WO2014046617A1

WO2014046617A1 - Compositions and methods for treating cancer

Info

Publication number: WO2014046617A1
Application number: PCT/SG2013/000407
Authority: WO
Inventors: Qiang Yu; Jing Tan
Original assignee: Agency For Science, Technology And Research
Priority date: 2012-09-19
Filing date: 2013-09-19
Publication date: 2014-03-27

Abstract

The present application is directed towards compositions comprising a combination of Polo-like Kinase 1 (PLK1) inhibitors with an inhibitor of the phosphatidyhnositol 3-kinase (PI3K)/AKT/mTOR pathway, and uses of these combinations to treat cancer. Also, the application is directed to the use of an inhibitor of the interaction between PLK1 and 3-phosphoinositide-dependent protein kinase-1 (PDK1) to treat Myc dependent cancer and to inhibit Myc phosphorylation with these inhibitors.

Description

COMPOSITIONS AND METHODS FOR TREATING

CANCER

Incorporation by Cross Reference

This application claims priority from Singapore patent application no. 201206977-9 filed on 19 September 2012, the entire contents of which are incorporated herein by cross reference.

Technical Field

The present invention relates generally to the field of cancer. More specifically, the present invention relates to cancer therapy, including the provision of compositions, agents and methods for treating cancer.

Background

Phosphatidylinositol 3'-kinase (PBK)-AKT pathway is one of the most commonly deregulated signaling pathways in human cancers. Genetic aberrations affecting this pathway, such as activating mutations of PIK3CA or inactivation of PTEN, have been identified in virtually all epithelial tumors. The 3-phosphoinositide-dependent protein kinase- 1 (PDKl) is Icnown to be activated as a result of the accumulation of the PI3K product phosphatidylinositol-3,4,5-trisphosphate (PIP3) and thus considered as an important component of the PI3K pathway. PDKl is a master regulator of AGC kinase members, including AKT, p70 ribosomal S6 kinase (S6K), serum- and glucocorticoid- induced protein kinase (SGK) and protein kinase C (PKC) family members, thus having multiple roles in various physiological processes such as metabolism, growth, proliferation and survival. In human cancers, PDKl is thought to be constitutively activated upon elevation of PIP3 owing to the loss of PTEN or gain of PIK3CA activity. In addition, PDKl deregulation in human malignancy can also be caused by gene amplification or abnormal phosphorylation in cytosol and nucleus, such as colon cancer and invasive breast cancer.

One of the most defined PDKl targets relevant in human cancer is AKT. Specifically, PDKl directly phosphorylates AKT on T308, but requires mTORC2- induced AKT phosphorylation on S473 to confer a full activation. Given its connection to AKT, PDKl has been pursued as a critical anti-cancer target. However, it has been recently shown that inhibition of PDKl has no significant effect on AKT signaling in a PTEN-deficient transgenic tumor mouse model or breast rumor growth. Furthermore, resistance is prevalent to drugs that target the PDKl/Akt pathway (e.g. P13K inhibitors, mTOR inhibitors and dual PI3K-mTOR inhibitors), which is a significant cause of tumour recurrence and patient relapse.

The relationship between stem cells and human cancers has become an important issue in cancer research given that self-renewal is a hallmark of both cell types. The evolutionarily conserved transcription factor Myc promotes various processes including cell growth and proliferation through incompletely understood mechanisms. Myc is implicated in both cancer and stem cell self-renewal. Genes associated with embryonic stem cell (ESC) identity, including pluripotency transcription factors, Polycomb targets and Myc targets, have been observed in aggressive human cancers and are associated with poor disease outcome. Moreover, the Myc associated molecular network is strikingly similar between ESC and human cancer transcription programs, and ectopic overexpression of Myc in differentiated somatic cells can induce both ESC gene signature and properties of cancer stem cells (CSC). Activation of an ESC-like gene expression program in adult cells may thus confer self-renewal to cancer cells or cancer stem cells. Notably, although the cancer associated ESC-like gene regulation by transcription factors such as Myc has been well documented, its regulation by a draggable kinase-driven signaling pathway has yet to be identified. Clinical inhibitors of Myc are also not currently available.

In view of the apparent shortcomings and deficiencies in cancer treatments targeting the PDKl/Akt pathway and the lack of agents capable of targeting Myc-dependent tumours, a need exists for new treatments that target alternative components of PDK1- related signalling pathways. In particular, there is a need for treatments that are effective against cancer cells resistant to drugs targeting the PI3K-AKT pathway and/or treatments capable effective against Myc-dependent cancer cells.

Summary of the Invention

The present invention aims to overcome at least one deficiency of known cancer treatment/s.

Accordingly, the present invention relates at least to embodiments 1-134 as follows: Embodiment 1. A composition comprising:

(i) an inhibitor of Polo-like kinase 1 (PLK1); and

(ii) an inhibitor of the phosphatidylinositol 3' -kinase- Akt-mammalian target of rapamycin (PI3K-Akt-mTOR) signalling pathway. Embodirnent 2. The composition according to embodiment 1, wherein the inhibitor of the PI3K-Akt-mTOR signalling pathway is selected from a PI3K inhibitor, an Akt inhibitor, an mTOR kinase inhibitor, or a dual PI3K/mTOR kinase inhibitor.

Embodiment 3. The composition according to embodiment 1 or embodiment 2, wherein the PI3K inhibitor is selected from the group consisting of GSK2636771, EPI-145 (INK1197), LY294002, GDC-0941, CAL-101 (GS-1101, Idelalisib), BEZ235 (NVP- BEZ235), BKM120 (NVP-BKM120, Buparlisib), NU7441 (KU-57788), Wortmannin, TGX-221, BYL719, an anti-PI3K antibody, an inhibitory PI3 RNA molecule, and PI- 103.

Embodiment 4. The composition according to embodiment 1 or embodiment 2, wherein the Akt inhibitor is selected from the group consisting of afuresertib (GSK2110183), perifosine (KRX-0401), -RX-0201, Erucylphosphocholine (ErPC), PBI- 05204, GSK690693, A-443654, AKT inhibitor ARQ 092, AKT inhibitor AZD5363, AKT inhibitor GDC-0068, AKT inhibitor GSK2141795, AKT inhibitor LY2780301, AKT inhibitor MK2206, A-674563, CCT 128930, an anti- Akt antibody, an inhibitory Akt RNA molecule, and AKT inhibitor SRI 3668.

Embodiment 5. The composition according to embodiment 1 or embodiment 2, wherein the mTOR inhibitor is selected from the group consisting of Rapamycin, PP242, Temsirolimus, Sirolimus, Everolimus, Ridaforolimus, AZD8055, an anti-mTOR antibody, an inhibitory mTOR RNA molecule, and INK 128.

Embodiment 6. The composition according to embodiment 1 or embodiment 2, wherein the dual PI3K/mTOR kinase inhibitor is₍ selected from the group consisting of PF-04691502, PF-05212384, X-480, NVP-BEZ235, GDC-0980, VS-5584, PKI-179, PKI- 587 and XL765.

Embodiment 7. The composition according to embodiment 1 or embodiment 2, wherein the inhibitor of PLK1 is BI2536 and the inhibitor of the PI3K-Akt-mTOR signalling pathway is NVP-BEZ235.

Embodiment 8. A composition comprising an inhibitor of Polo-like kinase 1 (PLK1) and an inhibitor of phosphatidylinositol 3 '-kinase (PI3K)-mTOR kinase.

Embodiment 9. The composition according to any one of embodiments 1 to 8, wherein the inhibitor of PLK1 is selected from the group consisting of BI2536, GW843682X, Cylapolin-1, DAP-81, ZK-thiazolidinone, Compound 36, LFM-A13, Poloxin, Poloxipan, Purpurogallin, ON 01910.Na, HMN-176, GSK461364, NMS-P937, an anti-PLKl antibody, an inhibitory RNA molecule, and BI6727. Embodiment 10. The composition according to embodiment 8 or 9, wherein the inhibitor of PBK-mTOR kinase is selected from the group consisting of NVP-BEZ235, Rapamycin, PP242, Temsirolimus, Sirolimus, Everolimus, Ridaforolimus, AZD8055, PKI-179, PKI-587, and XL765.

Embodiment 11. The composition according to any one of embodiments 8 to 10, wherein said inhibitor of PLK1 is BI2536 and said inhibitor of PBK-mTOR kinase is NVP-BEZ235.

Embodiment 12. The composition according to any one of embodiments 8 to 11, comprising said inhibitor of PLK1 and said inhibitor of PBK-mTOR kinase in a therapeutically effective amount.

Embodiment 13. The composition according to any one of embodiments 1 to 7, comprising said inhibitor of PLK1 and said inhibitor of the PBK-Akt-mTOR signalling pathway in a therapeutically effective amount.

Embodiment 14. The composition according to embodiment 12 or embodiment 13, wherein said therapeutically effective amount of said inhibitor of PLK1 is selected from the group consisting of about 0.01 μg/kg body weight per day to about 60 mg/kg body weight per day, about 0.1 μg/kg body weight per day to about 60 mg/kg body weight per day, about 1 μg/kg body weight per day to about 60 mg/kg body weight per day, about 0.01 mg/kg body weight per day to about 60 mg/kg body weight per day, about 0.1 mg/kg body weight per day to about 60 mg/kg body weight per day, about 1 mg/kg body weight per day to about 60 mg/kg body weight per day, at least about 1 mg/kg body weight per day, at least about 5 mg/kg body weight per day, at least about 10 mg/kg body weight per day, at least about 15 mg/kg body weight per day, at least about 20 mg/kg body weight per day, at least about 25 mg/kg body weight per day, at least about 30 mg/kg body weight per day, at least about 35 mg/kg body weight per day, at least about 40 mg/kg body weight per day, at least about 45 mg/kg body weight per day, at least about 50 mg/kg body weight per day, at least about 55 mg/kg body weight per day, at least about 60 mg/kg body weight per day, about 25 mg/kg body weight per day to about 60 mg/kg body weight per day, about 30 mg/kg body weight per day to about 55 mg/kg body weight per day, about 35 mg/kg body weight per day to about 50 mg/kg body weight per day, and about 40 mg/kg body weight per day to about 45 mg/kg body weight per day.

Embodiment 15. The composition according to embodiment 12, wherein said therapeutically amount of said inhibitor of PBK-mTOR kinase is selected from the group consisting of at least about 0.01 μg/kg body weight per day, at least about 0.1 μg/kg body weight per day, at least about 1 μg/kg body weight per day, at least about 0.01 mg/kg body weight per day, at least about 0.1 mg/kg body weight per day, at least about 1 mg/kg body weight per day, at least about 5 mg/kg body weight per day, at least about 10 mg/kg body weight per day, at least about 15 mg/kg body weight per day, at least about 20 mg/kg body weight per day, at least about 25 mg/kg body weight per day, at least about 30 mg/kg body weight per day, at least about 35 mg/kg body weight per day, at least about 40 mg/kg body weight per day, at least about 45 mg/kg body weight per day, at least about 50 mg/kg body weight per day, and at least about 55 mg/kg body weight per day.

Embodiment 16. The composition according to embodiment 13, wherein said therapeutically amount of said inhibitor of the PBK-Akt-mTOR signalling pathway is selected from the group consisting of at least about 0.01 μg/kg body weight per day, at least about 0.1 μg/kg body weight per day, at least about 1 μg/kg body weight per day, at least about 0.01 mg/kg body weight per day, at least about 0.1 mg/kg body weight per day, at least about 1 mg/kg body weight per day, at least about 5 mg/kg body weight per day, at least about 10 mg/kg body weight per day, at least about 15 mg/kg body weight per day, at least about 20 mg/kg body weight per day, at least about 25 mg/kg body weight per day, at least about 30 mg/kg body weight per day, at least about 35 mg/kg body weight per day, at least about 40 mg/kg body weight per day, at least about 45 mg/kg body weight per day, at least about 50 mg/kg body weight per day, and at least about 55 mg/kg body weight per day.

Embodiment 17. The composition according to any one of embodiments 1 to 16, further comprising a pharmaceutically acceptable carrier or excipient.

Embodiment 18. A method of prophylactically or therapeutically treating cancer in a patient in need thereof, comprising administering to the patient a therapeutically effective amount of:

(i) an inhibitor of Polo-like kinase 1 (PLK1); and

(ii) an inhibitor of the PBK-Akt-mTOR signalling pathway.

Embodiment 19. A method of prophylactically or therapeutically treating cancer in a patient in need thereof, comprising administering to the patient a synergistic combination of:

(i) an inhibitor of Polo-like kinase 1 (PLK1); and

(ii) an inhibitor of the PBK-Akt-mTOR signalling pathway,

in a therapeutically effective amount.

Embodiment 20. The method according to embodiment 18 or embodiment 19, wherein the cancer is resistant to a treatment that inhibits mTOR kinase activity. Embodiment 21. The method according to any one of embodiments 18 to 20, comprising administering the composition of any one of embodiments 1 to 17.

Embodiment 22. The method according to any one of embodiments 18 to 21, wherein the inhibitor of the PI3 -Akt-mTOR signalling pathway is selected from a PI3K inhibitor, an Akt inhibitor, an mTOR kinase inhibitor, or a dual PI3K/mTOR kinase inhibitor.

Embodiment 23. The method according to any one of embodiments 18 to 22, wherein the inhibitor of PLK1 is selected from the group consisting of BI2536, GW843682X, Cylapolin-1, DAP-81, ZK-thiazolidinone, Compound 36, LFM-A13, Poloxin, Poloxipan, Purpurogallin, ON 01910.Na, HMN-176, GSK461364, NMS-P937, an anti-PLKl antibody, an inhibitory PLK1 RNA molecule, and BI6727.

Embodiment 24. The method according to any one of embodiments 18 to 23, wherein the dual PI3K/mTOR kinase inhibitor is selected from the group consisting of PF-04691502, PF-05212384, X-480, NVP-BEZ235, GDC-0980, VS-5584, PKI-179, PKI- 587 and XL765.

Embodiment 25. The method according to any one of embodiments 18 to 23, wherein the PI3K inhibitor is selected from the group consisting of GSK2636771, IPI-145 (INK1197), LY294002, GDC-0941, CAL-101 (GS-1101, Idelalisib), BEZ235 (NVP- BEZ235), BKM120 (NVP-BKM120, Buparlisib), NU7441 (KU-57788), Wortmannin, TGX-221, BYL719, an anti-PI3K antibody, an inhibitory PI3K RNA molecule, and PI- 103.

Embodiment 26. The method according to any one of embodiments 18 to 23, wherein the Akt inhibitor is selected from the group consisting of afuresertib (GSK2110183), perifosine (KRX-0401), RX-0201, Erucylphosphocholine (ErPC), PBI- 05204, GSK690693, A-443654, AKT inhibitor ARQ 092, AKT inhibitor AZD5363, AKT inhibitor GDC-0068, AKT inhibitor GSK2141795, AKT inhibitor LY2780301, AKT inhibitor MK2206, A-674563, CCT 128930, an anti-mAkt antibody, an inhibitory Akt RNA molecule, and AKT inhibitor SR13668.

Embodiment 27. The method according to any one of embodiments 18 to 23, wherein the mTOR inhibitor is selected from the group consisting of Rapamycin, PP242, Temsirolimus, Sirolimus, Everolimus, Ridaforolimus, AZD8055, an anti-mTOR antibody, an inhibitory mTOR RNA molecule, and INK 128.

Embodiment 28. The method according to any one of embodiments 18 to 24, wherein the inhibitor of PLK1 is BI2536 and the inhibitor of the PI3K-Akt-mTOR signalling pathway is NVP-BEZ235. Embodiment 29. The method according to any one of embodiments 18 to 28, wherein said therapeutically effective amount of the inhibitor of PLKl is selected from the group consisting of about 0.01 μg/kg body weight per day to about 60 mg/kg body weight per day, about 0.1 μg/kg body weight per day to about 60 mg/kg body weight per day, about 1 μg/kg body weight per day to about 60 mg/kg body weight per day, about 0.01 mg/kg body weight per day to about 60 mg/kg body weight per day, about 0.1 mg/kg body weight per day to about 60 mg/kg body weight per day, about 1 mg/kg body weight per day to about 60 mg/kg body weight per day, at least about 1 mg/kg body weight per day, at least about 5 mg/kg body weight per day, at least about 10 mg/kg body weight per day, at least about 15 mg/kg body weight per day, at least about 20 mg/kg body weight per day, at least about 25 mg/kg body weight per day, at least about 30 mg/kg body weight per day, at least about 35 mg/kg body weight per day, at least about 40 mg/kg body weight per day, at least about 45 mg/kg body weight per day, at least about 50 mg/kg body weight per day, at least about 55 mg/kg body weight per day, at least about 60 mg/kg body weight per day, about 25 mg/kg body weight per day to about 60 mg/kg body weight per day, about 30 mg/kg body weight per day to about 55 mg/kg body weight per day, about 35 mg/kg body weight per day to about 50 mg/kg body weight per day, and about 40 mg/kg body weight per day to about 45 mg/kg body weight per day.

Embodiment 30. The method according to any one of embodiments 18 to 29, wherein said therapeutically effective amount of said inhibitor of the PI3K-Akt-mTOR signalling pathway is selected from the group consisting of at least about 0.01 μ^/kg body weight per day, at least about 0.1 μg/kg body weight per day, at least about 1 μg/kg body weight per day, at least about 0.01 mg/kg body weight per day, at least about 0.1 mg/kg body weight per day, at least about 1 mg/kg body weight per day, at least about 5 mg/kg body weight per day, at least about 10 mg/kg body weight per day, at least about 15 mg/kg body weight per day, at least about 20 mg/kg body weight per day, at least about 25 mg/kg body weight per day, at least about 30 mg/kg body weight per day, at least about 35 mg/kg body weight per day, at least about 40 mg/kg body weight per day, at least about 45 mg/kg body weight per day, at least about 50 mg/kg body weight per day, and at least about 55 mg/kg body weight per day.

Embodiment 31. The method according to any one of embodiments 18 to 30, wherein said inhibitor of PLKl is administered to the subject orally, parenterally, or intravenously. Embodiment 32. The method according to any one of embodiments 18 to 31, wherein said inhibitor of the PI3K-Akt-mTOR signalling pathway is administered to the subject orally, parenterally, or intravenously.

Embodiment 33. The method according to any one of embodiments 18 to 32, wherein said inhibitor of PLKl and said inhibitor of the PI3K-Akt-mTOR signalling pathway are administered to the subject sequentially.

Embodiment 34. The method according to any one of embodiments 18 to 33, comprising administering said inhibitor of PLKl to the subject for two consecutive days followed by said inhibitor of the PI3K-Akt-mTOR signalling pathway for five days for a period of two weeks.

Embodiment 35. The method according to any one of embodiments 18 to 34, comprising administering said inhibitor of PLKl to the subject for two consecutive days at about 50 mg/kg body weight per day followed by said inhibitor of the PI3K-Akt- mTOR signalling pathway at about 35 mg/kg body weight per day for five days for a period of two weeks.

Embodiment 36. The method according to any one of embodiments 18 to 32, wherein said inhibitor of PLKl and said inhibitor of the PI3K-Akt-mTOR signalling pathway are administered to the subject concurrently or simultaneously.

Embodiment 37. The method according to any one of embodiments 18 to 36, wherein the cancer is a Myc-dependent cancer.

Embodiment 38. The method according to embodiment 37, wherein the Myc- dependent cancer is selected from the group consisting of bladder cancer, breast cancer, colon cancer, gastric cancer, hepatocellular carcinoma, leukemia, lymphoma, melanoma, myeloma (including multiple myeloma), neuroblastoma, ovarian cancer, prostate cancer, rhabdomyosarcoma, small cell lung cancer, subungual melanoma, uveal melanoma and Burkitt's lymphoma.

Embodiment 39. A method of prophylactically or therapeutically treating cancer in a patient in need thereof, comprising administering to the patient an effective amount of an inhibitor of PLKl in combination with an inhibitor of PI3K-mTOR kinase.

Embodiment 40. The method according to embodiment 39, wherein the inhibitor of PLKl is selected from the group consisting of BI2536, GW843682X, Cylapolin-1, DAP- 81, ZK-thiazolidinone, Compound 36, LFM-A13, Poloxin, Poloxipan, Purpurogallin, ON 01910.Na, HMN-176, GSK461364, NMS-P937, an anti-PLKl antibody, an inhibitory PLKl RNA molecule, and BI6727. Embodiment 41. The method according to embodiment 39 or 40, wherein the inhibitor of PI3K-mTOR kinase is selected from the group consisting of NVP-BEZ235, Rapamycin, PP242, Temsirolimus, Sirolimus, Everolimus, Ridaforolimus, AZD8055, PKI-179, PKI-587, and XL765.

Embodiment 42. The method according to any one of embodiments 39 to 41, wherein said inhibitor of PLKl is BI2536 and said inhibitor of PI3K-mTOR kinase is NVP-BEZ235.

Embodiment 43. The method according to any one of embodiments 39 to 42, wherein said inhibitor of PLKl and said inhibitor of PI3K-mTOR kinase are to be administered in a therapeutically effective amount.

Embodiment 44. The method according to embodiment 43, wherein said therapeutically effective amount of said inhibitor of PLKl is selected from the group consisting of about 0.01 μg/kg body weight per day to about 60 mg/kg body weight per day, about 0.1 μg/kg body weight per day to about 60 mg/kg body weight per day, about 1 μg/kg body weight per day to about 60 mg/kg body weight per day, about 0.01 mg/kg body weight per day to about 60 mg/kg body weight per day, about 0.1 mg/kg body weight per day to about 60 mg/kg body weight per day, about 1 mg/kg body weight per day to about 60 mg/kg body weight per day, at least about 1 mg/kg body weight per day, at least about 5 mg/kg body weight per day, at least about 10 mg/kg body weight per day, at least about 15 mg/kg body weight per day, at least about 20 mg/kg body weight per day, at least about 25 mg/kg body weight per day, at least about 30 mg/kg body weight per day, at least about 35 mg/kg body weight per day, at least about 40 mg/kg body weight per day, at least about 45 mg/kg body weight per day, at least about 50 mg/kg body weight per day, at least about 55 mg/kg body weight per day, at least about 60 mg/kg body weight per day, about 25 mg/kg body weight per day to about 60 mg/kg body weight per day, about 30 mg/kg body weight per day to about 55 mg/kg body weight per day, about 35 mg/kg body weight per day to about 50 mg/kg body weight per day, and about 40 mg/kg body weight per day to about 45 mg/kg body weight per day.

Embodiment 45. The method according to embodiment 43, wherein said therapeutically effective amount of said inhibitor of PI3K-mTOR kinase is selected from the group consisting of at least about 0.01 μg/kg body weight per day, at least about 0.1 μg/kg body weight per day, at least about 1 μg/kg body weight per day, at least about 0.01 mg/kg body weight per day, at least about 0.1 mg/kg body weight per day, at least about 1 mg/kg body weight per day, at least about 5 mg/kg body weight per day, at least about 10 mg/kg body weight per day, at least about 15 mg/kg body weight per day, at least about 20 mg kg body weight per day, at least about 25 mg/kg body weight per day, at least about 30 mg/kg body weight per day, at least about 35 mg/kg body weight per day, at least about 40 mg/kg body weight per day, at least about 45 mg/kg body weight per day, at least about 50 mg/kg body weight per day, and at least about 55 mg/kg body weight per day.

Embodiment 46. The method according to any one of embodiments 39 to 45, wherein said inhibitor of PLKl is administered orally, parenterally, or intravenously.

Embodiment 47. The method according to any one of embodiments 39 to 46, wherein said inhibitor of PI3K-mTOR kinase is administered orally, parenterally, or intravenously.

Embodiment 48. The method according to any one of embodiments 39 to 47, wherein said inhibitor of PLKl and said inhibitor of PDK-mTOR kinase are administered sequentially or simultaneously.

Embodiment 49. The method according to any one of embodiments 39 to 48, comprising administering said inhibitor of PLKl for two consecutive days followed by said inhibitor of PDK-mTOR kinase for five days for a period of two weeks.

Embodiment 50. The method according to any one of embodiments 39 to 49, comprising administering said inhibitor of PLKl for two consecutive days at about 50 mg/kg body weight per day followed by said inhibitor of PDK-mTOR kinase at about 35 mg/kg body weight per day for five days for a period of two weeks.

Embodiment 51. The method according to embodiment 50, wherein said inhibitor of PLKl is BI2536 and said inhibitor of PDK-mTOR kinase is NVP-BEZ235.

Embodiment 52. The method according to any one of embodiments 18 to 437 or 39 to 51, wherein said cancer is selected from the group consisting of colorectal cancer, breast cancer, lung cancer (small cell and non-small cell), prostate cancer, cancer of the endometrium, ovarian cancer, cervical cancer, cancer of the uterus, head and neck cancer, pancreatic cancer, kidney cancer, brain cancer, bladder cancer, mouth cancer, cancer of the larynx, cancer of the esophagus, stomach cancer, a sarcoma, melanoma, multiple myeloma, B-cell lymphoma, mantle cell lymphoma, Non-Hodgkin's Lymphoma, and leukemia.

Embodiment 53. A composition comprising an inhibitor of PLKl and an inhibitor of PDK-mTOR kinase, and optionally a pharmaceutically acceptable carrier or excipient, for use in the prophylactic or therapeutic treatment of cancer in a patient in need thereof.

Embodiment 54. The composition according to embodiment 52, wherein the inhibitor of PLKl is selected from the group consisting of BI2536, GW843682X, Cylapolin-1, DAP-81, ZK-thiazolidinone, Compound 36, LFM-A13, Poloxin, Poloxipan, Purpurogallin, ON 01910.Na, HMN-176, GSK461364, NMS-P937, an anti-PLKl antibody, an inhibitory PLK1 RNA molecule, and BI6727.

Embodiment 55. The composition according to embodiment 53 or 54, wherein the inhibitor of PBK-mTOR kinase is selected from the group consisting of NVP-BEZ235, Rapamycin, PP242, Temsirolimus, Sirolimus, Everolimus, Ridaforolimus, AZD8055, PKI-179, PKI-587, and XL765.

Embodiment 56. The composition according to any one of embodiments 53 to 55, wherein said inhibitor of PLK1 is BI2536 and said inhibitor of PBK-mTOR kinase is NVP-BEZ235.

Embodiment 57. The composition according to any one of embodiments 53 to 56, comprising said inhibitor of PLK1 and said inhibitor of PBK-mTOR kinase in a therapeutically effective amount.

Embodiment 58. The composition according to embodiment 57, wherein said therapeutically effective amount of said inhibitor of PLK1 is selected from the group consisting of about 0.01 μg/kg body weight per day to about 60 mg/kg body weight per day, about 0.1 μg/kg body weight per day to about 60 mg/kg body weight per day, about 1 μg/kg body weight per day to about 60 mg/kg body weight per day, about 0.01 mg/kg body weight per day to about 60 mg/kg body weight per day, about 0.1 mg/kg body weight per day to about 60 mg/kg body weight per day, about 1 mg/kg body weight per day to about 60 mg/kg body weight per day, at least about 1 mg/kg body weight per day, at least about 5 mg/kg body weight per day, at least about 10 mg/kg body weight per day, at least about 15 mg/kg body weight per day, at least about 20 mg/kg body weight per day, at least about 25 mg/kg body weight per day, at least about 30 mg/kg body weight per day, at least about 35 mg/kg body weight per day, at least about 40 mg/kg body weight per day, at least about 45 mg/kg body weight per day, at least about 50 mg/kg body weight per day, at least about 55 mg/kg body weight per day, at least about 60 mg/kg body weight per day, about 25 mg/kg body weight per day to about 60 mg/kg body weight per day, about 30 mg/kg body weight per day to about 55 mg/kg body weight per day, about 35 mg/kg body weight per day to about 50 mg/kg body weight per day, and about 40 mg/kg body weight per day to about 45 mg/kg body weight per day.

Embodiment 59. The composition according to embodiment 57, wherein said therapeutically amount of said inhibitor of PBK-mTOR kinase is selected from the group consisting of at least about 0.01 μg/kg body weight per day, at least about 0.1 μg/kg body weight per day, at least about 1 μg/kg body weight per day, at least about 0.01 mg/kg body weight per day, at least about 0.1 mg/kg body weight per day, at least about 1 mg/kg body weight per day, at least about 5 mg/kg body weight per day, at least about 10 mg/kg body weight per day, at least about 15 mg/kg body weight per day, at least about 20 mg/kg body weight per day, at least about 25 mg/kg body weight per day, at least about 30 mg/kg body weight per day, at least about 35 mg/kg body weight per day, at least about 40 mg/kg body weight per day, at least about 45 mg/kg body weight per day, at least about 50 mg/kg body weight per day, and at least about 55 mg/kg body weight per day.

Embodiment 60. The composition according to any one of embodiments 53 to 59, wherein said inhibitor of PLK1 is to be administered orally, parenterally, or intravenously.

Embodiment 61. The composition according to any one of embodiments 53 to 60, wherein said inhibitor of PBK-mTOR kinase is to be administered orally, parenterally, or intravenously.

Embodiment 62. The composition according to any one of embodiments 53 to 61, wherein said inhibitor of PLK1 and said inhibitor of PBK-mTOR kinase are to be administered sequentially or simultaneously.

Embodiment 63. A therapeutically effective amount of:

(i) an inhibitor of Polo-like kinase 1 (PLK1); and

(ii) an inhibitor of the PI3K-Akt-mTOR signalling pathway

for use in prophylactically or therapeutically treating cancer.

Embodiment 64. A synergistic combination of:

(i) an inhibitor of Polo-like kinase 1 (PLK1); and

(ii) an inhibitor of the PI3K- Akt-mTOR signalling pathway

for use in prophylactically or therapeutically treating cancer.

Embodiment 65. The method according to embodiment 63 or embodiment 64, wherein the cancer is resistant to a treatment that inhibits mTOR kinase activity.

Embodiment 66. The composition according to any one of embodiments 63 to 65, wherein the inhibitor of the PI3K-Akt-mTOR signalling pathway is selected from a PI3K inhibitor, an Akt inhibitor, an mTOR kinase inhibitor, or a dual PI3K/mTOR kinase inhibitor.

Embodiment 67. The composition according to any one of embodiments 63 to 66, wherein the inhibitor of PLK1 is selected from the group consisting of BI2536, GW843682X, Cylapolin-1, DAP-81, ZK-thiazolidinone, Compound 36, LFM-A13, Poloxin, Poloxipan, Purpurogallin, ON 01910.Na, HMN-176, GSK461364, NMS-P937, an anti-PLKl antibody, an inhibitory PLK1 RNA molecule, and BI6727.

Embodiment 68. The composition according to any one of embodiments 63 to 67, wherein the dual PBK/mTOR kinase inhibitor is selected from the group consisting of PF-04691502, PF-05212384, X-480, NVP-BEZ235, GDC-0980, VS-5584, PKI-179, PKI- 587 and XL765.

Embodiment 69. The composition according to any one of embodiments 63 to 67, wherein the PI3K inhibitor is selected from the group consisting of GSK2636771, IPI-145 (INK1197), LY294002, GDC-0941, CAL-101 (GS-1101, Idelalisib), BEZ235 (NVP- BEZ235), BKM120 (NVP-BKM120, Buparlisib), NU7441 (KU-57788), Wortmannin, TGX-221, BYL719, an anti-PBK antibody, an inhibitory PI3K RNA molecule, and PI- 103.

Embodiment 70. The composition according to any one of embodiments 63 to 67, wherein the Akt inhibitor is selected from the group consisting of afuresertib (GSK2110183), perifosine (KRX-0401), RX-0201, Erucylphosphocholine (ErPC), PBI- 05204, GSK690693, A.443654, AKT inhibitor ARQ 092, AKT inhibitor AZD5363, AKT inhibitor GDC-0068, AKT inhibitor GSK2141795, AKT inhibitor LY2780301, AKT inhibitor MK2206, A-674563, CCT 128930, an anti-Akt antibody, an inhibitory Akt RNA molecule, and AKT inhibitor SRI 3668.

Embodiment 71. The composition according to any one of embodiments 63 to 67, wherein the mTOR inhibitor is selected from the group consisting of Rapamycin, PP242, Temsirolimus, Sirolimus, Everolimus, Ridaforolimus, AZD8055, and INK 128.

Embodiment 72. The composition according to any one of embodiments 63 to 68, wherein the inhibitor of PLK1 is B 12536 and the inhibitor of the PBK-Akt-mTOR signalling pathway is NVP-BEZ235.

Embodiment 73. The composition according to any one of embodiments 63 to 72, wherein the cancer is a Myc-dependent cancer.

Embodiment 74. The composition according to embodiment 73, wherein the Myc- dependent cancer is selected from the group consisting of bladder cancer, breast cancer, colon cancer, gastric cancer, hepatocellular carcinoma, leukemia, lymphoma, melanoma, myeloma (including multiple myeloma), neuroblastoma, ovarian cancer, prostate cancer, rhabdomyosarcoma, small cell lung cancer, subungual melanoma, uveal melanoma and Burkitt's lymphoma.

Embodiment 75. The composition according to any one of embodiments 53 to 73, wherein said cancer is selected from the group consisting of colorectal cancer, breast cancer, lung cancer (small cell and non- small cell), prostate cancer, cancer of the endometrium, ovarian cancer, cervical cancer, cancer of the uterus, head and neck cancer, pancreatic cancer, kidney cancer, brain cancer, bladder cancer, mouth cancer, cancer of the larynx, cancer of the esophagus, stomach cancer, a sarcoma, melanoma, multiple myeloma, B-cell lymphoma, mantle cell lymphoma, Non-Hodgkin's Lymphoma, and leukemia.

Embodiment 76. Use of an inhibitor of PLKl in the manufacture of a medicament for the prophylactic or therapeutic treatment of cancer in a patient in need thereof, wherein said medicament is to be administered with an inhibitor of PI3K÷mTOR kinase.

Embodiment 77. The use according to embodiment 76, wherein the inhibitor of PLKl is selected from the group consisting of BI2536, GW843682X, Cylapolin-1, DAP- 81, ZK-thiazolidinone, Compound 36, LFM-A13, Poloxin, Poloxipan, Purpurogallin, ON 01910.Na, HMN-176, GSK461364, NMS-P937, an anti-PLKl antibody, an inhibitory PLKl RNA molecule, and BI6727.

Embodiment 78. The use according to embodiment 76 or 77, wherein the inhibitor of PDK-mTOR kinase is selected from the group consisting of NVP-BEZ235, Rapamycin, PP242, Temsirolimus, Sirolimus, Everolimus, Ridaforolimus, AZD8055, PKI-179, PKI-587, and XL765.

Embodiment 79. The use according to any one of embodiments 76 to 78, wherein said inhibitor of PLKl is BI2536 and said inhibitor of PI3K-mTOR kinase is NVP- BEZ235.

Embodiment 80. The use according to any one of embodiments 76 to 79, wherein said medicament comprises said inhibitor of PLKl and said inhibitor of PI3K-mTOR kinase in a therapeutically effective amount.

Embodiment 81. The use according to embodiment 80, wherein said therapeutically effective amount of said inhibitor of PLKl is selected from the group consisting of about 0.01 μg/kg body weight per day to about 60 mg/kg body weight per day, about 0.1 μg/kg body weight per day to about 60 mg/kg body weight per day, about 1 μg/kg body weight per day to about 60 mg/kg body weight per day, about 0.01 mg/kg body weight per day to about 60 mg/kg body weight per day, about 0.1 mg/kg body weight per day to about 60 mg/kg body weight per day, about 1 mg/kg body weight per day to about 60 mg/kg body weight per day, at least about 1 mg/kg body weight per day, at least about 5 mg/kg body weight per day, at least about 10 mg/kg body weight per day, at least about 15 mg/kg body weight per day, at least about 20 mg/kg body weight per day, at least about 25 mg/kg body weight per day, at least about 30 mg/kg body weight per day, at least about 35 mg/kg body weight per day, at least about 40 mg/kg body weight per day, at least about 45 mg/kg body weight per day, at least about 50 mg/kg body weight per day, at least about 55 mg/kg body weight per day, at least about 60 mg/kg body weight per day, about 25 mg/kg body weight per day to about 60 mg/kg body weight per day, about 30 mg/kg body weight per day to about 55 mg/kg body weight per day, about 35 mg/kg body weight per day to about 50 mg/kg body weight per day, and about 40 mg/kg body weight per day to about 45 mg/kg body weight per day.

Embodiment 82. The use according to embodiment 80, wherein said therapeutically amount of said inhibitor of PI3K-mTOR kinase is selected from the group consisting of at least about 0.01 g/kg body weight per day, at least about 0.1 μg/kg body weight per day, at least about 1 μg/kg body weight per day, at least about 0.01 mg/kg body weight per day, at least about 0.1 mg/kg body weight per day, at least about 1 mg/kg body weight per day, at least about 5 mg/kg body weight per day, at least about 10 mg/kg body weight per day, at least about 15 mg/kg body weight per day, at least about 20 mg/kg body weight per day, at least about 25 mg/kg body weight per day, at least about 30 mg/kg body weight per day, at least about 35 mg/kg body weight per day, at least about 40 mg/kg body weight per day, at least about 45 mg/kg body weight per day, at least about 50 mg/kg body weight per day, and at least about 55 mg/kg body weight per day.

Embodiment 83. The use according to any one of embodiments 76 to 82, wherein said inhibitor of PLK1 is to be administered orally, parenterally, or intravenously.

Embodiment 84. The use according to any one of embodiments 76 to 83, wherein said inhibitor of PI3K-mTOR kinase is to be administered orally, parenterally, or intravenously.

„ , Embodiment 85. The use according to any one of embodiments 76 to 84, wherein said inhibitor _of PLK1 and said inhibitor of P13K-mTOR kinase are to be administered sequentially or simultaneously.

Embodiment 86. The use according to any one of embodiments 76 to 85, wherein said cancer is selected from the group consisting of colorectal cancer, breast cancer, lung cancer (small cell and non-small cell), prostate cancer, cancer of the endometrium, ovarian cancer, cervical cancer, cancer of the uterus, head and neck cancer, pancreatic cancer, kidney cancer, brain cancer, bladder cancer, mouth cancer, cancer of the larynx, cancer of the esophagus, stomach cancer, a sarcoma, melanoma, multiple myeloma, B- cell lymphoma, mantle cell lymphoma, Νοή-Hodgkin's Lymphoma, and leukemia.

Embodiment 87. Use of a therapeutically effective amount of:

(i) an inhibitor of Polo-like kinase 1 (PLK1); and (ii) an inhibitor of the PBK-Akt-mTOR signalling pathway in the preparation of a medicament for prophylactically or therapeutically treating cancer.

Embodiment 88. Use of a synergistic combination of:

(i) an inhibitor of Polo-like kinase 1 (PLKl); and

(ii) an inhibitor of the PBK-Akt-mTOR signalling pathway

in the preparation of a medicament for prophylactically or therapeutically treating cancer.

Embodiment 89. The use according to embodiment 87 or embodiment 88, wherein the cancer is resistant to a treatment that inhibits mTOR kinase activity.

Embodiment 90. The use according to any one of embodiments 87 to 89, wherein the inhibitor of the PBK-Akt-mTOR signalling pathway is selected from a PBK inhibitor, an Akt inhibitor, an mTOR kinase inhibitor, or a dual PBK/mTOR kinase inhibitor.

Embodiment 91. The use according to any one of embodiments 87 to 90, wherein the inhibitor of PLKl is selected from the group consisting of BI2536, GW843682X, Cylapolin-1, DAP-81, ZK-thiazolidinone, Compound 36, LFM-A13, Poloxin, Poloxipan, Purpurogallin, ON 01910.Na, HMN-176, GSK461364, NMS-P937, an anti-PLKl antibody, an inhibitory PLKl RNA molecule, and BI6727.

Embodiment 92. The use according to any one of embodiments 87 to 91, wherein the dual PBK/mTOR kinase inhibitor is selected from the group consisting of PF- 04691502, PF-05212384, X-480, NVP-BEZ235, GDC-0980, VS-5584, PKI-179, PKI-. 587 and XL765.

Embodiment 93. The use according to any one of embodiments 87 to 91, wherein the PBK inhibitor is selected from the group consisting of GSK2636771, IPI-145 (INK1197), LY294002, GDC-0941, CAL-101 (GS-1101, Idelalisib), BEZ235 (NVP- BEZ235), BKM120 (NVP-BKM120, Buparlisib), NU7441 (KU-57788), Wortmannin, TGX-221, BYL719, an anti-PBK antibody, an inhibitory PBK RNA molecule, and PI- 103.

Embodiment 94. The use according to any one of embodiments 87 to 91, wherein the Akt inhibitor is selected from the group consisting of afuresertib (GSK2110183), perifosine (KRX-0401), RX-0201, Erucylphosphocholine (ErPC), PBI-05204, GSK690693, A-443654, AKT inhibitor ARQ 092, AKT inhibitor AZD5363, AKT inhibitor GDC-0068, AKT inhibitor GSK2141795, AKT inhibitor LY2780301, AKT inhibitor MK2206, A-674563, CCT 128930, an anti-Akt antibody, an inhibitory Akt RNA molecule, and AKT inhibitor SRI 3668.

Embodiment 95. The use according to any one of embodiments 87 to 91, wherein the mTOR inhibitor is selected from the group consisting of Rapamycin, PP242, Temsirolimus, Sirolimus, Everolimus, Ridaforolimus, AZD8055, and INK 128.

Embodiment 96. The use according to any one of embodiments 87 to 92, wherein the inhibitor of PLKl is BI2536 and the inhibitor of the PI3K-Akt-mTOR signalling pathway is NVP-BEZ235.

Embodiment 97. The use according to any one of embodiments 87 to 96, wherein the cancer is a Myc-dependent cancer.

Embodiment 98. The use according to embodiment 97, wherein the Myc-dependent cancer is selected from the group consisting of bladder cancer, breast cancer, colon cancer, gastric cancer, hepatocellular carcinoma, leukemia, lymphoma, melanoma, myeloma (including multiple myeloma), neuroblastoma, ovarian cancer, prostate cancer, rhabdomyosarcoma, small cell lung cancer, subungual melanoma, uveal melanoma and Burkitt's lymphoma.

Embodiment 99. A method for inhibiting phosphorylation of Myc protein in a subject in need thereof, the method comprising administering to the subject an inhibitor of an interaction between 3-phosphoinositide_^dependent protein kinase- 1 (PDKl) and Pololike kinase 1 (PLKl).

Embodiment 100. A method of prophylactically or therapeutically treating a Myc- dependent cancer in a subject in need thereof, the method comprising administering to the subject an inhibitor of an interaction between 3-phosphoinositide-dependent protein kinase-1 (PDKl) and Polo-like kinase 1 (PLKl).

Embodiment 101. The method according to embodiment 99 or embodiment 100, wherein the inhibitor prevents or inhibits phosphorylation of PLKl by PDKl .

Embodiment 102. A method for reducing or inhibiting phosphorylation of Myc protein, comprising administering an inhibitor selected from the group consisting of an inhibitor of 3-phosphoinositide-dependent protein kinase-1 (PDKl) and an inhibitor of PLKl.

Embodiment 103. The method according to embodiment 102, wherein the reduction or inhibition of phosphorylation of Myc protein is for treating cancer.

Embodiment 104. The method according to any one of embodiments 99 to 103, comprising administering an inhibitor of PDKl and an inhibitor of PLKl. Embodiment 105. The method according to any one of embodiments 102 to 104, wherein the inhibitor of PDK1 is selected from the grou consisting of OSU 03012, BX795, BAG 956, an anti-PDKl antibody, an inhibitory PDK1 RNA molecule, and BX912.

Embodiment 106. The method according to any one of embodiments 102 to 105, wherein the inhibitor of PLKl is selected from the group consisting of BI2536, GW843682X, Cylapolin-1, DAP-81, ZK-thiazolidinone, Compound 36, LFM-A13, Poloxin, Poloxipan, Purpurogallin, ON 01910.Na, HMN-176, GSK461364, NMS-P937, an anti-PLKl antibody, an inhibitory PLKl RNA molecule, and BI6727.

Embodiment 107. The method according to any one of embodiments 102 to 106, wherein the inhibitor of PDK1 is BX795 and the inhibitor of PLK1 is BI2536.

Embodiment 108. The method according to any one of embodiments 102 to 107, wherein said inhibitor of PDK1 and said inhibitor of PLKl are administered in a therapeutically effective amount.

Embodiment 109. The method according to embodiment 108, wherein said therapeutically effective amount of said inhibitor of PLKl is selected from the group consisting of about 0.01 μg/kg body weight per day to about 60 mg/kg body weight per day, about 0.1 μg/kg body weight per day to about 60 mg/kg body weight per day, about 1 μg/kg body weight per day to about 60 mg/kg body weight per day, about 0.01 mg/kg body weight per day to about 60 mg/kg body weight per day, about 0.1 mg/kg body weight per day to about 60 mg/kg body weight per day, about 1 mg/kg body weight per day to about 60 mg/kg body weight per day, at least about 1 mg/kg body weight per day, at least about 5 mg/kg body weight per day, at least about 10 mg/kg body weight per day, at least about 15 mg/kg body weight per day, at least about 20 mg/kg body weight per day, at least about 25 mg/kg body weight per day, at least about 30 mg/kg body weight per day, at least about 35 mg/kg body weight per day, at least about 40 mg/kg body weight per day, at least about 45 mg/kg body weight per day, at least about 50 mg/kg body weight per day, at least about 55 mg/kg body weight per day, at least about 60 mg/kg body weight per day, about 25 mg/kg body weight per day to about 60 mg/kg body , weight per day, about 30 mg/kg body weight per day to about 55 mg/kg body weight per day, about 35 mg/kg body weight per day to about 50 mg/kg body weight per day, and about 40 mg/kg body weight per day to about 45 mg/kg body weight per day.

Embodiment 110. The method according to embodiment 108, wherein said therapeutically effective amount of said inhibitor of PDK1 is selected from the group consisting of about 0.01 ^g/kg body weight per day to about 60 mg/kg body weight per day, about 0.1 μg/kg body weight per day to about 60 mg/kg body weight per day, about 1 μg/kg body weight per day to about 60 mg/kg body weight per day, about 0.01 mg/kg body weight per day to about 60 mg/kg body weight per day, about 0.1 mg/kg body weight per day to about 60 mg/kg body weight per day, about 1 mg/kg body weight per day to about 60 mg/kg body weight per day, at least about 1 mg/kg body weight per day, at least about 5 mg/kg body weight per day, at least about 10 mg/kg body weight per day, at least about 15 mg/kg body weight per day, at least about 20 mg/kg body weight per day, at least about 25 mg/kg body weight per day, at least about 30 mg/kg body weight per day, at least about 35 mg/kg body weight per day, at least about 40 mg/kg body weight per day, at least about 45 mg/kg body weight per day, at least about 50 mg/kg body weight per day, at least about 55 mg/kg body weight per day, at least about 60 mg/kg body weight per day, about 25 mg/kg body weight per day to about 60 mg/kg body weight per day, about 30 mg/kg body weight per day to about 55 mg/kg body weight per day, about 35 mg/kg body weight per day to about 50 mg/kg body weight per day, and about 40 mg/kg body weight per day to about 45 mg/kg body weight per day.

Embodiment 111. An inhibitor of an interaction between 3-phosphoinositide- dependent protein kinase- 1 (PDK1) and Polo-like kinase 1 (PLK1) for use in inhibiting phosphorylation of Myc protein in a subject in need thereof, the method comprising administering to the subject.

Embodiment 112. An inhibitor of an interaction between 3 -phosphoinosi tide- dependent protein kinase- 1 (PDKl) and Polo-like kinase 1 (PL 1) for use in prophylactically or therapeutically treating a Myc-dependent cancer in a subject in need thereof.

Embodiment 113. The composition according to embodiment 111 or embodiment 112, wherein the inhibitor prevents or inhibits phosphorylation of PLK1 by PDKl .

Embodiment 114. A composition for use in reducing or inhibiting phosphorylation of Myc protein comprising an inhibitor selected from the group consisting of an inhibitor of PDKl and an inhibitor of PLKl.

Embodiment 115. The composition according to embodiment 114, wherein the composition is for treating cancer.

Embodiment 116. The composition according to any one of embodiments 111 to

115, comprising an inhibitor of PDKl and an inhibitor of PLKl .

Embodiment 117. The composition according to any one of embodiments 114 to

116, wherein the inhibitor of PDKl is selected from the group consisting of OSU 03012, BX795, BAG 956, an anti-PDKl antibody, an inhibitory PDK1 RNA molecule, and BX912.

Embodiment 1 18. The composition according to any one of embodiments 114 to 117, wherein the inhibitor of PLK1 is selected from the group consisting of BI2536, GW843682X, Cylapolin-1, DAP-81, ZK-thiazolidinone, Compound 36, LFM-A13, Poloxin, Poloxipan, Purpurogallin, ON 01910.Na, HMN-176, GSK461364, NMS-P937, an anti-PLKl antibody, an inhibitory PLK1 RNA molecule, and BI6727.

Embodiment 119. The composition according to any one of embodiments 114 to 117, wherein the inhibitor of PDKl is BX795 and the inhibitor of PLK1 is BI2536.

Embodiment 120. The composition according to any one of embodiments 114 to 119, comprising said inhibitor of PDKl and said inhibitor of PLK1 in a therapeutically effective amount.

Embodiment 121. The composition according to embodiment 120, wherein said therapeutically effective amount of said inhibitor of PLK1 is selected from the group consisting of about 0.01 g/kg body weight per day to about 60 mg/kg body weight per day, about 0.1 μg/kg body weight per day to about 60 mg/kg body weight per day, about 1 μg/kg body weight per day to about 60 mg/kg body weight per day, about 0.01 mg/kg body weight per day to about 60 mg/kg body weight per day, about 0.1 mg/kg body weight per day to about 60 mg/kg body weight per day, about 1 mg/kg body weight per day to about 60 mg/kg body weight per day, at least about 1 mg/kg body weight per day, at least about 5 mg/kg body weight per day, at least about 10 mg/kg body weight per day, at least about 15 mg/kg body weight per day, at least about 20 mg/kg body weight per day, at least about 25 mg/kg body weight per day, at least about 30 mg/kg body weight per day, at least about 35 mg/kg body weight per day, at least about 40 mg/kg, body weight per day, at least about 45 mg/kg body weight per day, at least about 50 mg/kg body weight per day, at least about 55 mg/kg body weight per day, at least about 60 mg/kg body weight per day, about 25 mg/kg body weight per day to about 60 mg/kg body weight per day, about 30 mg/kg body weight per day to about 55 mg/kg body weight per day, about 35 mg/kg body weight per day to about 50 mg/kg body weight per day, and about 40 mg/kg body weight per day to about 45 mg/kg body weight per day.

Embodiment 122. The composition according to embodiment 120, wherein said therapeutically effective amount of said inhibitor of PDKl is selected from the group consisting of about 0.01 μg/kg body weight per day to about 60 mg/kg body weight per day, about 0.1 μg/kg body weight per day to about 60 mg/kg body weight per day, about 1 μξ/kg body weight per day to about 60 mg/kg body weight per day, about 0.01 mg/kg body weight per day to about 60 mg/kg body weight per day, about 0.1 mg/kg body weight per day to about 60 mg/kg body weight per day, about 1 mg/kg body weight per day to about 60 mg/kg body weight per day, at least about 1 mg/kg body weight per day, at least about 5 mg/kg body weight per day, at least about 10 mg/kg body weight per day, at least about 15 mg/kg body weight per day, at least about 20 mg/kg body weight per day, at least about 25 mg/kg body weight per day, at least about 30 mg/kg body weight per day, at least about 35 mg/kg body weight per day, at least about 40 mg/kg body weight per day, at least about 45 mg/kg body weight per day, at least about 50 mg/kg body weight per day, at least about 55 mg/kg body weight per day, at least about 60 mg/kg body weight per day, about 25 mg/kg body weight per day to about 60 mg/kg body weight per day, about 30 mg/kg body weight per day to about 55 mg/kg body weight per day, about 35 mg/kg body weight per day to about 50 mg/kg body weight per day, and about 40 mg/kg body weight per day to about 45 mg/kg body weight per day.

Embodiment 123. Use of an inhibitor of an interaction between 3-phosphoinositide- dependent protein kinase- 1 (PDKl) and Polo-like kinase 1 (PLKl) in the preparation of a medicament for inhibiting phosphorylation of Myc protein in a subject in need thereof, the method comprising administering to the subject.

Embodiment 124. Use of an inhibitor of an interaction between 3-phosphoinositide- dependent protein kinase- 1 (PDKl) and Polo-like kinase 1 (PLKl) in the preparation of a medicament for prophylactically or therapeutically treating a Myc-dependent cancer in a subject in need thereof.

Embodiment 125. The composition according to embodiment 123 or embodiment 124, wherein the inhibitor prevents or inhibits phosphorylation of PLKl by PDKl .

Embodiment 126. Use of an inhibitor selected from the group consisting of an inhibitor of PDKl and an inhibitor of PLKl, in the manufacture of a medicament for reducing or inhibiting phosphorylation of Myc protein.

Embodiment 127. The use according to embodiment 126, wherein the medicament is for treating cancer.

Embodiment 128. The use according to embodiment 123 or 127, wherein said medicament comprises an inhibitor of PDKl and an inhibitor of PLKl .

Embodiment 129. The use according to any one of embodiments 126 to 128, wherein the inhibitor of PDKl is selected from the group consisting of OSU 03012, BX795, BAG 956, an anti-PDKl antibody, an inhibitory PDKl RNA molecule, and BX912. Embodiment 130. The use according to any one of embodiments 126 to 129, wherein the inhibitor of PLKl is selected from the group consisting of BI2536, GW843682X, Cylapolin-1, DAP-81, ZK-thiazolidinone, Compound 36, LFM-A13, Poloxin, Poloxipan, Purpurogallin, ON 01910.Na, HMN-176, GSK461364, NMS-P937, an anti-PLKl antibody, an inhibitory PLKl RNA molecule, and BI6727.

Embodiment 131. The use according to any one of embodiments 126 to 130, wherein the inhibitor of PDKl is BX795 and the inhibitor of PLKl is BI2536.

Embodiment 132. The use according to any one of embodiments 126 to 131, wherein said medicament comprises said inhibitor of PDKl and said inhibitor of PLKl in a therapeutically effective amount.

Embodiment 133. The use according to embodiment 132, wherein said therapeutically effective amount of said inhibitor of PLKl is selected from the group consisting of about 0.01 g kg body weight per day to about 60 mg/kg body weight per day, about 0.1 μg/kg body weight per day to about 60 mg/kg body weight per day, about 1 μg/kg body weight per day to about 60 mg/kg body weight per day, about 0.01 mg/kg body weight per day to about 60 mg/kg body weight per day, about 0.1 mg/kg body weight per day to about 60 mg/kg body weight per day, about 1 mg/kg body weight per day to about 60 mg/kg body weight per day, at least about 1 mg/kg body weight per day, at least about 5 mg/kg body weight per day, at least about 10 mg/kg body weight per day, at least about 15 mg/kg body weight per day, at least about 20 mg/kg body weight per day, at least about 25 mg/kg body weight per day, at least about 30 mg/kg body weight per day, at least about 35 mg/kg body weight per day, at least about 40 mg/kg body weight per day, at least about 45 mg/kg body weight per day, at least about 50 mg/kg body weight per day, at least about 55 mg/kg body weight per day, at least about 60 mg/kg body weight per day, about 25 mg/kg body weight per day to about 60 mg/kg body weight per day, about 30 mg/kg body weight per day to about 55 mg/kg body weight per day, about 35 mg/kg body weight per day to about 50 mg/kg body weight per day, and about 40 mg/kg body weight per day to about 45 mg/kg body weight per day.

Embodiment 134. The use according to embodiment 132, wherein said therapeutically effective amount of said inhibitor of PDKl is selected from the group consisting of about 0.01 μg/kg body weight per day to about 60 mg/kg body weight per day, about 0.1 μg/kg body weight per day to about 60 mg/kg body weight per day, about 1 μg/kg body weight per day to about 60 mg/kg body weight per day, about 0.01 mg/kg body weight per day to about 60 mg kg body weight per day, about 0.1 mg/kg body weight per day to about 60 mg/kg body weight per day, about 1 mg/kg body weight per day to about 60 mg/kg body weight per day, at least about 1 mg/kg body weight per day, at least about 5 mg/kg body weight per day, at least about 10 mg/kg body weight per day, at least about 15 mg/kg body weight per day, at least about 20 mg/kg body weight per day, at least about 25 mg/kg body weight per day, at least about 30 mg kg body weight per day, at least about 35 mg/kg body weight per day, at least about 40 mg/kg body weight per day, at least about 45 mg/kg body weight per day, at least about 50 mg/kg body weight per day, at least about 55 mg/kg body weight per day, at least about 60 mg/kg body weight per day, about 25 mg/kg body weight per day to about 60 mg/kg body weight per day, about 30 mg/kg body weight per day to about 55 mg/kg body weight per day, about 35 mg/kg body weight per day to about 50 mg/kg body weight per day, and about 40 mg/kg body weight per day to about 45 mg/kg body weight per day.

A subject in accordance with any one of the above embodiments (where applicable) may be a mammalian subject (e.g. a human subject).

Cancer in accordance with any one of the above embodiments (where applicable) may comprise and/or arise either entirely or partially from cancer stem cells.

Brief Description of the Figures

Preferred embodiments of the invention will now be described, by way of example only, with reference to the accompanying Figures wherein:

Figure 1 demonstrates PDKl induces cell transformation through Myc induction: (A) Soft-agar growth of HEK-TERV cells infected with retroviral constructs expressing empty vector, PDKl, Myc, shPTEN, or PIK3CA-E545K; (B) Immunoblot analysis of indicated proteins in HEK-TERV-derived cell lines; (C) Soft-agar growth of HEK-PDK1 and HEK-E545K cells transfected with non-targeting siRNA (siNC) or Myc siRNA, respectively; * P<0.01; (D) Soft-agar growth of HEK-PDK1 , HEK-E545K and HEK-Myc cells treated with BX795 (2.5 μΜ), GDC-0941 (0.5 μΜ), or MK2206 (0.5 μΜ) for 14 days; Right panel shows the changes of Myc and AKT after indicated drug treatments; (E) Soft-agar growth of HMEC and RWPE-1 cells expressing retroviral empty vector, PDKl or E545K; (F) Immunoblot analysis of indicated proteins in HMEC and RWPE-1- derived cell lines; (G) Immunoblot analysis of indicated cancer cell lines treated with PDKl siRNA; (H) Immunoblot analysis of indicated breast cancer cell lines treated with BX795 (2;5 μΜ) for 24h; (I) Cell viability assay showing the dose response of a panel of breast cancer cell lines that are Myc-dependent (MDA-MB-231, SUM159PT and Hs578T) and Myc-independent (T47D and BT474) to BX795 treatment. All the data in the graph bars represent mean ± SEM, n=3; Figure 2 shows that PLKl is a crucial downstream effector of PDKl for Myc activation and cell survival: (A) Cell viability of HEK-vector, HEK-PDK1 and HEK- E545K cell treated with the indicated concentrations of BI2536 and GW843682X for 4 days; (B) Cell viability of RWPE-1 and HMEC-derived cell lines treated with 10 nM BI2536 for 4 days; (C) Immunoblot analysis of PLKl in indicated cell lines; (D) Soft- agar growth of indicated cell lines treated with 10 nM BI2536 for 14 days; (E) Immunoblot analysis in HEK-PDK1 and HEK-Myc cells treated with BI2536 and GW843682X as indicated concentration for 24 hr; (F) Apoptosis by sub-Gl analysis of indicated cell lines treated with 10 nM BI2536 for 48 hr; (G) Apoptosis of indicated cell lines treated with.NC or PLKl siRNAs for 48 hr (Upper) and immunoblot analysis of indicated proteins (Bottom); (H) Xenograft tumor growth of HEK-PDK1 and HEK- E545K cells in nude mice treated with 50 mg/kg BI2536 twice per week as described in Experimental Procedures. Data are means ± SEM (n=5 for each group); (I) Cell viability assay showing the dose response of a panel of breast cancer cell lines that are Myc- dependent (MDA-MB-231, SUM159PT and Hs578T) and Myc-independent (T47D, BT474, MCF-IOA and HMEC) to BI2536 treatment.

Figure 3 indicates that PDKl regulates PLKl in vivo and in vitro. (A) Immunoblot analysis of indicated proteins in HCT116 PDKl wild-type (PDK1+/+) and knockout (PDKl-/-) cells. Cells were synchronized by double-thymidine block and released into cell cycle at indicated times; (B) Immunoblot analysis of indicated proteins in MDA-MB- 231 shNC and PDKl knockdown (shPDKl) cells. Cells were synchronized by double- thymidine block and released into cell cycle at indicated times; (C) Cells were synchronously released from double-thymidine arrest (TT) and harvested at the indicated times for FACS analysis. Percentages of cells positive for phosphor-H3 (S28) are indicated; (D) PLKl protein domain analysis (upper) and PDKl consensus motif alignment with other known PDKl substrates (bottom); (E) Immunoblot analysis of immunoprecipitated PLKl in 293T cells transfected with PLKl, or-cotransfected with PDKl, with or without 2.5 μΜ BX795, 5.0 μΜ BX912 and 1.0 μΜ VX680 treatment for 24 hr; (F) In vitro immunoprecipitation-kinase assay using recombinant PDKl and immunoprecipitated endogenous PLKl from DLDl cells as substrate. Cells were synchronized by a double-thymidine arrest and released in the presence or absence of 2.5 μΜ BX795 or 1.0 μΜ VX680 for 8 hr. PLKl IP-kinase assay was performed and the phosphorylation of PLKl was assessed by using p-T210 PLKl antibody; (G) In vitro kinase assay using recombinant PDKl and recombinant PLKl with or without 1.0 μΜ BX795, 1.0 μΜ BX912 and 1.0 μΜ VX680; Figure 4 shows PLK1 interacts with Myc and induces Myc phosphorylation. (A) Co-immunoprecipitation analysis in 293T cells transfected with ectopic PLK1, Myc, or both; (B) Co-immunoprecipitation analysis of endogenous PLK1 and Myc in HEK- Vector and HEK-PDKl cells; (C) Co-immunoprecipitation analysis of endogenous PLK1 and Myc in cancer cell lines; (D) Immunoblot analysis of Myc protein expression in 293T cells transfected with empty vector, PLK.1 WT or kinase dead mutant of PLK1 (KD) in the absence or presence ectopic Myc; (E) Immunoblot analysis of in vitro kinase assay using recombinant PLK1 and recombinant Myc proteins in the presence or absence of BI2536. Phosphorylation of Myc was assessed by indicated Myc antibodies; (F) Immunoblot analysis of in vitro kinase assay using immunoprecipitated PLK1 and recombinant Myc proteins in the presence or absence of BI2536; (G) Immunoblot analysis of in vitro kinase assay using immunoprecipitated PLK1 from DLD1 cells treated with or without 2.5 μΜ BX795; (H) Immunoblot analysis of in vitro kinase assay using immunoprecipitated PL 1 from DLD1 and DLD1 PDK1-/- cells;

Figure 5 illustrates that PDKl-PLKl-Myc signaling drives CSC-like phenotypes. (A) Representative phase-contrast images of HEK- vector, PDK1, Myc or E545K cells grown in monolayer culture in upper panel. Lower panel shows tumorsphere formation in suspension culture without serum. Scale bar represents 100 μπι; (B) Spheres formed in suspension culture reattached when transferred back to gelatin-coated culture plates in DMEM, 10% FBS and the sphere reformed a monolayer for 48 hr. Scale bar represents 100 μη ; (C) Self-renewal capacity of PDK1 and Myc-transformed cells. Primary tumorspheres were trypsinized into single cells and reformed spheres 7 days later for 4 passages; (D) Xenograft tumor growth in nude mice. HEK-PDKl, Myc or Έ545Κ injected with indicated cell numbers were shown. Data are means ± SEM; (E) Xenograft tumor formation frequencies of tumor-initiating cells derived from the first, second, and third passage tumors arising from HEK-PDKl cells.; (F) Immunoblot analysis showing the PDKl-PLKl-Myc signaling in CD44⁺/CD24^"low or non-CD44⁺/CD24^"low populations; (G) Representative FACS profiles for CD44⁺/CD24^"low or non- CD44⁺/CD24^"low populations in MDA-MB-231 and MD A-MB-231 -PDK1 KD cells. Inset: Isotype control; (H) Bar graphs showing the percentages of CD44⁺/CD24^"low cells in MDA-MB-231 cells depleted of PDK1 or PLKl. * P<0.005; (I) Bar graphs showing the percentages of CD44⁺/CD24^"low cells in MDA-MB-231 cells treated with indicated inhibitors. * P<0.01, ** P<0.005; (J) Bar graphs showing the number of tumorspheres of MDA-MB-231 cells depleted of PDK1/PLK1 (Left) or treated with BX795/BI2536. * P<0.01 ; Data are means ± SEM (n=3); Figure 6 indicates that PDKl evokes an ESC-like gene expression profile. (A) Venn diagram showing the overlapping of differentially expressed genes in HEK-PDK1, Myc or E545K as compared with HEK-vector control cells; (B) Heat map of differentially expressed genes in HEK-PDK1, Myc or E545K cells; (C) qRT-PCR analysis of representative genes in HEK-transformed cells. Data are shown as gene expression fold change (log 2) relative to HEK-vector cells. Red and green bars indicate upregulation and downregulation, respectively. Black bars indicate <0.6-fold change in log 2 (1.5 fold in linear scale). Data are means ± SEM, n=3; (D) Immunoblot analysis of indicated proteins; (E) 318 upregulated and 350 downregulated genes show significant differences between PDKl and Myc regulation. Average gene expression levels indicating a higher impact of PDKl on these genes; (F) qRT-PCR analysis of indicated miRNAs in HEK-PDK1 ,-Myc and -E545K cells. Data are presented as (c); (G) qRT-PCR analysis of indicated genes in HEK-PDKl cells treated with 10 nM BI2536 at indicated times. Data are means ± SEM (n=3);

Figure 7 shows that BI2356 synergizes with BEZ235 to induce synthetic lethality in CRC both in vitro and in vivo. (A) Immunoblot analysis of DLD1 cells treated with 100 nM Rapamycin or 100 nM BEZ235 for 48 hr; (B) Immunoblot analysis of DLD1, SW480 and HT15 cells treated with 10 nM B 12536, 100 nM BEZ235 alone or combination for 48 hr; (C) Sub-Gl detection of apoptosis in DLD1, SW480 and HT15 cells treated as (B);

(D) The growth curves of DLD1, SW480 and HT15 cells treated with 10 nM BI2536, 100 nM BEZ235 single or combination for 4 days. RLU means relative luminescence units;

(E) Xenograft tumor growth of SW480 and HT15 cells in nude mice treated with BI2536 at 50 mg/kg or BEZ235 at 35 mg/kg or both, every other day as described in Experimental Procedures. Error bars represent ± SEM (n=6 per group). Data are means ± SEM (n=3);

Figure 8 demonstrates that PDKl -induces Oncogenic Transformation through Myc Activation. (A) Soft-agar colony formation assay for HEK-TERV cells infected with vector, PDKl, Myc, shPTEN, and PIK3CA-E545K. The representative images of three independent experiments are shown on the right. Average diameters of colonies are shown on the left; (B) Quantitative Myc mRNA level as measured by using a probe detecting the 3 UTR of Myc mRNA; (C) Soft-agar colony formation assay for HEK- TERV cells infected with vector, PDKl wild-type (PDKl WT) and PDKl kinase-dead mutant (PDKl KD). The immunoblotting results show the expression of indicated protein. The representative images of colonies are shown in the bottom; (D) Bar graphs showing soft-agar colony formation assay with multiple dosages of PDKl inhibitor BX795 and BX912; (E) Bar graphs showing soft-agar colony formation assay with multiple dosages of PI3K inhibitor (GDC-0941) and AKT inhibitors (MK2206 and GSK690693);

Figure 9 shows the results of Synthetic Lethal Screening which Identifies PLKl as a Crucial Downstream Effector of PDKl to Mediate Cancer Cell Survival. (A) Cell Viability of HEK-PDKl and vector control cells treated with various kinase inhibitors. The results are expressed as a percentage of cell viability of 5.0 μΜ each kinase inhibitor- treated cells relative to the DMSO-treated controls and presented as means ± SEM (n=3); (B) Soft-agar growth of indicated cell lines treated with 10 nM BI2536 for 14 days; (C) HEK-PDKl, E545K and vector control cells treated 10 nM BI2536, and caspase 3 activity was measured by FACS analysis. The data are presented as mean ± SEM; (D) Cell cycle analysis of HEK-PDKl, E545K and vector control cells treated with 10 nM BI2536 for 48 hr;

Figure 10 indicates PLKl Inhibition Decreases Myc Protein expression in various Cancer Cell Lines. (A) Immunoblot analysis of Myc expression in a variety of human cancer cell lines treated with 10 nM BI2536 for 48 hr; (B) Immunoblot analysis of indicated proteins in HI 299 and H460 treated with NC or PLKl siRNA; (C) qRT-PCR of Myc mRNA level in H460 and H1299 treated as (B). Data represent ± SEM, n=3; (D) Immunoblot analysis of Myc protein level in SW480 cells treated with 10 nM BI2536 at indicated times. Cell cycle stages were analyzed by FACS;

Figure 11 illustrates that Genetic and Pharmacologic Inhibition of PDKl Blocks PLKl Activity in Cancer Cells. (A) Immunoblot analysis of indicated proteins in DLD1 PDKl wild-type (PDKl +/+) and knockout (PDKl-/-) cells. Cells were synchronized by double-thymidine block and released into cell cycle at indicated times; (B) Immunoblot analysis of p-AKT (T308) in HCT116 cells. Cells were incubated in medium containing 0.25% FBS for 48 h and then stimulated with 10% FBS medium for 5, 10, 30 or 60 min as indicated; (C) Immunoblot analysis of indicated proteins in cancer cell lines treated with 2.5 μΜ BX795, 1.0 μΜ GDC-0941 or 1.0 μΜ MK2206. Cells were double- thymidine blocked and released for 8 hrs in the absence or presence of above inhibitors;

Figure 12 demonstrates that PDKl Drives Cancer Initiating Cell Maintenance and Self-Renewal. (A) Bar graphs showing the number of tumorspheres of HEK-vector, - PDKl, -Myc and -E545K cells; (B) Self-renewal capacity of PDKl -transformed cells in sphere culture conditions. Data shows the percentage of tumorsphere formation of PDKl cells during 4 passages; (C) Soft-agar growth of MEF p53-/- (MEF) cells expressing empty vector, PDKl or E545K (Left). Immunoblot analysis of above cell lines for indicated proteins (Right); (D) Tumorsphere formation of MEF-PDK1 or -E545K cells cultured in suspension (Upper), ESC-like colonies formation cultured in mES media (Lower). Scale bar represents 100 μηι; (E) qRT-PCR analysis of ESC genes in MEF- stable cells and MEF-PDK1 cells cultured in tumorsphere medium (PDK1 SP); (F) Immunofluorescence microscopy of Sox2 and Oct4 in MEF-PDK1 cells cultured as monolayer or sphere condition. The nuclei were stained in blue with EJAPI. Scale bar represents 10 μηι; (G) Representative images of MEF-PDK1 or-E545K cells with AP staining. Scale bar represents 100 μιη;

Figure 13 shows PDK1 -induced gene signature is associated with human cancers and patient survival. (A) Significant overlapping of PDK1 -regulated genes with previously identified ESC-like genes and Polycomb target genes. Corresponding p-values are indicated; (B) Gene set enrichment analysis (GSEA) plots showing enrichment of PDK1- upregulated ESC-like genes or downregulated PRC genes in human tumors versus normal tissues; (C) GSEA of PDK1 -induced ESC-like genes and Polycomb target genes shows the association with high grade breast tumors compared with low grade tumor; (D) Kaplan-Meier survival curves of breast and lung tumors stratified into 4 classes based on quartile expression of the PDK1 -induced ESC-like gene signature;

Figure 14 demonstrates that BI2536 Synergizes with PDK-mTOR Inhibitor BEZ235 to Induce Robust Apoptosis and Anti -tumor Effect in CRC. (A) Representative images of immunohistochemical (IHC) analysis of PLK1 in human colon tumor and normal mucosa from the same patient. Dark brown color represents positive staining of PLK1, and blue color represents the nuclear staining; (B) Box plot showing the different expression of PLK1 protein levels in colon primary tumors (N=106) and normal colon mucosa (N=76) as detected by IHC analysis. The scoring criteria are as described on Materials and Methods; (C) HT15 and DLD1 cells were treated with 10 nM ΒΓ2536, 100 nM BEZ235, combination of either drugs, or DMSO control for 48 hr, and caspase 3 activity was measured by FACS analysis; (D) BI2536 interacts synergistically with BEZ235 in HT15 cells. The cell viability of HT15 cells were analyzed after 4 days of treatment with the drug combinations. Normalized isobologram analysis of the interaction between BI2536 and BEZ235 in HT15 cells was determined by using the CompuSyn software. All data points below the red line define synergistic interaction between the two drugs (Shown as red color, CI <1.0); (E) Soft-agar growth of DLD1, SW480 and HT15 cells treated with 10 nM BI2536, 100 nM BEZ235 or combination for 14 days; (F) Immunoblot analysis of Myc protein in xenograft tumor from HT15 cells; and

Figure 15 demonstrates the Effects of BI2536 in Combination with PP242 or Rapamycin on Apoptosis and Proliferation of CRC Cells. (A) Sub-Gl detection of cell death in HT15 and SW480 cells treated with 10 nM BI2536, 2.5 μΜ alone or combination for 48h; (B) Immunoblot analysis of HT15 and SW480 cells treated as (A); (C) Immunoblot analysis of HT15 cells treated with 10 nM BI2536, 100 nM rapamycin alone or combination for 48 hr; (D) Sub-Gl detection of apoptosis in HT15 cells treated as (C); (E) The growth curves of HT15 cells treated with 10 nM BI2526, 100 nM rapamycin single or combination for 4 days. RLU means relative luminescence units; (F) Xenograft tumor growth of HT15 cells in nude mice treated with BI2536 at 50 mg/kg or rapamycin at 4 mg/kg or both as described in Experimental Procedures. Error bars represent ±SEM (n=6 per group).

Definitions

As used in this application, the singular form "a", "an" and "the" include plural references unless the context clearly dictates otherwise. For example, the term "a PLK1 inhibitor" also includes a plurality of PLK1 inhibitors.

As used herein, the term "comprising" means "including." Variations of the word "comprising", such as "comprise" and "comprises," have correspondingly varied meanings. Thus, for example, a composition "comprising" a PLK1 inhibitor may consist exclusively of that PLKl inhibitor or may include one or more additional components (e.g. an mTOR inhibitor).

As used herein, the terms "the phosphatidylinositol 3' -kinase- Akt-mammalian target of rapamycin signalling pathway", "PI3K-Akt-mTOR signalling pathway" and "PI3K-Akt-mTOR pathway" will be understood to have the same meaning. The terms will be understood to encompass a cell signalling pathway comprising, but not limited to, sequential stages of: (i) phosphorylation/activation of Akt directly or indirectly by PI3K, and (ii) activation/phosphorylation of mTOR directly or indirectly by phosphorylated/activated Akt.

As used herein, an "inhibitor" of the"PI3K-Akt-mTOR signalling pathway" will be understood to encompass any agent capable of reducing or preventing the phosphorylation/activation of mTOR by Akt, whether by direct (e.g. reducing or preventing an interaction between Akt and mTOR) or indirect (e.g. reducing or preventing phosphorylation/activation of Akt, PDK1 and/or PI3K.) means.

As used herein a "Myc-dependent cancer" is any cancer that arising at least in part due to aberrant overexpression and consequent accumulation of Myc, such that complete or partial inhibition of expression of Myc in the cancerous cells responsible for the cancer condition causes a more significant level of cancer cell neutralisation or death compared to cancerous cells responsible for a non-Myc dependent form of cancer.

As used herein, an "inhibitor" of a given protein, such as, for example, a "PI3K inhibitor", a "PDK1 inhibitor", a "PLK1 inhibitor", an "Akt inhibitor" and an "mTOR inhibitor", is any agent capable of eliciting complete or partial inhibition of a given activity of the relevant protein, including down-regulation of the activity, or antagonism of the activity.

As used herein, the term "synergistic combination" will be understood to refer a combination of components that, when used together, provide a level of effect or activity which exceeds the sum of the level of effect or activity arising from each component taken separately.

As used herein, the term "inhibitory RNA molecule" encompasses an RNA molecule capable of decreasing the expression of a given endogenous target gene, including eliciting complete or partial inhibition of expression of the gene. Non-limiting examples of "inhibitory RNA molecules" include those capable of eliciting complete or partial inhibition of expression of the gene through RNA interference (e.g. small interfering RNA (siRNA), small hairpin RNA (shRNA), microRNA), antisense RNA, double-stranded RNA (dsRNA), single stranded RNA (ssRNA) and the like.

A used herein, reference to a given form of cancer that is "resistant" to treatment with a given agent (e.g. PI3K inhibitor, a PDK1 inhibitor, a PLK1 inhibitor, an Akt inhibitor and/or an mTOR inhibitor") will be understood to be less responsive (including non-responsive) to treatment with the agent compared to a non-resistant form of the same cancer, as measurable, for example by the degree of cancer cell neutralisation or death.

As used herein, the term "prophylactic treatment" refers to a treatment which inhibits or prevents the onset, recurrence, or relapse of cancer in a subject including, but not limited to, treatment in cases where the subject does not yet experience or display the pathology or symptomatology of the disease, and cases where the subject is known to be predisposed to developing cancer.

As used herein, the term "therapeutic treatment" refers to a treatment that is administered to a subject after the onset of cancer including, but not limited to, treatment that is curative of or that slows the progression of the pathology and/or symptomatology of cancer, an treatment that reverses or reduces at least in part the pathology and/or symptomatology of cancer in the subject.

The term "therapeutically effective amount" as used herein, includes within its meaning a non-toxic but sufficient amount of a compound or composition for use in the invention to provide the desired therapeutic effect. The exact amount required will vary from subject to subject depending on factors such as the species being treated, the age and general condition of the subject, the severity of the condition being treated, the particular agent being administered, the mode of administration and so forth; Thus, it is not possible to specify an exact "effective amount". However, for any given case, an appropriate "effective amount" may be determined by one of ordinary skill in the art using only routine experimentation.

As used herein, the term "subject" includes any animal of economic, social or research importance including bovine, equine, ovine, primate, avian and rodent species. Hence, a "subject" may be a mammal such as, for example, a human or a non-human mammal.

As used herein, the terms "antibody" and "antibodies" include IgG (including IgGl, IgG2, IgG3, and IgG4), IgA (including IgAl and IgA2), IgD, IgE, or IgM, and IgY, whole antibodies, including single-chain whole antibodies, and antigen-binding fragments thereof. Antigen-binding antibody fragments include, but are not limited to, Fab, Fab' and _; F(ab')2, Fd, single-chain Fvs (scFv), single-chain antibodies, disulfide-linked Fvs (sdFv) and fragments comprising either a VL or VH domain. The antibodies may be from any animal origin. Antigen-binding antibody fragments, including single-chain antibodies, may comprise the variable region(s) alone or in combination with the entire or partial of the following: hinge region, CHI, CH2, and CH3 domains. Also included are any combinations of variable region(s) and hinge region, CHI, CH2^ and CH3 domains. Antibodies may be monoclonal, polyclonal, chimeric, multispecific, humanized, and human monoclonal and polyclonal antibodies which specifically bind the biological molecule.

As used herein the term "plurality" means more than one. In certain specific aspects or embodiments, a plurality may mean 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, or more, and any integer derivable therein, and any range derivable therein.

As used herein, the terms "protein" and "polypeptide" each refer to a polymer made up of amino acids linked together by peptide bonds and are used interchangeably herein. For the purposes of the present invention a "polypeptide" may constitute a full length protein or a portion of a full length protein. As used herein, the term "polynucleotide" refers to a single- or double-stranded polymer of deoxyribonucleotide, ribonucleotide bases or known analogues or natural nucleotides, or mixtures thereof.

As used herein, the term "kit" refers to any delivery system for delivering materials. Such delivery systems include systems that allow for the storage, transport, or delivery of reaction reagents (for example labels, reference samples, supporting material, etc. in the appropriate containers) and/or supporting materials (for example, buffers, written instructions for performing the assay etc.) f om one location to another. For example, kits include one or more enclosures, such as boxes, containing the relevant reaction reagents and/or supporting materials. The term "kit" includes both fragmented and combined kits.

As used herein, the term "fragmented kit" refers to a delivery system comprising two or more separate containers that each contains a subportion of the total kit components The containers may be delivered to the intended recipient together or separately. Indeed, any delivery system comprising two or more separate containers that each contains a subportion of the total kit components are included in the term "fragmented kit". In contrast, a "combined kit" refers to a delivery system containing all of the components of a reaction assay in a single container (e.g. in a single box housing each of the desired components).

It will be understood that use the term "about" herein in reference to a recited numerical value includes the recited numerical value and numerical values within plus or minus ten percent of the recited value.

It will be understood that use of the term "between" herein when referring to a range of numerical values encompasses the numerical values at each endpoint of the range. For example, a polypeptide of between 10 residues and 20 residues in length is inclusive of a polypeptide of 10 residues in length and a polypeptide of 20 residues in length.

Any description of prior art documents herein, or statements herein derived from or based on those documents, is not an admission that the documents or derived statements are part of the common general knowledge of the relevant art.

For the purposes of description all documents referred to herein are hereby incorporated by reference in their entirety unless otherwise stated. Detailed Description

The role of the PI3K-Akt-mTOR pathway in tumourigenesis is well recognised. The present inventors have unexpectedly identified that the oncogenic functions of PDKl are not limited to signaling through AKT, but are also elicited through activation of the serine/threonine-protein kinase PLK1. Blocking the activation of PLK1 by PDKl thus provides a new therapeutic target in the treatment of cancer. Moreover, the present inventors have also determined that the oncogenic effects of PLK1 activation by PDKl are elicited through the direct binding of PLKl to Myc inducing Myc activation. Although the role of Myc in tumourigenesis is known, clinical inhibitors of Myc are not available and the identification of the PDKl -PLKl -Myc activation pathway provides a new means of targeting Myc-dependent cancers. Moreover, resistance to drugs that target the PDKl/Akt pathway (e.g. PI3K inhibitors, mTOR inhibitors and dual PI3K-mTOR inhibitors) is prevalent and a significant cause of rumour recurrence and patient relapse. mTOR inhibition induces Myc activation a compensatory effect mitigating the antiproliferative effect of mTOR inhibitors. The present inventors have also unexpectedly identified that PLKl inhibition blocks mTOR inhibitor-induced Myc activation. The present invention thus provides a synergistic combination of PLKl and mTOR inhibitors capable of inducing massive apoptosis in cancerous cells.

Prophylactic and Therapeutic Methods

The present invention relates to the identification of an alternative pathway for PDKl -mediated tumourigenesis. Specifically, the experimental data provided herein demonstrates that PDKl is capable of phosphorylating and activating PLKl, which is a previously unknown substrate of PDKl. The experimental data also shows that direct binding of PDKl to Myc facilitates Myc phosphorylation and activation. The link between activation and accumulation of Myc protein and oncogenesis is well established. The identification of this new PDKl -PLKl -Myc cell signalling pathway in cancer cells provides a new therapeutic target for their treatment.

In one aspect, the present invention relates to methods for the prophylactic and/or therapeutic treatment of cancer in a subject by administering agent/s capable of inhibiting or blocking activation of Myc through the newly identified PDKl -PLKl -Myc cell signalling pathway in cancer cells of the subject.

The agent/s may target, for example, an interaction between PDKl and PLKl and thereby inhibit or block phosphorylation/activation of PLKl via interaction/s with PDKl. The interaction may be a direct or indirect interaction. The direct interaction may be a binding interaction. Suitable agents for inhibiting or blocking an interaction between PDKl and PLKl this purpose are well known to the skilled person and are commercially available. Non-limiting examples of suitable agent/s include those provided within compositions of the present invention (see section below entitled "Compositions"). In some embodiments, the interaction between PDKl and PLKl may be inhibited or blocked using one or more antibodies comprising binding specificity for PDKl and PLKl. In other embodiments, a natural or synthetic compound agent capable of achieving this outcome may be used. The skilled person is readily able to test whether a given agent inhibits or blocks phosphorylation/activation of PLKl by PDKl using known methods in the art, including those described in the Examples of the present specification.

The agent/s may target, for example, PDKl. Suitable agents for inhibiting or blocking PDKl activity are known in the field and include, but are not limited to, those provided within compositions of the present invention as set out in the section below entitled "Compositions". Any agent capable of blocking or inhibiting PDKl activity may be utilised. The agent may be, for example, OSU 03012, BX795, BAG 956, BX912, an anti-PDKl antibody, an inhibitory PDKl RNA molecule, or a combination thereof.

The agerit/s may target, for example, PLKl. Suitable agents for inhibiting or blocking PLKl activity are known in the field and include, but are not limited to, those provided within compositions of the present invention as set out in the section below entitled "Compositions". Any agent capable of blocking or inhibiting PLKl activity may be utilised. The agent may be, for example, BI2536, GW843682X, Cylapolin-1, DAP-81, ZK-thiazolidinone, Compound 36, LFM-A13, Poloxin, Poloxipan, Purpurogallin, ON 01910.Na, HMN-176, GSK461364, NMS-P937, BI6727, an anti-PLKl antibody, an inhibitory PLKl RNA molecule, or any combination thereof.

The agent/s may be capable of targeting both PDKl and PLKl.

The agent s may be capable of reducing the expression of PDKl and/or PLKl. The agents capable of inhibiting or blocking PDKl and/or PLKl expression may be inhibitory RNA molecules including those which are present within compositions of the present invention (refer to section below entitled "Compositions"). For example, the inhibitory RNA molecule may be one that is capable of eliciting complete or partial inhibition of expression of the gene through RNA interference (e.g. small interfering RNA (siRNA), small hairpin RNA (shRNA), microRNA), antisense RNA, double-stranded RNA (dsRNA), single stranded RNA (ssRNA) and the like.

Experimental data in the Examples of the present specification identifies that inhibition of mTOR activation (e.g. via the PI3K-Akt cell signalling pathway) induces Myc activation. This compensatory effect mitigates the anti-proliferative effect of inhibitors capable of directly or indirectly reducing mTOR activation. The identification of the PD l-PLKl-Myc cell signalling pathway as an alternative pathway of activation and tumourigenesis through PDK1 provides a rationale to administer combination treatments comprising inhibitor/s of the PI3K-Akt pathway and inhibitor/s of the Myc activation via the PDKl-PLKl-Myc cell signalling pathway.

Accordingly, in a further aspect the present invention relates to methods for the prophylactic and/or therapeutic treatment of cancer in a subject by administering a combination of inhibitory agents. A first agent of the combination may be capable of inhibiting or blocking activation of Myc via the PDKl-PLKl-Myc cell signalling pathway. A second agent of the combination may be capable of inhibiting or blocking activation of Myc through the newly identified PDKl-PLKl-Myc cell signalling pathway. No particular limitation exists in relation to the particular agents used in the combination treatment. Non-limiting examples of suitable agent/s include those provided within compositions of the present invention (see section below entitled "Compositions"). For example, the combination of agents may comprise a PI3K inhibitor, Akt inhibitor, mTOR inhibitor, and/or a dual PI3K/mTOR inhibitor in combination with a PLK1 inhibitor. In some embodiments, the combination comprises a PI3K inhibitor combined with a PLK1 inhibitor, an Akt inhibitor combined with a PLK1 inhibitor, an mTOR inhibitor combined with a PLK1 inhibitor, or a dual PI3K/mTOR inhibitor combined with a PLK1 inhibitor.

By way of non-limiting example, one or more agents of the combination may be capable of reducing the expression of PI3K, PLK1, Akt, mTOR and/or PDK1. The agent/s capable capable of reducing the expression may be inhibitory RNA molecules including those which are present within compositions of the present invention (refer to section below entitled "Compositions"). For example, the inhibitory RNA molecule may be one that is capable of eliciting complete or partial inhibition of expression of the gene through RNA interference (e.g. small interfering RNA (siRNA), small hairpin RNA (shRNA), microRNA), antisense RNA, double-stranded RNA (dsRNA), single stranded RNA (ssRNA) and the like.

By way of non-limiting example, the PI3K inhibitor of the combination treatment may be selected from the group consisting of GSK2636771, IPI-145 (INK1197), LY294002, GDC-0941, CAL-101 (GS-1101, Idelalisib), BEZ235 (NVP-BEZ235), BKM120 (NVP-BKM120, Buparlisib), NU7441 (KU-57788), Wortmannin, TGX-221, BYL719, an anti-PI3K antibody, an inhibitory PI3K RNA molecule, PI- 103, and any combination thereof. By way of non-limiting example, the Akt inhibitor of the combination treatment may be selected from the group consisting of afuresertib (GSK2110183), perifosine (KRX-0401), RX-0201, Erucylphosphocholine (ErPC), PBI-05204, GSK690693, A- 443654, AKT inhibitor ARQ 092, AKT inhibitor AZD5363, AKT inhibitor GDC-0068, AKT inhibitor GSK2141795, AKT inhibitor LY2780301, AKT inhibitor MK2206, A- 674563, CCT 128930, an anti-Akt antibody, an inhibitory Akt RNA molecule, AKT inhibitor SRI 3668, and any combination thereof.

By way of non-limiting example, the mTOR inhibitor of the combination treatment may be selected from the group consisting of Rapamycin, PP242, Temsirolimus, Sirolimus, Everolimus, Ridaforolimus, AZD8055, an anti-mTOR antibody, an inhibitory mTOR RNA molecule, INK 128, and any combination thereof.

The inhibitory agents of the combination may act in a synergistic fashion for the prophylactic or therapeutic treatment of cancer in the subject. Accordingly, the beneficial effect of administering the agents in combination may exceed the additive beneficial effect of each agent taken separately. The provision of a synergistic effect of the combination can be determined readily assessed using known techniques including those exemplified in the Examples of the present specification and be measured on eth basis of factors including the amount/rate of cancer cell death and/or the rate of cancer cell proliferation.

In an additional aspect the present invention relates to methods for inhibiting phosphorylation of Myc protein in a cell. The cell may or may not be a cancerous cell, and the cell may be within a subject. The methods according to this aspect comprise administering to the cell or the subject an inhibitor of an interaction between 3- phosphoinositide-dependent protein kinase- 1 (PDKl) and Polo-like kinase 1 (PLKl). The agent/s may target, for example, an interaction between PDKl and PLKl and thereby inhibit or block phosphorylation/activation of PLKl via interaction/s with PDKl. The interaction may be a direct or indirect interaction. The direct interaction may be a binding interaction. Suitable agents for inhibiting or blocking an interaction between PDKl and PLKl this purpose are well known to the skilled person and are commercially available. Non-limiting examples of suitable agent s include those provided within compositions of the present invention (see section below entitled "Compositions"). In some embodiments, the interaction between PDKl and PLKl may be inhibited or blocked using one or more antibodies comprising binding specificity for PDKl and PLKl. In other embodiments, a natural or synthetic compound agent capable of achieving this outcome may be used. The skilled person is readily able to test whether a given agent inhibits or blocks phosphorylation/activation of PLKl by PDKl using known methods in the art, including those described in the Examples of the present specification.

Although there is no particular limitation to the type of cancer treated by the methods of these aspects, in some embodiments the methods are used to treat Myc- dependent cancer. In general, a cancer that is Myc-dependent is one that arises in the subject at least in part due to aberrant overexpression and consequent accumulation of Myc. As identified herein, activation of PLKl through PDKl can result in Myc activation, and hence at least one source of Myc accumulation in cancer cells can arise from overactivation via this newly identified pathway. The dependence of a given cancer type on Myc activation/accumulation can be determined using known methods in the art. For example, a cancerous cell that is Myc-dependent will respond to inhibition of Myc activity or expression (e.g. cell death/apoptosis, inhibition of cell division) whereas a cancerous cell that is not a Myc dependent condition may exhibit a reduced response or no response to the inhibition of Myc. Non-limiting examples of cancer types that may be Myc-dependent include bladder cancer, breast cancer, colon cancer, gastric cancer, hepatocellular carcinoma, leukemia, lymphoma, melanoma, myeloma (including multiple myeloma), neuroblastoma, ovarian cancer, prostate cancer, rhabdomyosarcoma, small cell lung cancer, subungual melanoma, uveal melanoma and Burkitt's lymphoma. Non limiting examples of organs and tissues in which Myc-dependent cancerous cells may be prophylactically or therapeutically treated in accordance with the methods of these aspects include, but are not limited to, normal tissue, adrenal gland, appendix, bone marrow, bronchus, cerebellum, colon, duodenum, endometrium, epididymis, fallopian tube, gall bladder, heart, kidney, lateral ventricle, liver, lung, lymph node, nasopharynx, oesophagus, oral mucosa, ovary, pancreas, parathyroid, placenta, prostate, rectum, salivary gland, seminal vesicle, skin, small intestine, spleen, stomach, testis, and tonsil.

In some embodiments, the methods of these aspects may be used to treat cancer that is resistant to an agent which prevents or inhibits activation of mTOR via the PI3K-AKT cell signalling pathway. As set out above, PI3K-AKT cell signaling pathway is one of the most commonly deregulated signaling pathways in human cancers. Resistance is prevalent to drugs that target the PDKl/Akt pathway (e.g.^' PI3K inhibitors, mTOR inhibitors and dual PI3K-mTOR inhibitors), which is a significant cause of tumour recurrence and patient relapse. Accordingly, the identification of an alternative pathway by which PDKl activation can mediate tumourigenesis provides a means of treating subjects with cancer that display resistance to drug/s and treatment/s targeting at the PI3K-AKT cell signaling pathway. For example, in some embodiments the methods may be used to treat cancer that is resistant to a PI3K inhibitor, Akt inhibitor, an mTOR inhibitor, and/or a dual PI3K/mTOR inhibitor.

By way of non-limiting example, the cancer treated may be resistant to treatment with a PI3K inhibitor selected from the group consisting of GSK2636771, IPI-145 (ΓΝΚ1197), LY294002, GDC-0941, CAL-101 (GS-1101, Idelalisib), BEZ235 (NVP- BEZ235), BKM120 (NVP-BKM120, Buparlisib), NU7441 (KU-57788), Wortmannin, TGX-221, BYL719, an anti-PI3K antibody, an inhibitory PI3K RNA molecule, PI- 103, and any combination thereof.

By way of non-limiting example, the cancer treated may be resistant to treatment with an Akt inhibitor selected from the group consisting of afuresertib (GSK2110183), perifosine (KRX-0401), RX-0201, Erucylphosphocholine (ErPC), PBI-05204, GSK690693, A-443654, AKT inhibitor ARQ 092, AKT inhibitor AZD5363, AKT inhibitor GDC-0068, AKT inhibitor GSK2141795, AKT inhibitor LY2780301, AKT inhibitor MK2206, A-674563, CCT 128930, an anti-Akt antibody, an inhibitory Akt RNA molecule, AKT inhibitor SRI 3668, and any combination thereof.

By way of non-limiting example, the cancer treated may be resistant to treatment with an mTOR inhibitor selected from the group consisting of Rapamycin, PP242, Temsirolimus, Sirolimus, Everolimus, Ridaforolimus, AZD8055, an anti-mTOR antibody, an inhibitory mTOR RNA molecule, INK 128, and any combination thereof.

By way of non-limiting example, the cancer treated may be resistant to treatment with a dual PI3K/mTOR kinase inhibitor selected from the group consisting of PF- 04691502, PF-05212384, X-480, NVP-BEZ235, GDC-0980, VS-5584, PKI-179, PKI- 587, XL765 and any combination thereof.

The methods of these aspects may be used to prophylactically or therapeutically treat a cell. The cell may be a cancerous or non-cancerous cell including, but not limited to, a cancer stem cell. The cell may exist within a subject, or not within a subject. Accordingly, the methods of these aspects may be conducted in vitro, ex vivo, or in vivo. The subject may be any subject in need of prophylactic or therapeutic treatment for cancer. Non-limiting examples of suitable subjects may include, for example, bovine subjects, equine subjects, ovine subjects, primate subjects, avian subjects and rodent subjects. Hence, the subject may be a mammal such as, for example, a human or a non- human mammal. Compositions, Medicaments and Kits

Also provided are compositions that are suitable for use in the methods of the present invention.

In one aspect, a composition of the present invention comprises agent/s capable of inhibiting or blocking activation of Myc through the newly identified PDKl -PLKl -Myc cell signalling pathway. For example, the compositions may comprise an agent capable of inhibiting an interaction between PDKl and PLKl and thereby be capable of inhibiting or blocking phosphorylation/activation of PLKl via interaction/s with PDKl. The interaction may be a direct or indirect interaction. The direct interaction may be a binding interaction. Suitable agents for inhibiting or blocking an interaction between PDKl and PLKl this purpose are well known to the skilled person and are commercially available.

The agent/s may target, for example, PDKl. Any agent capable of blocking or inhibiting PDKl activity may be utilised including, but not limited to, OSU 03012, BX795, BAG 956, BX912, an anti-PDKl antibody, an inhibitory PDKl RNA molecule, or a combination thereof.

The agent/s may target, for example, PLKl. Any agent capable of blocking or inhibiting PLKl activity may be utilised including, but not limited to, BI2536, GW843682X, Cylapolin-1, DAP-81, ZK-thiazolidinone, Compound 36, LFM-A13, Poloxin, Poloxipan, Purpurogallin, ON 01910.Na, HMN-176, GSK461364, NMS-P937, BI6727, an anti-PLKi antibody, an inhibitory PLKl RNA molecule, or any combination thereof.

The agent/s may be capable of targeting both PDKl and PLKl .

The compositions according to this aspect may be used to perform a method according to the present invention (see section above entitled "Methods"). For example, the compositions of this aspect may be used in a method for the prophylactic and/or therapeutic treatment of cancer in a subject by inhibiting or blocking activation of Myc through the newly identified PDKl -PLKl -Myc cell signalling pathway in cancer cells of the subject. Although there is no particular limitation to the type of cancer treated with the compositions according to this aspect, in some embodiments the compositions may be used in methods of prophylactically or therapeutically treating cancer that is resistant to an agent which prevents or inhibits activation of mTOR via the PI3K-AKT cell signalling pathway, (e.g. PI3K inhibitors, mTOR inhibitors and dual PI3K-mTOR inhibitors). Additionally or alternatively, the compositions may be used in methods of prophylactically or therapeutically treating Myc-dependent cancer, non-limiting examples which include bladder cancer, breast cancer, colon cancer, gastric cancer, hepatocellular carcinoma, leukemia, lymphoma, melanoma, myeloma (including multiple myeloma), neuroblastoma, ovarian cancer, prostate cancer, rhabdomyosarcoma, small cell lung cancer, subungual melanoma, uveal melanoma and Burkitt's lymphoma.

In another aspect, a composition of the present invention may comprise a combination of inhibitory agents. A first agent of the combination may be capable of inhibiting or blocking activation of Myc via the PDKl-PLKl-Myc cell signalling pathway. A second agent of the combination may be capable of inhibiting or blocking activation of Myc through the newly identified PDKl-PLKl-Myc cell signalling pathway. No particular limitation exists in relation to the particular agents used in the combination treatment. For example, the combination of agents may comprise a PI3K inhibitor, Akt inhibitor, mTOR inhibitor, and/or a dual PBK/mTOR inhibitor in combination with a PLKl inhibitor. In some embodiments, the combination comprises a PI3K inhibitor combined with a PLKl inhibitor, an Akt inhibitor combined with a PLKl inhibitor, an mTOR inhibitor combined with a PLKl inhibitor, or a dual PBK/mTOR inhibitor combined with a PLKl inhibitor.

By way of non-limiting example, the PI3K inhibitor of the combination of inhibitory agents may be selected from the group consisting of GSK2636771, IPI-145 (INK1197), LY294002, GDC-0941, CAL-101 (GS-1101, Idelalisib), BEZ235 (NVP- BEZ235), BKM120 (NVP-BKM120, Buparlisib), NU7441 (KU-57788), Wortmannin, TGX-221, BYL719, an anti-PBK antibody, an inhibitory PI3K RNA molecule, PI- 1:03, and any combination thereof.

By way of non-limiting example, the Akt inhibitor of the combination of inhibitory agents may be selected from the group consisting of afuresertib (GSK2110183), perifosine (KRX-0401), RX-0201, Erucylphosphocholine (ErPC), PBI-05204, GSK690693, A-443654, AKT inhibitor ARQ 092, AKT inhibitor AZD5363, AKT inhibitor GDC-0068, AKT inhibitor GSK2141795, AKT inhibitor LY2780301, AKT inhibitor MK2206, A-674563, CCT 128930, an anti-Akt antibody, an inhibitory Akt RNA molecule, AKT inhibitor SRI 3668, and any combination thereof.

By way of non-limiting example, the mTOR inhibitor of the combination of inhibitory agents may be selected from the group consisting of Rapamycin, PP242, Temsirolimus, Sirolimus, Everolimus, Ridaforolimus, AZD8055, an anti-mTOR antibody, an inhibitory mTOR RNA molecule, INK 128, and any combination thereof.

By way of non-limiting example, the dual PBKmTOR inhibitor of the combination of inhibitory agents may be selected from the group consisting of PF-04691502, PF- 05212384, X-480, NVP-BEZ235, GDC-0980, VS-5584, PKI-179, PKI-587, XL765 and any combination thereof.

By way of non-limiting example, the PLKl inhibitor of the combination of inhibitory agents may be selected from the group consisting of BI2536, GW843682X, Cylapolin-1, DAP-81, ZK-thiazolidinone, Compound 36, LFM-A13, Poloxin, Poloxipan, Purpurogallin, ON 01910.Na (rigosertib, Estybon), HMN-176, GSK461364, NMS-P937, an anti-PLKl antibody, an inhibitory PLKl RNA molecule, BI6727, or any combination thereof.

In some embodiments, the combination of inhibitory agents may comprise BI2536 and PF-04691502, BI2536 and PF-05212384, BI2536 and X-480, BI2536 and NVP- BEZ235, BI2536 and GDC-0980, BI2536 and VS-5584, BI2536 and PKI-179, BI2536 and PKI-587, or BI2536 and XL765.

In some embodiments, the combination of inhibitory agents may comprise GW843682X and PF-04691502, GW843682X and PF-05212384, GW843682X and X- 480, GW843682X and NVP-BEZ235, GW843682X and GDC-0980, GW843682X and VS-5584, GW843682X and PKI-179, GW843682X and PKI-587, or GW843682X and XL765.

In some embodiments, the combination of inhibitory agents may comprise Cylapolin-1 and PF-04691502, Cylapolin-1 and PF-05212384, Cylapolin-1 and X-480, Cylapolin-1 and NVP-BEZ235, Cylapolin-1 and GDC-0980, Cylapolin-1 and VS-5584, Cylapolin-1 and PKI-179, Cylapolin-1 and PKI-587, or Cylapolin-1 and XL765.

In some embodiments, the combination of inhibitory agents may comprise D AP-81 and PF-04691502, DAP-81 and PF-05212384, DAP-81 and X-480, DAP-81 and NVP- BEZ235, DAP-81 and GDC-0980, DAP-81 and VS-5584, DAP-81 and PKI-179, DAP-81 and PKI-587, or DAP-81 and XL765. In some embodiments, the combination of inhibitory agents may comprise ZK- thiazolidinone and PF-04691502, ZK-thiazolidinone and PF-05212384, ZK- thiazolidinone and X-480, ZK-thiazolidinone and NVP-BEZ235, ZK-thiazolidinone and GDC-0980, ZK-thiazolidinone and VS-5584, ZK-thiazolidinone and PKI-179, ZK- thiazolidinone and PKI-587, or ZK-thiazolidinone and XL765.

In some embodiments, the combination of inhibitory agents may comprise Compound 36 and PF-04691502, Compound 36 and PF-05212384, Compound 36 and X- 480, Compound 36 and NVP-BEZ235, Compound 36 and GDC-0980, Compound 36 and VS-5584, Compound 36 and PKI-179, Compound 36 and PKI-587, or Compound 36 and XL765.

In some embodiments, the combination of inhibitory agents may comprise LFM- A13 and PF-04691502, LFM-A13 and PF-05212384, LFM-A13 and X-480, LFM-A13 and NVP-BEZ235, LFM-A13 and GDC-0980, LFM-A13 and VS-5584, LFM-A13 and PKI-179, LFM-A13 and PKI-587, or LFM-A13 and XL765.

In some embodiments, the combination of inhibitory agents may comprise Poloxin and PF-04691502, Poloxin and PF-05212384, Poloxin and X-480, Poloxin and NVP- BEZ235, Poloxin and GDC-0980, Poloxin and VS-5584, Poloxin and PKI-179, Poloxin and PKI-587, or Poloxin and XL765.

In some embodiments, the combination of inhibitory agents may comprise Poloxipan and PF-04691502, Poloxipan and PF-05212384, Poloxipan and X-480, Poloxipan and NVP-BEZ235, Poloxipan and GDC-0980, Poloxipan and VS-5584, Poloxipan and PKI- 179, Poloxipan and PKI-587, or Poloxipan and XL765.

In some embodiments, the combination of inhibitory agents may comprise Purpurogallin and PF-04691502, Purpurogallin and PF-05212384, Purpurogallin and X- 480, Purpurogallin and NVP-BEZ235, Purpurogallin and GDC-0980, Purpurogallin and VS-5584, Purpurogallin and PKI-179, Purpurogallin and PKI-587, or Purpurogallin and XL765.

In some embodiments, the combination of inhibitory agents may comprise ON 01910.Na (rigosertib, Estybon) and PF-04691502, ON 01910.Na (rigosertib, Estybon) and PF-05212384, ON 01910.Na (rigosertib, Estybon) and X-480, ON 01910.Na (rigosertib, Estybon) and NVP-BEZ235, ON 01910.Na (rigosertib, Estybon) and GDC- 0980, ON 01910.Na (rigosertib, Estybon) and VS-5584, ON 01910.Na (rigosertib, Estybon) and PKI-179, ON 01910.Na (rigosertib, Estybon) and PKI-587, or ON 01910.Na (rigosertib, Estybon) and XL765. In some embodiments, the combination of inhibitory agents may comprise HMN- 176 and PF-04691502, HMN-176 and PF-05212384, HMN-176 and X-480, HMN-176 and NVP-BEZ235, HMN-176 and GDC-0980, HMN-176 and VS-5584, HMN-176 and PKI-179, HMN-176 and PKI-587, or HMN-176 and XL765.

In some embodiments, the combination of inhibitory agents may comprise GSK461364 and PF-04691502, GSK461364 and PF-05212384, GSK461364 and X-480, GSK461364 and NVP-BEZ235, GSK461364 and GDC-0980, GSK461364 and VS-5584, GSK461364 and PKI-179, GSK461364 and PKI-587, or GSK461364 and XL765.

In some embodiments, the combination of inhibitory agents may comprise NMS- P937 and PF-04691502, NMS-P937 and PF-05212384, NMS-P937 and X-480, NMS- P937 and NVP-BEZ235, NMS-P937 and GDC-0980, NMS-P937 and VS-5584, NMS- P937 and PKI-179, NMS-P937 and PKI-587, or NMS-P937 and XL765.

In some embodiments, the combination of inhibitory agents may comprise BI6727 and PF-04691502, BI6727 and PF-05212384, BI6727 and X-480, BI6727 and NVP- BEZ235, BI6727 and GDC-0980, BI6727 and VS-5584, BI6727 and PKI-179, BI6727 and PKI-587, or BI6727 and XL765.

In some embodiments, the combination of inhibitory agents may comprise an anti- PLK1 antibody and PF-04691502, an anti-PLKl antibody and PF-05212384, an anti- PLK1 antibody and X-480, an anti-PLKl antibody and NVP-BEZ235, an anti-PLKl antibody and GDC-0980, an anti-PLKl antibody and VS-5584, an anti-PLKl antibody and PKI-179, an anti-PLKl antibody and PKI-587, or an anti-PLKl antibody and XL765.

In some embodiments, the combination of inhibitory agents may comprise an inhibitory PLK1 RNA molecule and PF-04691502, an inhibitory PLK1 RNA molecule and PF-05212384, an inhibitory PLK1 RNA molecule and X-480, an inhibitory PLKl RNA molecule and NVP-BEZ235, an inhibitory PLKl RNA molecule and GDC-0980, an inhibitory PLKl RNA molecule and VS-5584, an inhibitory PLKl RNA molecule and PKI-179, an inhibitory PLKl RNA molecule and PKI-587, or an inhibitory PLKl RNA molecule and XL765.

The compositions according to this aspect may be used to perform a method according to the present invention (see section above entitled "Methods"). For example, the compositions of this aspect may be used in a method for the prophylactic and/or therapeutic treatment of cancer in a subject by administering a combination of inhibitory agents. The inhibitory agents of the combination may act in a synergistic fashion for the prophylactic or therapeutic treatment of cancer in the subject. Although there is no particular limitation to the type of cancer treated with the compositions according to this aspect, in some embodiments the compositions may be used in methods of prophylactically or therapeutically treating cancer that is resistant to an agent which prevents or inhibits activation of mTOR via the PI3K-AKT cell signalling pathway, (e.g. PI3K inhibitors, mTOR inhibitors and dual PBK-mTOR inhibitors). Additionally or alternatively, the compositions may be used in methods of prophylactically or therapeutically treating Myc-dependent cancer, non-limiting examples which include bladder cancer, breast cancer, colon cancer, gastric cancer, hepatocellular carcinoma, leukemia, lymphoma, melanoma, myeloma (including multiple myeloma), neuroblastoma, ovarian cancer, prostate cancer, rhabdomyosarcoma, small cell lung cancer, subungual melanoma, uveal melanoma and Burkitt's lymphoma.

Compositions according to the present invention may comprise inhibitory nucleic acids (e.g. inhibitory RNA molecules and/or inhibitory DNA molecules). The inhibitory nucleic acids may be capable of suppressing expression of one or more components of the newly identified PDKl-PLKl-Myc cell signalling pathway (e.g. PD 1 and/or PLK1) and/or one or more components of the PI3K-AKT cell signalling pathway (e.g. PI3K, Akt, and/or mTOR). In general, the inhibitory nucleic acids are capable of specifically reducing or silencing expression of a gene or gene/s encoding the cell signaling pathway component/s. Non-limiting examples of such agents include antisense oligonucleotides (asODN), DNAzymes, ribozymes, DNA decoys, aptamers and RNA interference (RNAi) agents.

In some embodiments, an antisense oligodeoxynucleotide (asODN) may be used to inhibit or silence the expression of a given target gene. The asODN may be a single- stranded DNA, single-stranded RNA, or hybrid thereof that is complementary or substantially complementary to a messenger RNA (mRNA) strand transcribed from the target gene encoding the cell signalling pathway component/s. The asODN may inhibit translation of a complementary mRNA sequence by Watson-Crick base pair hybridisation and physically obstruct the transfer of genetic information from DNA to protein.

Additionally or alternatively, RNA interference (RNAi) may be used to inhibit or silence the expression of a given target gene. As known to those of skill in the art, RNAi relies upon double-stranded RNA fragments called small interfering RNAs (siRNA) or small, hairpin RNAs (shRNA) to trigger catalytically mediated gene silencing, most typically by targeting the RNA-induced silencing complex (RISC) to bind to and degrade the mRNA of a target gene. Accordingly, the present invention provides nucleic acids which are capable of inhibiting or silencing the expression of a given target gene or gene/s encoding the cell signalling pathway component/s via RNAi. These nucleic acids may be provided in the form of, for example, dsRNA, siRNA, shRNA, bi-functional shRNA. The nucleic acids may in some embodiments derive from a vector comprising a nucleic acid sequence operatively linked to a promoter (e.g. a tissue-specific promoter such as a plant root-specific promoter) and a transcription termination sequence, wherein the nucleic acid sequence encodes a dsRNA, siRNA, shRNA, bi-functional shRNA or micro-RNA.

The inhibitory nucleic acids may be provided in the form of stabilised dsRNA or siRNA molecules comprising two or more RNA sequences arranged in a sense and an antisense orientation relative to one or more promoter(s) (e.g. one or more tissue-specific promoter(s) such as plant root-specific promoter(s)), and linked by a spacer sequence. The spacer sequence may be between about one and about 1000 nucleotides in length.

The skilled addressee will recognise that inhibitory nucleic acids of the present invention may be chemically synthesised using conventional techniques known in the art and/or provided by recombinant nucleic acid constructs (e.g. expression vectors) as known to those of skill in the art

Compositions according to the present invention may comprise antibodies, blocking/binding polypeptides, mimetic agents, and/or protein antagonists capable of selectively inhibiting one or more components of the newly identified PDKl-PLKl-Myc cell signalling pathway (e.g. PD 1 and/or PLK1) and/or one or more components of the PI3K-AKT cell signalling pathway (e.g. PI3K, Akt, and/or mTOR). For example, the compositions may comprise an antibody capable of binding specifically to a given target component of the cell signalling pathway. By "binding specifically" to the cell signalling pathway component, it will be understood that the antibody is capable of binding to the cell signalling pathway component with a significantly higher affinity than it binds to an unrelated molecule (i.e. non-target molecules). Accordingly, an antibody that binds specifically to a target cell signalling pathway component is an antibody with the capacity to discriminate between the targeted component and any other number of potential alternative binding partners. Thus, when exposed to a plurality of different but equally accessible molecules as potential binding partners, an antibody capable of binding specifically to a targeted component will selectively bind to the targeted component and other alternative potential binding partners will remain substantially unbound by the antibody. In general, an antibody capable of binding specifically to a targeted component will preferentially bind to the targeted component at least 10-fold, preferably 50-fold, more preferably 100-fold, and most preferably greater than 100-fold more frequently than other potential binding partners that are not the targeted component. An antibody capable of binding specifically to a given target component of the cell signalling pathway may be capable of binding to other non-target molecules at a weak, yet detectable level. This is commonly known as background binding and is readily discernible from target molecule- specific binding, for example, by use of an appropriate control.

Methods for the generation of suitable antibodies are well known to those of ordinary skill in the art. For example, a monoclonal antibody that binds specifically to a given target component of the cell signalling pathway may be prepared using the hybridoma technology described in Harlow and Lane (eds), (1988), "Antibodies - A Laboratory Manual ", Cold Spring Harbor Laboratory, NY. In essence, in the preparation of monoclonal antibodies directed toward a target polypeptide/protein, any technique that provides for the production of antibodies by continuous cell lines in culture may be used. These include the hybridoma technique originally developed by Kohler et al, (1975), "Continuous cultures of fused cells secreting antibody of predefined specificity ", Nature, 256:495-497, as well as the trioma technique, the human B-cell hybridoma technique (see Kozbor et al., (1983), "The Production of Monoclonal Antibodies From Human Lymphocytes ", Immunology Today, 4:72-79), and the EBV-hybridoma technique to produce human monoclonal antibodies (see Cole et al., (1985), in "Monoclonal Antibodies and Cancer Therapy", 77-96, Alan R. Liss, Inc.). Immortal, antibody- producing cell lines can be created by techniques other than fusion, such as direct transformation of B lymphocytes with oncogenic DNA, or transfection with Epstein-Barr virus (see, for example, Schreier et al., (1980), "Hybridoma Techniques", Cold Spring Harbor Laboratory; Hammerling et al., (1981), "Monoclonal Antibodies and T-cell Hybridomas", Elsevier/North-Holland Biochemical Press, Amsterdam; and Kennett et al, (1980), "Monoclonal Antibodies^'", Plenum Press).

Compositions according to the present invention including those according to the two aspects set out above, may comprise the inhibitory agent/s alone or in combination with other additional components.

For example, the compositions may additionally comprise a pharmaceutically acceptable carrier, adjuvant, excipient and/or diluent. The carriers, diluents, excipients and adjuvants must be "acceptable" in terms of being compatible with the other ingredients of the composition or medicament, and are generally not deleterious to the recipient thereof. Non-limiting examples of pharmaceutically acceptable carriers or diluents are demineralised or distilled water; saline solution; vegetable based oils such as peanut oil, safflower oil, olive oil, cottonseed oil, maize oil; sesame oils such as peanut oil, safflower oil, olive oil, cottonseed oil, maize oil, sesame oil, arachis oil or coconut oil; silicone oils, including polysiloxanes, such as methyl polysiloxane, phenyl polysiloxane and methylphenyl polysolpoxane; volatile silicones; mineral oils such as liquid paraffin, soft paraffin or squalane; cellulose derivatives such as methyl cellulose, ethyl cellulose, carboxymethylcellulose, sodium carboxymethylcellulose or hydroxypropylmethylcellulose; lower alkanols, for example ethanol or isopropanol; lower aralkanols; lower polyalkylene glycols Or lower alkylene glycols, for example polyethylene glycol, polypropylene glycol, ethylene glycol, propylene glycol, 1,3- butylene glycol or glycerin; fatty acid esters such as isopropyl palmitate, isopropyl myristate or ethyl oleate; polyvinylpyrolidone; agar; gum tragacanth or gum acacia, and petroleum jelly. Typically, the carrier or carriers will form from about 10% to about 99.9% by weight of the composition or medicament.

Additionally or alternatively, the compositions may comprise an immunosuppressive agent, non-limiting examples of which include anti-inflammatory compounds, bronchodilatory compounds, cyclosporines, tacrolimus, sirolimus, mycophenolate mofetil, methotrexate, chromoglycalates, theophylline, leukotriene antagonist, and antihistamine, and combinations thereof. The immunosuppressive agent may also be an immunosuppressive drug or a specific antibody directed against B or T lymphocytes, or surface receptors that mediate their activation. For example, the immunosuppressive drug may be cyclosporine, tacrolimus, sirolimus, mycophenolate mofetil, methotrexate, chromoglycalates, theophylline, leukotriene antagonist, and antihistamine, or a combination thereof.

Additionally or alternatively, the compositions may comprise a steroid, such as a corticosteroid.

The composition may be in a form suitable for administration by injection (e.g. for parenteral administration including subcutaneous, intramuscular or intravenous injection), by oral administration (such as capsules, tablets, caplets, and elixirs, for example), by topical administration (e.g. in the form of an ointment, cream or lotion, or a form suitable for delivery as an eye drop), or by intranasal inhalation (e.g. in the form of aerosols).

For administration as an injectable solution or suspension, non-toxic parenterally acceptable diluents or carriers can include, Ringer's solution, isotonic saline, phosphate buffered saline, ethanol and 1 ,2 propylene glycol. Methods for preparing parenterally administrable compositions and medicaments are apparent to those of ordinary skill in the art, and are described in more detail in, for example, Remington's Pharmaceutical Science, 15th ed., Mack Publishing Company, Easton, Pa. For oral administration, some examples of suitable carriers, diluents, excipients and adjuvants include peanut oil, liquid paraffin, sodium carboxymethylcellulose, methyl cellulose, sodium alginate, gum acacia, gum tragacanth, dextrose, sucrose, sorbitol, mannitol, gelatine and lecithin. In addition these oral formulations may contain suitable flavouring and colourings agents. When used in capsule form the capsules may be coated with compounds such as glyceryl monostearate or glyceryl stearate which delay disintegration. Adjuvants typically include emollients, emulsifiers, thickening agents, preservatives, bactericides and buffering agents.

Solid forms for oral administration may contain binders acceptable in human and veterinary pharmaceutical practice, sweeteners, disintegrating agents, diluents, flavourings, coating agents, preservatives, lubricants and/or time delay agents. Suitable binders include gum acacia, gelatine, corn starch, gum tragacanth, sodium alginate, carboxymethylcellulose or polyethylene glycol. Suitable sweeteners include sucrose, lactose, glucose, aspartame or saccharine. Suitable disintegrating agents include corn starch, methylcellulose, polyvinylpyrrolidone, guar gum, xanthan gum, bentonite, alginic acid or agar. Suitable diluents include lactose, sorbitol, mannitol, dextrose, kaolin, cellulose, calcium carbonate, calcium silicate or dicalcium phosphate. Suitable flavouring agents include peppermint oil, oil of wintergreen, cherry, orange or raspberry flavouring. Suitable coating agents include polymers or copolymers of acrylic acid and/or methacrylic acid and/or their esters, waxes, fatty alcohols, zein, shellac or gluten. Suitable preservatives include sodium benzoate, vitamin E, alpha-tocopherol, ascorbic acid, methyl paraben, propyl paraben or sodium bisulphite. Suitable lubricants include magnesium stearate, stearic acid, sodium oleate, sodium chloride or talc. Suitable time delay agents include glyceryl monostearate or glyceryl distearate.

Liquid forms for oral administration may contain, in addition to the above agents, a liquid carrier. Suitable liquid carriers include water, oils such as olive oil, peanut oil, sesame oil, sunflower oil, safflower oil, arachis oil, coconut oil, liquid paraffin, ethylene glycol, propylene glycol, polyethylene glycol, ethanol, propanol, isopropanol, glycerol, fatty alcohols, triglycerides or mixtures thereof.

Suspensions for oral administration may further comprise dispersing agents and/or suspending agents. Suitable suspending agents include sodium carboxymethylcellulose, methylcellulose, hydroxypropylmethyl-cellulose, poly-vinyl-pyrrolidone, sodium alginate or acetyl alcohol. Suitable dispersing agents include lecithin, polyoxyethylene esters of fatty acids such as stearic acid, polyoxyethylene sorbitol mono-or di-oleate, -stearate or- laurate, polyoxyethylene sorbitan mono-or di-oleate, -stearate or-laurate and the like. Formulations for oral administration may comprise one or more emulsifying agents. Suitable emulsifying agents include dispersing agents as exemplified above or natural gums such as guar gum, gum acacia or gum tragacanth.

Topical formulations of the present invention may comprise an active ingredient together with one or more acceptable carriers, and optionally any other therapeutic ingredients. Formulations suitable for topical administration include liquid or semi-liquid preparations suitable for penetration through the skin to the site where treatment is required, such as liniments, lotions, creams, ointments or pastes, and drops suitable for administration to the eye, ear or nose.

Drop formulations may comprise sterile aqueous or oily solutions or suspensions. These may be prepared by dissolving the active ingredient in an aqueous solution of a bactericidal and/or fungicidal agent and/or any other suitable preservative, and optionally including a surface active agent. The resulting solution may then be clarified by filtration, transferred to a suitable container and sterilised. Sterilisation may be achieved by autoclaving or maintaining at 90°C-100°C for half an hour, or by filtration, followed by transfer to a container by. an aseptic technique. Examples of bactericidal and fungicidal agents suitable for inclusion in the drops are phenylmercuric nitrate or acetate (0.002%), benzalkonium chloride (0.01%) and chlorhexidine acetate (0.01%). Suitable solvents for the preparation of an oily solution include glycerol, diluted alcohol and propylene glycol.

Lotions formulations include those suitable for application to the skin or eye. An eye lotion may comprise a sterile aqueous solution optionally containing a bactericide and may be prepared by methods similar to those described above in relation to the preparation of drops. Lotions or liniments for application to the skin may also include an agent to hasten drying and to cool the skin, such as an alcohol or acetone, and/or a moisturiser such as glycerol, or oil such as castor oil or arachis oil.

Creams, ointments or pastes formulations are semi-solid formulations of the active ingredient for external application. They may be made by mixing the active ingredient in finely-divided or powdered form, alone or in solution or suspension in an aqueous or nonaqueous fluid, with a greasy or non-greasy basis. The basis may comprise hydrocarbons such as hard, soft or liquid paraffin, glycerol, beeswax, a metallic soap; a mucilage; an oil of natural origin such as almond, corn, arachis, castor or olive oil, wool fat or its derivatives, or a fatty acid such as stearic or oleic acid together with an alcohol such as propylene glycol or macrogols.

The compositions may incorporate any suitable surfactant such as an anionic, cationic or non-ionic surfactant such as sorbitan esters or polyoxyethylene derivatives thereof. Suspending agents such as natural gums, cellulose derivatives or inorganic materials such as silicaceous silicas, and other ingredients such as lanolin, may also be included.

The compositions may be administered in the form of a liposome. Suitable methods to form liposomes are known in the art, and in relation to this specific reference is made to Prescott, (Ed), (1976), "Methods in Cell Biology", Volume XIV, Academic Press, New York, N.Y. p.33 et seq.

Supplementary active ingredients such as adjuvants or biological response modifiers can also be incorporated into the compositions.

Although adjuvant(s) may be included in the compositions present invention they need not necessarily comprise an adjuvant. In such cases, reactogenicity problems arising from the use of adjuvants may be avoided. In gerieral, adjuvant activity in the context of the compositions includes, but is not limited to, an ability to enhance the immune response (quantitatively or qualitatively) induced by immunogenic components in the composition or medicament (e.g. an inhibitory agent). This may reduce the dose or level of the immunogenic components required to produce an immune response and/or reduce the number or the frequency of immunisations required to produce the desired immune response.

Any suitable adjuvant may be included in the compositions. For example, an aluminium-based adjuvant may be utilised. Suitable aluminium-based adjuvants include, but are not limited to, aluminium hydroxide, aluminium phosphate and combinations thereof. Other specific examples of aluminium-based adjuvants that may be utilised are described in European Patent No. 1216053 and US Patent No. 6,372,223. Other suitable adjuvants include Freund's Incomplete Adjuvant and Complete Adjuvant (Difco Laboratories, Detroit, Mich.); Merck Adjuvant 65 (Merck and Company, Inc., Rahway, N.J.); AS-2 (SmithKline Beecham, Philadelphia, Pa.); aluminium salts such as aluminium hydroxide gel (alum) or aluminium phosphate; salts of calcium, iron or zinc; an insoluble suspension of acylated tyrosine; acylated sugars; cationically or anionically derivatized polysaccharides; polyphosphazenes; biodegradable microspheres; monophosphoryl lipid A and quil A; oil in water emulsions including those described in European Patent No. 0399843, US Patent No. 7,029,678 and PCT Publication No. WO 2007/006939; and/or additional cytokines, such as GM-CSF or interleukin-2, -7, or -12, granulocyte- macrophage colony-stimulating factor (GM-CSF), monophosphoryl lipid A (MPL), cholera toxin (CT) or its constituent subunit, heat labile enterotoxin (LT) or its constituent subunit, toll-like receptor ligand adjuvants such as lipopolysaccharide (LPS) and derivatives thereof (e.g. monophosphoryl lipid A and 3-Deacylated monophosphoryl lipid A), muramyl dipeptide (MDP) and F protein of Respiratory Syncytial Virus (RSV).

The compositions may be prepared for use in the prophylactic and/or therapeutic methods of the present invention.

Also provided herein are methods for preparing the compositions of the present invention. In such cases, the compositions may be equivalently referred to as "medicaments". Accordingly, the present invention provides for the use of various inhibitory agent/s as described herein in the preparation of medicaments for the prophylactic and/or therapeutic treatment of cancer in a subject. The present invention also provides various inhibitory agent/s for use in prophylactically and/or therapeutically treating cancer in a subject.

The inhibitory agent/s may be capable of inhibiting or blocking activation of Myc, for example, by inhibiting component/s of the newly identified PDKl-PL l-Myc cell signalling pathway. The inhibitory agents may be capable of inhibiting or blocking activation of mTOR, for example, by inhibiting component/s of the PI3K-Akt cell signalling pathway. Combinations of inhibitory agents may act in a synergistic fashion for the prophylactic or therapeutic treatment of cancer in the subject.

Although there is no particular limitation to the type of cancer in some embodiments the compositions the cancer may be resistant to an agent which prevents or inhibits activation of mTOR via the PI3K-AKT cell signalling pathway (e.g. PI3 inhibitors, Akt inhibitors, mTOR inhibitors and dual PI3 -mTOR inhibitors). Additionally the cancer may be a Myc-dependent cancer, non-limiting examples which include bladder cancer, breast cancer, colon cancer, gastric cancer, hepatocellular carcinoma, leukemia, lymphoma, melanoma, myeloma (including multiple myeloma), neuroblastoma, ovarian cancer, prostate cancer, rhabdomyosarcoma, small cell lung cancer, subungual melanoma, uveal melanoma and Burkitt's lymphoma.

Agent(s) suitable for performing the methods of the present invention, including compositions and medicaments, may be provided as component(s) in kits.

Kits of the present invention may comprise components to assist in performing the methods of the present invention such as, for example, administration device(s), buffer(s), and/or diluent(s). The kits may include containers for housing the various components and instructions for using the kit components in the methods of the present invention.

In certain embodiments, the kits may be combined kits.

In other embodiments, the kits may be fragmented kits. Dosages and Routes of Administration

Agent/s and compositions suitable for performing the methods of the present invention, which as noted above will be understood to include compositions and medicaments of the present invention, can be administered to a recipient by standard routes, including, but not limited to, parenteral (e.g. intravenous, intraspinal, subcutaneous or intramuscular), oral, topical, or mucosal routes (e.g. intranasal). In some embodiments, they may be administered to a recipient in isolation or in combination with other additional therapeutic agent(s). In such embodiments the administration may be simultaneous or sequential.

In general, the agents and compositions can be administered in a manner compatible with the route of administration and physical characteristics of the recipient (including health status) and in such a way that the desired effect(s) are induced (i.e. therapeutically and/or prophylactically effective). For example, the appropriate dosage may depend on a variety of factors including, but not limited to, a subject's physical characteristics (e.g. age, weight, sex), whether the agent or composition is being used as single agent or adjuvant therapy, the progression (i.e. pathological state) of a disease or condition being treated, and other factors readily apparent to those of ordinary skill in the art.

Various general considerations when determining an appropriate dosage of the agents and compositions are described, for example, in Gennaro et al. (Eds), (1990), "Remington's Pharmaceutical Sciences", Mack Publishing Co., Easton, Pennsylvania, USA; and Gilman et al., (Eds), (1990), "Goodman And Gilman's: The Pharmacological Bases of Therapeutics^'", Pergamon Press.

One of ordinary skill in the art would be able, by routine experimentation, to determine an effective, non-toxic amount of the agents and compositions for the desired therapeutic outcome. In general, an agent or composition of the present invention may be administered to a patient in an amount of from about 50 micrograms to about 5 mg of active component(s) (e.g. inhibitory agent/s). Dosage in an amount of from about 50 micrograms to about 500 micrograms is especially preferred. Generally, an effective dosage is expected to be in the range of about O.OOOlmg to about lOOOmg of active component(s) per kg body weight per 24 hours; typically, about O.OOlmg to about 750mg per kg body weight per 24 hours; about O.Olmg to about 500mg per kg body weight per 24 hours; about O.lmg to about 500mg per kg body weight per 24 hours; about O.lmg to about 250mg per kg body weight per 24 hours; or about l .Omg to about 250mg per kg body weight per 24 hours. More typically, an effective dose range is expected to be in the range about l .Omg to about 200mg per kg body weight per 24 hours; about l.Omg to about lOOmg per kg body weight per 24 hours; about l.Omg to about 50mg per kg body weight per 24 hours; about l.Omg to about 25mg per kg body weight per 24 hours; about 5.0mg to about 50mg per kg body weight per 24 hours; about 5.0mg to about 20mg per kg body weight per 24 hours; or about 5.0mg to about 15mg per kg body weight per 24 hours.

Typically, in treatment applications, the treatment may be for the duration of the disease state or condition. Further, it will be apparent to one of ordinary skill in the art that the optimal quantity and spacing of individual dosages can be determined by the nature and extent of the disease state or condition being treated, the form, route and site of administration, and the nature of the particular subject being treated. Optimum dosages can be determined using conventional techniques.

In many instances (e.g. prophylactic applications), it may be desirable to have several or multiple administrations of an agent or composition which may, for example, be administered 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more times. The administrations may be from about one to about twelve week intervals, and in certain embodiments from about one to about four week intervals. Periodic re-administration is also contemplated.

It will also be apparent to one of ordinary skill in the art that the optimal course of administration can be ascertained using conventional course of treatment determination tests.

Where two or more entities (e.g. agents or compositions) are administered to a subject "in conjunction", they may be administered in a single composition at the same time, or in separate compositions at the same time, or in separate compositions separated in time.

Certain embodiments of the present invention involve administration of the agents or compositions in multiple separate doses. Accordingly, the methods for prophylactic and therapeutic treatment described herein encompass the administration of multiple separated doses to a subject, for example, over a defined period of time. Accordingly, in some embodiments the methods include administering a priming dose, which may be followed by a booster dose. In various embodiments, the agent or composition is administered at least once, twice, three times or more.

The agents and compositions may generally be administered in an effective amount to achieve an intended purpose. More specifically, they may be administered in a therapeutically effective amount which means an amount effective to prevent development of, or to alleviate the existing symptoms of, a target disease or condition. Determination of effective amounts is well within the capability of persons of ordinary skill in the art. For example, a therapeutically effective dose of the agents and compositions can be estimated initially from cell culture assays. For example, a dose can be formulated in animal models to achieve a circulating concentration range that includes the IC.sub.50 as determined in cell culture. Such information can be used to more accurately determine useful doses in humans and other mammalian subjects.

A therapeutically effective dose refers to that amount of the agent or composition to prevent development of symptoms, ameliorate symptoms and/or prolong the survival of the subject under treatment. Toxicity and therapeutic efficacy of the agents and compositions can be determined by standard pharmaceutical assays in cell cultures, and/or experimental animals (e.g. by determination of the LD.sub.50 (the dose lethal to 50% of the population) and the ED.sub.50 (the dose therapeutically effective in 50% of the population)). The dose ratio between toxic and therapeutic effects is the therapeutic index which can be expressed as the ratio between LD.sub.50 and ED. sub.50. Agents, compositions and medicaments which exhibit high therapeutic indices are preferred. The data obtained from such cell culture assays and/or animal studies may be used to formulate a range of dosage for use in humans or other mammals. The dosage of such compounds lies preferably within a range of circulating concentrations that include the ED. sub.50 with little or no toxicity. The dosage may vary within this range depending upon the dosage form employed and the administration route utilised. The exact formulation, route of administration and dosage can be selected without difficulty by an individual physician in view of the subject's condition (see, for example, Fingl et al, (1975), in "The Pharmacological Basis of Therapeutics^'", Ch. 1 p. l). Dosage amount and interval may be adjusted individually to provide plasma levels of the active agent sufficient to achieve and maintain the desired therapeutic effect/s and/or a minimal effective concentration (MEC). The MEC will vary for each agent but can be estimated without difficulty from in vitro data which may provide, for example, the concentration necessary to achieve about 50%, 70%, 8_.0%, 90% or about 95% inhibition of PDK1- PLKl-Myc cell signalling and/or PI3K-Akt-mTOR cell signalling using the methods described herein. Dosages necessary to achieve the MEC will depend on the route of administration and other individual characteristics. Bioassays and/or HPLC assays may be used to determine plasma concentrations.

Dosage intervals may also be determined using MEC value. In general, the agents, compositions and medicaments may be administered using a regimen which maintains plasma levels above the MEC for between about 10%-90% of the time, preferably between 30%-90% and more preferably between about 50%-90%. In embodiments where local administration or selective uptake is utilised, the effective local concentration of the drug may not be related to plasma concentration.

It will be appreciated by persons skilled in the art that numerous variations and/or modifications may be made to the invention as shown in the specific embodiments without departing from the spirit or scope" of the invention as broadly described. The present embodiments are, therefore, to be considered in all respects as illustrative and not restrictive. :

Examples

The invention will now be described with reference to specific Examples, which should not be construed as in any way limiting.

Example 1

(i) MATERIALS AND METHODS

Constructs and Reagents

Human full-length PDK1, Myc, PIK3CA-E545K and PLK1 were cloned into PMN- IRES-GFP retroviral vector and introduced into human epithelial cells and MEFs. All kinase inhibitors used in this study were obtained from Axon Medchem. Information for plasmid DNA vectors and stable cell line construction are provided in the Supplemental Materials and Methods (see part (ii) below).

Cell Cultures

Cell cultures and various cellular assays are described in Materials and Methods (see part (ii) below). All cancer cell lines were purchased from American Type Culture Collection (ATCC) (Manassas, VA).

Mouse Experiments

All of the experiments in xenografts are described in Supplemental Materials and Methods (see part (ii) below).

Immunoblotting, immunoprecipitation and in vitro kinase assays

Details are described in Supplemental Materials and Methods (see part (ii) below). Gene Expression, Data Analysis and Real-Time PCR Analysis

The microarray hybridization was performed using the Illumina Gene Expression Sentrix BeadChip HumanHT-12_V4 (Illumina) and the data was analyzed using the GeneSpring GX 11.0.2 (Agilent Technologies). Detailed information can be found in Supplemental Materials and Methods (see part (ii) below). Primers used in real-time PCR analysis are described in Table 1 below.

Table 1: Primers used for real time PCR analysis

Statistical Analysis

PDK1 regulated ESC-like and PRC gene signature definition was described in Experimental Procedures (see part (ii) below). Gene Set Enrichment Analysis (GSEA) (see Subramanian et al. Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles. Proc Natl Acad Sci U S A. 2005;102:15545-50) was conducted to assess the degree of correlation between PDK1- regulated gene signatures and cancer phenotypes on different human patient. Survival curves were calculated using the Kaplan-Meier survival analyses and the quantiles-rank test. Detailed statistical analysis is included in Supplemental Information. Data are presented as mean ± SEM, unless otherwise stated. A student's t test was used to compare two groups for statistical significance analysis. Accession Number

The microarray data are deposited into the Gene Expression Omnibus (GEO) with the accession number GSE30669.

(ii) SUPPLEMENTARY MA TERIALS AND METHODS

Cell Cultures and Reagents

The immortalized human embryo kidney epithelial cells (HEK-TERV) were kind gifts from Dr. W.C. Hahn at Dana-Farber Cancer Institute. The immortalized human mammary epithelial cells (HMEC) and the human prostate epithelial cells (RWPE-1) were purchased from the American Type Culture Collection (ATCC) (Manassas, VA) and were maintained in culture as recommended by ATCC. The human tumor cell lines were obtained from ATCC and maintained in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin (Invitrogen). The immortalized p53-/- mouse embryo fibroblasts (MEFs) were analyzed beginning at passage 4. The cells, were cultured in DMEM with 10% FBS. All kinase inhibitors used in this study were obtained from Axon Medchem.

Plasmid Construction, Retrovirus Production and Infection

Human c-Myc protein was expressed in pMN-IRES-GFP retroviral expression vector. HA-tagged human PDK1 was subcloned from pHACE-PDKl vector and expressed in pMN-IRES-GFP retroviral expression vector. The human PLK1 plasmids were subcloned to the pMN-IRES-GFP retroviral expression vector. The PD 1 kinase dead mutant (PDK1 KD) was subcloned from PINCO-PDKl vector. The pMN-PIK3CA (E545K) mutant vector was subcloned from the DNA plasmid coding PIK3CA-E545K obtained from Addgene (Addgene plasmid 12525). shRNA vector pMKO.l targeting human PTEN was from Addgene (Addgene plasmid 10669). shRNA vector PLKO.l targeting human PDK1 was infected into MDA-MB-231 as described in (Liu et al. Targeting the phosphoinositide 3 -kinase pathway in cancer. Nat Rev Drug Discov. 2009;8:627-44). The retroviral vectors were transfected into PlatA packaging cells using Lipofectamine 2000 (Invitrogen). At 48 hr posttransfection, viral supernatants were passed through a 0.45 μπι nitrocellulose filter and were used to infect human epithelial cells or MEFs with polybrene ^g/ml). Stable retroviral cell lines were selected by sorting with GFP for further analysis. After infection with shPTEN vector, HEK cells were selected with l^g/ml puromycin (Sigma) for 7 days and pooled for experiments. Gene Expression Profiling and Quantitative RT-PCR Analysis

Total RNA was extracted from cell lines using Trizol (Invitrogen) and purified with the RNeasy Mini Kit (Qiagen). Reverse transcription was performed using an RNA Amplification kit (Ambion). The microarray hybridization was performed using the Illumina Gene Expression Sentrix BeadChip HumanHT-12_V4 (Illumina). Microarray scanned images were imported to Illumina® GenomeStudio for data quality control and the raw data was analyzed with GeneSpring GX 11.0.2 (Agilent Technologies), the gene expression level data file was transformed to log2 values and quantile normalized. With the normalized gene expression levels, significant genes were selected using SAM by separately comparing each treatment (PDK1, Myc and E545K) with the control (Vector). Significant genes were selected based on a minimum 2 fold change and FDR < 0.1%. Unsupervised hierarchical clustering analysis for the 2040 probes was performed using Cluster and visualized using Tree View.

For qPCR, cDNA was generated by using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems) according to the manufacturer's protocol. qPCR was performed on an ABI PRISM 7500 Sequence Detection System (Applied Biosystems) with SyBR Green Master mix (Applied Biosystems). Three independent samples, each in triplicate, were analyzed for each qPCR condition. Samples were normalized to the levels of GAPDH mRNA. PCR primers are described in Table 1. TaqMan MicroRNA assays were used to quantify the levels of mature miRNAs. In brief, total RNA was reverse transcribed by using Taqman MicroRNA Reverse Transciption Kit (Applied Biosystems) and the product was subjected to TaqMan stemloop miRNA assay (Applied Biosysterms). RNU6B was used to normalize the data.

Gene Expression Data Analysis

PDKl-up and -down regulated genes were separately overlapped with public available ES-like gene sets and PRC gene sets. Fisher's exact test for count data was used to assess the significance of the overlap (p-value cutoff: 0.05). The up-regulated probes were found to be significantly overlapping with the public available ES-like gene sets: ES expl (Engelman, Targeting PI3K signalling in cancer: opportunities, challenges and limitations. Nat Rev Cancer. 2009;9:550-62), Myc targetl (Mora et al. PDK1, the master regulator of AGC kinase signal transduction. Semin Cell Dev Biol. 2004;15:161-70) and Human ESC-like Module (Maurer et al. 3-Phosphoinositide-dependent kinase 1 potentiates upstream lesions on the phosphatidylinositol 3 -kinase pathway in breast carcinoma. Cancer Res. 2009;69:6299-306). In total there are 97 overlapping genes, defined as PDK1 -driven ES-like genes. 182 out of 872 down-regulated probes were found to be significantly overlapped with the public available PRC gene sets: Suzl2 targets, Eed targets, and H3K27 bound (see Tan et al. B55beta-associated PP2A complex controls PDK1 -directed myc signaling and modulates rapamycin sensitivity in colorectal cancer. Cancer Cell. 2010;18:459-71), H3 4&K27 co-methylated (see Sarbassov et al. Phosphorylation and regulation of Akt/PKB by the rictor-mTOR complex. Science. 2005;307:1098-101), PrC_Human (see Peifer et al. Small-molecule inhibitors of PD 1. ChemMedChem. 2008;3 : 1810-38), defined as PDK1 -driven PRC genes.

For Gene Enrichment Analysis, Gene Set Enrichment Analysis (GSEA) (Ellwood- Yen et al. Attenuation Fails to Prevent Tumor Formation in PTEN-Deficient Transgenic Mouse Models. Cancer Res. 2011;71:3052-65) was conducted to assess the degree of correlation between our gene signatures and cancer phenotypes on different human patient cohort: colon cancer (GSE10972) (Gagliardi et al. 3-phosphoinositide-dependent kinase 1 controls breast tumor growth in a kinase-dependent but akt-independent manner. Neoplasia. 2012;14:719-31), lung cancer (GSE7670) (Vasudevan et al. AKT-independent signaling downstream of oncogenic PIK3CA mutations in human cancer. Cancer Cell. 2009;16:21-32) and breast cancer (GSE5460) (Sato et al. Involvement of 3- phosphoinositi de-dependent protein kinase- 1, in the MEK/MAPK signal transduction pathway. J Biol Chem. 2004;279:33759-67). For gene signature survival analysis, Kaplan-Meier survival analyses were performed using previously published cancer cohort data: breast cancer (GSE1456, GSE2990) (Zeng et al. Transformation of mammary epithelial cells by 3-phosphoinositide-dependent protein kinase- 1 (PDK1) is associated with the induction of protein kinase Calpha. Cancer Res. 2002;62:3538-43; Reya et al. Stem cells, cancer, and cancer stem cells. Nature. 2001;414:105-11 and lung cancer (GSE3141) (Bon-Porath et al. An embryonic stem cell-like gene expression signature in poorly differentiated aggressive human tumors. Nat Genet. 2008;40:499-507). Using the quantiles of the average expression levels of the PDK1 ES-like gene signature, tumor samples were stratified into four groups (namely 0%-25%, 25%-50%, 50%-75% and 75%- 100%). The p- values were calculated using Cox proportional hazards regression model.

Immunoblotting, Immunoprecipitation and Antibodies

Protein extracts were prepared with RIPA cell lysis buffer (150 mM NaCl, 50 mM Tris-HCl, 0.5% deoxychlorate sodium, 200 mM NaF, 200 mM PMSF, 1.0% NP40, 1 mM EDTA) with the protease inhibitor cocktail (Roche), Lysates were subjected to SDS- PAGE and transferred to PVDF membrane for immunoblotting analysis. For immunoprecipitation analysis, cells were lysed for 30 min on ice with IP lysis buffer containing 50 mM Tris-HCl, 150 mM NaCl, 1.0% NP40 and complete protein inhibitor cocktail on ice. Cell lysates were precleared with protein A-agarose or protein G-agarose beads (Roche) for 3 h and immunoprecipitated with indicated antibodies overnight at 4 °C. Immunoprecipitates were washed three times with IP buffer, boiled in SDS sample buffer and analysed by immunoblotting. The following antibodies were used: PI 10a, PTEN, AKT, p-A T(S473), p-AKT(T308), p-RSK2(S227), p-p70S6K(T389), p-SGK3(T320), PKC6, p-PKC5(T505), Aurora A, p-PLKl(T210), p-AuroraA(T228), p-FOX01(S256), FOXOl, p-FOX03A, FOX03A, p-ERKl/2(T202/Y204), LIN28B, EPCAM, SOX2, FOXA2, 4E-BP1, p-4E-BPl(T70), p-4E-BPl(T37/46) and cleavage PARP (Cell Signaling Technology). S100A4, Myc (9E10), JAG2, p-Myc(T58) and P-Actin(Santa Cruz Biotech), p-S6K(T229)(R&D systems), p-Myc(S62) (Bioacademia), Myb, Histone H3 and p-Histone H3(S10)(Upstate), SALL4, p-PDKl(S241), PLK1 and p- PLKl(T210)(Abcam), p-PLKl(T210)(Epitomics), Myc (Roche), PDK1 and CD24 (BD Pharmingen).

- Immunoprecipitation and In Vitro Kinase Assays

Recombinant human PLK1 and PDK1 were purchased from Millipore. To generate the construct for bacterial expression of wild-type Myc tagged with maltose-binding protein (MBP), DNA fragments encoding full-length Myc were subcloned into pDEST- HisMBP vector. Myc protein expression was induced in E. coli BL21 and purified by one-step affinity purification specific for MBP through amylose resin (NEB). For in vitro kinase assays, the reactions were performed in 1.x kinase buffer supplemented with 200 μΜ ATP (50 mM Tris pH 7.4, 10 mM MgC12, and 1 mM DTT (Cell Signaling Technology)) for 30 minutes at 30 °C, with shaking. Kinase reaction products were resolved by SDS-PAGE and probed with the indicated antibodies.

For the in vitro kinase assay involving PDK1, the immunoprecipitated PLK1 or 100 ng recombinant PLK1 (Millipore, #14-777) was mixed with 200 ng of recombinant PDK1 (Millipore, #14-452) in l x kinase buffer supplemented with 200 μΜ ATP. The samples were incubated for 30 min at 30°C and analyzed by immunoblotting to probe the levels of p-PLKl T210 using p-PLKl antibody (Abeam, #12157) and the total PLK1 using PLK antibody (Abeam, #17056).

For PLK1 immunoprecipitation-kinase assay, cells were extracted with ice-cold IP lysis buffer (50 mM Tris-HCl pH7.5, 150 mM NaCl, 1% Nonidet P-40 (NP-40), 25 mM NaF, 0.1 mM sodium orthopervanadate, 1 mM phenylmethylsulfonyl fluoride (PMSF) and complete protease inhibitor (Roche)). 3.0 μg of PLKl antibody or normal mouse IgG coupled with 25 μΐ of protein G-agarose (Roche) were added to the cellular lysates for immunoprecipitation. The immune complexes were washed with IP lysis buffer, followed by washing with I xkinase buffer. For the kinase reaction, immunoprecipitations were incubated for 30 min at 30 °C in a final volume of 20 μΐ kinase buffer supplemented with 200 μΜ ATP and 500 ng recombinant MBP-Myc as substrate. The reactions were terminated with 10 μΐ 3 <SDS sample buffer and analyzed by immunoblotting using p- Myc (S62) (Bioacademia), p-Myc (T58) (Santa Cruz Biotech) and Myc (Roche).

RNA Interference

Table 2: List of siRNA sequence for the functional study

Accession No Gene name Sequence SEQ ID NO:

NM 002467 Myc GGTCAGAGTCTGGATCACC 33

NM_002613 PDKl-1 GCAGCAACATAGAGCAGTACA 34

NM 002613 PDK1-2 CAAAGTTCTGAAAGGTGAAAT 35

NM_005030 PLKl-1 GATCACCCTCCTTAAATAT 36

NM 005030 PLKl -2 AGATTGTGCCTAAGTCTCT , 37

NM 005030 PLKl -3 CCTTGATGAAGAAGATCAC 38

Cells were transfected with 100 nM final concentration of siRNA duplexes Lipofectamine RNAiMAX (Invitrogen) following the manufacturer's instructions.

Alkaline Phosphatase Staining, Confocol and Immunohistochemistry

MEF stable cells were cultured in mES medium containing DMEM with 15% FBS, 100 μΜ β-Met, 100 μΜ non-essential amino acids, and 1000 U/ml of LIF. Cells were fixed with 100% methanol and stained with Alkaline Phosphatase (AP) staining buffer (Fast Red Violet solution: Naphthol AS-BI phosphate solution: H₂0=2:l:l) by using the Alkaline Phosphatase Detection Kit (Millipore) according to the protocol.

The monolayer cultured cells or tumorsphere cells were seeded on the glass coverslips coated with gelatin in 12 well plates. After culturing for 24 hrs, cells were fixed with 3.7% paraformaldehyde in PBS and permeabilized with 0.2%o Triton-XlOO. Cells were sequentially incubated with primary antibodies (anti-Sox2 or anti-Oct4 from Abeam) and Alexa Fluor 633 -conjugated secondary antibodies (Invitrogen) for 1 hour each and D API for nuclear staining for 15 mins. They were then mounted in Fluorsave (CalBiochem) mounting medium. The stained cells were examined by Zeiss LSM510 confocal microscopy.

Archived patient samples from the Department of Pathology, Yong Loo Lin School of Medicine, National University of Singapore, Singapore were used in this study. Tissue microarrays of 2mm core size were prepared from colorectal cancers and morphologically normal tissues from the surgical margin of clearance. 4 μπι thick paraffinized sections were stained for PLK-1 expression. PLK-1 was achieved by heat treatment in TRIS-EDTA pH9 for 30 min. After treatment with 3 % hydrogen peroxide, the sections were incubated at room temperature with an antibody targeting PLK-1 (Abeam, 1:50 dilution) for 2 hr. Detection using Dako REAL HRP detection kit and colour development by DAB+ substrate solution were in accordance with the manufacturer's instructions (Dako Cytomation). The TMA sections were counterstained with Gill's Hematoxylin, dehydrated, cleared and mounted in Canada Balsam mounting medium. The stained TMA sections were scored for intensity of staining in the whole slides. The stained TMA sections were scored for intensity of staining in the cytoplasmic and nuclear compartments. The score criteria are as follows: for staining intensity (Ql), 0 = no staining, 1 = weak staining, 2 = moderate staining, 3 = strong staining; for cell numbers (Qn), 0 = no cells stained, 1 = 5 - 25% cells stained, 2 = up to 60% cells stained, 3 = >60% cells stained. The Expression Index (EI) is defined as Ql * Qn. For each compartment, the highest possible EI is 9. The maximum combined EI for each sample is 18.

Flow Cytometric Analysis

Cell cycle and cell death analysis were done by DNA content quantification. The cells were fixed with 70% ethanol and stained with propidium iodide (50 μg/ml) staining. The stained cells were analyzed by FACScalibur (BD Bioscience) and quantified by using CellQuest software (BD Bioscience). To measure caspase-3 activity, cells were harvested and fixed with Cytofix/Cytoperm solution (BD Biosciences) after drug treatment for 48 hr and then stained with fluorescein isothiocyanate (FITC)-conjugated rabbit anti-active caspase-3 monoclonal antibody (BD Biosciences). Quantification of cells positive for the caspase-3 was performed by flow cytometry. To detect the level of phosphor-Histone H3 (ser28) in synchronously released cells, cells were fixed with 70% ethanol and stained with Alexa Fluor® 647 conjugated p-H3(S28) and propidium iodide (PI). The labeled cells were analyzed using FACScalibur. To measure CD44+/CD24- low populations, cells were stained with fluorescent-conjugated antibodies and analyzed by FACS after treatment. In brief, cells were harvested and blocked with Fc-receptor blocking reagent (Miltenyi Biotec) and then stained with fluorescent-conjugated antibodies against human CD44 (FITC-conjugated, clone BJ18) and CD24 (APC-conjugated, clone ML5) (BioLegend) or their respective isotype control IgGs. The labeled cells were analyzed using FACScalibur.

Cell Viability, Soft Agar and Tumorsphere Assay

Cells were seeded in 96-well plates at a density of 1000 cells in triplicates. After 24 hr, cells were treated with different concentrations of the indicated kinase inhibitors and cultured at 37°C for 4 days, and then the number of viable cells was measured by CellTiter-Glo Luminescent Cell Viability Assay (Promega). For soft agar assay, experiments were carried out in 6 well plates coated with a base layer of DMEM containing 0.6% agar, cells were seeded at a density of 10,000 cells per well in DMEM containing 0.3 % agar, 10 % fetal bovine serum for 14 days. Colonies were stained with iodonitrotetrazolium chloride (Sigma) overnight. The number and size of colonies were analyzed using GelCount according to the manufacturer's instructions.

For tumorsphere formation assays. Single-cell suspensions were plated (5000 cells/well) in 6 well ultra-low attachment plates (Corning) in Mammocult medium (Stem cell Technologies), supplemented with fresh hydrocortisone (0^g/ml) and heparin (1 :500). Tumorsphere were cultured for 7 days prior to being counted and photographed. For serial passages of tumorsphere formation assay, the spheres were collected by gentle centrifugation, dissociated to single cells for passaging tumorspheres every 7 days and counted.

- In Vivo Studies

The female athymice BALB/c nude mice (5-8 week-old) were housed in the Biological Resource Centre. Mice were implanted subcutaneously in flank with l lO⁵ HEK-PDK1 cells or 3xl0⁶ HEK-E545K cells. When tumors reached ~ 200mm³, the mice were divided two groups (4 mice per group) and the BI2536 was administered IV at 35 mg/kg twice per week. Tumor progress was monitored with whole body weight and tumor size for every other day.

For tumorigenecity studies, aliquots of 10⁴, 10³ and 10² HEK-PDK1, HEK-Myc or 3x10⁶ HEK-E545K cells were injected subcutaneously in the flanks of BALB/c nude mice. The tumor volume was monitored every 2-3 days following injection. Serial transplantation experiments were performed with 100 or 500 cells from xenograft tumors formed from HEK-PDKl cells. In brief, subcutaneous tumors were excised, minced, and digested into a single cell suspension, prior to subcutaneous injection into nude mice. Tumor growth was followed for 4 weeks.

For colorectal SW480 and HT15 xenografts, cells were injected subcutaneously into the nude mice. When tumors reached ~ 200mm , BI2536 was given via i.v. at 50 mg/kg for 2 consecutive days followed by 35 mg/kg of BEZ235 for 5 days or 4 mg/kg of Rapamycin twice per week for 2 weeks. Tumor diameters were measured every other day with caliper and tumor volumes were calculated. All animal studies were conducted in compliance with animal protocols approved by the A-STAR-Biopolis Institutional Animal Care and Use Committee (IACUC) of Singapore.

Statistical Analysis

Data are presented as mean ± SEM, unless otherwise stated. A student's t test was used to compare two groups for statistical significance analysis.

(Hi) RESULTS

PDKl-Induced Myc Protein Induction Confers Oncogenic Transformation

As the first step to investigate the differential signaling pathways activated by PDK1 or PI3K in tumorigenesis, the transforming capacity of PDK1 and PI3K was compared by using the in vitro transformation assay that measures the anchorage- independent growth in soft agar. This was achieved with semi-transformed human embryonic kidney epithelial cells (HEK) that express a low level of activated HRasV12 (HEK-TERV) which were infected with retroviral vectors expressing PDK1, Myc, a constitutively activating mutant of PIK3CA (E545K) or PTEN small hairpin RNA (shRNA), resulting in stable cell lines designated as HEK-PDKl, HEK-Myc, HEK- E545K or HEK-shPTEN cells, respectively. The transformation assay results showed that they were all able to induce cellular transformation, although PDK1 - or Myc-induced colonies appeared to be larger in size as compared with that of E545K- or shPTEN- expressing cells (Figure 1A and Figure 8A). A marked protein accumulation of Myc in HEK-PDKl cells was detected but not in HEK-E545K or HEK-shPTEN cells (Figure IB) which was not due to the induction of Myc mRNA level (Figure 8B). The results also show that the kinase activity of PDK1 is required for transformation as well as Myc protein induction as a kinase-dead mutant of PDK1 (PDK1 K100N) (Gagliardi et al. (2012), ibid) induced neither the transformation nor the Myc accumulation (Figure 8C). A survey of known AGC substrates of PDKl revealed that PDKl also induced a strong phosphorylation of PKC5 and a modest increase of phosphorylated AKT (T308). The other known PDKl substrates, including SGKl/3 and S6K, were not activated, nor AKT phosphorylated at S473, which is required for a full activation of AKT. In contrast, E545K overexpression induced strong phosphorylations of AKT (at both T308 and S473) as well as the downstream substrates FOXOl and FOX03A (Figure IB). Thus, the remarkable observation that PDKl induces transformation in the presence of a weak AKT activation suggests a potential more functional role of Myc in this process. Indeed, RNA interference-mediated knockdown of Myc resulted in much reduced transformation of HEK-PDK1 cells, but not in HEK-E545K cells (Figure 1C), demonstrating a Myc- dependency for PDKl -induced transformation. Moreover, in a series of dose-response analysis (see Figure 8D&E), HEK-PDK1 cells, compared with HEK-E545K cells, were much more sensitive to small molecule PDKl inhibitors BX795 and BX912 (Figure ID, Left and Figure 8D). In contrast, E545K-transformed cells were much more sensitive to the PI3K inhibitor GDC-0941 and the AKT inhibitor MK2206 and GSK690693 (Figure ID, Left and Figure 8E). Consistent with these effects, BX795 reduced Myc accumulation but had only a modest effect on AKT. By contrast, GDC-0941 or MK2206 easily abolished phosphorylations of AKT in HEK-E545K cells, but had no such effects on Myc inhibition (Figure ID, Right). These results demonstrated the differential pathway dependency for the two transformed cell systems. Interestingly, Myc- transformed cells were also sensitive to BX795 (Figure ID, Left), which is consistent with the observation that BX795 was able to eliminate the exogenous Myc in these cells (Figure ID, Right). Altogether, these data show that PDKl -induced transformation depends more on Myc, but less on AKT signaling, when compared with E545K-driven transformation. The data also suggest that Myc-dependent cells become sensitive to the PDKl inhibitor, regardless of PDKl status, which reveals a PDKl -dependency in Myc- driven cells. PDKl -induced Myc activation upon transformation was also observed in immortalized human mammary epithelial cells (HMEC) and prostate epithelial cells (RWPE-1) (Figure IE and F), suggesting that the Myc activation by PDKl is not restricted to HEK but occurs in multiple epithelial lineages.

To demonstrate the physiological relevance of PDKl -Myc connection in human cancers, it was demonstrated that PDKl knockdown was able to eliminate Myc expression in a variety of human cancer cell lines (Figure 1G). Moreover, in a panel of breast cancer cell lines in which the Myc-dependent viability has been previously characterized (see Kessler et al. A SUMOylation-dependent transcriptional subprogram is required for Myc-driven tuniorigenesis. Science. 2011 ;335:348-53), BX795 treatment resulted in similar Myc depletion in all these cells (Figure 1H) but preferentially reduced the cell viability of Myc-dependent breast cancer cell lines (MDA-MB-231, Hs578T, and SUM159PT) as compared to Myc-independent breast cancer cell lines (T47D and BT474)(Figure II). Of notice, in these cell lines BX795 seemed to inhibit AKT and FOX03A phosphorylations in a cell-dependent manner (Figure 1H). Taken together, these results show a potential role of PDK1 activity towards Myc regulation which is therapeutically implicated for Myc-driven tumors.

Synthetic Lethal Screening Identifies PLKl as a Crucial Downstream Effector of PDK1 for Myc Induction and Cancer Cell Survival

To investigate whether or not there are downstream kinase(s) of PDK1 that is crucial for Myc induction and cell transformation, a screen for kinases was performed that, when pharmacologically inhibited, selectively kill PDK1 -transformed cells. Among 60 small molecule protein kinase inhibitors we have screened, it was found that two PLK1 inhibitors (B12536 and GW843682X), one MEK inhibitor (PD0325901), and one ALK inhibitor (NVP-TAE684), PD180970, one Brc-Abl inhibitor (PD 180970) and one tyrosine kinase inhibitor (Sunitinib) showed a preferential inhibitory effect on the viability of HEK-PDKl cell as compared to the control cells (Figure 9A). The two PLK1 inhibitors were further validated in a secondary screen and were thus chosen for further study (data not shown). Further analyses in all the three epithelial systems showed that PDK1 -transformed cells were much more sensitive to the PLK1 inhibitors compared to vector control or E545K-transformed cells (Figure 2A and B). This finding reveals a possible role of PLK1 in PDK1 -induced transformation. Indeed, western blot analysis showed an induction of PLKl phosphorylation in all the three PDK1 -transformed cell lines, but not in E545K- or Myc-transformed cells (Figure 2C). Similar to PDK1 inhibitor BX795, BI2536 treatment resulted in strong colony growth inhibition in both PDKl -and Myc-transformed cells, but not in E545K-transformed cells (Figure 2D and Figure 9B). Furthermore, like BX795, PLKl inhibitor BI2536 or GW843682X was able to eliminate endogenous Myc in HEK-PDKl cells but also the exogenous Myc in HEK- Myc cells (Figure 2E). This finding suggests that the exogenous Myc is also sensitive to the perturbation of the basal level of PDKl-PLKl signaling. Accordingly, in both HEK- PDKl and HEK-Myc cells, but not in HEK-E545K cells, BI2536 treatment resulted in strong apoptosis, as demonstrated by both FACS analysis (Figure 2F) and increased caspase 3 activity (Figure 9C), while E545K-transformed cells mainly displayed G2/M arrest, a typical feature related to a mitotic effect following PLKl inhibition (Figure 9D). Furthermore, to confirm the PLKl -specific effect of BI2536, PLKl depletion by three independent siRNAs gave rise to similar effects on endogenous and exogenous Myc and apoptosis in PDK1 or Myc-driven cells (Figure 2G). These findings suggest a crucial role for PDK1-PLK1 signaling in regulating Myc and cancer cell survival. Consistent with the in vitro data, xenograft tumors derived from HEK-PDK1 cells were highly sensitive to BI2536 treatment and displayed a strong tumor regression following just two dosages, while the same treatment only induced tumor growth inhibition in E545K-derived xenograft tumors (Figure 2H). "

These results further show that the PLKl regulation of Myc is not limited to transformed cells but physiologically relevant in human cancers as either PLKl knockdown or BI2536 treatment resulted in endogenous Myc protein depletion in various cancer cell lines without changing Myc mRNA level (Figure lOA-C). In addition, a time course analysis indicates that BI2536 treatment can result in Myc depletion as early as 8 hrs, concomitant with an early G2/M arrest (Figure lOD), indicating that Myc downregulation is unlikely to be a result of the secondary effect of cell cycle change. BI2536 treatment also resulted in more effective growth inhibition in Myc-dependent breast cancer cell lines compared to Myc-independent cells (except MDA-MB-231) (Figure 21). These results further support a role of PDKl -PLKl signaling in supporting Myc-driven tumorigenesis.

PDK1 Induces PLKl Phosphorylation in Human Cancer Cells

It was next investigated whether or not the PLKl activation by PDK1 seen in transformed cells represents a finding that is physiologically relevant in human cancer cells. To achieve this, experiments were performed using the colon cancer HCT116 and DLD1 cells in which PDK1 is genetically knocked out (Ericson et al. Genetic inactivation of AKT1, AKT2, and PDPK1 in human colorectal cancer cells clarifies their roles in tumor growth regulation. Proc Natl Acad Sci USA. 2010;107:2598-603). To facilitate the detection of phosphorylation of PLKl, which is a mitotic kinase, cells were first synchronized by double-thymidine block and then released into the cell cycle progressively (Figure 3 A and Figure 11 A). In PDK1 wild-type cells, progressive induction of PDK1 phosphorylation was noted upon cell cycle progression into mitosis as indicated by elevated levels of phosphor-histone H3, which was accompanied by a similar pattern of PLKl phosphorylation, whereas in PDK1-/- counterparts a much more deficient PLK1 phosphorylation and Myc accumulation was detected but not the phosphorylation of the PLK1 -related kinase Aurora A (Figure 3 A and Figure 11 A).

Changes of AKT-mTOR pathway in these cellular contexts were also assessed. Of notice, compared with p-PLKl, p-AKT (T308) was only modestly changed in this condition in PDKl-/- cells, while p-AKT( S473) and p-FOX03A were even enhanced in both PDKl-/- cell lines (Figure 3A). This could be due to the inhibition of S6K in PDK1- - cells, leading to a feedback activation of p-AKT (S473). In contrast, in a different condition where cells were serum starved and then stimulated with growth factors for early time points, a clear p-AKT-(T308) inhibition in HCT116 PDK-/- cells was observed (Figure 11B). Thus, PDKl regulates p-PLKl and p-AKT (T308) in different growth conditions. To further consolidate the data, PDKl knockdown was performed by shRNA in MDA-MB-231 cells. The result shows again that the PDKl knockdown resulted in ablation of PLK1 phosphorylation and Myc accumulation (Figure 3B), as well as deficient entry into mitosis (Figure 3C). These data consolidated a role of PDKl in driving PLK1 and Myc activation not just in a confined system but also in cancer cells.

Furthermore, in multiple cancer cell lines treated with BX795, GDC0941 or MK2206 upon double-thymidine block and release (Figure 11C), it was observed that BX795 always blocked PLK1 phosphorylation and Myc accumulation, but inhibited AKT phosphorylation in a cell line dependent manner (for example, AKT phosphorylation is not affected by BX795 in MDA-MB-231 cells). By contrast, GDC0941 and MK2206 consistently inhibited AKT phosphorylation in each of these cell lines, but had little effect on PLK1 and Myc. Together, these data demonstrate the physiological relevance of AKT- independent PDKl -PLK1 -Myc signaling in cancer cells.

It was next investigated whether or not PLK1 is a potential substrate of PDKl . PDKl regulates AGC kinases. Protein domain analysis indicates that the kinase domain of PLK1 is part of the AGC kinase family (Figure 3D). Interestingly, the amino acid sequence surrounding the Thr210 contains a consensus motif for PDKl which is found in many known PDKl substrates (Figure 3D), thus enhancing the possibility that PLK1 could be a potential substrate of PDKl . Indeed, co-transfection of PDKl and PLK1 into 293T cells, followed by PLK1 immunoprecipitation, showed that PDKl enhanced the phosphorylation of both the endogenous and exogenous PLK1, which was abolished when cells were treated with BX795, BX912, but not Aurora A inhibitor VX680 (Figure 3E). This suggests that PDKl -induced PLK1 phosphorylation was unlikely to be an indirect effect of Aurora A, which might be co-immunoprecipitated with PLK1. Furthermore, in an in vitro kinase assay using endogenous PLK1 immunoprecipitated from DLDl as a substrate, recombinant PDKl added in the kinase assay induced the PLKl phosphorylation at T210, which was markedly reduced in cells treated with BX795 (Figure 3F), indicating that the recombinant PDKl can directly induce endogenous PLKl phosphorylation in vitro. Importantly, in cells treated with VX680, where the PLKl phosphorylation was greatly reduced as expected, recombinant PDKl still boosted the PLKl phosphorylation in the in vitro kinase assay (Figure 3F). This further excludes the possibility that PDKl may induce PLKl phosphorylation indirectly through Aurora A kinase. Finally, in an in vitro kinase assays using both PDKl and PLKl as recombinant proteins, it was shown that PDKl induced a strong PLKl phosphorylation, which was blocked by BX795, BX912, but not by VX680 (Figure 3G). Collectively, these experiments provided evidence that PDKl directly regulates PLKl in human cancer cells.

PLKl Directly Interacts with Myc and Induces Myc Phosphorylation in a PDK1- Dependent Manner

Next it was investigated whether PLKl directly regulates Myc. Through co- immunoprecipitation (co-IP) assay, an interaction between both exogenous PLKl and Myc in 293T cells was demonstrated (Figure 4 A). It was also shown that the endogenous interaction between the two proteins occurs in HEK-PDK1 cells as well as in various cancer cell lines (Figure 4B and C). It was further showed that PLKl kinase activity is required for the Myc protein accumulation as the wild type PLKl, but not the kinase dead mutant, induced strong Myc accumulation (Figure 4D). Crucially, in vitro kinase assays using either recombinant PLKl (Figure 4E) or endogenous PLKl pulled down from the cancer cells (Figure 4F) demonstrated a robust induction of S62 phosphorylation of recombinant Myc but not T58 phosphorylation, which was reduced in the presence of BI2536. Importantly, the endogenous PLKl kinase activity towards Myc phosphorylation was strongly abolished in cells treated with BX795 (Figure 4G) or in PDKl-/- cells (Figure 4H). Thus, these results not only showed a direct phosphorylation of Myc by PLKl, but also showed that PLKl activity on Myc is crucially dependent on PDKl . Together, these data reiterate the operation of PDKl -PLKl -Myc signaling in cancer cells.

PDKl-PLKl-Myc Signaling Drives Cancer Initiating Cell Maintenance and Self- Renewal

During culturing of these transformed cells, it was noticed that HEK-PDK1 cells, and to a lesser extent, HEK-Myc cells, displayed distinct morphologies from HEK-E545K cells and once they became confluent in culture, started to form semi-attached 3D clusters on the plate (Figure 5A, Upper), suggesting that they displayed tumorigenic and stem cell-like properties. This feature, however, was not observed in E545K-transformed cells (Figure 5A). Given the role of Myc in inducing ESC- or CSC-like phenotypes in differentiated somatic cells, it raises a possibility that PDKl, which activates Myc, may have a similar capacity in inducing CSC-like behavior. This hypothesis was first tested by using an in vitro assay for spheroids formation in serum-free suspension culture, a property associated with cancer stem/progenitor cells (see Ponti et al. Isolation and in vitro propagation of tumorigenic breast cancer cells with stem/progenitor cell properties. Cancer Res. 2005;65:5506-11). It was observed that PDKl-or Myc transformed HEK or HMEC cells formed large and abundant non-adherent tumorspheres after 7 days of growth in suspension culture, whereas E545K-transformed cells were only able to generate low number of small spheres (Figure 5A, Bottom and Figure 12A). These spheres were able to reform a monolayer when placed back to a tissue culture plate containing serum-rich medium (Figure 5B). Furthermore, after dispersion into single cells, PDKl or Myc-transformed HEK or HMEC cells reformed spheres with increasing enrichments for at least 4 passages (Figure 5C and Figure 12B), indicating a gain of self- renewal capacity that resembles a stem cell-like property.

To demonstrate the tumor-initiating capacity of these transformed cells in vivo, cells were injected at different numbers into the flank of BALB/c nude mice. Strikingly, 1000 HEK-PDK1 cells were sufficient to generate tumors in all 6 mice as early as 2 weeks (Figure 5D, left). HEK-Myc cells seemed to be less tumorigenic and required 10,000 cells to generate a similar size of tumors. By contrast, 10,000 HEK-E545K cells were unable to induce tumors in the mice (Figure 5D). A further experiment shows that as low as 100 PDKl cells were sufficient to give rise to xenograft tumors, whereas 3 x 10⁶ E545K cells were required to generate observable tumors by 28 days (Figure 5D, right). Importantly, PDKl -associated primary xenograft tumors were self-renewable, as determined by the ability to form secondary and tertiary tumors using as low as 100 xenograft tumor cells (Figure 5E). These in vitro and in vivo data demonstrated a strong tumorigenicity of PDKl -transformed cells with self-renewal capacity.

The ability of PDKl in inducing mouse embryonic fibroblasts (MEFs) reprogramming was also tested. To achieve this, p53-deficient MEFs were used as immortalization by p53 inactivation has been shown to enhance MEF reprogramming efficiency (see Kawamura et al. Linking the p53 tumour suppressor pathway to somatic cell reprogramming. Nature. 2009;460:1140-4; Marion et al. A p53-mediated DNA damage response limits reprogramming to ensure iPS cell genomic integrity. Nature. 2009;460:1149-53). Again, PDK1 but not E545K was also able to induce Myc activation, as well as tumorsphere formation in immortalized p53-/- MEFs (Figure 12C and 12D). In the PDK1 -sphere populations we detected strongly increased expressions of ES pluripotency factors Sox2 and Oct4 as assessed by both qPCR and confocal imaging compared to the monolayer growth (Figure 12E and 12F). When these MEF-PDK1 cells were cultured in ESC medium containing the differentiation inhibitor LIF (leukemia inhibitory factor), MEF-PDK1 cells formed colonies resembling the ESC-like morphology and were alkaline-phosphatase (AP) positive (Figure 12G), although it was found that these colonies were unable to maintain the ES-like morphology in the subsequent passages, probably due to an incomplete reprogramming. Thus, in both human epithelial cells and MEFs, PDK1 is able to induce PLK1 and Myc activation and ESC- like property.

Aberrant high PD 1 activity occurs in invasive and metastatic breast tumor samples. To demonstrate the capacity of the PDKl-PLKl-Myc pathway in regulating cancer stem cells, experiments utilized the highly invasive breast cancer MDA-MB-231 and SUM159PT cells that contain a high percentage of CD44⁺/CD24^"low CSC-like population (26). Intriguingly, PDKl-PLKl-Myc signaling was found to be enriched in CD44⁺/CD241ow cells compared to the non-CD44⁺/CD24^"low cells (Figure 5F). Knockdown of PDK1/PLK1 or treatment with their corresponding inhibitors BX795/B 12536, resulted in marked reduction of CD44⁺/CD24^"low populations (Figure 5G, H and I). By contrast, PI3K/AKT inhibitors GDC-0941 and MK-2206 were unable to do so (Figure 51). Corresponding to the reduced CD44⁺/CD24^"low cells, PDK1 or PLK1 inhibition either by gene knockdown or inhibitor treatment resulted in marked inhibition of tumorsphere formation in MDA-MB-231 cells (Figure 5J).

PDK1 Activates ES or CSC-like Transcriptional Programs

Myc is able to activate ESC-like transcriptional programs in adult epithelial cells, resulting in a CSC-like phenotype in the appropriate genetic context. To characterize the transcriptional program underlying the PDK1 -induced CSC-like behavior, the gene expression profiles in HEK-PDKl, -Myc or -E545K cells were compared. Significant Analysis of Microarray (SAM) identified 1750, 1080 and 297 differentially expressed genes in these transformed cells when compared to non-transformed control cells, respectively (FDR < 0.05, p < 0.01; Tables 1-3). Gene Venn Diagram analysis shows that HEK-PDKl shared a robust transcriptional program with HEK-Myc, but had little overlap with HEK-E545K (Figure 6A). In addition to the PDK1 and Myc common gene set, PDK1 also regulates a unique set of 784 genes. The PDKl - or Myc-regulated genes were further stratified into 889 upregulated and 1 151 downregulated genes via gene cluster analysis (Figure 6B). Notably, a number of well-known genes implicated in ESC pluripotency or maintenance, including SOX2, LIN28B, SALL4 and ΈΖΗ2 (Takahashi and Yamanaka, Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell. 2006;126:663-76), or CSC, including EPCAM, ALDHIA and S100A4 (Ginestier et al. ALDHl is a marker of normal and malignant human mammary stem cells and a predictor of poor clinical outcome. Cell Stem Cell. 2007;1 :555-67), were upregulated in both HEK-PDK1 and HEK-Myc cells, but not in HEK-E454K cells (Figure 6B). JAG2, which was recently shown to be a Myc target (Yustein et al. Induction of ectopic Myc target gene JAG2 augments hypoxic growth and tumorigenesis in a human B-cell model. Proc Natl Acad Sci U S A. 2010;107:3534-9) with a role in modulating CSCs, was also markedly induced by PDKl and Myc but not by E545K. In addition, a set of secreted inhibitors of autocrine signaling, including DKK1, SFRP1, and BMP4, whose reduction enables self-renewal of epithelial cells (Scheel et al. Paracrine and autocrine signals induce and maintain mesenchymal and stem cell States in the breast. Cell. 2011 ;145:926-40), were strongly repressed in PDKl and Myc cells but not in E545K cells. CD24, a negative selection marker for CSCs (Visvader and Lindeman, Cancer stem cells in solid tumours: accumulating evidence and unresolved questions. Nat Rev Cancer. 2008;8:755-68), was also selectively repressed in PDKl and Myc cells. The array results of selected genes were further validated by qRT- PCR (Figure 6C) and Western blotting (Figure 6D). Notably, many genes co-regulated by PDKl and Myc, including SOX2, EPCAM, JAG 2 and S100A4, were more affected by PDKl than Myc. In total, 668 genes were identified showing such a pattern (Figure 6E), which is consistent with a more robust role of PDKl than Myc in tumorigenesis.

The changes of microRNAs that are Myc-associated and implicated in ESC self- renewal were also investigated. LIN28B is an Myc target and is able to inhibit the biogenesis of the let-7 family microRNAs. Inhibition of let-7 miRNAs enhances reprogramming of somatic cells to induced pluripotent (iPS) cells. Myc also transactivates the mir- 17-92 cluster, which is also implicated in ESC maintenance. Consistent with Myc and LIN28B elevation, a marked upregulation of miR- 17-92 and down-regulation of let- 7s in PDKl and Myc cells, but not in E545K cells, was detected (Figure 6F). Since let-7 suppresses its own negative regulator LIN28B, it is likely that PDKl enforces a feedback loop via Myc-LIN28B-mediated Let-7 downregulation to support the self-renewal program. Lastly, it was shown that BI2536 treatment of HEK-PDK1 cells resulted in reduced expression of some ESC or CSC-related genes, including EPCAM, SOX2, SALL4, and JAG2 (Figure 6G), validating a role of PLKl in the PDKl -mediated CSC gene signature. These findings indicate that PDKl is able to evoke multiple transcriptional programs that coordinately induced a remarkable reprogramming towards a state resembling CSCs. In this process, Myc is one important factor but not the only one that modulates the reprogramming.

PDKl-Induced CSC-like Gene Signature is Relevant to Human Cancers and is Associated with Aggressive Tumor Behavior

Aberrant gene expression associated with ES cell identity, including ESC genes, Myc targets and Polycomb targets, exists in poorly differentiated tumors. By further interrogating several datasets collectively, it was shown that the above ESC-related genes were significantly enriched in the PDKl -dependent transcriptome, including upregulation of 97 ESC-expressed genes and downregulation of 182 Polyccomb targets (PRC genes) (Figure 13A). In contrast, the E545K-associated transcriptional program displayed a distinct gene set that is not significantly associated with ESCs (Figure 13A).

It was next determined whether PDKl -driven ESC-like gene expression is of clinical relevance to human malignance. Gene set enrichment analysis (GSEA) (Subramanian et al. Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles. Proc Natl Acad Sci USA. 2005; 102: 15545- 50) of several data sets showed that PDKl -induced ESC-like genes were found to be significantly enriched in colon and lung tumor samples as compared to the normal controls, while the Polycomb targets were reversely correlated in these samples (Figure 13B). Moreover, in breast cancer, deregulation of these genes was significantly correlated with the high-grade tumors as compared to the low-grade tumors (Figure 13C). This indicates that aberrant expression of these PDKl -regulated ESC genes is associated with malignant progression from normal to aggressive tumors. In addition, we also demonstrated that the PDKl -regulated ESC-like gene signature was associated with poor disease outcome as shown in the survival analysis of breast and lung cancer cohorts (Figure 13D), providing a prognostic value of these genes. Together, these findings demonstrate that the PDKl -activated ESC-like gene signature identified from the in vitro culture system is clinically relevant to human cancers arising in distinct tissues and support a link of PDKl -Myc signaling to aggressive cancer behavior. BI2536 Synergizes with PBK-mTOR Inhibitor BEZ235 to Induce Robust Apoptosis and Tumor Growth Inhibition in CRC

mTOR inhibition by rapamycin or mTOR/Raptor knockdown induces Myc accumulation in CRC, which can be inhibited by PDK1 inhibition, resulting in rapamycin sensitization. As the data now indicate that PL 1 is required for PD l-Myc signaling, together with a further observation that PLK1 is highly expressed in CRC tumors compared to adjunct normal regions (Figure 14A, B), it was hypothesized that the PLK1 inhibitor could also sensitize CRC cells to mTOR inhibitors through abolishing mTOR inhibitor-induced Myc activation. Classical mTOR inhibitors like rapalogs induce compensatory feedback activation of PI3K-AKT due to S6K inhibition. BEZ235, a dual PBK-mTOR kinase inhibitor is able to overcome the feedback AKT activation. Unlike Rapamycin treatment which induced both AKT and Myc activation in CRC cells, BEZ235 did not induce AKT activation but retained the ability to induce Myc (Figure 7A). Of notice, neither drugs induced ERK activation in CRC, which is however often seen in breast cancer cells. As expected, BI2536 co-treatment effectively removed BEZ235-induced Myc induction (Figure 7B). In these cells, BI2536 or BEZ235 alone failed to induce significant apoptosis, but their combination, which resulted in inhibition of both Myc and p-4E-BPl, induced a massive apoptosis, as evidenced by strong detection of PARP cleavage (Figure 7B), cells in Sub-Gl (Figure 7C), and caspase 3 activation (Figure 14C). The combinatorial effect was synergistic as shown by combination index analysis (Figure 14D) and further confirmed by time-course analysis of cell viability (Figure 7D) and long term colony formation assay (Figure 14E). Finally, to assess the potential of the combination strategy in vivo, SW480 and HT15 cells were injected subcutaneously into nude mice to establish tumor xenografts. It was demonstrated that BEZ235 also induced Myc accumulation in the xenograft tumors which can be inhibited via combination with BI2536 (Figure 14F). Accordingly, the combination treatment induced synergistic tumor growth inhibition compared to the single agent treatment, validating the in vitro findings (Figure 7E).

Like BEZ235, a specific mTOR inhibitor PP242 also generated similar results on Myc, p-4EBPl and apoptosis when combined with BI2536 (Figure 15A, B). On the contrary, BI2536, though it also blocked Rapamycin-induced Myc accumulation (Figure 15C), did not enhance apoptosis (Figure 15D), only potentiated the anti-proliferation effect and xenograft tumor growth inhibition (Figure 15E, F). This is probably due to the inability of rapamycin to block 4EBP1 phosphorylation (Figure 15C). 4EBP1, but not S6K, is the key effector of the mTOR pathway responsible for cell proliferation and survival and additional inhibition of 4EBP1 phosphorylation seems to be required for apoptosis induction in response to the AKT inhibitor. Thus, the simultaneous inhibition of both Myc and 4EBP1 phosphorylation upon combination of BI2536 and BEZ235 seemed to be crucial for apoptosis induction of CRC cells. Taken all the data together, it is concluded that the combination of BI2536 and PBK-mTOR dual inhibitors like BEZ235 represent a promising treatment strategy for CRC.

(Hi) DISCUSSION

PDKl Regulation of PLKl-Myc Signaling in Human Cancer Cells

Although PI3K-AKT signaling has been considered to be the main signaling pathway associated with PDKl in oncogenesis, the experimental data presented herein uncovers another arm of signaling that routs to PLKl-Myc to confer malignant phenotypes. The system utilised detected AKT phosphorylation at T308 by PDKl, and did not identify AKT phosphorylation at S473 which is required for a full AKT activation. This is in contrast to PI3K-transformed cells where both AKT phosphorylations are strongly induced. The data thus indicates that PDKl signaling is wired differentially in certain oncogenic contexts to confer growth advantage that becomes less dependent on AKT. This data is consistent with a conclusion that Myc can be an alternative pharmacodynamic marker for the evaluation of small molecule PDKl inhibitors under preclinical and clinical development.

Therapeutic Targeting ofPDKl-PLKl Signaling in Myc-dependent Tumors

The experimental data provided herein identifies the crucial role of PDKl -PLKl- Myc signaling for cancer cell survival. The data provides evidence that PDKl induces PLK1 phosphorylation and PLK1 binds to and induces Myc phosphorylation and protein accumulation widely in cancer cells. The data presented here shows that PLK1 can directly bind to Myc. The direct regulation of Myc by PDK1-PLK1 signaling facilitates a therapeutic approach for targeting Myc-driven tumors. Indeed, the experimental data shows preferential killing using a small molecule inhibitor of PDKl or PLK1 in Myc- dependent breast cancer cells compared with Myc-independent breast cancer cells. Given that a clinical inhibitor of Myc is not available, small molecule inhibitors targeting PDK-1 and/or PLKlcan provide an alternative anti-Myc strategy. Therapeutic targeting of PLK1 may yield a more favorable therapeutic index in Myc-associated tumors. Role of PDKl-PLKl-Myc Signaling in Driving Tumor Initiating Cells

The main characteristic of the PDK1 -induced transformation is that it is able to induce both genotype and phenotype of CSCs that has been proposed to account for tumor initiation, progression and chemo-resistance (Reya et al. (2001) ibid; Visvader and Lindeman (2008) ibid). The results provided here show that as low as 500 PDK1- transformed cells can induce robust tumorigenicity and the PDK1 activates clinically- relevant transcriptional programs associated with poor disease outcome. In addition, PDK1 or PLK1 inhibition also resulted in disruption of both embryonic and adult stem cell self-renewal while inducing differentiation. Activation of an ESC-like signature and an ESC-like phenotype in differentiated somatic cells also indicates that the ES program can be reactivated during the course of tumor progression and is not necessarily inherited from a stem cell-of-origin.

Furthermore, the present data shows that PDK1 or PLK1 inhibition in highly invasive breast cancer MDA-MB-231 cells resulted in depletion of CSC-like CD44+/CD24-low populations and accordingly strongly reduced tumorsphere formation, while PI3K-AKT inhibition did not have such effects. Thus, small molecule inhibition of PDKl-PLKl-Myc signaling for elimination of CSCs may provide a targeted therapy to overcome recurrence of aggressive breast tumors following chemotherapy.

Combination of PLK Inhibitor and PISK-mTOR Inhibitor for CRC

The experimental results provide an additional therapeutic application in the identification of strategies to overcome resistance to mTOR-targeted therapy in CRC. Drug resistance and tumor recurrence is the main cause of patient relapse, possibly owing to recurrence of cancer stem cells. mTOR inhibition induces Myc activation, a compensatory effect mitigating the anti-proliferative effect of mTOR inhibitors in CRC. The present data shows that PLK1 inhibitor blocks mTOR inhibitor-induced Myc activation, demonstrating its advantage in a new combination therapy for CRC. Specifically, low dose of PLK1 inhibitor BI2536 plus PI3K-mTOR dual inhibitor BEZ235 induced massive apoptosis in CRC cells and a synergistic loss of colony formation, indicating a useful approach in CRC.

Claims

CLAIMS:

1. A composition comprising:

(i) an inhibitor of Polo-like kinase 1 (PLK1); and

(ii) an inhibitor of the phosphatidylinositol 3' -kinase- Akt-mammalian target of rapamycin (PI3K-Akt-mTOR) signalling pathway.

2. The composition according to claim 1 , wherein the inhibitor of the PDK-Akt- mTOR signalling pathway is selected from a PI3K inhibitor, an Akt inhibitor, an mTOR kinase inhibitor, or a dual PI3K/mTOR kinase inhibitor.

3. The composition according to claim 1 or claim 2, wherein the PI3K inhibitor is selected from the group consisting of GSK2636771, IPI-145 (INK1197), LY294002, GDC-0941, CAL-101 (GS-1101, Idelalisib), BEZ235 (NVP-BEZ235), BKM120 (NVP- BKM120, Buparlisib), NU7441 (KU-57788), Wortmannin, TGX-221, BYL719, an anti- PI3K antibody, an inhibitory PI3K RNA molecule, and PI- 103.

4. The composition according to claim 1 or claim 2, wherein the Akt inhibitor is selected from the group consisting of afuresertib (GSK2110183), perifosine (KRX-0401), RX-0201, Erucylphosphocholine (ErPC), PBI-05204, GSK690693, A-443654, AKT inhibitor ARQ 092, AKT inhibitor AZD5363, AKT inhibitor GDC-0068, AKT inhibitor GSK2141795, AKT inhibitor LY2780301, AKT inhibitor MK2206, A-674563, CCT 128930, an anti-Akt antibody, an inhibitory Akt RNA molecule, and AKT inhibitor SR13668.

5. The composition according to claim 1 or claim 2, wherein the mTOR inhibitor is selected from the group consisting of Rapamycin, PP242, Temsirolimus, Sirolimus, Everolimus, Ridaforolimus, AZD8055, an anti-mTOR antibody, an inhibitory mTOR RNA molecule, and INK 128.

6. The composition according to claim 1 or claim 2, wherein the dual PI3K/mTOR kinase inhibitor is selected from the group consisting of PF-04691502, PF- 05212384, X-480, NVP-BEZ235, GDC-0980, VS-5584, PKI-179, PKI-587 and XL765.

7. The composition according to claim 1 or claim 2, wherein the inhibitor of PLK1 is BI2536 and the inhibitor of the PI3 K- Akt-mTOR signalling pathway is NVP- BEZ235.

8. The composition according to any one of claims 1 to 7, further comprising a pharmaceutically acceptable carrier or excipient.

9. A method of prophylactically or therapeutically treating cancer in a patient in need thereof, comprising administering to the patient a therapeutically effective amount of: (i) an inhibitor of Polo-like kinase 1 (PLK1); and (ii) an inhibitor of the PBK-Akt-mTOR signalling pathway.

10. A method of prophylactically or therapeutically treating cancer in a patient in need thereof, comprising administering to the patient a synergistic combination of:

(i) an inhibitor of Polo-like kinase 1 (PLKl);_tand

(ii) an inhibitor of the PBK-Akt-mTOR signalling pathway,

in a therapeutically effective amount.

11. The method according to claim 9 or claim 10, wherein the cancer is resistant to a treatment that inhibits mTOR kinase activity.

12. The method according to any one of claims 9 to 1 I comprising administering the composition of any one of claims 1 to 8.

13. The method according to any one of claims 9 to 12, wherein the inhibitor of the PBK-Akt-mTOR signalling pathway is selected from a PBK inhibitor, an Akt inhibitor, an mTOR kinase inhibitor, or a dual PBK/mTOR kinase inhibitor.

14. The method according to any one of claims 9 to 13, wherein the inhibitor of PLK1 is selected from the group consisting of BI2536, GW843682X, Cylapolin-1, DAP- 81, ZK-thiazolidinone, Compound 36, LFM-A13, Poloxin, Poloxipan, Purpurogallin, ON 01910.Na, HMN-176, GSK461364, NMS-P937, an anti-PLKl antibody, an inhibitory PLK1 RNA molecule, and BI6727.

15. The method according to any one of claims 9 to 13, wherein the dual PBK/mTOR kinase inhibitor is selected from the group consisting of PF-04691502, PF- 05212384, X-480, NVP-BEZ235, GDC-0980, VS-5584, PKI-179, PKI-587 and XL765.

16. The method according to any one of claims 9 to 13, wherein the PBK inhibitor is selected from the group consisting of GSK2636771, IPI-145 (INK1197), LY294002, GDC-0941, CAL-101 (GS-1101, Idelalisib), BEZ235 (NVP-BEZ235), BKM120 (NVP-BKM120, Buparlisib), NU7441 (KU-57788), Wortmannin, TGX-221, BYL719, an anti-PBK antibody, an inhibitory PBK RNA molecule, and PI- 103.

17. The method according to any one of claims 9 to 13, wherein the Akt inhibitor is selected from the group consisting of afuresertib (GSK2110183), perifosine (KRX- 0401), RX-0201, Erucylphosphocholine (ErPC), PBI-05204, GSK690693, A-443654, AKT inhibitor ARQ 092, AKT inhibitor AZD5363, AKT inhibitor GDC-0068, AKT inhibitor GSK2141795, AKT inhibitor LY2780301, AKT inhibitor MK2206, A-674563, CCT 128930, an anti-mAkt antibody, an inhibitory Akt RNA molecule, and AKT inhibitor SRI 3668.

18. The method according to any one of claims 9 to 13, wherein the mTOR inhibitor is selected from the group consisting of Rapamycin, PP242, Temsirolimus, Sirolimus, Everolimus, Ridaforolimus, AZD8055, an anti-mTOR antibody, an inhibitory mTOR RN A molecule, and INK 128.

19. The method according to any one of claims 9 to 15, wherein the inhibitor of PLK1 is BI2536 and the inhibitor of the PBK-Akt-mTOR signalling pathway is NVP- BEZ235.

20. The method according to any one of claims 9 to 19, wherein the cancer is a Myc-dependent cancer.

21. The method according to any one of claims 9 to 19, wherein the cancer is selected from the group consisting of colorectal cancer, breast cancer, lung cancer (small cell and non-small cell), prostate cancer, cancer of the endometrium, ovarian cancer, cervical cancer, cancer of the uterus, head and neck cancer, pancreatic cancer, kidney cancer, brain cancer, bladder cancer, mouth cancer, cancer of the larynx, cancer of the esophagus, stomach cancer, a sarcoma, melanoma, multiple myeloma, B-cell lymphoma, mantle cell lymphoma, Non-Hodgkin's Lymphoma, and leukemia.

22. A method for inhibiting phosphorylation of Myc protein in a subject in need thereof, the method comprising administering to the subject an inhibitor of an interaction between 3-phosphoinositide-dependent protein kinase-1 (PDK1) and Polo-like kinase 1 (PLK1).

23.. A method of prophylactically or therapeutically treating a Myc-dependent cancer in a subject in need thereof, the method comprising administering to the subject an inhibitor of an interaction between 3-phosphoinositide-dependent protein kinase-1 (PDK1) and Polo-like kinase 1 (PLK1).

24. The method according to claim 22 or claim 23, wherein the inhibitor prevents or inhibits phosphorylation of PLK1 by PDK1.

25. The method according to any one of claims 22 to 24, comprising administering an inhibitor of PDK1 and an inhibitor of PLK1.

26. The method according to any one of claims 22 to 25, wherein the inhibitor of PDK1 is selected from the group consisting of OSU 03012, BX795, BAG 956 and BX912.

27. The method according to any one of claims 22 to 26, wherein the inhibitor of PLK1 is selected from the group consisting of BI2536, GW843682X, Cylapolin-1, DAP- 81, ZK-thiazolidinone, Compound 36, LFM-A13, Poloxin, Poloxipan, Purpurogallin, ON 01910.Na, HMN-176, GSK461364, NMS-P937, and BI6727.

28. The method according to any one of claims 22 to 27, wherein the inhibitor of PDK1 is BX795 and the inhibitor of PLK1 is BI2536.

29. The method according to any one of claims 20 or 22 to 28, wherein the Myc- dependent cancer is selected from the group consisting of bladder cancer, breast cancer, colon cancer, gastric cancer, hepatocellular carcinoma, leukemia, lymphoma, melanoma, myeloma (including multiple myeloma), neuroblastoma, ovarian cancer, prostate cancer, rhabdomyosarcoma, small cell lung cancer, subungual melanoma, uveal melanoma and Burkitt's lymphoma.