WO2017114823A1 - Generic method for the stabilization of specific rna - Google Patents

Generic method for the stabilization of specific rna Download PDF

Info

Publication number
WO2017114823A1
WO2017114823A1 PCT/EP2016/082696 EP2016082696W WO2017114823A1 WO 2017114823 A1 WO2017114823 A1 WO 2017114823A1 EP 2016082696 W EP2016082696 W EP 2016082696W WO 2017114823 A1 WO2017114823 A1 WO 2017114823A1
Authority
WO
WIPO (PCT)
Prior art keywords
oligonucleotides
rna
stranded rna
segment
nucleic acid
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2016/082696
Other languages
English (en)
French (fr)
Inventor
Amar Gupta
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
F Hoffmann La Roche AG
Roche Diagnostics GmbH
Roche Molecular Systems Inc
Original Assignee
F Hoffmann La Roche AG
Roche Diagnostics GmbH
Roche Molecular Systems Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by F Hoffmann La Roche AG, Roche Diagnostics GmbH, Roche Molecular Systems Inc filed Critical F Hoffmann La Roche AG
Priority to CA3009716A priority Critical patent/CA3009716C/en
Priority to JP2018533890A priority patent/JP6880034B2/ja
Priority to CN201680069920.6A priority patent/CN108291252B/zh
Priority to ES16828748T priority patent/ES2886605T3/es
Priority to EP16828748.0A priority patent/EP3397775B1/en
Publication of WO2017114823A1 publication Critical patent/WO2017114823A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/6848Nucleic acid amplification reactions characterised by the means for preventing contamination or increasing the specificity or sensitivity of an amplification reaction
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813Hybridisation assays
    • C12Q1/6832Enhancement of hybridisation reaction
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/6851Quantitative amplification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/6853Nucleic acid amplification reactions using modified primers or templates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the present invention belongs to the field of in-vitro diagnostics, and in particular to the detection and quantitation of nucleic acid through amplification technology.
  • nucleic acid amplification and detection are the detection of viruses such as Human Papilloma Virus (HPV), West Nile Virus (WNV) or the routine screening of blood donations for the presence of Human Immunodeficiency Virus (HIV), Hepatitis-B (HBV) and/or C Virus (HCV).
  • viruses such as Human Papilloma Virus (HPV), West Nile Virus (WNV) or the routine screening of blood donations for the presence of Human Immunodeficiency Virus (HIV), Hepatitis-B (HBV) and/or C Virus (HCV).
  • HPV Human Papilloma Virus
  • WNV West Nile Virus
  • HCV Human Immunodeficiency Virus
  • HBV Hepatitis-B
  • HCV C Virus
  • said amplification techniques are suitable for bacterial targets such as mycobacteria, or the analysis of oncology markers.
  • PCR Polymerase Chain Reaction
  • Other amplification reactions comprise, among others, the Ligase Chain Reaction, Polymerase Ligase Chain Reaction, Gap-LCR, Repair Chain Reaction, 3SR, NASBA, Strand Displacement Amplification (SDA), Transcription Mediated Amplification (TMA), and Q - amplification.
  • SDA Strand Displacement Amplification
  • TMA Transcription Mediated Amplification
  • Q - amplification Q amplification.
  • Automated systems for PCR-based analysis often make use of real-time detection of product amplification during the PCR process in the same reaction vessel. Key to such methods is the use of modified oligonucleotides carrying reporter groups or labels.
  • control nucleic acids are usually designed in a specific manner. In brief, these controls usually resemble the target nucleic acid for which they serve as control in order to mimic their properties during the process. This circumstance applies for both qualitative and quantitative assays.
  • RNA standards are usually synthesized by in vitro transcription or are the infectious agents themselves.
  • the RNA is purified and then quantified by several different methods, such as absorbance at OD 2 6o, phosphate analysis, hyperchromicity or isotopic tracer analysis (Collins, 1995).
  • RNA is encapsulated using the coat proteins of a bacteriophage to create pseudoviral particles (and as further described in U.S. 5,677,124 and U.S. 5,939,262).
  • Another method of encapsulation of RNA involves the AccuPlex technology (SeraCare Life Sciences, Milford MA) in which the RNA of interest is generated by exocytosis inside a mammalian virus envelope.
  • the RNA protection offered by these encapsulated particles is limited at elevated temperatures.
  • novel methods and compositions that increase the shelf life of RNA in products developed in areas where refrigeration may be limited.
  • the present invention relates to methods and compositions for the stabilization of specific RNA molecules that can either be the target for detection or the control standard.
  • the invention relates to a method of preventing or reducing degradation of a segment of a single-stranded RNA template that is amplified in an amplification reaction, the method comprising the steps of providing the single-stranded RNA template; hybridizing the single-stranded RNA template with one or more oligonucleotides whose sequences are completely or partially complementary to the segment of the single-stranded RNA template that is amplified; and reverse transcribing and amplifying the segment of the single-stranded RNA template under reaction conditions whereby the one or more oligonucleotides do not interfere with reverse transcription and amplification.
  • each one oligonucleotide from the one or more oligonucleotides has a melting temperature that is at least 5°C lower than an extension temperature used during amplification. In another embodiment, each one oligonucleotide from the one or more oligonucleotides has a melting temperature that is at least 5°C lower than melting temperatures of primers and probes used during reverse transcription and amplification.
  • each one oligonucleotide from the one or more oligonucleotides is present at a concentration that is at least fifty-fold lower than the concentration of primers and probes used during reverse transcription and amplification. In another embodiment, each one oligonucleotide from the one or more oligonucleotide is present at a concentration that is between 0.1 nM and 2.0 nM. In one embodiment, the one or more oligonucleotides hybridize to more than 48% of the segment of the single-stranded RNA template that is amplified.
  • the one or more oligonucleotides hybridize to more than 60%, more than 75%, or more than 90% of the segment of the single-stranded RNA template that is amplified. In one embodiment, the one or more oligonucleotides hybridize to the entire segment of the single-stranded RNA template that is amplified. In one embodiment, each one oligonucleotide from the one or more oligonucleotides is between 11 nucleotides and 50 nucleotides or between 11 nucleotides and 40 nucleotides in length or between 11 nucleotides and 30 nucleotides in length.
  • the plurality of oligonucleotides hybridizes to more than 90% of the segment of the single-stranded RNA molecule, wherein each one oligonucleotide from the plurality oligonucleotides is between 11 and 30 nucleotides in length.
  • each one oligonucleotide from the one or more oligonucleotides has a melting temperature that ranges between 20°C and 80°C, or between 30°C and 70°C, or between 40°C and 70°C, or between 40°C and 60°C.
  • the sequence of each one oligonucleotide from the one or more oligonucleotides does not overlap with the sequence of another oligonucleotide from the one or more oligonucleotides.
  • the single-stranded RNA template is caged. The caging may be accomplished by means of encapsulation, encapsidation, trapping, or by the RNA template being inside a cell.
  • a step of isolating or purifying the single-stranded RNA template is performed prior to the step of reverse transcription and amplification.
  • the one or more oligonucleotides comprise a group of oligonucleotides whose sequences are selected from group consisting of SEQ ID NOs: 1-10, 11-19, 20-27, and 28-35.
  • the invention in another aspect, relates to a method of detecting the presence of a tested RNA sequence in a sample during an amplification reaction comprising obtaining the sample; obtaining a nucleic acid standard that serves as a standard in detection and/or quantification of the tested RNA sequence wherein the nucleic acid standard comprises a single-strand RNA control sequence and one or more oligonucleotide whose sequences are completely or partially complementary to a segment of the single-stranded RNA control sequence; mixing the sample and the nucleic acid standard; providing conditions for performing reverse transcription and amplification of both the tested RNA sequence and the segment of the single-stranded RNA control sequence, wherein under these conditions, the one or more oligonucleotides do not interfere with reverse transcription and amplification; and detecting amplification products from the tested RNA sequence and from the single-stranded RNA control sequence.
  • each one oligonucleotide from the one or more oligonucleotides has a melting temperature that is at least 5°C lower than an extension temperature used during amplification. In another embodiment, each one oligonucleotide from the one or more oligonucleotides has a melting temperature that is at least 5°C lower than melting temperatures of primers and probes used during reverse transcription and amplification.
  • each one oligonucleotide from the one or more oligonucleotides is present at a concentration that is at least fifty-fold lower than the concentration of primers and probes used during reverse transcription and amplification. In another embodiment, each one oligonucleotide from the one or more oligonucleotide is present at a concentration that is between 0.1 nM and 2.0 nM. In one embodiment, the one or more oligonucleotides hybridize to more than 48% of the segment of the single-stranded RNA control sequence.
  • the one or more oligonucleotides hybridize to more than 60%, more than 75%, or more than 90% of the segment of the single-strand RNA control sequence that is amplified. In one embodiment, the one or more oligonucleotides hybridize to the entire segment of the single-stranded RNA control sequence. In one embodiment, each one oligonucleotide from the one or more oligonucleotides is between 11 nucleotides and 50 nucleotides or between 11 nucleotides and 40 nucleotides in length or between 11 nucleotides and 30 nucleotides in length.
  • the plurality of oligonucleotides hybridizes to more than 90% of the segment of the single-stranded RNA molecule, wherein each one oligonucleotide from the plurality oligonucleotides is between 11 and 30 nucleotides in length.
  • each one oligonucleotide from the one or more oligonucleotides has a melting temperature that ranges between 20°C and 80°C, or between 30°C and 70°C, or between 40°C and 70°C, or between 40°C and 60°C.
  • the sequence of each one oligonucleotide from the one or more oligonucleotides does not overlap with the sequence of another oligonucleotide from the one or more oligonucleotides.
  • the single- stranded RNA control sequence is caged. In some embodiments, the single-strand RNA control sequence is caged by means selected from the group consisting of encapsulation, encapsidation, trapping, and being inside a cell. In another embodiment, a step of isolating or purifying both the tested RNA sequence and the segment of the single-stranded RNA control sequence is performed prior to the step of providing conditions for performing reverse transcription and amplification.
  • the one or more oligonucleotides comprise a group of oligonucleotides whose sequences are selected from group consisting of SEQ ID NOs: 1-10, 11-19, 20-27, and 28-35.
  • the invention relates to a nucleic acid standard that serves as a standard in detection and/or quantification of a tested RNA sequence that is amplified in an amplification reaction wherein the nucleic acid standard comprises a single-strand RNA control sequence and one or more oligonucleotide whose sequences are completely or partially complementary to a segment of the single-stranded RNA control sequence and hybridize to more than 48% of the segment of the single-stranded RNA control sequence.
  • each one oligonucleotide from the one or more oligonucleotides does not serve as primers, probes or templates during the amplification reaction.
  • each one oligonucleotide from the one or more oligonucleotides has a melting temperature that is at least 5°C lower than an extension temperature used during the amplification reaction.
  • each one oligonucleotide from the one or more oligonucleotides has a melting temperature that is at least 5°C lower than melting temperatures of primers and probes used during the amplification reaction.
  • each one oligonucleotide from the one or more oligonucleotides is present at a concentration that is at least fifty-fold lower than the concentration of primers and probes used during the amplification reaction. In another embodiment, each one oligonucleotide from the one or more oligonucleotide is present at a concentration that is between 0.1 nM and 2.0 nM. In one embodiment, the one or more oligonucleotides hybridize to more than 60%, more than 75%, or more than 90% of the segment of the single-stranded RNA control sequence. In one embodiment, the one or more oligonucleotides hybridize to the entire segment of the single-stranded RNA control sequence.
  • each one oligonucleotide from the one or more oligonucleotides is between 11 nucleotides and 50 nucleotides or between 11 nucleotides and 40 nucleotides in length or between 11 nucleotides and 30 nucleotides in length.
  • the plurality of oligonucleotides hybridizes to more than 90% of the segment of the single- stranded RNA molecule, wherein each one oligonucleotide from the plurality oligonucleotides is between 11 and 30 nucleotides in length.
  • each one oligonucleotide from the one or more oligonucleotides has a melting temperature that ranges between 20°C and 80°C, or between 30°C and 70°C, or between 40°C and 70°C, or between 40°C and 60°C.
  • the sequence of each one oligonucleotide from the one or more oligonucleotides does not overlap with the sequence of another oligonucleotide from the one or more oligonucleotides.
  • the single-strand RNA control sequence is caged. The caging may be accomplished by means of encapsulation, encapsidation, trapping, or by the RNA template being inside a cell.
  • the one or more oligonucleotides comprise a group of oligonucleotides whose sequences are selected from group consisting of SEQ ID NOs: 1-10, 11-19, 20-27, and 28-35.
  • the invention in another aspect, relates to a method of preventing or reducing degradation of a segment of a single-stranded RNA molecule, the method comprising the steps of providing the single-stranded RNA molecule; and hybridizing the single-stranded RNA molecule with a plurality of oligonucleotides whose sequences are completely or partially complementary to the segment of the single-stranded RNA molecule, wherein the plurality of oligonucleotides hybridizes to more than 48% of the segment of the single-stranded RNA molecule, wherein each one oligonucleotide from the plurality oligonucleotides is between 11 nucleotides and 50 nucleotides in length.
  • the plurality of oligonucleotides hybridizes to more than 60%, more than 75%, or more than 90% of the segment of the single-stranded RNA molecule. In one embodiment, the plurality of oligonucleotides hybridizes to the entire segment of the single-stranded RNA molecule. In one embodiment, each one oligonucleotide from the plurality of oligonucleotides is between 11 nucleotides and 40 nucleotides in length or between 11 nucleotides and 30 nucleotides in length.
  • the plurality of oligonucleotides hybridizes to more than 90% of the segment of the single-stranded RNA molecule, wherein each one oligonucleotide from the plurality oligonucleotides is between 11 and 30 nucleotides in length.
  • each one oligonucleotide from the plurality of oligonucleotides has a melting temperature that ranges between 20°C and 80°C, or between 30°C and 70°C, or between 40°C and 70°C, or between 40°C and 60°C.
  • the sequence of each one oligonucleotide from the plurality of oligonucleotides does not overlap with the sequence of another oligonucleotide from the plurality of oligonucleotides.
  • the single-stranded RNA molecule is caged. The caging may be accomplished by means of encapsulation, encapsidation, trapping, or by the RNA molecule being inside a cell.
  • the providing and hybridizing steps are conducted in solution.
  • the plurality of oligonucleotides comprises a group of oligonucleotides whose sequences are selected from group consisting of SEQ ID NOs: 1-10, 11-19, 20-27, and 28-35.
  • the invention relates to the use of one or more oligonucleotides for preventing or reducing degradation of a segment of a single-stranded RNA molecule to be subjected to a reverse transcription reaction or a reverse transcription and amplification reaction, wherein the sequences of said one or more oligonucleotides are completely or partially complementary to the segment of the single-stranded RNA.
  • each one oligonucleotide from the one or more oligonucleotides has a melting temperature that is at least 5°C lower than an extension temperature used in the reverse transcription reaction or the reverse transcription and amplification reaction.
  • each one oligonucleotide from the one or more oligonucleotides has a melting temperature that is at least 5°C lower than melting temperatures of primers and probes used during reverse transcription reaction or the reverse transcription and amplification reaction. In one embodiment, each one oligonucleotide from the one or more oligonucleotides is present at a concentration that is at least fifty-fold lower than the concentration of primers and probes used during reverse transcription reaction or the reverse transcription and amplification reaction. In another embodiment, each one oligonucleotide from the one or more oligonucleotide is present at a concentration that is between 0.1 nM and 2.0 nM.
  • the one or more oligonucleotides hybridize to more than 48% of the segment of the single-stranded RNA. In one embodiment, the one or more oligonucleotides hybridize to more than 60%, more than 75%, or more than 90% of the segment of the single-stranded RNA. In one embodiment, the one or more oligonucleotides hybridize to the entire segment of the single-stranded RNA. In one embodiment, each one oligonucleotide from the one or more oligonucleotides is between 11 nucleotides and 50 nucleotides or between 11 nucleotides and 40 nucleotides in length or between 11 nucleotides and 30 nucleotides in length.
  • the plurality of oligonucleotides hybridizes to more than 90% of the segment of the single-stranded RNA, wherein each one oligonucleotide from the plurality oligonucleotides is between 11 and 30 nucleotides in length.
  • each one oligonucleotide from the one or more oligonucleotides has a melting temperature that ranges between 20°C and 80°C, or between 30°C and 70°C, or between 40°C and 70°C, or between 40°C and 60°C.
  • the sequence of each one oligonucleotide from the one or more oligonucleotides does not overlap with the sequence of another oligonucleotide from the one or more oligonucleotides.
  • the single- stranded RNA is caged. The caging may be accomplished by means of encapsulation, encapsidation, trapping, or by the RNA template being inside a cell.
  • the RNA is at least a single-strand RNA control sequence.
  • the RNA is at least a single-strand RNA template sequence.
  • the RNA is a mixture of at least one single a single-strand RNA control sequence and at least a single-strand RNA template sequence.
  • the degradation of the segment of a single-stranded RNA is prevented or reduced for a period of at least 18 days at an incubation temperature of 37°C. In one embodiment the degradation of the segment of a single-stranded RNA is prevented or reduced for a period of at least 18 days at an incubation temperature of 45°C. In certain embodiments the degradation of the segment of a single-stranded RNA is prevented or reduced for a period of at least 45 days at an incubation temperature of 37°C or 45°C. In certain embodiments the degradation of the segment of a single-stranded RNA is prevented or reduced for a period of at least 71 days at an incubation temperature of 37°C or 45°C.
  • the degradation of the segment of a single-stranded RNA is prevented or reduced for a period of at least 12 weeks at an incubation temperature of 37°C or 45°C.
  • the one or more oligonucleotides comprise a group of oligonucleotides whose sequences are selected from group consisting of SEQ ID NOs: 1-10, 11-19, 20-27, and 28-35.
  • the invention in another aspect, relates to a mixture for preventing or reducing degradation of a segment of a single-stranded RNA molecule, the mixture comprising in solution a single- stranded RNA molecule and a plurality of oligonucleotides whose sequences are completely or partially complementary to the segment of the single-stranded RNA molecule, wherein the plurality of oligonucleotides hybridizes to more than 48% of the segment of the single- stranded RNA molecule and wherein each one oligonucleotide from the plurality oligonucleotides is between 11 nucleotides and 50 nucleotides in length.
  • the plurality of oligonucleotides hybridizes to more than 60%, more than 75%, or more than 90% of the segment of the single-stranded RNA molecule. In one embodiment, the plurality of oligonucleotides hybridizes to the entire segment of the single-stranded RNA molecule. In one embodiment, each one oligonucleotide from the plurality of oligonucleotides is between 11 nucleotides and 40 nucleotides in length or between 11 nucleotides and 30 nucleotides in length.
  • the plurality of oligonucleotides hybridizes to more than 90% of the segment of the single-stranded RNA molecule, wherein each one oligonucleotide from the plurality oligonucleotides is between 11 and 30 nucleotides in length.
  • each one oligonucleotide from the plurality of oligonucleotides has a melting temperature that ranges between 20°C and 80°C, or between 30°C and 70°C, or between 40°C and 70°C, or between 40°C and 60°C.
  • the sequence of each one oligonucleotide from the plurality of oligonucleotides does not overlap with the sequence of another oligonucleotide from the plurality of oligonucleotides.
  • the single-stranded RNA molecule is caged. The caging may be accomplished by means of encapsulation, encapsidation, trapping, or by the RNA molecule being inside a cell.
  • the mixture further comprises a buffer and salts suitable for performing a reverse transcription reaction or a reverse transcription and amplification reaction.
  • the plurality of oligonucleotides comprises a group of oligonucleotides whose sequences are selected from group consisting of SEQ ID NOs: 1-10, 11-19, 20-27, and 28-35.
  • FIG. 1 shows the results of a UPLC analysis of the complementary oligonucleotide pool used in the stability experiments.
  • FIG. 2 shows the results of an 18-day stability study of PEF066 RNA transcript in the presence of complementary oligonucleotides. Samples were incubated at 2-8°C, 37°C, and 45°C, and amplified and detected by RT-PCR, where an increased cycle threshold (value) was indicative of sample degradation.
  • FIG. 3 shows the results of an 18-day stability study of PEF070 Armored RNA control in the presence of complementary oligonucleotides. Samples were incubated at 2-8°C, 37°C, and 45°C, and amplified and detected by RT-PCR, where an increased cycle threshold (value) was indicative of sample degradation.
  • FIG. 4 shows the RT-PCR growth curves of a 12-week stability study of a PEF066 RNA transcript in the absence or presence of complementary oligonucleotides. Samples were incubated at 4°C, 37°C, and 45°C, and amplified and detected by RT-PCR, where an increased cycle threshold (value) was indicative of sample degradation.
  • FIG. 5 shows the RT-PCR growth curves of a 71 -day stability study of a HIV-2 LTR RNA transcript in the absence or presence of complementary oligonucleotides. Samples were incubated at 4°C, 37°C, and 45°C, and amplified and detected by RT-PCR, where an increased cycle threshold (value) was indicative of sample degradation.
  • FIG. 6 shows the results of a stability study of an RNA control encapsulated in Accuplex in the absence (NO COPS) or presence (10 nM COPS) of complementary oligonucleotides. Samples incubated at either 4°C, 37°C, or 45°C for 1 day, 15 days or 71 days were amplified and detected by RT-PCR, where increased cycle threshold (Cp value) was indicative of sample degradation.
  • Amplification reagents are chemical or biochemical components that enable the amplification of nucleic acids.
  • Such reagents comprise, but are not limited to, nucleic acid polymerases, buffers, mononucleotides such as nucleoside triphosphates, oligonucleotides e.g. as oligonucleotide primers, salts and their respective solutions, detection probes, dyes, and more.
  • nucleoside is a base-sugar combination.
  • the base portion of the nucleoside is normally a heterocyclic base.
  • the two most common classes of such heterocyclic bases are purines and pyrimidines.
  • Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside.
  • the phosphate group can be linked to either the 2'-, 3'- or 5'-hydroxyl moiety of the sugar.
  • a nucleotide is the monomeric unit of an "oligonucleotide", which can be more generally denoted as an "oligomeric compound", or a "polynucleotide”, more generally denoted as a "polymeric compound”.
  • Another general expression for the aforementioned is deoxyribonucleic acid (DNA) and ribonucleic acid (RNA).
  • oligomeric compound is a compound consisting of "monomeric units” which may be nucleotides alone or non-natural compounds (see below), more specifically modified nucleotides (or nucleotide analogs) or non-nucleotide compounds, alone or combinations thereof.
  • Oligonucleotides and modified oligonucleotides are subgroups of oligomeric compounds.
  • oligonucleotide refers to components formed from a plurality of nucleotides as their monomeric units.
  • the phosphate groups are commonly referred to as forming the internucleoside backbone of the oligonucleotide.
  • the normal linkage or backbone of RNA and DNA is a 3' to 5' phosphodiester linkage.
  • Oligonucleotides and modified oligonucleotides may be synthesized as principally described in the art and known to the expert in the field.
  • Chemical synthesis methods may include, for example, the phosphotriester method described by Narang S. A. et al, Methods in Enzymology 68 (1979) 90-98, the phosphodiester method disclosed by Brown E. L., et al., Methods in Enzymology 68 (1979) 109-151, the phosphoramidite method disclosed in Beaucage et al., Tetrahedron Letters 22 (1981) 1859, the H-phosphonate method disclosed in Garegg et al., Chem. Scr. 25 (1985) 280-282 and the solid support method disclosed in US 4,458,066.
  • the oligonucleotides may be chemically modified, i.e. the primer and/ or the probe comprise a modified nucleotide or a non-nucleotide compound.
  • the probe or the primer is then a modified oligonucleotide.
  • Modified nucleotides differ from a natural nucleotide by some modification but still consist of a base, a pentofuranosyl sugar, a phosphate portion, base-like, pentofuranosyl sugar-like and phosphate-like portion or combinations thereof.
  • a label may be attached to the base portion of a nucleotide whereby a modified nucleotide is obtained.
  • a natural base in a nucleotide may also be replaced by e.g. a 7-deazapurine whereby a modified nucleotide is obtained as well.
  • modified oligonucleotide (or “oligonucleotide analog”), belonging to another specific subgroup of oligomeric compounds, possesses one or more nucleotides and one or more modified nucleotides as monomeric units.
  • modified oligonucleotide (or “oligonucleotide analog”) refers to structures that function in a manner substantially similar to oligonucleotides and can be used interchangeably.
  • a modified oligonucleotide (or an oligonucleotide analog) can for example be made by chemical modification of oligonucleotides by appropriate modification of the phosphate backbone, ribose unit or the nucleotide bases (Uhlmann and Peyman, Chemical Reviews 90 (1990) 543; Verma S., and Eckstein F., Annu. Rev. Biochem. 67 (1998) 99-134).
  • Representative modifications include phosphorothioate, phosphorodithioate, methyl phosphonate, phosphotriester or phosphoramidate inter-nucleoside linkages in place of phosphodiester internucleoside linkages; deaza- or azapurines and -pyrimidines in place of natural purine and pyrimidine bases, pyrimidine bases having substituent groups at the 5 or 6 position; purine bases having altered substituent groups at the 2, 6 or 8 positions or 7 position as 7- deazapurines; bases carrying alkyl-, alkenyl-, alkinyl or aryl-moieties, e.g.
  • lower alkyl groups such as methyl, ethyl, propyl, butyl, tert-butyl, pentyl, hexyl, heptyl, octyl, nonyl, decyl, or aryl groups like phenyl, benzyl, naphtyl; sugars having substituent groups at, for example, their 2' position; or carbocyclic or acyclic sugar analogs.
  • modified oligonucleotides or oligonucleotide analogs
  • nucleic acid as well as the “target nucleic acid” is a polymeric compound of nucleotides as known to the expert skilled in the art.
  • Target nucleic acid is used herein to denote a nucleic acid in a sample which should be analyzed, i.e. the presence, non-presence and/or amount thereof in a sample should be determined.
  • the term “primer” is used herein as known to the expert skilled in the art and refers to oligomeric compounds, primarily to oligonucleotides, but also to modified oligonucleotides that are able to prime DNA synthesis by a template- dependent DNA polymerase, i.e. the 3'-end of the e.g.
  • primer provides a free 3'-OH group whereto further nucleotides may be attached by a template-dependent DNA polymerase establishing 3'- to 5'-phosphodiester linkage whereby deoxynucleoside triphosphates are used and whereby pyrophosphate is released.
  • a "probe” also denotes a natural or modified oligonucleotide.
  • a probe serves the purpose to detect an analyte or amplificate. In the case of the process described above, probes can be used to detect the amplificates of the target nucleic acids. For this purpose, probes typically carry labels.
  • Labeled nucleic acid binding compounds labeled probes or just probes.
  • exemplary labels are fluorescent labels, which are e.g. fluorescent dyes such as a fluorescein dye, a rhodamine dye, a cyanine dye, and a coumarin dye.
  • Exemplary fluorescent dyes are FAM, HEX, JA270, CAL635, Coumarin343, Quasar705, Cyan500, CY5.5, LC-Red 640, LC-Red 705.
  • any primer and/or probe may be chemically modified, i.e. the primer and/ or the probe comprise a modified nucleotide or a non-nucleotide compound.
  • the probe or the primer is then a modified oligonucleotide.
  • a method of nucleic acid amplification is the Polymerase Chain Reaction (PCR) which is disclosed, among other references, in U.S. Patent Nos. 4,683,202, 4,683,195, 4,800,159, and 4,965,188.
  • PCR typically employs two or more oligonucleotide primers that bind to a selected nucleic acid template (e.g. DNA or RNA).
  • Primers useful for nucleic acid analysis include oligonucleotides capable of acting as a point of initiation of nucleic acid synthesis within the nucleic acid sequences of the target nucleic acids.
  • a primer can be purified from a restriction digest by conventional methods, or it can be produced synthetically.
  • the primer can be single- stranded for maximum efficiency in amplification, but the primer can be double-stranded.
  • Double-stranded primers are first denatured, i.e., treated to separate the strands.
  • One method of denaturing double stranded nucleic acids is by heating.
  • a "thermostable polymerase” is a polymerase enzyme that is heat stable, i.e., it is an enzyme that catalyzes the formation of primer extension products complementary to a template and does not irreversibly denature when subjected to the elevated temperatures for the time necessary to effect denaturation of double-stranded template nucleic acids.
  • the synthesis is initiated at the 3' end of each primer and proceeds in the 5' to 3' direction along the template strand.
  • Thermostable polymerases have e.g. been isolated from Thermus fiavus, T. ruber, T. thermophilus, T. aquaticus, T. lacteus, T. rubens, Bacillus stearothermophilus, and Methanothermus fervidus. Nonetheless, polymerases that are not thermostable also can be employed in PCR assays provided the enzyme is replenished.
  • Strand separation can be accomplished by any suitable denaturing method including physical, chemical or enzymatic means.
  • One method of separating the nucleic acid strands involves heating the nucleic acid until it is predominately denatured (e.g., greater than 50%, 60%, 70%, 80%, 90% or 95% denatured).
  • the heating conditions necessary for denaturing template nucleic acid will depend, e.g., on the buffer salt concentration and the length and nucleotide composition of the nucleic acids being denatured, but typically range from about 90°C to about 105°C for a time depending on features of the reaction such as temperature and the nucleic acid length. Denaturation is typically performed for about 5 sec to 9 min. In order to not expose the respective polymerase like e.g. the Z05 DNA Polymerase to such high temperatures for too long and thus risking a loss of functional enzyme, it can be preferred to use short denaturation steps.
  • the reaction mixture is allowed to cool to a temperature that promotes annealing of each primer to its target sequence on the target nucleic acids.
  • the temperature for annealing can be from about 35°C to about 70°C, or about 45°C to about 65°C; or about 50°C to about 60°C, or about 55°C to about 58°C.
  • Annealing times can be from about 10 sec to about 1 min (e.g., about 20 sec to about 50 sec; about 30 sec to about 40 sec). In this context, it can be advantageous to use different annealing temperatures in order to increase the inclusivity of the respective assay.
  • annealing temperatures at relatively low annealing temperatures, primers may also bind to targets having single mismatches, so variants of certain sequences can also be amplified. This can be desirable if e.g. a certain organism has known or unknown genetic variants which should also be detected.
  • relatively high annealing temperatures bear the advantage of providing higher specificity, since towards higher temperatures the probability of primer binding to not exactly matching target sequences continuously decreases.
  • the process described above comprises annealing at different temperatures, for example first at a lower, then at a higher temperature.
  • non-exactly matching target sequences may be (pre-)amplified. This can be followed e.g. by about 45 cycles at 58°C, providing for higher specificity throughout the major part of the experiment. This way, potentially important genetic variants are not missed, while the specificity remains relatively high.
  • the reaction mixture is then adjusted to a temperature at which the activity of the polymerase is promoted or optimized, i.e., a temperature sufficient for extension to occur from the annealed primer to generate products complementary to the nucleic acid to be analyzed.
  • the temperature should be sufficient to synthesize an extension product from each primer that is annealed to a nucleic acid template, but should not be so high as to denature an extension product from its complementary template (e.g., the temperature for extension generally ranges from about 40° to 80°C (e.g., about 50°C to about 70°C; about 60°C).
  • Extension times can be from about 10 sec to about 5 min, or about 15 sec to 2 min, or about 20 sec to about 1 min, or about 25 sec to about 35 sec.
  • the newly synthesized strands form a double-stranded molecule that can be used in the succeeding steps of the reaction.
  • the steps of strand separation, annealing, and elongation can be repeated as often as needed to produce the desired quantity of amplification products corresponding to the target nucleic acids.
  • the limiting factors in the reaction are the amounts of primers, thermostable enzyme, and nucleoside triphosphates present in the reaction.
  • the cycling steps i.e., denaturation, annealing, and extension
  • the cycling steps can be repeated at least once.
  • the number of cycling steps will depend, e.g., on the nature of the sample. If the sample is a complex mixture of nucleic acids, more cycling steps will be required to amplify the target sequence sufficient for detection.
  • the cycling steps are repeated at least about 20 times, but may be repeated as many as 40, 60, or even 100 times.
  • a PCR can be carried out in which the steps of annealing and extension are performed in the same step (one-step PCR) or, as described above, in separate steps (two-step PCR).
  • steps of annealing and extension are performed in the same step (one-step PCR) or, as described above, in separate steps (two-step PCR).
  • Performing annealing and extension together and thus under the same physical and chemical conditions, with a suitable enzyme such as, for example, the Z05 DNA polymerase bears the advantage of saving the time for an additional step in each cycle, and also abolishing the need for an additional temperature adjustment between annealing and extension.
  • the one- step PCR reduces the overall complexity of the respective assay.
  • shorter times for the overall amplification can be preferred, as the time-to-result is reduced and leads to a possible earlier diagnosis.
  • nucleic acid amplification methods to be used comprise the Ligase Chain Reaction (LCR; Wu D. Y. and Wallace R. B., Genomics 4 (1989) 560-69; and Barany F., Proc. Natl. Acad. Sci. USA 88 (1991)189-193); Polymerase Ligase Chain Reaction (Barany F., PCR Methods and Applic. 1 (1991) 5-16); Gap -LCR (WO 90/01069); Repair Chain Reaction (EP 0439182 A2), 3SR (Kwoh D.Y. et al., Proc. Natl. Acad. Sci. USA 86 (1989) 1173-1177; Guatelli J.C., et al, Proc. Natl.
  • the internal control nucleic acid may exhibit the following properties relating to its sequence: - a melting temperature from 55°C to 90°C, or from 65°C to 85°C, or from 70°C to 80°C, or about 75°C a length of up to 500 bases or base pairs, or from 50 to 300 bases or base pairs, or from
  • GC content from 30% to 70%, or from 40% to 60%, or about 50%.
  • a “sequence” is the primary structure of a nucleic acid, i.e. the specific arrangement of the single nucleobases of which the respective nucleic acids consists. It has to be understood that the term “sequence” does not denote a specific type of nucleic acid such as RNA or DNA, but applies to both as well as to other types of nucleic acids such as e.g. PNA or others. Where nucleobases correspond to each other, particularly in the case of uracil (present in RNA) and thymine (present in DNA), these bases can be considered equivalent between RNA and DNA sequences, as well-known in the pertinent art.
  • nucleic acids are often DNA which can be derived e.g. from DNA viruses like e.g. Hepatitis B Virus (HBV), Cytomegalovirus (CMV) and others, or bacteria like e.g. Chlamydia trachomatis (CT), Neisseria gonorrhoeae (NG) and others.
  • HBV Hepatitis B Virus
  • CMV Cytomegalovirus
  • CT Chlamydia trachomatis
  • NG Neisseria gonorrhoeae
  • nucleic acids relevant for clinical diagnostics are ribonucleic acids, like e.g. the nucleic acids from RNA viruses such as for example Human Immunodeficiency Virus (HIV), Hepatitis C Virus (HCV), the West Nile Virus (WNV), Human Papilloma Virus (HPV), Japanese Encephalitis Virus (JEV), St. Louis Encephalitis Virus (SLEV) and others.
  • the present invention can be readily applied to such nucleic acids.
  • the internal control nucleic acid can be RNA, as the internal control nucleic acid mimics the most sensitive target of an assay involving multiple targets, and RNA targets usually have to be more closely controlled.
  • an aspect of the invention is the method described above, wherein said internal control nucleic acid is RNA.
  • RNA Since RNA is more prone to degradation than DNA due to influences such as alkaline pH, ribonucleases etc., internal control nucleic acids made of RNA may be provided as armored particles. Armored particles such as especially armored RNA are described e.g. in EP910643.
  • the RNA which can be produced chemically or heterologously e.g. by bacteria such as e.g. E. coli, is at least partially encapsulated in a viral coat protein. The latter confers resistance of the RNA towards external influences, in particular ribonucleases.
  • internal control DNA can also be provided as an armored particle. Both armored RNA and DNA are useful as internal control nucleic acids.
  • RNA control nucleic acids are armored with the MS2 coat protein in E. coli.
  • DNA control nucleic acids are armored using lambda phage GT11.
  • an aspect of the invention is the method described above, wherein said internal control nucleic acid is an armored nucleic acid.
  • RNA templates are reverse transcribed into DNA prior to amplification and detection.
  • a "polymerase with reverse transcriptase activity” is a nucleic acid polymerase capable of synthesizing DNA based on an RNA template. It is also capable of replicating a single or double-stranded DNA once the RNA has been reverse transcribed into a single strand cDNA. In an embodiment of the invention, the polymerase with reverse transcriptase activity is thermostable.
  • a segment of a single-stranded RNA template or "a segment of a single-stranded RNA control sequence” refers to the portion of an RNA template or sequence whose degradation is prevented or reduced by the one or more oligonucleotides that are used in the methods of the present invention.
  • the segment can cover the entire RNA template or sequence and in other cases, the segment can cover the portion of the RNA template or sequence that is amplified and detected.
  • the process according to the invention comprises incubating a sample containing an RNA template with an oligonucleotide primer sufficiently complementary to said RNA template to hybridize with the latter, and a thermostable DNA polymerase in the presence of at least all four natural or modified deoxyribonucleoside triphosphates, in an appropriate buffer comprising a metal ion buffer which, in an embodiment, buffers both the pH and the metal ion concentration.
  • This incubation is performed at a temperature sufficient for said primer to hybridize to said RNA template and said DNA polymerase to catalyze the polymerization of said deoxyribonucleoside triphosphates to form a cDNA sequence complementary to the sequence of said RNA template.
  • cDNA refers to a complementary DNA molecule synthesized using a ribonucleic acid strand (RNA) as a template.
  • RNA ribonucleic acid strand
  • the RNA may e.g. be mRNA, tRNA, rRNA, or another form of RNA, such as viral RNA.
  • the cDNA may be single-stranded, double-stranded or may be hydrogen-bonded to a complementary RNA molecule as in an RNA/cDNA hybrid.
  • a primer suitable for annealing to an RNA template may also be suitable for amplification by PCR.
  • a second primer complementary to the reverse transcribed cDNA strand, provides an initiation site for the synthesis of an extension product.
  • the first extension reaction is reverse transcription using an RNA template, and a DNA strand is produced.
  • the second extension reaction using the DNA template, produces a double-stranded DNA molecule.
  • Thermostable DNA polymerases can be used in a coupled, one-enzyme reverse transcription/amplification reaction.
  • the term "homogeneous”, in this context, refers to a two-step single addition reaction for reverse transcription and amplification of an RNA target. By homogeneous it is meant that following the reverse transcription (RT) step, there is no need to open the reaction vessel or otherwise adjust reaction components prior to the amplification step.
  • RT reverse transcription
  • amplification reagents are e.g. adjusted, added, or diluted, for which the reaction vessel has to be opened, or at least its contents have to be manipulated. Both homogeneous and non-homogeneous embodiments are comprised by the scope of the invention.
  • Reverse transcription is an important step in an RT/PCR. It is, for example, known in the art that RNA templates show a tendency towards the formation of secondary structures that may hamper primer binding and/or elongation of the cDNA strand by the respective reverse transcriptase. Thus, relatively high temperatures for an RT reaction are advantageous with respect to efficiency of the transcription. On the other hand, raising the incubation temperature also implies higher specificity, i.e. the RT primers will not anneal to sequences that exhibit mismatches to the expected sequence or sequences. Particularly in the case of multiple different target RNAs, it can be desirable to also transcribe and subsequently amplify and detect sequences with single mismatches, e.g. in the case of the possible presence of unknown or rare substrains or subspecies of organisms in the fluid sample.
  • the RT incubation can be carried out at more than one different temperature.
  • an aspect of the invention is the process described above, wherein said incubation of the polymerase with reverse transcriptase activity is carried out at different temperatures from 30°C to 75°C, or from 45°C to 70°C, or from 55°C to 65°C.
  • RT steps can damage the DNA templates that may be present in the fluid sample. If the fluid sample contains both RNA and DNA species, it is thus favorable to keep the duration of the RT steps as short as possible, but at the same time ensuring the synthesis of sufficient amounts of cDNA for the subsequent amplification and optional detection of amplificates.
  • an aspect of the invention is the process described above, wherein the period of time for incubation of the polymerase with reverse transcriptase activity is up to 30 minutes, 20 minutes, 15 minutes, 12.5 minutes, 10 minutes, 5 minutes, or 1 minute.
  • a further aspect of the invention is the process described above, wherein the polymerase with reverse transcriptase activity and comprising a mutation is selected from the group consisting of a) a CS5 DNA polymerase
  • enzymes carrying a mutation in the polymerase domain that enhances their reverse transcription efficiency in terms of a faster extension rate.
  • an aspect of the invention is the process described above, wherein the polymerase with reverse transcriptase activity is a polymerase comprising a mutation conferring an improved nucleic acid extension rate and/or an improved reverse transcriptase activity relative to the respective wildtype polymerase.
  • the polymerase with reverse transcriptase activity is a polymerase comprising a mutation conferring an improved reverse transcriptase activity relative to the respective wildtype polymerase.
  • polymerases carrying point mutations that render them particularly useful are disclosed in WO 2008/046612.
  • polymerases to be used i can be mutated DNA polymerases comprising at least the following motif in the polymerase domain:
  • thermostable DNA polymerase from Thermus species Z05 (described e.g.
  • An embodiment for the method according to the invention is a mutant Z05 DNA polymerase wherein the amino acid at position 580 is selected from the group consisting of G, T, R, K and L.
  • Mn2+ can be the divalent cation and is typically included as a salt, for example, manganese chloride (MnCl2), manganese acetate (Mn(OAc)2), or manganese sulfate (MnS04). If MnCl2 is included in a reaction containing 50 mM Tricine buffer, for example, the MnCl2 is generally present at a concentration of 0.5-7.0 mM; 2.5-3.5mM is generally present when 200 ⁇ of each dGTP, dATP, dUTP, and, dCTP are utilized.
  • MnCl2 manganese chloride
  • Mn(OAc)2 manganese acetate
  • MnS04 manganese sulfate
  • the internally controlled process described above is particularly useful for the simultaneous amplification of target nucleic acids derived from both organisms having an RNA or organisms having a DNA genome. This advantage considerably increases the spectrum of different organisms, especially pathogens, that can be analyzed under identical physical conditions.
  • An "organism”, as used herein, means any living single- or multicellular life form.
  • a virus is an organism.
  • enzymes like Tth polymerase or, for example, the mutant Z05 DNA polymerase mentioned above are suited to carry out the subsequent step of amplification of the target nucleic acids. Exploiting the same enzyme for both reverse transcription an amplification contributes to the ease of carrying out the process and facilitates its automation, since the fluid sample does not have to be manipulated between the RT and the amplification step.
  • the target of the amplification step can be an RNA/DNA hybrid molecule.
  • the target can be a single-stranded or double-stranded nucleic acid. Although the most widely used PCR procedure uses a double-stranded target, this is not a necessity.
  • the reaction mixture contains a double-stranded DNA molecule consisting of the single-stranded target and a newly synthesized complementary strand.
  • the reaction mixture contains a double-stranded cDNA molecule. At this point, successive cycles of amplification proceed as described above.
  • nucleic acid detection methods are known to the expert in the field and are described in standard textbooks as Sambrook J. et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 1989 and Ausubel F. et al: Current Protocols in Molecular Biology 1987, J. Wiley and Sons, NY.
  • the detection methods may include but are not limited to the binding or intercalating of specific dyes as ethidium bromide which intercalates into the double-stranded DNA and changes its fluorescence thereafter.
  • the purified nucleic acid may also be separated by electrophoretic methods optionally after a restriction digest and visualized thereafter.
  • probe-based assays which exploit the oligonucleotide hybridization to specific sequences and subsequent detection of the hybrid.
  • the amplified target nucleic acids can be detected during or after the amplification reaction in order to evaluate the result of the analysis. Particularly for detection in real time, it is advantageous to use nucleic acid probes.
  • the methods set out above can be based on Fluorescence Resonance Energy Transfer (FRET) between a donor fluorescent moiety and an acceptor fluorescent moiety.
  • FRET Fluorescence Resonance Energy Transfer
  • a representative donor fluorescent moiety is fluorescein, and representative corresponding acceptor fluorescent moieties include LC-Red 640, LC-Red 705, Cy5, and Cy5.5.
  • detection includes exciting the sample at a wavelength absorbed by the donor fluorescent moiety and visualizing and/or measuring the wavelength emitted by the corresponding acceptor fluorescent moiety.
  • detection can be followed by quantitating the FRET. For example, detection is performed after each cycling step. For example, detection is performed in real time.
  • PCR amplification and detection of the amplification product can be combined in a single closed cuvette with dramatically reduced cycling time. Since detection occurs concurrently with amplification, the real-time PCR methods obviate the need for manipulation of the amplification product, and diminish the risk of cross-contamination between amplification products. Real-time PCR greatly reduces turn-around time and is an attractive alternative to conventional PCR techniques in the clinical laboratory.
  • the following patent applications describe real-time PCR as used in the LightCycler TM technology: WO 97/46707, WO 97/46714 and WO 97/46712.
  • the LightCycler TM instrument is a rapid thermal cycler combined with a microvolume fiuorometer utilizing high quality optics.
  • This rapid thermocycling technique uses thin glass cuvettes as reaction vessels. Heating and cooling of the reaction chamber are controlled by alternating heated and ambient air. Due to the low mass of air and the high ratio of surface area to volume of the cuvettes, very rapid temperature exchange rates can be achieved within the thermal chamber.
  • TaqMan * technology utilizes a single-stranded hybridization probe labeled with two fluorescent moieties.
  • a first fluorescent moiety When a first fluorescent moiety is excited with light of a suitable wavelength, the absorbed energy is transferred to a second fluorescent moiety according to the principles of FRET.
  • the second fluorescent moiety is generally a quencher molecule.
  • Typical fluorescent dyes used in this format are for example, among others, FAM, HEX, CY5, JA270, Cyan and CY5.5.
  • the labeled hybridization probe binds to the target nucleic acid (i.e., the amplification product) and is degraded by the 5' to 3' exonuclease activity of the Taq or another suitable polymerase as known by the skilled artisan, such as a mutant Z05 polymerase, during the subsequent elongation phase.
  • the excited fluorescent moiety and the quencher moiety become spatially separated from one another.
  • the fluorescence emission from the first fluorescent moiety can be detected.
  • the intensity of the emitted signal can be correlated with the number of original target nucleic acid molecules.
  • an amplification product can be detected using a double-stranded DNA binding dye such as a fluorescent DNA binding dye (e.g., SYBRGREEN P or SYBRGOLD * (Molecular Probes)).
  • a fluorescent DNA binding dye e.g., SYBRGREEN P or SYBRGOLD * (Molecular Probes)
  • Upon interaction with the double-stranded nucleic acid such fluorescent DNA binding dyes emit a fluorescence signal after excitation with light at a suitable wavelength.
  • a double-stranded DNA binding dye such as a nucleic acid intercalating dye also can be used.
  • a melting curve analysis is usually performed for confirmation of the presence of the amplification product.
  • Molecular beacons in conjunction with FRET can also be used to detect the presence of an amplification product using the real-time PCR methods of the invention.
  • Molecular beacon technology uses a hybridization probe labeled with a first fluorescent moiety and a second fluorescent moiety.
  • the second fluorescent moiety is generally a quencher, and the fluorescent labels are typically located at each end of the probe.
  • Molecular beacon technology uses a probe oligonucleotide having sequences that permit secondary structure formation (e.g. a hairpin). As a result of secondary structure formation within the probe, both fluorescent moieties are in spatial proximity when the probe is in solution. After hybridization to the amplification products, the secondary structure of the probe is disrupted and the fluorescent moieties become separated from one another such that after excitation with light of a suitable wavelength, the emission of the first fluorescent moiety can be detected.
  • probes comprise a nucleic acid sequence that permits secondary structure formation, wherein said secondary structure formation results in spatial proximity between said first and second fluorescent moiety.
  • Efficient FRET can only take place when the fluorescent moieties are in direct local proximity and when the emission spectrum of the donor fluorescent moiety overlaps with the absorption spectrum of the acceptor fluorescent moiety.
  • said donor and acceptor fluorescent moieties are within no more than 5 nucleotides of each other on said probe.
  • said acceptor fluorescent moiety is a quencher.
  • the labeled hybridization probe binds to the target nucleic acid (i.e., the amplification product) and is degraded by the 5'-to 3'-exonuclease activity of the Taq or another suitable polymerase as known by the skilled artisan, such as a mutant Z05 polymerase, during the subsequent elongation phase.
  • amplification employs a polymerase enzyme having 5'-to 3'-exonuclease activity. It is further advantageous to carefully select the length of the amplicon that is yielded as a result of the process described above. Generally, relatively short amplicons increase the efficiency of the amplification reaction.
  • an aspect of the invention is the process described above, wherein the amplified fragments comprise up to 450 bases, up to 300 bases, up to 200 bases, or up to 150 bases.
  • the internal control nucleic acid used in the present invention can serve as a "quantitative standard nucleic acid" which is apt to be and used as a reference in order to quantify, i.e. to determine the quantity of the target nucleic acids.
  • quantitative standard nucleic acids undergo all possible sample preparation steps along with the target nucleic acids.
  • a quantitative standard nucleic acid is processed throughout the method within the same reaction mixture. It must generate, directly or indirectly, a detectable signal both in the presence or absence of the target nucleic acid.
  • the concentration of the quantitative standard nucleic acid has to be carefully optimized in each test in order not to interfere with sensitivity but in order to generate a detectable signal also e.g. at very high target concentrations.
  • the concentration range for the "quantitative standard nucleic acid" is 20- 5000x LOD, 20-lOOOx LOD, or 20-5000x LOD.
  • the final concentration of the quantitative standard nucleic acid in the reaction mixture is dependent on the quantitative measuring range accomplished.
  • LID Limit of detection
  • IU/ml International units/ml
  • Probit Analysis is a method of analyzing the relationship between a stimulus (dose) and the quantal (all or nothing) response.
  • dose dose
  • quantal response experiment groups of animals are given different doses of a drug. The percent dying at each dose level is recorded. These data may then be analyzed using Probit Analysis.
  • the Probit Model assumes that the percent response is related to the log dose as the cumulative normal distribution. That is, the log doses may be used as variables to read the percent dying from the cumulative normal. Using the normal distribution, rather than other probability distributions, influences the predicted response rate at the high and low ends of possible doses, but has little influence near the middle.
  • the Probit Analysis can be applied at distinct "hitrates".
  • a "hitrate” is commonly expressed in percent [%] and indicates the percentage of positive results at a specific concentration of an analyte.
  • an LOD can be determined at 95% hitrate, which means that the LOD is calculated for a setting in which 95% of the valid results are positive.
  • the process described above provides an LOD of 1 to 100 cp/ml or 0.5 to 50 IU/ml, or 1 to 75 cp/ml or 0.5 to 30 IU/ml, or 1 to 25 cp/ml or 1 to 20 IU/ml.
  • HIV up to 60 cp/ml, up to 50 cp/ml, up to 40 cp/ml, up to 30 cp/ml, up to 20 cp/ml, or up to 15 cp/ml
  • HBV up to 10 IU/ml, up to 7.5 IU/ml, or up to 5 IU/ml
  • HCV up to 10 IU/ml, up to 7.5 IU/ml, or up to 5 IU/ml
  • WNV I up to 20 cp/ml, up to 15 cp/ml, or up to 10 cp/ml
  • ⁇ WNV II up to 20 cp/ml, up to 15 cp/ml, up to 10 cp/ml, or up to 5 cp/ml
  • SLEV up to 100 cp/ml, up to 75 cp/ml, up to 50 cp/ml, up to 25 cp/ml, or up to 10 cp/ml.
  • An example of how to perform calculation of quantitative results in the TaqMan * format based on an internal control nucleic acid serving as a quantitative standard nucleic acid is described in the following: A titer is calculated from input data of instrument-corrected fluorescence values from an entire PCR run. A set of samples containing a target nucleic acid and an internal control nucleic acid serving as a quantitative standard nucleic acid undergo PCR on a thermocycler using a specified temperature profile.
  • the filtered fluorescence data are collected for each sample for the target nucleic acid and the internal control nucleic acid.
  • the fluorescence readings are processed to yield one set of dye concentration data for the internal control nucleic acid and one set of dye concentration data for the target nucleic acid.
  • Each set of dye concentration data is processed in the same manner.
  • the elbow values are calculated for the internal control nucleic acid and the target nucleic acid. The elbow value is defined as the point where the fluorescence of the target nucleic acid or the internal control nucleic acid crosses a predefined threshold (fluorescence concentration).
  • CTQS - CTtarget is linear to log (target cone / QS cone).
  • QS denotes the internal control nucleic acid serving as a quantitative standard nucleic acid.
  • the internal control nucleic acid can serve as a "qualitative internal control nucleic acid".
  • a “qualitative internal control nucleic acid” is particularly useful for confirming the validity of the test result of a qualitative detection assay: Even in the case of a negative result, the qualitative internal control must be detected, otherwise the test itself is considered to be inoperative. However, in a qualitative setup, it does not necessarily have to be detected in case of a positive result. As a consequence, its concentration must be relatively low. It has to be carefully adapted to the respective assay and its sensitivity. For example, the concentration range for the qualitative internal nucleic acid, i.e. the second control nucleic acid, will comprise a range of 1 copy per reaction to 1000 copies per reaction.
  • LOD limit of detection
  • its concentration is between the LOD of an assay and the 25fold value of the LOD, or between the LOD and lOx LOD. Or, it is between 2x and lOx LOD. Or, it is between 5x and lOx LOD. Or, it is 5x or lOx LOD.
  • a primary aspect of the invention is the preparation and use of nuclease and hydrolysis resistant nucleic acid standards and controls.
  • Internal standards and positive controls play an important role in assuring the correct functioning of the test kits, and confirming test results. Internal standards also provide a means for quantification. The detection and quantification of specific RNAs in samples has become prevalent with the advent of RT-PCR.
  • the internal standard for RT-PCR studies should be an RNA molecule, as it controls for both the reverse transcription and PCR amplification steps. This is problematic, as RNA is particularly susceptible to RNase and thermal degradation. Altered test results could be produced by partial or complete degradation of an RNA standard either during storage or after introduction to a sample.
  • RNA diagnostic assays The likelihood of at least partial RNA degradation is quite high, given that many of the RNA detection schemes are designed to detect viral RNAs in serum samples, where relatively high quantities of various RNases are located.
  • the ideal internal standard for RNA diagnostic assays is a molecule that is functionally equivalent to RNA in the assay format, but resistant to degradation by nucleases or by hydrolysis.
  • RNA from enzyme-mediated degradation in an environment in which RNases are active: (1) microencapsulating the RNA inside an impenetrable structure, (2) non-covalently binding the RNA with molecules that deny access of nucleases to the standard, and (3) chemically altering the structure of the RNA in such a way that it is no longer a substrate for nucleases while still being functionally equivalent to RNA in the assay format.
  • the nucleic acids in the standards of the invention can be used in quantifying assays. These standards may be used for a variety of purposes such as quantitative RNA standards (to determine the absolute copy number of a specific RNA sequence), specifically to quantify the number of RNA viruses such as HIV-1, HIV-2, HCV, HTLV-1, HTLV-2, hepatitis G, enterovirus, dengue fever virus, or rabies, in plasma, serum, or spinal fluid. They may also be used to quantify the expression of specific mRNA in cells or tissue by an RT-PCR assay.
  • the standards may be internal or external. An internal standard is mixed with the sample at a known concentration such that the sample and the standard are processed and assayed as one.
  • RNA isolation procedures may be used to measure the integrity of an RNA isolation procedure by measuring the amount of degradation observed in the protected RNA after it has been subjected to the isolation procedure followed by Northern blotting. They may be used as environmental tracers to follow the flow of groundwater or to label the waste of individual companies with a unique nucleic acid sequence which can be traced back to the offending company.
  • the present invention is particularly useful for viral quantification.
  • nucleic acid based assays in the process of being developed and/or marketed. These assays detect pathogenic human viruses such as HIV and HCV in human plasma or serum. These assays are highly sensitive, detecting even less than 300 virions per 1.0 ml of plasma.
  • these nucleic acid based assays use naked RNA for their quantitative standards. Unfortunately, these naked RNA standards are very susceptible to contaminating ribonuclease and thermally mediated hydrolysis and thus the results of the assay may be compromised.
  • nucleic acid standards comprising nuclease and hydrolysis resistant recombinant nucleic acid segments comprising a sequence coding a standard nucleic acid.
  • the nucleic acid standard is an RNA standard comprising a ribonuclease and hydrolysis resistant RNA segment comprising a sequence coding a standard RNA.
  • standard nucleic acid and standard RNA refer respectively to nucleic acids and RNAs that are suitable for use as a standard in the particular assay to be employed.
  • the present invention contemplates a ribonuclease and hydrolysis resistant recombinant RNA which is highly suitable as an RNA standard for quantifying RNA viruses, although it need not be recombinant and may be used as an RNA standard for RNA isolated from any source, such as cells from tissue cultures.
  • nuclease resistant and “ribonuclease resistant” mean that a nucleic acid exhibits some degree of increased resistance to nuclease over a naked, unmodified nucleic acid of the same sequence.
  • hydrolysis resistant means that a nucleic acid exhibits some degree of increased resistance to spontaneous temperature dependent hydrolysis over a naked, unmodified nucleic acid of the same sequence.
  • the nucleic acid segment may be chemically modified, coated with a nuclease resistant coating, or caged in a nuclease resistant structure.
  • the RNA standard can be a chemically modified RNA that is resistant to ribonuclease.
  • Another way in which to render a recombinant RNA segment ribonuclease resistant is to coat it with a ribonuclease resistant coating.
  • Such a coating can be anything that binds in a sequence dependent or independent manner to the RNA and renders the RNA ribonuclease resistant.
  • the RNA standard is a recombinant RNA that is caged from the external environment in a ribonuclease resistant structure. RNA may be caged simply by being inside a cell. Other synthetic methods of caging RNA involve the partial encapsidation of the RNA in viral proteins, partial lipid encapsulation of the RNA, partially trapping the RNA in polymer matrices, etc.
  • the ribonuclease or hydrolysis resistant structure is comprised of a viral coat protein that partially encapsidates the RNA standard.
  • the RNA is transcribed in vivo in a bacterial host and then encapsidated by bacteriophage proteins. This "caging" of the RNA results in RNA which is protected from ribonuclease (Armored RNA).
  • Armored RNA ribonuclease
  • the nucleic acid or RNA may be completely or substantially caged in the nuclease resistant or hydrolysis resistant structure, partially caged nucleic acids and RNAs are also within the scope of the present invention as long as the partial caging renders the nucleic acid or RNA nuclease or ribonuclease or hydrolysis resistant.
  • encapsidation encompass structures wherein the encapsidation, encapsulation, trapping etc. is partial as well as substantial or substantially complete so long as the resultant structure is nuclease or hydrolysis resistant as those terms are used herein.
  • the RNA can also be chemically modified so that it is resistant to ribonuclease.
  • a chemically modified RNA may be comprised of chemically modified nucleotides. These nucleotides are modified so that ribonucleases cannot act on the RNA.
  • the chemically modified RNA is prepared by chemical modification of an RNA or a previously transcribed RNA transcript. Alternatively, the chemically modified RNA may be transcribed or synthesized from nucleotides that have already been chemically modified.
  • RNA standard may also comprise an RNA that is bound non-covalently, or coated with, a ribonuclease resistant coating.
  • binding which may be sequence dependent or independent, renders the RNA ribonuclease resistant.
  • the bound molecule is comprised of a protein.
  • binding proteins are MS2/R17 coat protein, HIV-1 nucleocapsid protein, gp32, the regA protein of T4, or the gp32 of bacteriophage T4.
  • the non-covalently bound molecule is comprised of a small molecule.
  • the polyamines, spermine and/or spermidine are examples of a small molecule.
  • the ribonuclease- resistant coating may also be comprised of a nucleic acid.
  • the nucleic acid hybridizes to the recombinant RNA, blocks nucleases, and can serve as a primer for reverse transcriptase.
  • poly-L-lysine and cationic detergents such as CTAB may be used to coat and protect RNA.
  • a generic Internal Control/ Quantitation Standard (IC/QS) concept is based on using a single control sequence (e.g. one DNA and one RNA derived from one sequence) to be used in all diagnostic assays.
  • IC/QS Internal Control/ Quantitation Standard
  • competitive amplification has been utilized for the design of internal controls, controls which compete with the target for the primers.
  • each assay used individual control sequences composed of primer-binding sequences identical to the assay target and a generic probe binding site.
  • the target primers served also as the control primers, thus no extra primers were needed in the assay.
  • only one Internal Control was constructed with primer binding sites corresponding to one of the targets.
  • a second example of a noncompetitive control uses an endogenous Human Genomic Internal Control derived from cells in the sample which requires its own set of primers.
  • Key requirements of the Generic IC/QS included the following: It must meet all Regulatory needs. It should serve as a Full Process Control (FPC), an Internal Control (IC), and an Internal Quantitation Standard (IQS) in respective assays.
  • FPC Full Process Control
  • IC Internal Control
  • IQS Internal Quantitation Standard
  • FPC Full Process Control
  • IC Internal Control
  • IQS Internal Quantitation Standard
  • the Generic IC/QS should result in improved dynamic range, LOD, and assay precision and should result in reduced development time and operational complexity.
  • the generic control concept would consist of a common control sequence which can be either RNA or DNA, and will be protected (e.g. as in particles termed Armored RNA (MS2 phage Coat protein particles) or Armored DNA (lambda phage particles)).
  • the generic control will have one set of new generic primers and probe to be used in all assays, if possible.
  • a generic internal control (GIC) along with primers and probe can be designed using the NCBI Blast program and EMBOSS shuffleseq (European Molecular Biology Open Software Suite) to generate a unique sequence.
  • the basic concept of the present invention is the concept of protecting against hydrolysis or RNase degradation of RNA by converting the specific RNA sequence of interest into a nucleic acid duplex.
  • this duplex is an RNA/DNA hybrid duplex.
  • the rate of hydrolysis of a phosphodiester bond in duplex DNA is known to be 10-fold slower than single-stranded DNA.
  • all the common contaminating ribonucleases prefer single stranded RNA substrates.
  • an RNA/DNA hybrid duplex is the preferred substrate for RNase H, this ribonuclease is not a common contaminant. It is well known that single stranded RNA is readily hydrolyzed, and has low thermal stability.
  • RNA is rigid, and no longer flexible.
  • the 2'- hydroxyl and the phosphodiester linkage are not located in an opposite orientation to each other. Formation of the transition state is not possible without unwinding and breaking many hydrogen bonds. This is energetically very disfavorable, and therefore disallowed.
  • a rigid bicyclic 2',3'-phosphate intermediate cannot be formed in an already rigid structure. This explains the extraordinary thermal stability conferred to RNA by the COPS strategy.
  • RNA sequence to be protected may be optionally covered by hybridization to the one or more reverse complement oligonucleotide sequences.
  • the complementary oligonucleotide sequences need not be completely complementary to the RNA sequence of interest and may be partially complementary to the RNA sequence as long as hybridization between the oligonucleotide(s) and the RNA can still occur at moderately stringent conditions, as understood in the art.
  • the complementary oligonucleotide sequences may optionally be selected to be adjacent to each other.
  • the concentrations, lengths, and compositions of the complementary oligonucleotide sequences are to be chosen in such a way that the downstream process steps (e.g. PCR amplification) will be minimally impacted or harmed.
  • the downstream process steps e.g. PCR amplification
  • the lengths of the oligonucleotide complements in a range (e.g. between 11 and 50 nucleotides or betweenl l and 30 nucleotides in length) that allows hybridization to the RNA sequence at temperatures of 45°C or above but minimizes binding to a solid phase in a downstream sample preparation process, any harmful interference in a subsequent RT-PCR reaction will be minimized.
  • the oligonucleotide complements are designed to have sufficient lower melting temperatures than the primers, and maintaining a high-enough annealing temperature during the reverse transcription (RT) step, competition with primers can be minimized.
  • competition with primers can be minimized.
  • any such complements that may still be present in a subsequent RT-PCR reaction will be unable to be extended by the polymerase.
  • concentrations of the oligonucleotide complements can also be chosen such that they are in sufficient molar excess to provide adequate protection for the RNA sequence, but are in concentration that are low enough as to not cause any harm to the downstream processes (e.g. PCR amplification).
  • compositions of the complement oligonucleotide sequences are only restricted by their ability to form stable duplexes with the RNA sequences of interest.
  • These oligonucleotides can therefore comprise of DNA, L-DNA, RNA, LNA, PNA, BNA etc., or any other known variations and modifications on the nucleotide bases, sugars, or phosphodiester backbones. While the foregoing invention has been described in some detail for purposes of clarity and understanding, it will be clear to one skilled in the art from a reading of this disclosure that various changes in form and detail can be made. For example, all the compositions and methods described above can be used in various combinations.
  • Example 1 Design and preparation of the complementary oligonucleotide pools
  • oligonucleotides were designed against the RNA sequence using in silico design tools. A total of ten oligonucleotides were designed to cover the sequence of interest, varying in length between 14 and 26 bases and with a calculated Tm range of 49.9-57.9C. These sequences were further modified with a phosphate moiety at the 3'-end. The sequences and melting temperatures of the ten oligonucleotides are shown in Table 1.
  • oligonucleotides were synthesized and purified by HPLC, and adjusted to a final concentration of 100 micromolar each. Equal volumes of these solutions were combined to provide a 10 micromolar complementary oligonucleotide pool, which was further characterized by UPLC analysis using a CI 8 reverse phase column and alinear gradient of triethylammonium acetate and acetonitrile. The results are shown in Fig. 1, and confirm the presence of all 10 oligonucleotides.
  • RNA transcript and armored RNA samples were prepared at a concentration of 300 copies per microliter in Tris.HCl (pH 7.0) containing 100 mM KCl.
  • the complement pools referred as Complementary Oligonucleotide Pools for Stabilization (COPS) were added to the sample at a final concentration of 0, 0.1, 1, or 10 nM.
  • COPS Complementary Oligonucleotide Pools for Stabilization
  • PCR reaction mixtures were prepared on a 96-well plate with the following final concentrations: 60 mM Tricine(pH 8.3), 120 mM potassium acetate, 3% glycerol, 5.4% DMSO, 0.015% Tween 20, 400 ⁇ each dATP, dCTP and dGTP, 800 ⁇ dUTP, 600 nM of each primer, 100 nM probe, target RNA transcript or armored RNA (1,500 copies) , 900 units/mL Z05D DNA polymerase (with 5' nuclease activity), 200 units/mL UNG, 44 ⁇ EDTA, and 3.3 mM manganese acetate.
  • RNA transcript and armored RNA samples are prepared as in Example 2 with the exception that in one reaction, only COPS corresponding to SEQ ID NOs: 1, 3, 5, 7 and 10 are added (Set A) and in another reaction, only COPS corresponding to SEQ ID NOs: 2, 4, 6, 8 and 9 are added (Set B).
  • Set A covers 52% of the RNA transcript/ armored RNA sequence while set B covers 48% of the RNA transcript/ armored RNA sequence.
  • RNA stability in the absence of COPS or in the presence of Set A COPS or Set B COPS can be compared by determining the Ct values of each reaction by RT-PCR as described in Example 3.
  • Example 5 RNA stability after extended incubation
  • RNA transcript and armored RNA samples were prepared as in Example 2 except that the armored RNA was prepared at 1500 copies per microliter. COPS were then added to the samples at a final concentration of 0, 0.1, 1 or ⁇ and the samples were incubated at 4°C, 37°C or 45°C for 12 weeks. Determination of RNA stability by RT-PCR was performed as described in Example 3. Stability was significantly improved with the presence of COPS for both unarmored and armored RNA at 37°C and 45°C incubation.
  • Figure 4 shows the results of the RT-PCR growth curves for the unarmored RNA template.
  • Accuplex (SeraCare Life Sciences, Milford MA) is a recombinant technology capable of encapsulating an RNA molecule of interest inside a replication-deficient mammalian viruslike particle that contains both a protein coat and lipid bilayer.
  • the RNA control sequence, pEF070 which was used to design and prepare the complementary oligonucleotides described in Example 1 was provided to SeraCare for custom preparation of Accuplex-encapsulated single-stranded RNA. COPS were then added to the Accuplex- RNA samples at ⁇ concentration and the samples were incubated at 4°C, 37°C or 45°C for 71 days.
  • RNA stability by RT-PCR was performed as described in Example 3 and the results of the study are shown in FIG. 6. After 71 days of incubation, the ACp value between absence and presence of COPS was 4.3 (30.9-26.6) for 37°C and 8.3 (35.3-27.0) for 45°C, clearly showing the effectiveness of COPS in reducing degradation of RNA in Accuplex particles that are stored at high temperature.
  • Example 7 COPS stabilization of HIV RNA templates
  • RNA sequences corresponding to segments of the HIV-1 GAG, HIV-1 LTR, and HIV- 2 LTR regions were used as RNA templates for testing the stabilizing effects of their corresponding COPS.
  • the 25 oligonucleotides varied in length between 17 and 26 bases and their sequences are shown in Table 2.
  • RNA templates 35 TTATTAAGAGGTCTTTAAGCAAGCA HIV-2 LTR Two stability studies were performed.
  • armored RNA templates were used at 100 copies per microliter in Tris.HCl (pH 7.0) containing 100 mM KCl.
  • COPS corresponding to SEQ ID NOs: 11-35 were then added to the samples at a final concentration of 0 or lOnM and the samples were incubated at 4°C, 37°C or 45°C for 15 weeks.
  • RT-PCR with primers corresponding to the three RNA templates was performed using the conditions described in Example 3. The results of the study are shown in Table 3 and clearly demonstrates that the presence of COPS greatly stabilized both RNA templates.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Engineering & Computer Science (AREA)
  • Analytical Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
PCT/EP2016/082696 2015-12-28 2016-12-27 Generic method for the stabilization of specific rna Ceased WO2017114823A1 (en)

Priority Applications (5)

Application Number Priority Date Filing Date Title
CA3009716A CA3009716C (en) 2015-12-28 2016-12-27 Generic method for the stabilization of specific rna
JP2018533890A JP6880034B2 (ja) 2015-12-28 2016-12-27 特異的rnaの安定化のための汎用法
CN201680069920.6A CN108291252B (zh) 2015-12-28 2016-12-27 稳定特定rna的通用方法
ES16828748T ES2886605T3 (es) 2015-12-28 2016-12-27 Procedimiento genérico para la estabilización de ARN específico
EP16828748.0A EP3397775B1 (en) 2015-12-28 2016-12-27 Generic method for the stabilization of specific rna

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201562271614P 2015-12-28 2015-12-28
US62/271,614 2015-12-28

Publications (1)

Publication Number Publication Date
WO2017114823A1 true WO2017114823A1 (en) 2017-07-06

Family

ID=57838332

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2016/082696 Ceased WO2017114823A1 (en) 2015-12-28 2016-12-27 Generic method for the stabilization of specific rna

Country Status (7)

Country Link
US (1) US10689689B2 (enExample)
EP (1) EP3397775B1 (enExample)
JP (1) JP6880034B2 (enExample)
CN (1) CN108291252B (enExample)
CA (1) CA3009716C (enExample)
ES (1) ES2886605T3 (enExample)
WO (1) WO2017114823A1 (enExample)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP4461817A3 (en) * 2018-02-06 2025-01-22 Gen-Probe Incorporated Far-red dye probe formulations
JP7434742B2 (ja) * 2019-07-22 2024-02-21 株式会社島津製作所 核酸の検出方法
GB2594317B (en) * 2020-04-23 2022-05-25 Univ Johannesburg Witwatersrand SARS-CoV-2 Diagnostic control compositions

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5861250A (en) * 1993-12-06 1999-01-19 Pna Diagnostics A/S Protecting nucleic acids and methods of analysis
US5939262A (en) * 1996-07-03 1999-08-17 Ambion, Inc. Ribonuclease resistant RNA preparation and utilization
US20110009466A1 (en) * 2007-08-29 2011-01-13 President And Fellows Of Harvard College Methods of increasing gene expression through rna protection
US20120052502A1 (en) * 2010-08-30 2012-03-01 Samsung Techwin Co., Ltd. Real-time pcr detection using stabilized probes
US20150232846A1 (en) * 2013-08-16 2015-08-20 Rana Therapeutics, Inc. Pseudocircularization oligonucleotides for modulating rna
US20150267192A1 (en) * 2012-06-08 2015-09-24 Shire Human Genetic Therapies, Inc. Nuclease resistant polynucleotides and uses thereof

Family Cites Families (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5210015A (en) * 1990-08-06 1993-05-11 Hoffman-La Roche Inc. Homogeneous assay system using the nuclease activity of a nucleic acid polymerase
PT726962E (pt) * 1991-12-23 2006-10-31 Chiron Corp Sondas para hiv para uso em ensaios de hibridacao em sanduiche em fase de solucao
US5853990A (en) * 1996-07-26 1998-12-29 Edward E. Winger Real time homogeneous nucleotide assay
AU3117101A (en) * 2000-01-28 2001-08-07 Scripps Research Inst Synthetic internal ribosome entry sites and methods of identifying same
EP2240606B1 (en) * 2008-01-14 2016-10-12 Applied Biosystems, LLC Compositions, methods, and kits for detecting ribonucleic acid
CA2976576A1 (en) * 2015-02-13 2016-08-18 Translate Bio Ma, Inc. Compositions and methods for modulating rna

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5861250A (en) * 1993-12-06 1999-01-19 Pna Diagnostics A/S Protecting nucleic acids and methods of analysis
US5939262A (en) * 1996-07-03 1999-08-17 Ambion, Inc. Ribonuclease resistant RNA preparation and utilization
US20110009466A1 (en) * 2007-08-29 2011-01-13 President And Fellows Of Harvard College Methods of increasing gene expression through rna protection
US20120052502A1 (en) * 2010-08-30 2012-03-01 Samsung Techwin Co., Ltd. Real-time pcr detection using stabilized probes
US20150267192A1 (en) * 2012-06-08 2015-09-24 Shire Human Genetic Therapies, Inc. Nuclease resistant polynucleotides and uses thereof
US20150232846A1 (en) * 2013-08-16 2015-08-20 Rana Therapeutics, Inc. Pseudocircularization oligonucleotides for modulating rna

Also Published As

Publication number Publication date
JP6880034B2 (ja) 2021-06-02
ES2886605T3 (es) 2021-12-20
EP3397775A1 (en) 2018-11-07
CA3009716A1 (en) 2017-07-06
EP3397775B1 (en) 2021-06-30
CN108291252A (zh) 2018-07-17
CN108291252B (zh) 2022-05-13
JP2019506849A (ja) 2019-03-14
US10689689B2 (en) 2020-06-23
CA3009716C (en) 2021-11-02
US20170183720A1 (en) 2017-06-29

Similar Documents

Publication Publication Date Title
KR102295290B1 (ko) Dna 증폭 기술
US10358675B2 (en) Oligonucleotides for controlling amplification of nucleic acids
EP3397775B1 (en) Generic method for the stabilization of specific rna
CN105705660B (zh) 使用重叠引物和熔解探针检测单核苷酸多态性
EP3538674B1 (en) Compositions and methods for detection of bk virus
US20240240273A1 (en) Compositions and Methods for Detecting Hepatitis Delta Virus by a Dual-Target Assay
US20170356025A1 (en) Internal control probes for improving pcr assay performance
US20170283888A1 (en) Use of rnase h for the selective amplification of viral dna
EP3469102B1 (en) Compositions and methods for detection of hepatitis c virus genotype 3
JP5774990B2 (ja) 蛍光標識及び可溶性消光体を使用する標的変異体の検出
EP3494227B1 (en) Helper oligonucleotide for improving efficiency of amplification and detection/quantitation of nucleic acids
JP7628085B2 (ja) 鎖分離温度に基づくDNAに対してRNA標的の優先的/選択的増幅のためのdITPの利用
CA2705852C (en) Photoinduced electron transfer (pet) primer for nucleic acid amplification
WO2024141476A1 (en) Digital pcr assay designs for multiple hepatitis b virus gene targets and non-extendable blocker oligonucleotides therefor

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16828748

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 3009716

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2018533890

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE