mol / LH 2 O 2 alone 5 Huh7, or 25 ⁇ mol / L is della risip and 300 ⁇ mol / LH 2 O 2 by two processes differ from the mock treated 1 ⁇ 10 5 Huh7 was washed, harvested in PBS without Ca 2+ or Mg 2+ and subsequently injected into the subcutaneous tissue in 0.2 mL volumes. Tumor products were monitored weekly via caliper measurements of the two perpendicular diameters (largest diameter D1 and smallest diameter D2) of the tumor. Tumor volume was calculated to be ⁇ ⁇ D1 ⁇ D2 2/6 .
- telomere length measurements and survival rates were assessed using Fisher's exact test and log-rank test, respectively.
- P values in the comparison of telomere activity and messenger RNA expression levels between mock and ROS or PI3K-AKT inhibitor treatments were calculated using a two-sided test. The normality of the frequency distribution was tested using the Shapiro-Willk test.
- Statistical analysis was performed using R software (www.r-project.org) or Prism GraphPad Software version 4.0 (GraphPad Software Inc, San Diego, Calif., USA). All experiments were repeated at least three times independently. Significance values were adjusted to * P ⁇ 0.05, ** P ⁇ 0.01, and *** P ⁇ 0.001.
- a selective p110 ⁇ kinase inhibitor has been used to treat patients with chronic lymphocytic leukemia because of its activity of blocking PI3K-AKT signaling (Yang Q, et al. Clin Cancer Res. 2015; 21: 1537-42; Fruman DA, et al. Nat Rev Drug Discov. 2014; 13: 140-56).
- PI3K-AKT PI3K-AKT signaling
- THLE-3 cell line which represents endogenous proliferating endothelial cells, was included (FIG. 1C).
- TERT expression is regulated when PI3K-AKT signaling is activated, which is inhibited by Idelaria in HCC cells but not in THLE-3 cells.
- PI3K-AKT signaling activated are suitable targets to reduce TERT expression and telomere length in the presence of PI3K inhibitors.
- the present inventors treated cells with increasing ROS levels when treated with various concentrations of H 2 O 2 (0-300 ⁇ mol / L).
- the level and telomere length of TERT messenger RNA (mRNA) and protein in E. coli were compared.
- TERT expression and telomere length increased in HCC cells treated with 300 ⁇ mol / L of H 2 O 2 (telomere length increased 25% -30% and TERT Expression increased by 40% -45%; Figures 2C and D).
- idelariship reduced telomerase activity in two HCC cell lines (FIG. 2I and J), but not in THLE-3 cells (FIG. 2). 2K).
- ROS-mediated increase in TERT expression, telomerase activity, and telomere length was almost completely inhibited by Idelariship (FIG. 2F-K).
- mRNA levels of p110 ⁇ increased from early HCC tissues to advanced HCC tissues (2 or more stages) (FIG. 4A) and were positively associated with TERT mRNA expression (FIG. 4B). This means that the same primary signal causes increased p110 ⁇ and TERT expression.
- High mRNA levels of p110 ⁇ are associated with low recurrence-free survival ( Figure 4C), which indicates that high expression of mRNA levels of p110 ⁇ may be HCC prognostic markers such as high levels of TERT mRNA, high levels of ROS, or long telomeres. Say it can.
- the pharmaceutical composition of the present invention can inhibit HCC tumor proliferation by inhibiting p110 ⁇ kinase by inhibiting the expression of p110 ⁇ at high levels, and in particular, can be effectively used for the treatment of advanced hepatocellular carcinoma. It can also be seen that it is useful for treating liver cancer by specifically blocking ROS-PI3K-AKT-TERT signaling overactivation (FIG. 4D).
Landscapes
- Health & Medical Sciences (AREA)
- Veterinary Medicine (AREA)
- Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Life Sciences & Earth Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- General Health & Medical Sciences (AREA)
- Public Health (AREA)
- Epidemiology (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Organic Chemistry (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Priority Applications (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| JP2018561462A JP6871638B2 (ja) | 2016-02-15 | 2017-02-14 | 肝癌の治療または予防用組成物 |
| US15/998,556 US10463669B2 (en) | 2016-02-15 | 2017-02-14 | Composition for treating or preventing liver cancer |
| CN201780023517.4A CN109069513B (zh) | 2016-02-15 | 2017-02-14 | 用于治疗或预防肝癌的组合物 |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR1020160017187A KR101662975B1 (ko) | 2016-02-15 | 2016-02-15 | 간암 치료 또는 예방용 조성물 |
| KR10-2016-0017187 | 2016-02-15 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2017142283A1 true WO2017142283A1 (ko) | 2017-08-24 |
Family
ID=57164552
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/KR2017/001575 Ceased WO2017142283A1 (ko) | 2016-02-15 | 2017-02-14 | 간암 치료 또는 예방용 조성물 |
Country Status (5)
| Country | Link |
|---|---|
| US (1) | US10463669B2 (https=) |
| JP (1) | JP6871638B2 (https=) |
| KR (1) | KR101662975B1 (https=) |
| CN (1) | CN109069513B (https=) |
| WO (1) | WO2017142283A1 (https=) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2019121872A1 (en) * | 2017-12-20 | 2019-06-27 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods for the diagnosis and treatment of liver cancer |
Families Citing this family (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR101662975B1 (ko) * | 2016-02-15 | 2016-10-06 | 서울대학교산학협력단 | 간암 치료 또는 예방용 조성물 |
| CN110665007A (zh) * | 2019-09-19 | 2020-01-10 | 邦世(苏州)生物医药科技有限公司 | 一种治疗癌症用组合药物及其用途 |
| KR102699871B1 (ko) | 2021-04-29 | 2024-08-29 | 주식회사 서지넥스 | 약물전달물질로서의 간세포암 특이적 표적 엑소좀 조성물 및 이의 용도 |
| KR20230112770A (ko) | 2022-01-20 | 2023-07-28 | 가톨릭대학교 산학협력단 | 항섬유화 억제용 조성물 |
| CN114796482A (zh) * | 2022-05-31 | 2022-07-29 | 江苏省人民医院(南京医科大学第一附属医院) | gsk3β抑制剂在制备提高抗肝细胞肝癌疗效的药物中的应用 |
| KR20250044972A (ko) | 2023-09-25 | 2025-04-01 | 주식회사 마스터메디텍 | 이델라리십 함유 경구투여용 고형제제 및 그 제조방법 |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2014051359A1 (ko) * | 2012-09-26 | 2014-04-03 | 부경대학교 산학협력단 | 네퍼린을 유효성분으로 포함하는 간암 예방 또는 치료용 약제학적 조성물 |
| KR101662975B1 (ko) * | 2016-02-15 | 2016-10-06 | 서울대학교산학협력단 | 간암 치료 또는 예방용 조성물 |
Family Cites Families (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AP2011005956A0 (en) * | 2009-04-20 | 2011-10-31 | Gilead Calistoga Llc | Methods of treatment for solid tumors. |
| CA2768843A1 (en) * | 2009-07-21 | 2011-01-27 | Gilead Calistoga Llc | Treatment of liver disorders with pi3k inhibitors |
| WO2013082540A1 (en) * | 2011-12-02 | 2013-06-06 | Gilead Calistoga Llc | Compositions and methods of treating a proliferative disease with a quinazolinone derivative |
| WO2014046617A1 (en) * | 2012-09-19 | 2014-03-27 | Agency For Science, Technology And Research | Compositions and methods for treating cancer |
| WO2015002729A2 (en) * | 2013-06-13 | 2015-01-08 | Biomatrica, Inc. | Cell stabilization |
| CN104817559B (zh) * | 2014-01-30 | 2021-05-25 | 苏州泽璟生物制药股份有限公司 | 氘代喹唑啉酮化合物以及包含该化合物的药物组合物 |
| WO2016097314A1 (en) * | 2014-12-19 | 2016-06-23 | Sandoz Ag | Amorphous and crystalline forms of idelalisib and process for forming the same |
-
2016
- 2016-02-15 KR KR1020160017187A patent/KR101662975B1/ko active Active
-
2017
- 2017-02-14 JP JP2018561462A patent/JP6871638B2/ja active Active
- 2017-02-14 WO PCT/KR2017/001575 patent/WO2017142283A1/ko not_active Ceased
- 2017-02-14 US US15/998,556 patent/US10463669B2/en active Active
- 2017-02-14 CN CN201780023517.4A patent/CN109069513B/zh active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2014051359A1 (ko) * | 2012-09-26 | 2014-04-03 | 부경대학교 산학협력단 | 네퍼린을 유효성분으로 포함하는 간암 예방 또는 치료용 약제학적 조성물 |
| KR101662975B1 (ko) * | 2016-02-15 | 2016-10-06 | 서울대학교산학협력단 | 간암 치료 또는 예방용 조성물 |
Non-Patent Citations (3)
| Title |
|---|
| GEDALY, R. ET AL.: "The Role of P13K/mTOR Inhibition in Combination with Sorafenib in Hepatocellular Carcinoma Treatment", ANTICANCER RESEARCH, vol. 32, 2012, pages 2531 - 2536, XP055409681 * |
| HWANG, JU YEONG ET AL.: "Sanguinarine Induces Apoptosis in Human Hepatocellular Carcinoma HepG2 Cells through the Generation of ROS and Modulation of Akt/ERK Signaling Pathways", JOURNAL OF SCIENCE, vol. 25, no. 9, 2015, pages 984 - 992, XP055411538 * |
| YANG, Q. ET AL.: "Idelalisib: First-in-class PI3K Delta Inhibitor for the Treatment of Chronic Lymphocytic Leukemia, Small Lymphocytic Leukemia, and Follicular Lymphoma", CLINICAL CANCER RESEARCH, vol. 21, no. 7, 2015, pages 1537 - 1542, XP055305408 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2019121872A1 (en) * | 2017-12-20 | 2019-06-27 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods for the diagnosis and treatment of liver cancer |
Also Published As
| Publication number | Publication date |
|---|---|
| KR101662975B1 (ko) | 2016-10-06 |
| CN109069513A (zh) | 2018-12-21 |
| US20190160073A1 (en) | 2019-05-30 |
| US10463669B2 (en) | 2019-11-05 |
| JP2019510075A (ja) | 2019-04-11 |
| JP6871638B2 (ja) | 2021-05-12 |
| CN109069513B (zh) | 2021-12-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2017142283A1 (ko) | 간암 치료 또는 예방용 조성물 | |
| Bayurova et al. | HIV‐1 Reverse Transcriptase Promotes Tumor Growth and Metastasis Formation via ROS‐Dependent Upregulation of Twist | |
| Xu et al. | LncSHRG promotes hepatocellular carcinoma progression by activating HES6 | |
| Meng et al. | METTL3 promotes the progression of nasopharyngeal carcinoma through mediating M6A modification of EZH2. | |
| Liu et al. | Neutrophil extracellular traps promote gastric cancer cell metastasis via the NAT10-mediated N4-acetylcytidine modification of SMYD2 | |
| Jiang et al. | Galectin-1 gene silencing inhibits the activation and proliferation but induces the apoptosis of hepatic stellate cells from mice with liver fibrosis | |
| Kang et al. | NLRC3 silencing accelerates the invasion of hepatocellular carcinoma cell via IL‐6/JAK2/STAT3 pathway activation | |
| Ying et al. | Interferon alpha antagonizes the anti-hepatoma activity of the oncolytic virus M1 by stimulating anti-viral immunity | |
| WO2017026843A1 (ko) | 만성골수성백혈병에 관한 정보 제공 방법 | |
| Seo et al. | PTEN/AKT signaling pathway related to hTERT downregulation and telomere shortening induced in Toxoplasma GRA16-expressing colorectal cancer cells | |
| Liu et al. | Ethanol induces necroptosis in gastric epithelial cells in vitro | |
| Xu et al. | ApoM suppresses kidney renal clear cell carcinoma growth and metastasis via the Hippo-YAP signaling pathway | |
| Zheng et al. | S100A11 promotes metastasis via AKT and ERK signaling pathways and has a diagnostic role in hepatocellular carcinoma | |
| Mao et al. | OCT3/4 enhances tumor immune response by upregulating the TET1-dependent NRF2/MDM2 axis in bladder cancer | |
| WO2020113877A1 (zh) | E2f6抑制剂的功能与用途 | |
| Hu et al. | Spermine oxidase regulates liver inflammation and fibrosis through β-catenin pathway | |
| Duan et al. | Curcumin affects autophagy of prolactinoma cells by upregulating miR‐206 to exert antitumor effects | |
| CN111701025A (zh) | 用于治疗肾细胞癌的药物及其应用 | |
| Zheng et al. | Interleukin-1 prevents SARS-CoV-2-induced membrane fusion to restrict viral transmission via induction of actin bundles | |
| Pan et al. | PTEN status determines therapeutic vulnerability to celastrol in cholangiocarcinoma | |
| CN118286467B (zh) | 整合应激反应抑制剂isrib在治疗肝癌中的应用 | |
| CN110623953A (zh) | 中药单体氧化苦参碱在制备治疗或预防非小细胞肺癌药物上的应用 | |
| Younis et al. | Trichinella spiralis Larval Extract as a Biological Anti‐Tumor Therapy in a Murine Model of Ehrlich Solid Carcinoma | |
| Xue et al. | EP300 Modulates MCM8 Transcription and Augments the Malignant Phenotype of Hepatitis B Virus–Positive Hepatocellular Carcinoma Cells | |
| WO2014018619A1 (en) | Methods and compounds for increasing threonyl-trna synthetase activity |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 17753444 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 2018561462 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 17753444 Country of ref document: EP Kind code of ref document: A1 |