WO2017095271A1 - Method for the molecular genetic detection of mycobacterium tuberculosis resistance to second-line anti-tuberculosis drugs (fluoroquinolines, aminoglycosides and capreomycin) - Google Patents

Method for the molecular genetic detection of mycobacterium tuberculosis resistance to second-line anti-tuberculosis drugs (fluoroquinolines, aminoglycosides and capreomycin) Download PDF

Info

Publication number
WO2017095271A1
WO2017095271A1 PCT/RU2016/050051 RU2016050051W WO2017095271A1 WO 2017095271 A1 WO2017095271 A1 WO 2017095271A1 RU 2016050051 W RU2016050051 W RU 2016050051W WO 2017095271 A1 WO2017095271 A1 WO 2017095271A1
Authority
WO
WIPO (PCT)
Prior art keywords
resistance
gene
mutations
tuberculosis
detection
Prior art date
Application number
PCT/RU2016/050051
Other languages
French (fr)
Russian (ru)
Inventor
Сергей Альбертович КИРЬЯНОВ
Татьяна Александровна ЛЕВИНА
Наталия Юрьевна МАКАРОВА
Анатолий Петрович СУСЛОВ
Евгения Николаевна САМОХИНА
Андрей Викторович ШАНЬКО
Original Assignee
Общество С Ограниченной Ответственностью "Энджентикс"
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Общество С Ограниченной Ответственностью "Энджентикс" filed Critical Общество С Ограниченной Ответственностью "Энджентикс"
Publication of WO2017095271A1 publication Critical patent/WO2017095271A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids

Definitions

  • the proposed model relates to medicine, in particular to the field of treatment of tuberculosis, and relates to a method for detecting mutations based on real-time multiplex PCR technology for rapid determination of the resistance of tuberculosis mycobacteria (MBT) in biological samples to second-line anti-tuberculosis drugs, such as fluoroquinolones (ofloxacin, moxifloxacin) and reserve-type injectable anti-TB drugs (kanamycin, amikacin and capreomycin) (hereinafter referred to as second-line drugs).
  • fluoroquinolones ofloxacin, moxifloxacin
  • second-type injectable anti-TB drugs kanamycin, amikacin and capreomycin
  • Tuberculosis is one of the most significant global health security concerns. Despite the general tendency for a decrease in the incidence of tuberculosis, the share of tuberculosis in the structure of mortality of the population of Russia from infectious and parasitic diseases remains the main, and amounts to about 56.0% according to 2012 data (Nechaeva O.V., Biragova OK 2013 Epidemic situation with tuberculosis in the Russian Federation [Electronic resource]. URL: http://vestnik.mednet.ru/content/view/514/30/lang, w / (accessed 11.26.2015)).
  • tuberculosis - tuberculosis with resistance to anti-TB drugs PTP
  • PTP anti-TB drugs
  • MDR MDR multidrug-resistant tuberculosis
  • XDR extensively drug-resistant tuberculosis
  • Tuberculosis with MDR and XDR is difficult to treat with existing anti-TB drugs; treatment requires long-term (18-24 months) complex and expensive treatment that causes serious side effects (Haydel SE Extensively Drug-Resistant Tuberculosis: A Sign of the Times and an Impetus for Antimicrobial Discovery Pharmaceuticals (Basel). 2010 Jul 1; 3 (7): 2268-2290).
  • the set of drugs of choice in the case of drug-resistant tuberculosis is significantly limited, therefore, a quick and accurate diagnosis of the sensitivity of MVT to PTP, in particular to reserve drugs, is especially relevant.
  • XDR treatment for tuberculosis is extremely long and costly.
  • the analysis of drug resistance of MBT is mainly carried out by cultivation methods with antibiotics in a dense and / or liquid nutrient medium.
  • the analysis of drug resistance to MBT using these methods is extremely long, and takes from 1 to 3 months from the start of the study of diagnostic material to the treatment of the patient.
  • the analysis of resistance to second-line drugs is possible only in an extremely limited number of laboratories.
  • the main drugs of choice in the treatment of MDR-MBT are fluoroquinolone drugs, such as ofloxacin, moxifloxacin, levofloxacin and others, which have shown high activity against Mycobacterium tuberculosis complex with MDR [Chan E.D et al. Treatment and outcome analysis of 205 patients with multidrug-resistant tuberculosis // AJRCCM. - 2004. - p.26].
  • DNA gyrase ATP-dependent type II DNA topoisomerase
  • the gyrA gene also contains neutral polymorphism at codon 95. According to sequencing data, the substitution at codon 95 causes the coding of either serine (AGC) in M. tuberculosis H37Rv and H37Ra strains, or threonine (ACC) in M. tuberculosis Beiging, Erdman, M.
  • the A1401G substitution in the rrs gene is most common in kanamycin-resistant strains, and leads to the highest levels of kanamycin resistance with a minimum inhibitory concentration (MIC)> 80 ⁇ g / ml and cross-resistance to amikacin and capreomycin (17.
  • MIC minimum inhibitory concentration
  • Maus CE, Plikaytis BB, Shinnick TM Molecular analysis of cross-resistance to capreomycin, kanamycin, amikacin, and viomycin in Mycobacterium tuberculosis. Antimicrob Agents Chemother. 2005 Aug; 49 (8): 3192-3197).
  • This mutation is the most diagnostically significant, because was found in more than 84% of Beijing MBT strains resistant to kanamycin (KAN).
  • the A1401G mutation also leads to cross-resistance to amikacin and capreomycin in approximately 50% resistant to AMA and ATS strains. [Electronic resource]. URL: (http://www.ncbi.nlm.nih.gov/pubmed/23948547 (accessed date 26.1 01.2015). Mutations of resistance to kanamycin and amikacin at positions 514 and 517 of the rrs gene are more rare, and were identified mainly in MBT strains of non-Beijing origin.
  • the eis gene encodes the Eis acetyltransferase, which specifically acetylates kanamycin and amikacin, but the rate of acetylation kanamycin is significantly higher, which explains the lack of cross-resistance to amikacin in strains with mutations in the promoter region of the eis gene. um to repeated increase its expression and therefore to the accumulation of the enzyme and its build-up effect, i.e., to ultimately to the inactivation of the antibiotic.
  • the -37 mutation of the eis gene occurs with a frequency of more than 8% only in kanamycin-resistant XDR strains of Beijing origin that do not carry other mutations in the eis gene or mutation 1401 of the rrs gene. Therefore, the -37 mutation of the eis gene is an independent marker of kanamycin resistance.
  • the detection of resistance mutations in the eis gene can increase the overall detectability of kanamycin resistance in XDR strains from the current 58-63% to 82-87%.
  • Determination of known, mainly, point mutations associated with resistance to fluoroquinolones and reserve drugs (kanamycin, amikacin, and capreomycin) using molecular genetic detection and analysis methods can provide rapid diagnostics of MBT resistance to PTP.
  • Existing molecular genetic methods for determining the resistance or sensitivity of MBTs to specific PTPs are based on the detection of known mutations in MBT genes by PCR amplification, in particular real-time PCR amplification.
  • PCR amplification generates the required number of copies of the studied DNA, after which mutations are detected using one of such detection methods as: multiplex PCR analysis with hybridization probes, allele-specific PCR analysis, hybridization on chips or strips, analysis by melting curves, conformational analysis of single-chain fragments in denaturing gradient gel electrophoresis, etc.
  • detection methods as: multiplex PCR analysis with hybridization probes, allele-specific PCR analysis, hybridization on chips or strips, analysis by melting curves, conformational analysis of single-chain fragments in denaturing gradient gel electrophoresis, etc.
  • Victor T. C Jordan AM Detection of mutation in drug resistance genes of M. tuberculosis by a dot-blot hibridization strategy // Int. J. Tubercle and Lung Disease. - 1999. - V.2. - P.346-349; 23. Ramaswamy S, Musser J. Molecular genetic basis of antimicrobial agent resistance in M.
  • PCR analysis along with the advantages have a common disadvantage, which consists in using them only for scientific research purposes and in highly qualified and equipped laboratories.
  • the method of sequencing including pyrosequencing, has not yet been introduced into the practice of molecular genetic diagnostics to determine mutations of resistance to PTP, due to its high cost and low productivity.
  • the prototype of the invention is a method for determining mutations in the GroV gene, which are responsible for the resistance of MBT to rifampicin and isoniazid by multiplex PCR amplification using hybridization probes (L. Welebob, publication WO2013132447 A1 dated 09/12/2013), where multiplex PCR is understood as reactions under the same temperature conditions with simultaneous amplification and detection of targets, in this case, nucleotide substitutions at certain positions of the MBT genes.
  • oligonucleotide probes are used that are complementary to the regions of the GroV, katG genes and the promoter region of the inhA gene, to detect mutations resistance to first-line antibiotics, rifampicin and isoniazid.
  • the prototype does not report all PCR reactions in the same temperature regime and effective hybridization of probes to matrices (amplicons).
  • the present invention relates to a method for determining the resistance of mycobacterium tuberculosis to second-line anti-TB drugs, characterized in that the method comprises the simultaneous detection of mutations in the DNA of mycobacteria of a biological sample, leading to microorganism resistance to second-line anti-TB drugs in the regions of the gyrA, gyrB, rrs and promoter genes eis regions by real-time multiplex polymerase chain reaction using primers for amplification and detecting rows that are complementary to portions of said genes gyrA, gyrB, rrs promoter region and eis, where the second-line drugs are fluoroquinolones, aminoglycosides and capreomycin.
  • fluoroquinolones are ofloxacin, moxifloxacin, levofloxacin, and aminoglycosides are, in particular, kanamycin and amikacin.
  • all detection reactions of mutations of resistance to second-line anti-TB drugs are carried out in one temperature amplification mode.
  • the biological sample is directly a material of a clinical sample or a pre-grown culture of microorganisms.
  • the clinical specimen is sputum, exudate, flush or broncho-alveolar lavage.
  • the method is carried out for more than one biological sample.
  • the gene regions are selected from the group comprising codons 89, 90, 91 and 94 of the gyrA gene, codons 539 and 540 of the gyrB gene, positions 1401, 514 and 517 of the rrs gene, positions -10, -12 and -37 of the promoter region eis gene or combinations thereof.
  • the detection probes are 19-23 nucleotide oligonucleotide sequences labeled with fluorophores and quenchers, used to detect mutations in codons 89, 90, 91 and 94 of the arcA gene and in codons 539 and 540 of the arcV gene to detect mutations of resistance to fluoroquinolones.
  • the detection probes are 24-29 nucleotide oligonucleotide sequences labeled with fluorophores and quenchers, used to detect mutations at positions -10, -12 and -37 of the promoter region of the eis gene to detect mutations in resistance to kanamycin, amikacin and / or capreomycin.
  • said detection probes are 19-20 nucleotide oligonucleotide sequences used to detect mutations at positions 1401, 514 and 517 of the rrs gene to detect mutations of resistance to kanamycin, amikacin and / or capreomycin.
  • the probes include the nucleotide sequences shown in SEQ ID NOs: 7-14, 17-19, 26-31, or combinations thereof.
  • the amplification primers include the nucleotide sequences shown in SEQ ID NOs: 1-6, 15 and 16, 16, 20-25, or combinations thereof.
  • the present invention also relates to the use of the method of the invention to confirm the clinical diagnosis of extensively drug-resistant tuberculosis.
  • the present invention relates to a set of detection probes for implementing the method according to the invention, in which these probes include nucleotide sequences selected from those presented in SEQ ID NO: 7-14, 17-19, 26-31, or combinations thereof.
  • the present invention relates to a set of amplification primers for carrying out the method according to the invention, wherein said primers include nucleotide sequences selected from the group consisting of those presented in SEQ ID NOs: 1-6, 15, 16, 20-25, or a combination thereof .
  • the present invention provides a method for the rapid and reliable detection of resistance to antituberculosis drugs of mutant forms of mycobacterium tuberculosis by simultaneously detecting mutations in the arcs of arcs and arcs, rrs and eis during multiplex PCR amplification with a set of hybridization probes, further analysis according to the curves of accumulation of specific products reactions, simple and unambiguous interpretation of the results.
  • the technical result of the present invention is the simultaneous and rapid determination of the resistance of mycobacterium tuberculosis of biological samples to fluoroquinolones and injectable anti-TB drugs of a backup series with high detectability of mutations in the DNA of biological samples (in particular, more than 90% of mutations of resistance to fluoroquinolones and more than 82% of mutations of resistance to kanamycin , amikacin and capreomycin in clinical sputum samples).
  • tuberculosis mycobacteria can be carried out not only on DNA isolated from grown MBT cultures, but also isolated directly from clinical samples (sputum, bronchoalveolar lavage (BAL)) obtained from patients with different forms of tuberculosis.
  • the technical result is the ability to quickly analyze large amounts of DNA samples of mycobacterium tuberculosis for the presence of genotypic resistance to both second-line fluoroquinolones and the reserve series (kanamycin, amikacin and capreomycin), in particular, up to sixty-eight samples per 96-well PCR -plash, as well as the possibility of simultaneously setting two reaction mixtures to determine the resistance to fluoroquinolones and injectable anti-TB drugs of the reserve series, which only ko is limited by the capacity of a 96-well PCR plate.
  • the reserve series kanamycin, amikacin and capreomycin
  • An additional technical result is the possibility of detecting mutations in closely located codons of the 89, 90, 91, and 94 regions of the gyrA gene to determine the resistance of MBT strains to fluoroquinolones by conducting multiplex PCR amplification using a minimum number of only two hybridization probes, complementary or one, or both chains of the analyzed DNA region, selected for hybridization in one temperature regime.
  • a technical result of the invention is the introduction into the method for determining the resistance of tuberculosis mycobacteria of an additional detection target corresponding to mutations at positions -10, -12 and -37 in the promoter region of the eis gene, which is a new target for detecting mutations of resistance to kanamycin, amikacin and / or capreomycin .
  • the method for determining the resistance of tuberculosis mycobacteria according to the invention using hybridization probes to both strands of the target DNA, is quite reproducible, low-cost, and allows the detection of mutations in both DNA fragments under study, which simplifies and speeds up the result.
  • the method according to the present invention is safe, sufficiently affordable to carry out in a specialized laboratory and more fast compared to methods for determining stability known in the art (less than one day).
  • Another technical result of the invention is the simplification and minimization of the number of necessary sequential steps during PCR analysis in one test tube and thus reducing the possible intralaboratory contamination.
  • the present invention relates to a method for determining the resistance of mycobacterium tuberculosis to second-line anti-TB drugs, characterized in that the method comprises the simultaneous detection of mutations in the DNA of mycobacteria of a biological sample, leading to microorganism resistance to second-line anti-TB drugs in the regions of the gyrA, gyrB, rrs and promoter genes eis regions by real-time multiplex polymerase chain reaction using primers for amplification and detecting rows that are complementary to portions of said genes gyrA, gyrB, rrs promoter region and eis, where the second-line drugs are fluoroquinolones, aminoglycosides and capreomycin.
  • Second-line anti-TB drugs are drugs that are used in tuberculosis patients who have tuberculosis mycobacteria resistance to first-line drugs.
  • Second and reserve anti-TB drugs are widely known in the art and are, for example, fluoroquinolones, aminoglycosides and the capreomycin polypeptide.
  • fluoroquinolones are ofloxacin, moxifloxacin, levofloxacin, and aminoglycosides are, in particular, kanamycin and amikacin.
  • the principle of the method according to the invention is based on the use of the process of multiplex PCR amplification of DNA, consisting in repeated cycles of temperature denaturation of one or more different DNA matrices, annealing of primers with complementary sequences and subsequent elongation of polynucleotide chains from these primers with Taq polymerase.
  • Hybridization probes containing fluorescent labels and quenchers are introduced into the mixture for amplification, which allow detection of wild-type genetic variants in codons 89, 90, 91 and 94 of the gyrA gene, in codons 539 and 540 of the gyrB gene, at positions 1401, 514 and 517 of the rrs gene, at positions - 10, -12 and -37 of the promoter region of the eis gene.
  • the nucleotide composition, size and orientation of the probes are selected in such a way as to ensure hybridization of all probes with the DNA matrix at the same temperature conditions.
  • the absence of a genetic mutation is judged by the presence of an accumulation curve with high efficiency of fluorescence growth with an exponential growth of the curve of a specific product with a fluorescence growth efficiency of at least 90%.
  • the absence of an accumulation curve or the low efficiency of the increase in fluorescence in a sample indicates the presence of a mutation of a certain type.
  • Positive wild-type controls indicate detection by a set of wild-type variants and can eliminate false-positive results. To simultaneously detect the presence or absence of mutations, all PCR amplification reactions are carried out in the same temperature regime. Positive mutation controls allow the detection of MTB samples containing mutations of a certain type and indicate the absence of false negative results. Negative controls exclude cross-contamination of samples and non-specific reactions. In samples not containing MTB DNA, the result should be negative.
  • the present invention allows for simultaneous
  • PCR detection of the presence or absence of mutations of resistance to fluoroquinolones and injectable anti-TB drugs immediately after isolation of MBT DNA from a biological sample simultaneously determining the presence or absence of mutations in twelve positions of four genes, and to reduce the percentage of false-negative results due to the detection of additional mutations (in particular, mutations at positions 89, 91 in the gyrA gene, positions 539 or 540 in the arcs gene and positions -37 in the promoter region of the eis gene), and also allows to reduce the cost of analysis and okratit the meeting.
  • the resistance of mycobacterium tuberculosis to second-line anti-TB drugs is determined simultaneously in portions of genes selected from the group consisting of codons 89, 90, 91 and 94 of the gyrA gene, codons 539 and 540 of the arc gene, positions 1401, 514 and 517 of the rrs gene , positions -10, -12 and -37 of the promoter region of the eis gene or a combination thereof.
  • the biological sample is directly the material of a clinical sample or a pre-grown culture of microorganisms.
  • the clinical specimen is sputum, exudate, flush or broncho-alveolar lavage.
  • the method according to the invention can be carried out for more than one biological sample, for example, for 45 or 68 samples, in fact, the number of samples per set is determined only by the capacity of a 96-well PCR machine and the possibility of simultaneously setting two reaction mixtures to determine resistance to fluoroquinolones and injectable anti-tuberculosis drugs reserve row (kanamycin, amikacin and capreomycin).
  • the number of samples per the setting is from several to 43-45 (depending on the number of controls) when setting for all mutations simultaneously (resistance to fluoroquinolones and to kanamycin, amikacin and capreomycin) for PCR machines with a 96-well plate
  • the number of samples can reach 91.
  • the present invention also relates to a method in which all reactions of detection of mutations of resistance to second-line anti-TB drugs are carried out in the same temperature amplification mode.
  • the optimal amplification mode was selected, which is the same for both reaction mixtures for the detection of resistance to fluoroquinolones and injectable anti-tuberculosis drugs of the reserve series (kanamycin, amikacin and capreomycin).
  • Primary denaturation and initialization conditions were selected depending on the choice of chemically modified Taq polymerase, such as AmpliTaqGold (Roche, US) or Taq DNA polymerase (MBI Fermentas), and were determined in the range of 6-12 min. at a temperature of 95 ° C-96 ° C.
  • the primer annealing temperature was selected using the Primer 3 primer selection program (version 0.4.0) in the range of 60 ° ⁇ - 64 ° ⁇ , with the optimum set to 62 ° ⁇ .
  • the hybridization temperature of probespecific probes was selected in the range of 64 ° C-67 ° C, with a given optimal temperature of 66 ° C-67 ° C.
  • the elongation time was taken in the range of 20-30 seconds. at a temperature of 72 ° C, which was determined by the range of amplicon lengths of 130-220 bp
  • a scheme for setting up multiplex PCR amplification using preamplification in the amount of at least nine to fifteen cycles without reading the detection signals, and the subsequent 30 -38 cycles with reading of the detection signals at elevated annealing temperature (65 ° ⁇ -67 ° ⁇ ).
  • amplification primers and detection probes that are complementary are used the indicated regions of the genes gyrA, arcs, rrs and eis.
  • Hybridization probes can detect and differentiate both mutant and wild types of pathogens, as well as closely located mutations of resistance to fluoroquinolones.
  • the probes can be complementary to regions of the gyrA, arcB, rrs, and eis genes that do not contain a mutation, but can also contain mutations when they are used to confirm specific mutations.
  • the proposed probes containing mutations are labeled with a different fluorophore, unlike probes that do not include a mutation in their sequence, i.e. wild type, in cases where it is important to check and confirm the presence of certain mutations, such as the main mutation of resistance to aminoglycosides and capreomycin a1401 g rrs or c-12t promoter region of the eis gene.
  • primers are used to amplify short specific fragments, amplicons of the gyrA and arcB genes (in the case of determination of resistance to fluoroquinolones) and the rrs gene and the promoter region of the eis gene (in the case of determination of resistance to kanamycin, amikacin and capreomycin) for specific PCR detection of sites of these genes with subsequent detection of the presence or absence of mutations of resistance to these antibiotics in the DNA samples of mycobacterium tuberculosis.
  • Detection probes are modified oligonucleotides, usually 18-27 nucleotides in length, which carry a fluorophore sewn to the 5'-end of the probe and a quencher sewn to the 3'-end.
  • the fluorescence of the probe, and hence the detection of the PCR amplification product, occurs during the PCR reaction after hybridization of the probe with complementary DNA regions, while the fluorophore emits a signal, and the quencher is spatially separated from the fluorophore only during hybridization and as a result of using Taq polymerase with 5 ' exonuclease activity.
  • said detection probes may be 19-23 nucleotide oligonucleotide sequences used to detect mutations in codons 89, 90, 91 and 94 of the gyrA gene and in codons 539 and 540 of the arc gene to detect mutations of resistance to fluoroquinolones.
  • these detection probes can be oligonucleotide sequences of 24-29 nucleotides in length used to detect mutations at positions -10, -12 and -37 of the promoter region of the eis gene to detect mutations of resistance to kanamycin, amikacin and / or capreomycin.
  • said detection probes are 19-20 nucleotide oligonucleotide sequences used to detect mutations at positions 1401, 514 and 517 of the rrs gene to detect mutations of resistance to kanamycin, amikacin and / or capreomycin. These oligonucleotide sequences can be labeled with fluorophores and quenchers.
  • pairs of primers and hybridization probes were selected to amplify specific fragments of the gyrA and arcs.
  • a PCR amplification program was selected for PCR reactions and probe hybridization in the same temperature regime, and a method was proposed for differentiating closely spaced single nucleotide substitutions with two probes in four codons of 89, 90, 91, and 94 gyrA genes.
  • primers were selected using the Primer3 and BioEdit computer programs.
  • Primers were selected for amplification of the gyrA gene region, flanking the gene region with codons 88-95, not more than 140 bp:
  • primers were selected that flank the gene region between codons 516 and 550:
  • hybridization probes were selected to perform multiplex PCR amplification together with the selected primers to detect mutations in codons 90-94 of the gyrA gene region.
  • the probes were withdrawn both in the forward and reverse directions to ensure hybridization in the temperature range: 64-67 ° C.
  • FL1 is a fluorophore that is independently selected and, in particular, is a fluorophore FAM.
  • probes for specific hybridization with codons 89-91 of the arc gene region optimized for hybridization temperature in the same temperature range of 64-67 ° C, are proposed as follows:
  • SEQ ID NO 9 90-91 FL2-TAGATCGACGCGTCGCCGT-BHQ2
  • FL2 is a fluorophore that is independently selected and, in particular, is a ROX fluorophore.
  • the principle of differential detection of the main mutations in the arcA gene is implemented in such a way that, for example, a mutation in the 94 codon of the arcA gene is detected by the absence of an accumulation curve for one fluorophore recognition channel, for example, FAM with the simultaneous presence of an accumulation curve for another fluorophore recognition channel, for example, ROX with the efficiency of the increase in fluorescence close to 100%.
  • Mutations in the codon of the 91A gene are detected by the simultaneous absence of accumulation curves through both fluorophore recognition channels.
  • codons 89 and 90 of the arc gene is determined by the presence of accumulation curves for both channels, for example, FAM and ROX, with an efficiency of fluorescence increase close to 100%.
  • Mutations in codon 94 are detected by the absence of an accumulation curve on the FAM channel with a fluorescence gain of less than 10%.
  • Mutations in codons 89 and 90 of the arc gene are detected by the presence of an accumulation curve along one channel, for example, FAM, with fluorescence growth efficiencies close to 100% and less than 40%, respectively, whereas the absence of a curve is characteristic for the other channels, for example, ROX accumulation.
  • the presence of polymorphism in codon 95 is also determined by hybridization with a probe complementary to region with codon 94, and is detected by the accumulation curve with a fluorescence growth efficiency close to 70%, which does not affect the ability to differentiate mutant and wild forms from codon 94.
  • our proposed option for detecting mutations in closely located codons of the 89, 90, 91, and 94 regions of the archA gene is ensured by multiplex PCR amplification using only two hybridization probes, complementary to one or both chains of the analyzed DNA region, but chosen for hybridization in one temperature range 64-67 ° ⁇ .
  • the approach used allows one to avoid detection of nearby single-nucleotide polymorphism in codon 95, thereby only detecting fluoroquinolone resistance mutations.
  • a hybridization probe specific for the gyrB gene site at positions 539-540, both direct and complementary, from the following group was also selected:
  • SEQ ID NO 1 1 FL3-TAAAGAACACCGAAGTTCAGGCG-BHQ1
  • SEQ ID NO 12 FL3-AAAGAACACCGAAGTTCAGGCG-BHQ1
  • SEQ ID NO 13 FL3-CGCCTGAACTTCGGTGTTCTTTA-BHQ1
  • SEQ ID NO 14 FL3-CGCCTGAACTTCGGTGTTCTTT-BHQ1
  • FL3 is a fluorophore that is independently selected and, in particular, is a HEX fluorophore.
  • SEQ ID NO 11 Preferred is SEQ ID NO 11, because provides the best detection of possible substitutions in any of the codons 539-540.
  • the next step was the development of a method for detecting resistance mutations in mycobacterium tuberculosis against injectable anti-tuberculosis drugs of the reserve series (kanamycin, amikacin and capreomycin).
  • the low GC composition and extent of the promoter region of the eis gene allows the use of multiplex PCR amplification with simultaneous use two hybridization probes against the site with positions -10 / -12 and against position -37 for detection of mutations of interest to us. Accordingly, to amplify a specific region of the promoter region of the eis gene, pairs of primers of the following composition were selected:
  • SEQ ID N0 15 Direct 5'-ATCGCGTGATCCTTTGCCAG-3 '
  • the species specificity of the selected primers was determined using a comparative analysis of the nucleotide sequences from the GenBank database using the BLAST program and e-PCR. It was found that there are no cross-reactions when using selected primers with DNA of other types of microorganisms and humans.
  • hybridization probes were selected to perform multiplex PCR amplification together with the selected primers to detect mutations at positions -10 and -12, as well as at position -37 of the promoter region of the eis gene.
  • the following probes with a hybridization temperature range of 65-67 ° C were selected:
  • SEQ ID NO 17 eis-10 FL1 - CATATGCCACAGTCGGATTCTGTGAC-BHQ1
  • SEQ ID NO 18 eis-12 mutant FL2-ATATGCCACAATCGGATTCTGTGACTGTG-BHQ1 where FL1 is a fluorophore that is independently selected and, in particular, is a fluorophore FAM;
  • FL2 is a fluorophore that is independently selected and, in particular, is a ROX fluorophore.
  • the probe SEQ ID NO 18, labeled with a different fluorophore allows you to detect only a mutant form with a mutation at position -12 of the promoter region of the eis gene in biological samples of mycobacterium tuberculosis.
  • a hybridization probe recognizing the wild-type variant at position -37 was selected as follows:
  • FL3 is a fluorophore that is independently selected and, in particular, is a HEX fluorophore.
  • the method of the invention can use standard amplification primers and detection probes that are known in the art (Suzuki YC et al. Detection of kanamycin-resistant Mycobacterium tuberculosis by identifying mutations in the 16S rRNA gene.// J. Clin. Microbiol. - 1998. - v. 36. - p. 1220-1225) and are used to determine the resistance to reserve drugs for the treatment of tuberculosis by the presence or absence of mutations in the rrs gene. But to achieve the best detectable TM, we created primers and probes, which are described in more detail below.
  • pairs of primers and hybridization of ion probes were selected to amplify specific fragments flanking these gene mutations.
  • SEQ ID NO 20 Direct 5'- CGCGAGGTTAAGCGAATCCTTA-3 '
  • SEQ ID NO 21 Direct 5'-GCGAGGTTAAGCGAATCCTTA-3 '
  • a pair of primers SEQ ID NO 21 and SEQ ID NO 22 turned out to be preferable.
  • Primers for the rrs gene region flanking mutations at positions 514 and 517 are not in the region of high conservatism.
  • the species specificity of the selected primers was also determined using a comparative analysis of the nucleotide sequences from the GenBank database using the program
  • a pair of primers of the following composition were selected:
  • SEQ ID NO 24 Direct 5'- CGAAGGTCCGGGTTCTCTCG -3 '
  • hybridization probes were selected for the multiplex PCR amplification with the selected primers to detect mutations in regions 514 and 517 of the rrs gene.
  • the probes were withdrawn both in the forward and reverse directions to ensure hybridization in the temperature range: 64-67 ° C.
  • 514 / 517for1, 514 / 517for2 indicates probes selected in the forward direction to detect mutations 514 and 517.
  • 514 / 517rev1 denotes probes selected in the reverse direction to detect mutations 514 and 517.
  • the preferred option was the probe SEQ ID NO 28, because provides better detection during hybridization with possible replacements in any of the positions a514c and c517t.
  • FL2 is a fluorophore that is independently selected and, in particular, is a ROX fluorophore.
  • the probe SEQ ID NO 31, labeled with another fluorophore allows only the mutant form with the a1401 g mutation to be detected in biological samples of tuberculosis mycobacteria.
  • primers were selected, specific hybridization probes for amplification (61-63 ° C) and detection in the same temperature regime (64-67 ° C) of mutations of resistance to fluoroquinolones and kanamycin, amikacin and capreomycin.
  • PCR conditions for all targets are as follows: 1st stage - 95 ° -6-8 min; 2nd stage - 95 ° - 15 sec, 62 ° - 20 sec, 72 ° - 25 sec (9 cycles); 3rd stage: 95 ° - 15 sec, 66-67 ° - 40 sec. (30-35 cycles in read mode).
  • the composition of the reaction buffer was also selected, in which the important components are the ratio of the number of introduced primers and probes, the concentration of triphosphates, and the concentration of magnesium ions.
  • the reaction volume of the multiplex mixture is 22-24 ⁇ l containing 10 mM Tris-HC1 pH 8.8 - 9.0; 50-70 mM KCI; 0.5% Tween 20, 1, 8-3.5 mM MgCI 2 , 3.0 - 4.0 units Taq polymerase, 200 ⁇ M of each nucleoside triphosphate, 5-9 pmol of each oligonucleotide primer and 5-10 pmol of probes contributed 12 ⁇ l of the DNA sample.
  • DNA was isolated from MBT cultures obtained on Middlebrook 7H9 liquid nutrient medium in the WASTEC MGIT 960 automated system (Becton Dickinson, United States), by heating at 95 ° ⁇ for 20 min in TE buffer with 1% Triton (pH 8.8).
  • the temperature regime of amplification was chosen uniform, both for arcs and for arcs: 1st stage - 95 ° - 6-8 min; 2nd stage - 95 ° - 15 sec, 62 ° - 20 sec, 72 ° - 25 sec (9 cycles); 3rd stage: 95 ° - 15 sec, 66 ° - 40 sec (35 cycles - in read mode).
  • the present invention also relates to a set of detection probes for implementing the method of the invention, wherein said probes include nucleotide sequences selected from the group consisting of those presented in SEQ ID NOs: 7-14, 17-19, 26-31, or a combination thereof.
  • the present invention relates to a set of amplification primers for implementing the method according to any one of paragraphs. 1 -1 1, in which these primers include nucleotide sequences selected from the group consisting of those presented in SEQ ID NO: 1 -6, 15, 16, 20-25, or a combination thereof.
  • kits may also include instructions for use in a method for determining the resistance of Mycobacterium tuberculosis to second and reserve row anti-TB drugs.
  • PCR analysis was performed using 10-12 ⁇ l of purified DNA, isolated from each isolate by magnetic particle sorption with a commercial Promega kit, which was added to a 2-fold reaction mixture (final volume 24 ⁇ l) containing 5-6 pmol of each primer, 5 -10 pmol of each probe, 2.5 mm MgCI 2 , 3 units Taq DNA polymerase (MBI Fermentas), and 200 microM each of dNTP.
  • PCR reactions were performed on a DT-96 thermocycler (DNA technology, RF) under identical conditions according to the protocol with preamplification: 1st stage - 95 ° - 6 min; 2nd stage - 95 ° - 15 sec, 62 ° - 20 sec, 72 ° - 25 sec (9 cycles); 3rd stage: 95 ° - 15 sec, 66 ° - 40 sec (30 cycles with reading).
  • the results of the detection of mutations of resistance to fluoroquinolones by the proposed method and verification by sequencing of some isolates are presented in Table 2. Sequencing revealed a polymorphism with the replacement of the S95T amino acid in both fluoroquinolone-resistant and sensitive samples. However, during PCR detection by the proposed method, this polymorphism did not interfere with these closely spaced mutations in codon 94.
  • Wl wild type; S is sensitive; R is resistant.
  • PCR analysis was performed using 10-12 ⁇ l of purified DNA, isolated from isolates by magnetic particle sorption with a commercial Promega kit, which was added to a 2-fold reaction mixture (final volume 24 ⁇ l) containing 5-6 pmol of each of the primers, 5- 10 pmol of each probe, 2.5 mm MgCI 2 , 3 units Taq DNA polymerase (MBI Fermentas), and 200 microM each of dNTP.
  • PCR reactions were performed on a DT-96 thermocycler (DNA technology, RF) under identical conditions according to the protocol with preamplification: 1st stage - 95 ° - 6 min; 2nd stage - 95 ° - 15 sec, 62 ° - 20 sec, 72 ° - 25 sec (9 cycles); 3rd stage: 95 ° - 15 sec, 66 ° - 40 sec (30 cycles with reading).
  • the results of the detection of resistance to kanamycin, amikacin and capreomycin obtained by cultivating bacterial cultures, the proposed method of MPCR and sequencing are presented in table 3.
  • Table 3 The results of PCR determination of resistance or sensitivity to kanamycin, amikacin and capreomycin in DNA samples of monocultures cultured on Bactec MGIT 960 liquid media with kanamycin, amikacin and capreomycin at a concentration of 30 mg / l.
  • PCR analysis was carried out using 10-12 ⁇ l of purified DNA isolated from isolates by sorption on magnetic particles with a commercial Promega kit, which added to a 2-fold reaction mixture (final volume 24 ⁇ l) containing 5-6 pmol of each of the primers, 5-10 pmol of each probe, 2.5 mm MgCI 2 , 3 units Taq DNA polymerase (MBI Fermentas), and 200 microM each of dNTP.
  • the total duration of amplification was 1 hour 30 minutes.
  • the diagnostic sensitivity for the detection of ofloxacin resistance was 91.2% (31/34), while the diagnostic sensitivity for injectable anti-tuberculosis drugs was 82.4% (28/34), which is higher than the existing commercial test systems, such as GenoType MTBDRp / us / GenoType MTBDRs /, due to the lack of detection of mutations in the promoter region of the eis gene.
  • the contribution of mutations in the promoter region of the eis gene at positions –10, –12, and –37 was about 39% among all XDR samples, if we take into account that mutations c517t and a514c of the rrs gene were also found in some of them.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Plant Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention relates to the field of medicine and concerns a method for detecting resistance to second-line anti-tuberculosis drugs in Mycobacterium tuberculosis, where said method includes the simultaneous detection of DNA mutations in Mycobacterium tuberculosis in biological samples, causing resistance of the microorganisms to second-line anti-tuberculosis drugs, in regions of the genes gyrA, gyrB, rrs and in the promoter region of eis by means of a real-time multiplex polymerase chain reaction using amplification primers and detection probes which are complementary to the aforesaid regions of the genes gyrA, gyrB, rrs and to the promoter region of eis. The invention also relates to a set of detection probes and amplification primers for carrying out the method. The invention further relates to the use of said method for confirming a clinical diagnosis of multi-drug resistant tuberculosis. The invention provides, with high mutation detectability, for the simultaneous and rapid detection of resistance to fluoroquinolones, aminoglycosides and capreomycin in Mycobacterium tuberculosis in biological samples.

Description

СПОСОБ МОЛЕКУЛЯРНО-ГЕНЕТИЧЕСКОЙ ДЕТЕКЦИИ УСТОЙЧИВОСТИ МИКОБАКТЕРИЙ ТУБЕРКУЛЕЗА К ПРОТИВОТУБЕРКУЛЕЗНЫМ ПРЕПАРАТАМ ВТОРОГО РЯДА (ФТОРХИНОЛОНАМ, АМИНОГЛИКОЗИДАМ И КАПРЕОМИЦИНУ) Область техники  METHOD FOR MOLECULAR GENETIC DETECTION OF THE RESISTANCE OF TUBERCULOSIS MYCOBACTERIA TO TERMS OF THE SECOND RANGE (FLUORQUINOLONES, AMINOGLYCOSIDES AND CAPREOMES)
Предлагаемая модель относится к области медицины, в частности к области лечения туберкулеза, и касается способа детекции мутаций на основе технологии мультиплексной ПЦР в режиме реального времени для экспресс-определения устойчивости микобактерий туберкулеза (МВТ) в биологических образцах к противотуберкулезным препаратам второго ряда, таким как фторхинолоны (офлоксацин, моксифлоксацин) и инъекционные противотуберкулезные препараты резервного ряда (канамицин, амикацин и капреомицин) (далее - препараты второго ряда).  The proposed model relates to medicine, in particular to the field of treatment of tuberculosis, and relates to a method for detecting mutations based on real-time multiplex PCR technology for rapid determination of the resistance of tuberculosis mycobacteria (MBT) in biological samples to second-line anti-tuberculosis drugs, such as fluoroquinolones (ofloxacin, moxifloxacin) and reserve-type injectable anti-TB drugs (kanamycin, amikacin and capreomycin) (hereinafter referred to as second-line drugs).
Уровень техники  State of the art
Туберкулез является одной из наиболее существенных проблем глобальной безопасности в области здравоохранения. Несмотря на общую тенденцию снижения заболеваемости туберкулезом, доля туберкулеза в структуре смертности населения России от инфекционных и паразитарных болезней остается основной, и составляет около 56,0% по данным на 2012 г. (Нечаева О. В., Бирагова O.K. 2013 Эпидемическая ситуация по туберкулезу в Российской Федерации [Электронный ресурс]. URL: http://vestnik.mednet.ru/content/view/514/30/lang, ш/ (дата обращения 26.11.2015)).  Tuberculosis is one of the most significant global health security concerns. Despite the general tendency for a decrease in the incidence of tuberculosis, the share of tuberculosis in the structure of mortality of the population of Russia from infectious and parasitic diseases remains the main, and amounts to about 56.0% according to 2012 data (Nechaeva O.V., Biragova OK 2013 Epidemic situation with tuberculosis in the Russian Federation [Electronic resource]. URL: http://vestnik.mednet.ru/content/view/514/30/lang, w / (accessed 11.26.2015)).
В последнее время возникла угроза распространения крайне опасной формы туберкулеза - туберкулеза с устойчивостью к противотуберкулезным препаратам (ПТП), таким как рифампицин и изониазид, известной как туберкулез с множественной лекарственной устойчивостью (МВТ МЛУ) (WHO. Global Tuberculosis Control, 2011). Эпидемиологическая ситуация еще более усугубляется распространением туберкулеза с широкой лекарственной устойчивостью (ШЛУ), т.е. сочетанием МЛУ с устойчивостью, по крайней мере, к одному из препаратов фторхинолонового ряда и одному из инъекционных ПТП резервного ряда (канамицин, амикацин и капреомицин). Ежегодно в мире регистрируется более 30000 новых ШЛУ случаев. Более того, появились данные о случаях абсолютно устойчивого туберкулеза, т.е. формы, устойчивой ко всем существующим на сегодняшний день противотуберкулезным препаратам (Fattorini L, Migliori G.B., Cassone А. 2007. Extensively drug-resistant (XDR) tuberculosis: an old and new threat. - Ann. 1st. Super. Sanita, 43 (4), p.317-319; Haydel S.E. 2010. Extensively Drug- Resistant Tuberculosis: A Sign of the Times and an impetus for Antimicrobial Discovery.- NIH Public Access Author Manuscript. Pharmaceuticals (Basel), V.3 (7), p.2268-2290).  Recently, there has been a threat of the spread of an extremely dangerous form of tuberculosis - tuberculosis with resistance to anti-TB drugs (PTP), such as rifampicin and isoniazid, known as multidrug-resistant tuberculosis (MDR MDR) (WHO. Global Tuberculosis Control, 2011). The epidemiological situation is further exacerbated by the spread of extensively drug-resistant tuberculosis (XDR), i.e. a combination of MDR with resistance to at least one of the drugs of the fluoroquinolone series and one of the injection PTP of the reserve series (kanamycin, amikacin and capreomycin). More than 30,000 new XDR cases are registered worldwide each year. Moreover, there are data on cases of absolutely resistant tuberculosis, i.e. form resistant to all existing anti-TB drugs (Fattorini L, Migliori GB, Cassone A. 2007. Extensively drug-resistant (XDR) tuberculosis: an old and new threat. - Ann. 1st. Super. Sanita, 43 (4 ), p.317-319; Haydel SE 2010. Extensively Drug- Resistant Tuberculosis: A Sign of the Times and an impetus for Antimicrobial Discovery.- NIH Public Access Author Manuscript Pharmaceuticals (Basel), V.3 (7), p .2268-2290).
Основной причиной ухудшения эпидемиологической обстановки по туберкулезу, устойчивому к ПТП, является широкая географическая распространенность высоковирулентных и высокотрансмиссивных лекарственно-устойчивых штаммов М. Tuberculosis генотипов Beijing (Lopez В. et al. 2003 A marked difference in pathogenesis and immune response induced by different Mycobacterium tuberculosis genotypes. Clin Exp Immunol. 2003 Jul; 133(1 ):30-7; Нарвская О. В., Мокроусов И. В., Лимещенко Е.В. и др. Молекулярная эпидемиология туберкулеза // БЦЖ. -2000. N°7-8. - С.4-6; Нарвская О. В., Мокроусов И. В., Лимещенко Е.В. и др. Молекулярно-генетическая характеристика микобактерий туберкулеза, выделенных в Северо-Западном регионе России // Туберкулез сегодня: проблемы и перспективы. М., 2000. - С.210-21 ). The main reason for the deterioration in the epidemiological situation of TB-resistant tuberculosis is the wide geographical distribution of highly virulent and highly transmissible drug-resistant strains of M. Tuberculosis of the Beijing genotypes (B. Lopez et al. 2003 A marked difference in pathogenesis and immune response induced by different Mycobacterium tuberculosis genotypes. Clin Exp Immunol. 2003 Jul; 133 (1): 30-7; Narvskaya O.V., Mokrousov I.V., Limeshchenko E.V. et al. Molecular epidemiology of tuberculosis // BCG. -2000. N ° 7-8. - C.4-6; Narvskaya O.V., Mokrousov I.V., Limeshchenko E.V. et al. Molecular genetic characteristics of tuberculosis mycobacteria isolated in the North-West region of Russia // Tuberculosis today: problems and prospects. M., 2000 .-- S.210-21).
Туберкулез с МЛУ и ШЛУ плохо поддается лечению существующими ПТП, для лечения требуется проведение длительной (18-24 месяца) комплексной дорогостоящей терапии, вызывающей серьезные побочные эффекты (Haydel S.E. Extensively Drug- Resistant Tuberculosis: A Sign of the Times and an Impetus for Antimicrobial Discovery. Pharmaceuticals (Basel). 2010 Jul 1 ; 3 (7): 2268-2290). Набор препаратов выбора в случае лекарственно-устойчивого туберкулеза существенно ограничен, поэтому особенно актуальна быстрая и точная диагностика чувствительности МВТ к ПТП, в частности к препаратам резервного ряда. Кроме того, лечение ШЛУ туберкулеза крайне длительно и дорогостояще.  Tuberculosis with MDR and XDR is difficult to treat with existing anti-TB drugs; treatment requires long-term (18-24 months) complex and expensive treatment that causes serious side effects (Haydel SE Extensively Drug-Resistant Tuberculosis: A Sign of the Times and an Impetus for Antimicrobial Discovery Pharmaceuticals (Basel). 2010 Jul 1; 3 (7): 2268-2290). The set of drugs of choice in the case of drug-resistant tuberculosis is significantly limited, therefore, a quick and accurate diagnosis of the sensitivity of MVT to PTP, in particular to reserve drugs, is especially relevant. In addition, XDR treatment for tuberculosis is extremely long and costly.
Таким образом, проблема устойчивости МВТ к лекарственным препаратам создает большую угрозу для борьбы с туберкулезом и остается предметом серьезной озабоченности в отношении глобальной безопасности в области здравоохранения.  Thus, the problem of resistance of MVT to drugs poses a great threat to the fight against tuberculosis and remains a matter of serious concern for global health security.
Анализ лекарственной устойчивости МВТ в основном проводится методами культивирования с антибиотиками на плотной и/или жидкой питательной среде. Проведение анализа на лекарственную устойчивость МВТ данными методами крайне длительно, и занимает от 1 до 3 месяцев от начала исследования диагностического материала и до лечения больного. При этом анализ устойчивости к препаратам второго ряда возможен только в крайне ограниченном числе лабораторий.  The analysis of drug resistance of MBT is mainly carried out by cultivation methods with antibiotics in a dense and / or liquid nutrient medium. The analysis of drug resistance to MBT using these methods is extremely long, and takes from 1 to 3 months from the start of the study of diagnostic material to the treatment of the patient. Moreover, the analysis of resistance to second-line drugs is possible only in an extremely limited number of laboratories.
Основными препаратами выбора при лечении МЛУ-МБТ являются препараты фторхинолонового ряда, такие как: офлоксацин, моксифлоксацин, левофлоксацин и другие, которые показали высокую активность в отношении микобактерий туберкулезного комплекса с МЛУ [Chan E.D et al. Treatment and outcome analysis of 205 patients with multidrug-resistant tuberculosis // AJRCCM. - 2004. - p.26].  The main drugs of choice in the treatment of MDR-MBT are fluoroquinolone drugs, such as ofloxacin, moxifloxacin, levofloxacin and others, which have shown high activity against Mycobacterium tuberculosis complex with MDR [Chan E.D et al. Treatment and outcome analysis of 205 patients with multidrug-resistant tuberculosis // AJRCCM. - 2004. - p.26].
По литературным данным отмечены случаи первичной устойчивости МВТ к препаратам фторхинолоного ряда [Delgado М.В., Telenti A. In: Selected PCR protocols for Emerging Infectious Diseases / Persing D.H, ed., Washington, 1996], что подчеркивает актуальность своевременного определения резистентности МВТ к данной группе препаратов, особенно до начала лечения.  According to the literature, there have been cases of primary resistance of MBT to fluoroquinolone drugs [Delgado M.V., Telenti A. In: Selected PCR protocols for Emerging Infectious Diseases / Persing DH, ed., Washington, 1996], which emphasizes the relevance of timely determination of resistance of MVT to this group of drugs, especially before treatment.
Мишенью действия фторхинолонов в МВТ является АТФ-зависимая ДНК- топоизомераза II типа (ДНК-гираза), которая катализирует образование суперспирали ДНК [Blanchard J. S. Molecular mechanisms of drug resistance in Mycobacterium tuberculosis // Annu. Rev. Biochem. - 1996. - V.65. - P.215-239], и состоит из двух субъединиц GyrA и двух субъединиц GyrB [Chen FJ, Lo HJ (2003) Molecular mechanisms of fluoroquinolone resistance. J Microbiol Immunol Infect 36: 1-9.] . Мутации в участке гена gyrA, ограниченного кодонами 88 и 94, который обусловливает резистентность МВТ к фторхинолонам (главным образом, к офлоксацину и моксифлоксацину) в 64%- 79% штаммов МВТ Пекинского происхождения. Превалирующими мутациями, вызывающими кросс- резистентность к фторхинолонам, являются замены в кодоне 94G и 90V гена gyrA [Maruri F et al. 2012 [Электронный ресурс]. URL: http://www.ncbi.nlm.nih.gov/pubmed/22279180 (дата обращения 26.1 1.2015), Singh Р et al. 2015 [Электронный ресурс]. URL: http://www.ncbi.nlm.nih.gov/pubmed/25052485/ (дата обращения 26.1 1 .2015); Willby М. et al. 2015 Correlation between GyrA mutations and ofloxacin, levofloxacin and moxifloxacin cross- resistance in Mycobacterium tuberculosis]. Ген gyrA содержит также нейтральный полиморфизм в кодоне 95. По данным секвенирования замена в кодоне 95 обуславливает кодирование либо серина (AGC) в штаммах М. tuberculosis H37Rv и H37Ra, либо треонина (АСС) в М. tuberculosis Beiging, Erdman, M.bovis BCG, M.africanum. Однако данные замены не связаны с резистентностью к фторхинолонам [Takiff Н.Е et al. Cloning and nucleotide sequence of Mycobacterium tuberculosis gyrA and gyrB genes and detected of quinolone resistance mutations // Antimicrob. Agents a Chemotherapy. - 1994. - V.38. - p.773- 780]. Следовательно детекция данного полиморфизма S95T предложенная в некоторых диагностикумах, например, в биочипах [Zimenkov D. et al. 2013 Detection of second-line drug resistance in Mycobacterium tuberculosis using oligonucleotide microarrays] может приводить к ложноположительным результатам. The target of the action of fluoroquinolones in MVT is ATP-dependent type II DNA topoisomerase (DNA gyrase), which catalyzes the formation of DNA supercoiled [Blanchard JS Molecular mechanisms of drug resistance in Mycobacterium tuberculosis // Annu. Rev. Biochem. - 1996. - V.65. - P.215-239], and consists of two subunits of GyrA and two subunits of GyrB [Chen FJ, Lo HJ (2003) Molecular mechanisms of fluoroquinolone resistance. J Microbiol Immunol Infect 36: 1-9.]. Mutations in the region of the gyrA gene limited by codons 88 and 94, which determines the resistance of MBT to fluoroquinolones (mainly ofloxacin and moxifloxacin) in 64% - 79% of MBT strains of Beijing origin. The prevailing mutations causing cross-resistance to fluoroquinolones are substitutions in the codon 94G and 90V of the gyrA gene [Maruri F et al. 2012 [Electronic resource]. URL: http://www.ncbi.nlm.nih.gov/pubmed/22279180 (accessed 26.1 01.2015), Singh P et al. 2015 [Electronic resource]. URL: http://www.ncbi.nlm.nih.gov/pubmed/25052485/ (access date 26.1 1 .2015); Willby M. et al. 2015 Correlation between GyrA mutations and ofloxacin, levofloxacin and moxifloxacin cross-resistance in Mycobacterium tuberculosis]. The gyrA gene also contains neutral polymorphism at codon 95. According to sequencing data, the substitution at codon 95 causes the coding of either serine (AGC) in M. tuberculosis H37Rv and H37Ra strains, or threonine (ACC) in M. tuberculosis Beiging, Erdman, M. bovis BCG M.africanum. However, these substitutions are not associated with resistance to fluoroquinolones [Takiff N.E. et al. Cloning and nucleotide sequence of Mycobacterium tuberculosis gyrA and gyrB genes and detected of quinolone resistance mutations // Antimicrob. Agents a Chemotherapy. - 1994. - V.38. - p. 773-780]. Therefore, the detection of this S95T polymorphism proposed in some diagnostics, for example, in biochips [Zimenkov D. et al. 2013 Detection of second-line drug resistance in Mycobacterium tuberculosis using oligonucleotide microarrays] may lead to false positive results.
Мутации в гене gyrB встречаются в 5-10% фторхинолон-устойчивых штаммов, причем только три мутации в кодонах N538D, T539N, E540V, определяют устойчивость микобактерий туберкулеза ко всем фторхинолонам [13. Singh Р et al.2015, 16. S. Malik et al. 2012 [Электронный ресурс]. URL: http://journals.plos.org/plosone/article?id=10.1371/journal. pone.0039754 (дата обращения 26.1 1 .2015)].  Mutations in the gyrB gene are found in 5-10% of fluoroquinolone-resistant strains, and only three mutations in codons N538D, T539N, E540V determine the resistance of tuberculosis mycobacteria to all fluoroquinolones [13. Singh P et al. 2015, 16. S. Malik et al. 2012 [Electronic resource]. URL: http://journals.plos.org/plosone/article?id=10.1371/journal. pone.0039754 (accessed date 26.1 1 .2015)].
Также известно о механизме развития устойчивости МВТ к инъекционным противотуберкулезным препаратам (канамицин, амикацин и капреомицин) через возникновение мутации в рибосомальном гене 16S-pPHK (rrs) в позициях 1401 , 514 и 517 (16.S. Georghiou et al. 2012 Evaluation of Genetic Mutations Associated with Mycobacterium tuberculosis Resistance to Amikacin, Kanamycin and Capreomycin: A Systematic Review. PLoS One. 2012; 7(3): e33275).  The mechanism of the development of MBT resistance to injectable anti-TB drugs (kanamycin, amikacin and capreomycin) through the occurrence of a mutation in the 16S-pPHK (rrs) ribosomal gene at positions 1401, 514 and 517 (16.S. Georghiou et al. 2012 Evaluation of Genetic Mutations Associated with Mycobacterium tuberculosis Resistance to Amikacin, Kanamycin and Capreomycin: A Systematic Review. PLoS One. 2012; 7 (3): e33275).
Замена A1401G в гене rrs наиболее часто встречается в канамицин-устойчивых штаммах, и приводит к наиболее высокому уровню устойчивости к канамицину с минимальной ингибирующей концентрацией (MIC) >80 мкг/мл и кросс-резистентности к амикацину и капреомицину (17. Maus СЕ, Plikaytis ВВ, Shinnick ТМ. Molecular analysis of cross-resistance to capreomycin, kanamycin, amikacin, and viomycin in Mycobacterium tuberculosis. Antimicrob Agents Chemother. 2005 Aug; 49 (8): 3192-3197). Данная мутация является наиболее диагностически значимой, т.к. была обнаружена в более чем 84% Пекинских штаммах МБТ, устойчивых к канамицину (KAN). Кроме того, мутация A1401G также приводит к кросс-устойчивости к амикацину и капреомицину в приблизительно около 50% устойчивых к АМК и САР штаммах. [Электронный ресурс]. URL: (http://www.ncbi.nlm.nih.gov/pubmed/23948547 (дата обращения 26.1 1.2015) . Мутации устойчивости к канамицину и амикацину в позициях 514 и 517 гена rrs являются более редкими, и были выявлены в основном в штаммах МБТ непекинского происхождения. The A1401G substitution in the rrs gene is most common in kanamycin-resistant strains, and leads to the highest levels of kanamycin resistance with a minimum inhibitory concentration (MIC)> 80 μg / ml and cross-resistance to amikacin and capreomycin (17. Maus CE, Plikaytis BB, Shinnick TM, Molecular analysis of cross-resistance to capreomycin, kanamycin, amikacin, and viomycin in Mycobacterium tuberculosis. Antimicrob Agents Chemother. 2005 Aug; 49 (8): 3192-3197). This mutation is the most diagnostically significant, because was found in more than 84% of Beijing MBT strains resistant to kanamycin (KAN). In addition, the A1401G mutation also leads to cross-resistance to amikacin and capreomycin in approximately 50% resistant to AMA and ATS strains. [Electronic resource]. URL: (http://www.ncbi.nlm.nih.gov/pubmed/23948547 (accessed date 26.1 01.2015). Mutations of resistance to kanamycin and amikacin at positions 514 and 517 of the rrs gene are more rare, and were identified mainly in MBT strains of non-Beijing origin.
Влияние мутаций в промоторной области гена eis на развитие устойчивости МБТ к невысоким дозам канамицина было показано М.А. Zaunbrecher и соавт. в 2009 году (Zaunbrecher MA, Sikes RD Jr, Metchock В et al. Overexpression of the chromosomally encoded aminoglycoside acetyltransf erase eis confers kanamycin resistance in Mycobacterium tuberculosis. Proc Natl Acad Sci USA. 2009 Nov 24; 106 (47): 20004-20009 [Электронный ресурс]. URL: http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2785282/ (дата обращения 26.1 1.2015). Ген eis кодирует ацетилтрансферазу Eis, которая специфически ацетилирует канамицин и амикацин, однако скорость ацетилирования канамицина значительно выше, что объясняет отсутствие перекрестной устойчивости к амикацину у штаммов с мутациями в промоторной области гена eis. Появление мутаций в промоторной области гена приводит к многократному увеличению его экспрессии и, следовательно, к накоплению фермента и нарастанию его эффекта, т.е., в конечном счете, к инактивации антибиотика.  The effect of mutations in the promoter region of the eis gene on the development of MBT resistance to low doses of kanamycin was shown by M.A. Zaunbrecher et al. in 2009 (Zaunbrecher MA, Sikes RD Jr, Metchock B et al. Overexpression of the chromosomally encoded aminoglycoside acetyltransf erase eis confers kanamycin resistance in Mycobacterium tuberculosis. Proc Natl Acad Sci USA. 2009 Nov 24; 106 (47): 20004-2000 [Electronic resource]. URL: http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2785282/ (accessed 26.1 January 2015). The eis gene encodes the Eis acetyltransferase, which specifically acetylates kanamycin and amikacin, but the rate of acetylation kanamycin is significantly higher, which explains the lack of cross-resistance to amikacin in strains with mutations in the promoter region of the eis gene. um to repeated increase its expression and therefore to the accumulation of the enzyme and its build-up effect, i.e., to ultimately to the inactivation of the antibiotic.
Встречаемость мутаций в позициях -10, -12 и -14 промоторной области eis в канамицин-устойчивых штаммах оценивается в некоторых работах не выше 10% [M.Gicalo et al. 2012 [Электронный ресурс]. URL: http://jac.oxfordjournals.Org/content/67/9/2107.long (дата обращения 26.11.2015)]. Мутация в позиции -37 гена eis была обнаружена в некоторых штаммах МБТ, однако диагностическая значимость данной мутации устойчивости к канамицину ранее не обсуждалось [Casali N. et al. 2012]. По нашим данным мутация -37 гена eis встречается с частотой более 8% только в канамицин-устойчивых штаммах ШЛУ Пекинского происхождения, не несущих другие мутации в гене eis или мутацию 1401 гена rrs. Следовательно, мутация -37 гена eis является независимым маркером устойчивости к канамицину.  The occurrence of mutations at positions -10, -12, and -14 of the eis promoter region in kanamycin-resistant strains is estimated in some studies to be no higher than 10% [M. Gicalo et al. 2012 [Electronic resource]. URL: http://jac.oxfordjournals.Org/content/67/9/2107.long (accessed 11/26/2015)]. A mutation at position -37 of the eis gene was found in some MBT strains, however, the diagnostic significance of this mutation of resistance to kanamycin was not previously discussed [Casali N. et al. 2012]. According to our data, the -37 mutation of the eis gene occurs with a frequency of more than 8% only in kanamycin-resistant XDR strains of Beijing origin that do not carry other mutations in the eis gene or mutation 1401 of the rrs gene. Therefore, the -37 mutation of the eis gene is an independent marker of kanamycin resistance.
Таким образом, детекция мутаций устойчивости в гене eis может повысить общую выявляемость устойчивости к канамицину в штаммах ШЛУ с текущих 58-63% до 82-87%.  Thus, the detection of resistance mutations in the eis gene can increase the overall detectability of kanamycin resistance in XDR strains from the current 58-63% to 82-87%.
Определение известных, в основном, точковых мутаций, ассоциированных с устойчивостью к фторхинолонам и препаратам резервного ряда (канамицин, амикацин и капреомицин), методами молекулярно-генетической детекции и анализа в состоянии обеспечить экспресс-диагностику устойчивости МБТ к ПТП. Существующие молекулярно-генетические методы определения устойчивости или чувствительности МБТ к конкретным ПТП основаны на детекции известных мутаций в генах МБТ методом ПЦР-амплификации, в частности ПЦР-амплификацией в режиме реального времени. ПЦР-амплификацией нарабатывается необходимое количество копий исследуемой ДНК, после чего мутации детектируют с помощью одного из таких методов детекции, как: мультиплексный ПЦР-анализ с гибридизационными зондами, аллель-специфический ПЦР-анализ, гибридизация на чипах или стрипах, анализ по кривым плавления, конформационный анализ одноцепочечных фрагментов в денатурирующим градиентным гель-электрофорезом и др. (Victor Т. С, Jordan A.M. Detection of mutation in drug resistance genes of M.tuberculosis by a dot-blot hibridization strategy // Int. J.Tubercle and Lung Disease. - 1999. - V.2. - P.346-349; 23. Ramaswamy S, Musser J. Molecular genetic basis of antimicrobial agent resistance in M.tuberculosis// Tubercle and Lung Disease. - 1998 - V.79 - P.3-29). Сейчас все перечисленные методы, за исключением ПЦР-анализа, наряду с преимуществами обладают общим недостатком, который заключается в применении их только для научно-исследовательских целей и в условиях высококвалифицированных и оснащенных лабораторий. По той же причине в практику молекулярно-генетической диагностики по определению мутаций устойчивости к ПТП до сих пор не внедрен метод секвенирования, в том числе пиросеквенирования, в силу высокой стоимости и низкой производительности. Determination of known, mainly, point mutations associated with resistance to fluoroquinolones and reserve drugs (kanamycin, amikacin, and capreomycin) using molecular genetic detection and analysis methods can provide rapid diagnostics of MBT resistance to PTP. Existing molecular genetic methods for determining the resistance or sensitivity of MBTs to specific PTPs are based on the detection of known mutations in MBT genes by PCR amplification, in particular real-time PCR amplification. PCR amplification generates the required number of copies of the studied DNA, after which mutations are detected using one of such detection methods as: multiplex PCR analysis with hybridization probes, allele-specific PCR analysis, hybridization on chips or strips, analysis by melting curves, conformational analysis of single-chain fragments in denaturing gradient gel electrophoresis, etc. (Victor T. C, Jordan AM Detection of mutation in drug resistance genes of M. tuberculosis by a dot-blot hibridization strategy // Int. J. Tubercle and Lung Disease. - 1999. - V.2. - P.346-349; 23. Ramaswamy S, Musser J. Molecular genetic basis of antimicrobial agent resistance in M. tuberculosis // Tubercle and Lung Disease. - 1998 - V.79 - P.3-29). Now all of the above methods, with the exception of PCR analysis, along with the advantages have a common disadvantage, which consists in using them only for scientific research purposes and in highly qualified and equipped laboratories. For the same reason, the method of sequencing, including pyrosequencing, has not yet been introduced into the practice of molecular genetic diagnostics to determine mutations of resistance to PTP, due to its high cost and low productivity.
Молекулярно-генетические методы на основе ПЦР-анализа и соответствующие тест-системы (Xpert, GenoType MTBDRplus /GenoType MTBDRsl и др.) успешно внедряются в лабораторную диагностику туберкулеза, и являются перспективными как с позиции высокой диагностической чувствительности, высокой производительности (число анализов за постановку), так и по эксплуатационным характеристикам, и быстродействию (несколько часов). Однако ни в одной из современных тест-систем не реализована возможность детекции мутаций в гене eis, чтобы выявлять все известные на сегодня мутации устойчивости к канамицину, амикацину и капреомицину. Кроме того, ни в одном из предлагаемых способов на основе ПЦР-амплификации не реализован вариант детекции мутаций в близко расположенных кодонах 89, 90, 91 и 94 участка гена gyrA.  Molecular genetic methods based on PCR analysis and the corresponding test systems (Xpert, GenoType MTBDRplus / GenoType MTBDRsl, etc.) are successfully implemented in the laboratory diagnosis of tuberculosis, and are promising from the standpoint of high diagnostic sensitivity, high productivity (number of analyzes per formulation ), and in terms of performance and speed (several hours). However, in none of the modern test systems, the ability to detect mutations in the eis gene has been implemented to detect all mutations of resistance to kanamycin, amikacin, and capreomycin that are currently known. In addition, none of the proposed methods based on PCR amplification does not implement the option of detecting mutations in closely spaced codons 89, 90, 91 and 94 of the gyrA gene.
Прототипом предлагаемого изобретения является способ определения мутаций в гене гроВ, ответственных за резистентность МБТ к рифампицину и изониазиду методом мультиплексной ПЦР-амплификации с использованием гибридизационных зондов (L. Welebob, публикация WO2013132447 А1 от 12.09.2013), где под мультиплексной ПЦР понимается одновременное проведение нескольких реакций в одних температурных условиях с одновременным амплифицированием и детекцией мишеней, в данном случае нуклеотидных замен в определенных позициях генов МБТ.  The prototype of the invention is a method for determining mutations in the GroV gene, which are responsible for the resistance of MBT to rifampicin and isoniazid by multiplex PCR amplification using hybridization probes (L. Welebob, publication WO2013132447 A1 dated 09/12/2013), where multiplex PCR is understood as reactions under the same temperature conditions with simultaneous amplification and detection of targets, in this case, nucleotide substitutions at certain positions of the MBT genes.
В прототипе применяются только олигонуклеотидные зонды, комплементарные участкам генов гроВ, katG и промоторной области гена inhA, для детекции мутаций устойчивости к антибиотикам первого ряда, рифампицину и изониазиду. В прототипе нет информации о принципах подбора зондов для проведения ПЦР-детекции мутаций устойчивости к фторхинолонам и инъекционным противотуберкулезным препаратам резервного ряда (канамицину, амикацину и капреомицину). В прототипе не сообщается о проведении всех ПЦР-реакций в одном температурном режиме и эффективной гибридизации зондов к матрицам (ампликонам). In the prototype, only oligonucleotide probes are used that are complementary to the regions of the GroV, katG genes and the promoter region of the inhA gene, to detect mutations resistance to first-line antibiotics, rifampicin and isoniazid. In the prototype there is no information on the principles of selection of probes for PCR detection of mutations of resistance to fluoroquinolones and injectable anti-TB drugs of the reserve series (kanamycin, amikacin and capreomycin). The prototype does not report all PCR reactions in the same temperature regime and effective hybridization of probes to matrices (amplicons).
Таким образом, существует потребность в простом способе определения устойчивости микобактерий туберкулеза к препаратам второго ряда путем детекции всех известных диагностически значимых мутаций устойчивости к указанным препаратам.  Thus, there is a need for a simple method for determining the resistance of Mycobacterium tuberculosis to second-line drugs by detecting all known diagnostically significant mutations of resistance to these drugs.
Сущность изобретения  SUMMARY OF THE INVENTION
Настоящее изобретение относится к способу определения устойчивости микобактерий туберкулеза к противотуберкулезным препаратам второго ряда, отличающийся тем, что указанный способ включает одновременную детекцию мутаций в ДНК микобактерий биологического образца, приводящих к устойчивости микроорганизмов к противотуберкулезным препаратам второго ряда в участках генов gyrA, gyrB, rrs и промоторной области eis посредством мультиплексной полимеразной цепной реакции в режиме реального времени с использованием праймеров для амплификации и зондов детекции, которые комплементарны указанным участкам генов gyrA, gyrB, rrs и промоторной области eis, где противотуберкулезные препараты второго ряда представляют собой фторхинолоны, аминогликозиды и капреомицин.  The present invention relates to a method for determining the resistance of mycobacterium tuberculosis to second-line anti-TB drugs, characterized in that the method comprises the simultaneous detection of mutations in the DNA of mycobacteria of a biological sample, leading to microorganism resistance to second-line anti-TB drugs in the regions of the gyrA, gyrB, rrs and promoter genes eis regions by real-time multiplex polymerase chain reaction using primers for amplification and detecting rows that are complementary to portions of said genes gyrA, gyrB, rrs promoter region and eis, where the second-line drugs are fluoroquinolones, aminoglycosides and capreomycin.
В частности, фторхинолоны представляют собой офлоксацин, моксифлоксацин, левофлоксацин, а аминогликозиды представляют собой, в частности, канамицин и амикацин.  In particular, fluoroquinolones are ofloxacin, moxifloxacin, levofloxacin, and aminoglycosides are, in particular, kanamycin and amikacin.
В предпочтительном варианте осуществления изобретения все реакции детекции мутаций устойчивости к противотуберкулезным препаратам второго ряда осуществляется в одном температурном режиме амплификации.  In a preferred embodiment of the invention, all detection reactions of mutations of resistance to second-line anti-TB drugs are carried out in one temperature amplification mode.
В следующем варианте осуществления изобретения биологический образец представляет собой непосредственно материал клинического образца или предварительно выращенную культуру микроорганизмов.  In a further embodiment of the invention, the biological sample is directly a material of a clinical sample or a pre-grown culture of microorganisms.
В предпочтительном варианте осуществления изобретения клинический образец представляет собой мокроту, экссудат, смыв или бронхо-альвеолярный лаваж.  In a preferred embodiment, the clinical specimen is sputum, exudate, flush or broncho-alveolar lavage.
В еще одном варианте осуществления изобретения способ проводят для более чем одного биологического образца.  In yet another embodiment of the invention, the method is carried out for more than one biological sample.
Согласно следующему варианту осуществления изобретения участки генов выбраны из группы, включающей кодоны 89, 90, 91 и 94 гена gyrA, кодоны 539 и 540 гена gyrB, позиции 1401 , 514 и 517 гена rrs, позиции -10, -12 и -37 промоторной области гена eis или их комбинации. В другом варианте осуществления изобретения зонды детекции представляют собой олигонуклеотидные последовательности длиной 19-23 нуклеотида, меченные флуорофорами и гасителями, применяемые для детекции мутаций в кодонах 89, 90, 91 и 94 гена дугА и в кодонах 539 и 540 гена дугВ для выявления мутаций устойчивости к фторхинолонам. According to a further embodiment of the invention, the gene regions are selected from the group comprising codons 89, 90, 91 and 94 of the gyrA gene, codons 539 and 540 of the gyrB gene, positions 1401, 514 and 517 of the rrs gene, positions -10, -12 and -37 of the promoter region eis gene or combinations thereof. In another embodiment, the detection probes are 19-23 nucleotide oligonucleotide sequences labeled with fluorophores and quenchers, used to detect mutations in codons 89, 90, 91 and 94 of the arcA gene and in codons 539 and 540 of the arcV gene to detect mutations of resistance to fluoroquinolones.
В следующем варианте осуществления изобретения зонды детекции представляют собой олигонуклеотидные последовательности длиной 24-29 нуклеотида, меченные флуорофорами и гасителями, применяемые для детекции мутаций в позициях -10, -12 и -37 промоторной области гена eis для выявления мутаций устойчивости к канамицину, амикацину и/или капреомицину.  In a further embodiment, the detection probes are 24-29 nucleotide oligonucleotide sequences labeled with fluorophores and quenchers, used to detect mutations at positions -10, -12 and -37 of the promoter region of the eis gene to detect mutations in resistance to kanamycin, amikacin and / or capreomycin.
В еще одном варианте осуществления изобретения указанные зонды детекции представляют собой олигонуклеотидные последовательности длиной 19-20 нуклеотида, применяемые для детекции мутаций в позиции 1401 , 514 и 517 гена rrs для выявления мутаций устойчивости к канамицину, амикацину и /или капреомицину.  In another embodiment of the invention, said detection probes are 19-20 nucleotide oligonucleotide sequences used to detect mutations at positions 1401, 514 and 517 of the rrs gene to detect mutations of resistance to kanamycin, amikacin and / or capreomycin.
В предпочтительном варианте осуществления изобретения указанные зонды включают нуклеотидные последовательности, представленные в SEQ ID NO:7-14, 17-19, 26-31 или их комбинации.  In a preferred embodiment, the probes include the nucleotide sequences shown in SEQ ID NOs: 7-14, 17-19, 26-31, or combinations thereof.
В следующем предпочтительном варианте осуществления праймеры для амплификации включают нуклеотидные последовательности, представленные в SEQ ID NO: 1 -6, 15 и 16, 16, 20-25 или их комбинации.  In a further preferred embodiment, the amplification primers include the nucleotide sequences shown in SEQ ID NOs: 1-6, 15 and 16, 16, 20-25, or combinations thereof.
Настоящее изобретение также относится к применению способа по изобретению для подтверждения клинического диагноза туберкулеза с широкой лекарственной устойчивостью.  The present invention also relates to the use of the method of the invention to confirm the clinical diagnosis of extensively drug-resistant tuberculosis.
Дополнительно, настоящее изобретение относится к набору зондов детекции для осуществления способа по изобретению, в котором указанные зонды включают нуклеотидные последовательности, выбранные из представленных в SEQ ID NO:7-14, 17- 19, 26-31 или их комбинации.  Additionally, the present invention relates to a set of detection probes for implementing the method according to the invention, in which these probes include nucleotide sequences selected from those presented in SEQ ID NO: 7-14, 17-19, 26-31, or combinations thereof.
Кроме того, настоящее изобретение относится к набору праймеров амплификации для осуществления способа по изобретению, в котором указанные праймеры включают нуклеотидные последовательности, выбранные из группы, состоящей из представленных в SEQ ID NO: 1-6, 15, 16, 20-25 или их комбинации.  In addition, the present invention relates to a set of amplification primers for carrying out the method according to the invention, wherein said primers include nucleotide sequences selected from the group consisting of those presented in SEQ ID NOs: 1-6, 15, 16, 20-25, or a combination thereof .
Согласно настоящему изобретению предложен способ быстрой и надежной детекции устойчивости к противотуберкулезным препаратам мутантных форм микобактерий туберкулеза за счет одновременного выявления мутаций в генах дугА и дугВ, rrs и eis в ходе проведения мультиплексной ПЦР-амплификации с набором гибридизационных зондов, дальнейшего анализа по кривым накопления специфичных продуктов реакции, простой и однозначной интерпретации результатов. Техническим результатом настоящего изобретения является одновременное и быстрое определение устойчивости микобактерий туберкулеза биологических образцов к фторхинолонам и инъекционным противотуберкулезным препаратам резервного ряда с высокой выявляемостью мутаций в ДНК биологических образцов (в частности, более 90% обнаружения мутаций устойчивости к фторхинолонам и более 82% мутаций устойчивости к канамицину, амикацину и капреомицину в клинических образцах мокроты). Важным является также то, что определение устойчивости микобактерий туберкулеза можно проводить не только на ДНК, выделенной из выросших культур МВТ, но также выделенной непосредственно из клинических образцов (мокрота, бронхоальвеолярный лаваж (БАЛ)), полученных от больных разными формами туберкулеза. The present invention provides a method for the rapid and reliable detection of resistance to antituberculosis drugs of mutant forms of mycobacterium tuberculosis by simultaneously detecting mutations in the arcs of arcs and arcs, rrs and eis during multiplex PCR amplification with a set of hybridization probes, further analysis according to the curves of accumulation of specific products reactions, simple and unambiguous interpretation of the results. The technical result of the present invention is the simultaneous and rapid determination of the resistance of mycobacterium tuberculosis of biological samples to fluoroquinolones and injectable anti-TB drugs of a backup series with high detectability of mutations in the DNA of biological samples (in particular, more than 90% of mutations of resistance to fluoroquinolones and more than 82% of mutations of resistance to kanamycin , amikacin and capreomycin in clinical sputum samples). It is also important that the determination of the resistance of tuberculosis mycobacteria can be carried out not only on DNA isolated from grown MBT cultures, but also isolated directly from clinical samples (sputum, bronchoalveolar lavage (BAL)) obtained from patients with different forms of tuberculosis.
Также техническим результатом является возможность быстрого анализа больших количеств образцов ДНК микобактерий туберкулеза на наличие генотипической устойчивости как к препаратам второго ряда фторхинолонам, так и резервного ряда (канамицин, амикацин и капреомицин), в частности, до шестидесяти восьми образцов за постановку на 96-луночной ПЦР-плашке, а также возможность одновременной постановки двух реакционных смесей на определение устойчивости к фторхинолонам и инъекционным противотуберкулезным препаратам резервного ряда, что только ограничивается емкостью 96-луночной ПЦР-плашки.  Also, the technical result is the ability to quickly analyze large amounts of DNA samples of mycobacterium tuberculosis for the presence of genotypic resistance to both second-line fluoroquinolones and the reserve series (kanamycin, amikacin and capreomycin), in particular, up to sixty-eight samples per 96-well PCR -plash, as well as the possibility of simultaneously setting two reaction mixtures to determine the resistance to fluoroquinolones and injectable anti-TB drugs of the reserve series, which only ko is limited by the capacity of a 96-well PCR plate.
Дополнительным техническим результатом является возможность детекции мутаций в близко расположенных кодонах 89, 90, 91 и 94 участка гена gyrA для определения устойчивости штаммов МБТ к фторхинолонам при помощи проведения мультиплексной ПЦР-амплификации с использованием минимального числа, только двух гибридизационных зондов, комплементарных или одной, или обеим цепям анализируемого участка ДНК, выбранным для гибридизации в одном температурном режиме.  An additional technical result is the possibility of detecting mutations in closely located codons of the 89, 90, 91, and 94 regions of the gyrA gene to determine the resistance of MBT strains to fluoroquinolones by conducting multiplex PCR amplification using a minimum number of only two hybridization probes, complementary or one, or both chains of the analyzed DNA region, selected for hybridization in one temperature regime.
Также техническим результатом изобретения является введение в способ определения устойчивости микобактерий туберкулеза дополнительной мишени детекции, соответствующей мутациям в позициях -10, -12 и -37 в промоторной области гена eis, которая является новой мишенью для выявления мутаций устойчивости к канамицину, амикацину и /или капреомицину.  Also a technical result of the invention is the introduction into the method for determining the resistance of tuberculosis mycobacteria of an additional detection target corresponding to mutations at positions -10, -12 and -37 in the promoter region of the eis gene, which is a new target for detecting mutations of resistance to kanamycin, amikacin and / or capreomycin .
Дополнительно, способ определения устойчивости микобактерий туберкулеза по изобретению, использующий гибридизационные зонды к обеим цепям ДНК-мишени, является достаточно воспроизводимым, не требующим больших затрат и позволяющим выявлять мутации в обоих исследуемых фрагментах ДНК, что упрощает и ускоряет получение результата.  Additionally, the method for determining the resistance of tuberculosis mycobacteria according to the invention, using hybridization probes to both strands of the target DNA, is quite reproducible, low-cost, and allows the detection of mutations in both DNA fragments under study, which simplifies and speeds up the result.
Способ согласно настоящему изобретению является безопасным, достаточно доступным для проведения в условиях специализированной лаборатории и более быстрым по сравнению со способами определения устойчивости, известными из уровня техники (менее одного дня). The method according to the present invention is safe, sufficiently affordable to carry out in a specialized laboratory and more fast compared to methods for determining stability known in the art (less than one day).
Еще одним техническим результатом изобретения является упрощение и минимализация числа необходимых последовательных шагов при проведении ПЦР- анализа в одной пробирке и уменьшение таким образом возможной внутрилабораторной контаминации.  Another technical result of the invention is the simplification and minimization of the number of necessary sequential steps during PCR analysis in one test tube and thus reducing the possible intralaboratory contamination.
Подробное описание изобретения  DETAILED DESCRIPTION OF THE INVENTION
Настоящее изобретение относится к способу определения устойчивости микобактерий туберкулеза к противотуберкулезным препаратам второго ряда, отличающийся тем, что указанный способ включает одновременную детекцию мутаций в ДНК микобактерий биологического образца, приводящих к устойчивости микроорганизмов к противотуберкулезным препаратам второго ряда в участках генов gyrA, gyrB, rrs и промоторной области eis посредством мультиплексной полимеразной цепной реакции в режиме реального времени с использованием праймеров для амплификации и зондов детекции, которые комплементарны указанным участкам генов gyrA, gyrB, rrs и промоторной области eis, где противотуберкулезные препараты второго ряда представляют собой фторхинолоны, аминогликозиды и капреомицин.  The present invention relates to a method for determining the resistance of mycobacterium tuberculosis to second-line anti-TB drugs, characterized in that the method comprises the simultaneous detection of mutations in the DNA of mycobacteria of a biological sample, leading to microorganism resistance to second-line anti-TB drugs in the regions of the gyrA, gyrB, rrs and promoter genes eis regions by real-time multiplex polymerase chain reaction using primers for amplification and detecting rows that are complementary to portions of said genes gyrA, gyrB, rrs promoter region and eis, where the second-line drugs are fluoroquinolones, aminoglycosides and capreomycin.
Противотуберкулезные препараты второго ряда представляют собой препараты, которые применяются у больных туберкулезом, имеющих устойчивость микобактерий туберкулеза к препаратам первого ряда. Противотуберкулезные препараты второго и резервного ряда широко известны из предшествующего уровня техники и представляют собой, например, фторхинолоны, аминогликозиды и полипептид капреомицин. В частности, фторхинолоны представляют собой офлоксацин, моксифлоксацин, левофлоксацин, а аминогликозиды представляют собой, в частности, канамицин и амикацин.  Second-line anti-TB drugs are drugs that are used in tuberculosis patients who have tuberculosis mycobacteria resistance to first-line drugs. Second and reserve anti-TB drugs are widely known in the art and are, for example, fluoroquinolones, aminoglycosides and the capreomycin polypeptide. In particular, fluoroquinolones are ofloxacin, moxifloxacin, levofloxacin, and aminoglycosides are, in particular, kanamycin and amikacin.
Принцип способа по изобретению основан на использовании процесса мультиплексной ПЦР-амплификации ДНК, заключающегося в повторяющихся циклах температурной денатурации одной или нескольких разных матриц ДНК, отжига праймеров с комплементарными последовательностями и последующей элонгации полинуклеотидных цепей с этих праймеров Taq-полимеразой. В смесь для амплификации вносятся гибридизационные зонды, содержащие флуоресцентные метки и гасители, позволяющие детектировать генетические варианты дикого типа в кодонах 89, 90, 91 и 94 гена gyrA, в кодонах 539 и 540 гена gyrB, в позициях 1401 , 514 и 517 гена rrs, в позициях - 10, -12 и -37 промоторной области гена eis. Нуклеотидный состав, размер и ориентация зондов подобраны таким образом, чтобы обеспечить гибридизацию всех зондов с матрицей ДНК при одинаковом температурном режиме. Об отсутствии генетической мутации (вариант дикого типа) судят по наличию кривой накопления с высокой эффективностью прироста флуоресценции при экспоненциальным росте кривой специфического продукта с эффективностью прироста флуоресценции не менее 90%. Отсутствие кривой накопления, либо низкая эффективность прироста флуоресценции в пробе свидетельствуют о наличии мутации определённого типа. Положительные контроли дикого типа свидетельствуют о детекции набором вариантов дикого типа и позволяют исключить ложноположительные результаты. Для одновременной детекции наличия или отсутствия мутаций все реакции ПЦР-амплификации проводятся в одном температурном режиме. Положительные контроли мутаций позволяют выявлять образцы МТБ, содержащие мутации определённого типа, и свидетельствуют об отсутствии ложноотрицательных результатов. Отрицательные контроли позволяют исключить кросс-контаминацию образцов и неспецифические реакции. В образцах, не содержащих ДНК МТВ, результат должен быть отрицательным. The principle of the method according to the invention is based on the use of the process of multiplex PCR amplification of DNA, consisting in repeated cycles of temperature denaturation of one or more different DNA matrices, annealing of primers with complementary sequences and subsequent elongation of polynucleotide chains from these primers with Taq polymerase. Hybridization probes containing fluorescent labels and quenchers are introduced into the mixture for amplification, which allow detection of wild-type genetic variants in codons 89, 90, 91 and 94 of the gyrA gene, in codons 539 and 540 of the gyrB gene, at positions 1401, 514 and 517 of the rrs gene, at positions - 10, -12 and -37 of the promoter region of the eis gene. The nucleotide composition, size and orientation of the probes are selected in such a way as to ensure hybridization of all probes with the DNA matrix at the same temperature conditions. The absence of a genetic mutation (wild-type variant) is judged by the presence of an accumulation curve with high efficiency of fluorescence growth with an exponential growth of the curve of a specific product with a fluorescence growth efficiency of at least 90%. The absence of an accumulation curve or the low efficiency of the increase in fluorescence in a sample indicates the presence of a mutation of a certain type. Positive wild-type controls indicate detection by a set of wild-type variants and can eliminate false-positive results. To simultaneously detect the presence or absence of mutations, all PCR amplification reactions are carried out in the same temperature regime. Positive mutation controls allow the detection of MTB samples containing mutations of a certain type and indicate the absence of false negative results. Negative controls exclude cross-contamination of samples and non-specific reactions. In samples not containing MTB DNA, the result should be negative.
Таким образом, настоящее изобретение позволяет проводить одновременную Thus, the present invention allows for simultaneous
ПЦР-детекцию наличия или отсутствия мутаций устойчивости к фторхинолонам и инъекционным противотуберкулезным препаратам непосредственно после выделения ДНК МБТ из биологического образца, одновременно определяя наличие или отсутствие мутаций в двенадцати позициях четырех генов, и снизить процент ложноотрицательных результатов за счет детекции дополнительных мутаций (в частности, мутаций в позициях 89, 91 в гене gyrA, позициях 539 или 540 в гене дугВ и позиции -37 в промоторной области гена eis) , а также позволяет снизить себестоимость анализа и сократить время его проведения. PCR detection of the presence or absence of mutations of resistance to fluoroquinolones and injectable anti-TB drugs immediately after isolation of MBT DNA from a biological sample, simultaneously determining the presence or absence of mutations in twelve positions of four genes, and to reduce the percentage of false-negative results due to the detection of additional mutations (in particular, mutations at positions 89, 91 in the gyrA gene, positions 539 or 540 in the arcs gene and positions -37 in the promoter region of the eis gene), and also allows to reduce the cost of analysis and okratit the meeting.
В предпочтительном варианте осуществления изобретения устойчивость микобактерий туберкулеза к противотуберкулезным препаратам второго ряда определяется одновременной на участках генов, выбранных из группы, включающей кодоны 89, 90, 91 и 94 гена gyrA, кодоны 539 и 540 гена дугВ, позиции 1401 , 514 и 517 гена rrs, позиции -10, -12 и -37 промоторной области гена eis или их комбинации.  In a preferred embodiment of the invention, the resistance of mycobacterium tuberculosis to second-line anti-TB drugs is determined simultaneously in portions of genes selected from the group consisting of codons 89, 90, 91 and 94 of the gyrA gene, codons 539 and 540 of the arc gene, positions 1401, 514 and 517 of the rrs gene , positions -10, -12 and -37 of the promoter region of the eis gene or a combination thereof.
В настоящем изобретении биологический образец представляет собой непосредственно материал клинического образца или предварительно выращенную культуру микроорганизмов. В частности, клинический образец представляет собой мокроту, экссудат, смыв или бронхо-альвеолярный лаваж.  In the present invention, the biological sample is directly the material of a clinical sample or a pre-grown culture of microorganisms. In particular, the clinical specimen is sputum, exudate, flush or broncho-alveolar lavage.
Способ по изобретению можно проводить для более чем одного биологического образца, например для 45 или 68 образцов, по сути, количество образцов за постановку определяется только емкостью 96-луночной ПЦР машины и возможностью одновременной постановки двух реакционных смесей на определение устойчивости к фторхинолонам и инъекционным противотуберкулезным препаратам резервного ряда (канамицин, амикацин и капреомицин). Предпочтительно, количество образцов за постановку составляет от нескольких до 43-45 (в зависимости от числа контролей) при постановке на все мутации одновременно (устойчивость к фторхинолонам и к канамицину, амикацину и капреомицину) для ПЦР-машин с 96-луночной плашкой. В случае постановки только на мутации к фторхинолонам или только к канамицину, амикацину и капреомицину, то число образцов может доходить до 91 . The method according to the invention can be carried out for more than one biological sample, for example, for 45 or 68 samples, in fact, the number of samples per set is determined only by the capacity of a 96-well PCR machine and the possibility of simultaneously setting two reaction mixtures to determine resistance to fluoroquinolones and injectable anti-tuberculosis drugs reserve row (kanamycin, amikacin and capreomycin). Preferably, the number of samples per the setting is from several to 43-45 (depending on the number of controls) when setting for all mutations simultaneously (resistance to fluoroquinolones and to kanamycin, amikacin and capreomycin) for PCR machines with a 96-well plate In the case of posing only a mutation to fluoroquinolones or only to kanamycin, amikacin and capreomycin, the number of samples can reach 91.
Настоящее изобретение относится также к способу, в котором все реакции детекции мутаций устойчивости к противотуберкулезным препаратам второго ряда осуществляются в одном температурном режиме амплификации.  The present invention also relates to a method in which all reactions of detection of mutations of resistance to second-line anti-TB drugs are carried out in the same temperature amplification mode.
В результате варьирования температурами отжига праймеров и зондов, временем каждого цикла и количеством циклов, подбором оптимальной Taq-полимеразы был подобран оптимальный режим амплификации, единый для обеих реакционных смесей детекции устойчивости к фторхинолонам и инъекционным противотуберкулезным препаратам резервного ряда (канамицин, амикацин и капреомицин). Условия первичной денатурации и инициализации были выбраны в зависимости от выбора химически модифицированной Taq-полимеразы, такой как AmpliTaqGold (Roche, US) или Taq ДНК полимераза (MBI Fermentas), и были определены в диапазоне 6-12 мин. при температуре 95°С-96°С. Температура отжига праймеров была подобрана при помощи программы выбора праймеров Primer 3 (version 0.4.0) в диапазоне 60°С - 64°С, с оптимально заданной 62°С.  As a result of varying the annealing temperatures of the primers and probes, the time of each cycle and the number of cycles, and the selection of the optimal Taq polymerase, the optimal amplification mode was selected, which is the same for both reaction mixtures for the detection of resistance to fluoroquinolones and injectable anti-tuberculosis drugs of the reserve series (kanamycin, amikacin and capreomycin). Primary denaturation and initialization conditions were selected depending on the choice of chemically modified Taq polymerase, such as AmpliTaqGold (Roche, US) or Taq DNA polymerase (MBI Fermentas), and were determined in the range of 6-12 min. at a temperature of 95 ° C-96 ° C. The primer annealing temperature was selected using the Primer 3 primer selection program (version 0.4.0) in the range of 60 ° С - 64 ° С, with the optimum set to 62 ° С.
Температура гибридизации пробспецифичных зондов была подобрана в диапазоне 64°С-67°С, с заданной оптимальной температурой - 66°С-67°С.  The hybridization temperature of probespecific probes was selected in the range of 64 ° C-67 ° C, with a given optimal temperature of 66 ° C-67 ° C.
Продолжительность времени элонгации принималась в диапазоне 20-30 сек. при температуре 72°С, что определялось диапазоном длин ампликонов 130-220 п. о.  The elongation time was taken in the range of 20-30 seconds. at a temperature of 72 ° C, which was determined by the range of amplicon lengths of 130-220 bp
Также из-за разной бактериальной нагрузки анализируемых образцов, а значит и разным количеством вносимой ДНК матрицы для ПЦР-амплификации, предпочтительной оказалась схема постановки мультиплексной ПЦР-амплификации с использованием преамплификации в количестве не менее девяти-пятнадцати циклов без чтения сигналов детекции, и последующими 30-38 циклами с чтением сигналов детекции при повышенной температуре отжига (65°С-67°С).  Also, due to the different bacterial load of the analyzed samples, and hence the different amount of the DNA template being introduced for PCR amplification, a scheme for setting up multiplex PCR amplification using preamplification in the amount of at least nine to fifteen cycles without reading the detection signals, and the subsequent 30 -38 cycles with reading of the detection signals at elevated annealing temperature (65 ° С-67 ° С).
Окончательно был выбран следующий оптимальный режим мультиплексной ПЦР- амплификации, единый для обеих реакционных смесей детекции устойчивости к фторхинолонам и инъекционным противотуберкулезным препаратам резервного ряда (канамицин, амикацин и капреомицин), представляющий собой следующий: 1 -й этап - 95°С - 6-8 мин; 2-й этап - 95°С - 15 сек, 62° С - 20 сек, 72°С - 25-30 сек (9 циклов); 3-й этап: 95°С - 15 сек, 66°С - 40-45 сек (30-35 циклов с чтением).  Finally, the following optimal regimen of multiplex PCR amplification was chosen, which is common for both reaction mixtures for detecting resistance to fluoroquinolones and injectable anti-TB drugs of the reserve series (kanamycin, amikacin and capreomycin), which is as follows: 1st stage - 95 ° C - 6-8 min; 2nd stage - 95 ° С - 15 sec, 62 ° С - 20 sec, 72 ° С - 25-30 sec (9 cycles); 3rd stage: 95 ° С - 15 sec, 66 ° С - 40-45 sec (30-35 cycles with reading).
В способе определения устойчивости микобактерий туберкулеза к противотуберкулезным препаратам второго ряда по настоящему изобретению применяются праймеры для амплификации и зонды детекции, которые комплементарны указанным участкам генов gyrA, дугВ, rrs и eis. Гибридизационными зондами могут детектироваться и дифференцироваться и мутантные, и дикие типы патогенов, а также близко расположенные мутации устойчивости к фторхинолонам. Зонды могут быть комплементарны участкам генов gyrA, дугВ, rrs и eis, не содержащим мутацию, но могут также содержать мутации в тех случаях, когда они применяются для подтверждения определенных мутаций. Предлагаемые зонды, содержащие мутации, метятся другим флуорофором в отличие от зондов, не включающих в свою последовательность мутацию, т.е. дикий тип, в тех случаях, когда важно проверить и подтвердить наличие определенных мутаций, как например, основной мутации устойчивости к аминогликазидам и капреомицину а1401 g rrs или c-12t промоторной области гена eis. In the method for determining the resistance of mycobacterium tuberculosis to second-line anti-TB drugs of the present invention, amplification primers and detection probes that are complementary are used the indicated regions of the genes gyrA, arcs, rrs and eis. Hybridization probes can detect and differentiate both mutant and wild types of pathogens, as well as closely located mutations of resistance to fluoroquinolones. The probes can be complementary to regions of the gyrA, arcB, rrs, and eis genes that do not contain a mutation, but can also contain mutations when they are used to confirm specific mutations. The proposed probes containing mutations are labeled with a different fluorophore, unlike probes that do not include a mutation in their sequence, i.e. wild type, in cases where it is important to check and confirm the presence of certain mutations, such as the main mutation of resistance to aminoglycosides and capreomycin a1401 g rrs or c-12t promoter region of the eis gene.
Указанные праймеры применяются для амплифицирования коротких специфических фрагментов, ампликонов генов gyrA и дугВ (в случае определения устойчивости к фторхинолонам) и гена rrs и промоторной области гена eis (в случае определения устойчивости к канамицину, амикацину и капреомицину) для проведения специфичной ПЦР-детекции участков этих генов с последующей детекцией наличия или отсутствия мутаций устойчивости к указанным антибиотикам в образцах ДНК микобактерий туберкулеза.  These primers are used to amplify short specific fragments, amplicons of the gyrA and arcB genes (in the case of determination of resistance to fluoroquinolones) and the rrs gene and the promoter region of the eis gene (in the case of determination of resistance to kanamycin, amikacin and capreomycin) for specific PCR detection of sites of these genes with subsequent detection of the presence or absence of mutations of resistance to these antibiotics in the DNA samples of mycobacterium tuberculosis.
Зонды детекции представляют собой модифицированные олигонуклеотиды длиной обычно 18-27 нуклеотидов, которые несут флуорофор, пришитый к 5'- концу зонда и гаситель, пришитый к З'-концу. Флуоресцирование зонда, а значит и детекция продукта ПЦР-амплификации, происходит в ходе ПЦР-реакции после гибридизации зонда с комплементарными участками ДНК, при этом флуорофор испускает сигнал, и гаситель пространственно отделен от флуорофора только при гибридизации и в результате использования Taq полимеразы с 5'-экзонуклеазной активностью.  Detection probes are modified oligonucleotides, usually 18-27 nucleotides in length, which carry a fluorophore sewn to the 5'-end of the probe and a quencher sewn to the 3'-end. The fluorescence of the probe, and hence the detection of the PCR amplification product, occurs during the PCR reaction after hybridization of the probe with complementary DNA regions, while the fluorophore emits a signal, and the quencher is spatially separated from the fluorophore only during hybridization and as a result of using Taq polymerase with 5 ' exonuclease activity.
В способе согласно настоящему изобретению указанные зонды детекции могут представлять собой олигонуклеотидные последовательности длиной 19-23 нуклеотида, применяемые для детекции мутаций в кодонах 89, 90, 91 и 94 гена gyrA и в кодонах 539 и 540 гена дугВ для выявления мутаций устойчивости к фторхинолонам.  In the method according to the present invention, said detection probes may be 19-23 nucleotide oligonucleotide sequences used to detect mutations in codons 89, 90, 91 and 94 of the gyrA gene and in codons 539 and 540 of the arc gene to detect mutations of resistance to fluoroquinolones.
Кроме того, в способе согласно настоящему изобретению указанные зонды детекции могут представлять собой олигонуклеотидные последовательности длиной 24- 29 нуклеотида, применяемые для детекции мутаций в позициях -10, -12 и -37 промоторной области гена eis для выявления мутаций устойчивости к канамицину, амикацину и /или капреомицину.  In addition, in the method according to the present invention, these detection probes can be oligonucleotide sequences of 24-29 nucleotides in length used to detect mutations at positions -10, -12 and -37 of the promoter region of the eis gene to detect mutations of resistance to kanamycin, amikacin and / or capreomycin.
В одном из вариантов осуществления изобретения указанные зонды детекции представляют собой олигонуклеотидные последовательности длиной 19-20 нуклеотида, применяемые для детекции мутаций в позиции 1401 , 514 и 517 гена rrs для выявления мутаций устойчивости к канамицину, амикацину и /или капреомицину. Указанные олигонуклеотидные последовательности могут быть мечены флуорофорами и гасителями. In one embodiment of the invention, said detection probes are 19-20 nucleotide oligonucleotide sequences used to detect mutations at positions 1401, 514 and 517 of the rrs gene to detect mutations of resistance to kanamycin, amikacin and / or capreomycin. These oligonucleotide sequences can be labeled with fluorophores and quenchers.
Для выявления мутаций в генах gyrA и дугВ микобактерий туберкулеза были подобраны пары праймеров и гибридизационные зонды для амплифицирования специфичных фрагментов генов gyrA и дугВ. Была подобрана программа ПЦР- амплификации для проведения ПЦР-реакций и гибридизации зондов в одном температурном режиме, а также был предложен способ дифференцирования близкорасположенных однонуклеотидных замен двумя зондами в четырех кодонах 89, 90, 91 и 94 гена gyrA.  In order to identify mutations in the gyrA and arcs of mycobacterium tuberculosis, pairs of primers and hybridization probes were selected to amplify specific fragments of the gyrA and arcs. A PCR amplification program was selected for PCR reactions and probe hybridization in the same temperature regime, and a method was proposed for differentiating closely spaced single nucleotide substitutions with two probes in four codons of 89, 90, 91, and 94 gyrA genes.
Для решения проблемы детекции и дифференции близкорасположенных мутаций в генах gyrA и дугВ впервые были разработаны условия для каждой из стадий способа.  To solve the problem of detection and differentiation of nearby mutations in the genes gyrA and arcs, conditions were first developed for each of the stages of the method.
Для синтеза ДНК МБТ гена gyrA были выбраны праймеры с использованием компьютерной программы "Primer3" и "BioEdit".  For the synthesis of MBT DNA of the gyrA gene, primers were selected using the Primer3 and BioEdit computer programs.
Были выбраны праймеры для амплификации участка гена gyrA, фланкирующие участок гена с кодонами 88-95, не более 140 п. о.:  Primers were selected for amplification of the gyrA gene region, flanking the gene region with codons 88-95, not more than 140 bp:
SEQ ID NO 1 : Прямой 5'-CCGAGACCATGGGCAACTAC-3'  SEQ ID NO 1: Straight 5'-CCGAGACCATGGGCAACTAC-3 '
SEQ ID NO 2: Обратный 5'-GCTTCGGTGTACCTCATCG-3'  SEQ ID NO 2: Inverse 5'-GCTTCGGTGTACCTCATCG-3 '
или  or
SEQ ID NO 3: Прямой 5'-GAGACCATGGGCAACTACCA-3'  SEQ ID NO 3: Straight 5'-GAGACCATGGGCAACTACCA-3 '
SEQ ID NO 4: Обратный 5'-ATGACCCACCGGCGGCGATG-3'  SEQ ID NO 4: Inverse 5'-ATGACCCACCGGCGGCGATG-3 '
Для амплификации участка гена gyrB были выбраны праймеры, фланкирующие участок гена между кодонами 516 и 550:  To amplify the gyrB gene region, primers were selected that flank the gene region between codons 516 and 550:
SEQ ID NO 5: grB PRIMER 5'-TTCGATGTTCCAGGCGATAC-3'  SEQ ID NO 5: grB PRIMER 5'-TTCGATGTTCCAGGCGATAC-3 '
SEQ ID NO 6: grB PRIMER 5'-TCTTGTGGTAGCGCAGCTTG-3'  SEQ ID NO 6: grB PRIMER 5'-TCTTGTGGTAGCGCAGCTTG-3 '
Для обеспечения видоспецифичности выбранных праймеров проводили сравнительный анализ нуклеотидных последовательностей с базой данных GenBank с помощью программы BLAST и e-PCR. Было установлено отсутствие кросс-реакций при использовании выбранных праймеров с ДНК других видов микроорганизмов и человека.  To ensure species specificity of the selected primers, a comparative analysis of the nucleotide sequences was carried out with the GenBank database using the BLAST program and e-PCR. It was found that there are no cross-reactions when using selected primers with DNA of other types of microorganisms and humans.
Далее были выбраны гибридизационные зонды для постановки мультиплексной ПЦР-амплификации вместе с выбранными праймерами для выявления мутаций в кодонах 90-94 участка гена gyrA. Зонды выведены как в прямом, так и обратном направлении для обеспечения гибридизации в температурном интервале: 64-67°С.  Next, hybridization probes were selected to perform multiplex PCR amplification together with the selected primers to detect mutations in codons 90-94 of the gyrA gene region. The probes were withdrawn both in the forward and reverse directions to ensure hybridization in the temperature range: 64-67 ° C.
SEQ ID NO 7: 94 FL1 -ACGCGTCGATCTACGACACCCTG-BHQ1  SEQ ID NO 7: 94 FL1 -ACGCGTCGATCTACGACACCCTG-BHQ1
SEQ ID NO 8: 94 FL1 -AGGGTGTCGTAGATCGACGCG-BHQ1  SEQ ID NO 8: 94 FL1 -AGGGTGTCGTAGATCGACGCG-BHQ1
где FL1 - флуорофор, который выбирается независимо и, в частности, представляет собой флуорофор FAM.  where FL1 is a fluorophore that is independently selected and, in particular, is a fluorophore FAM.
Чтобы избежать пространственных осложнений при гибридизации близкорасположенных зондов, к позициям 91 и 94 был выбран более предпочтительный вариант, при котором используются зонды, комплементарные (-) цепи ДНК матрицы в позициях 89 и 90. Зонды для специфичной гибридизации с кодонами 89-91 участка гена дугА, оптимизированные по температуре гибридизации в том же температурном интервале 64- 67°С, предложены следующие: In order to avoid spatial complications during hybridization of closely located probes, a more preferable option was chosen for positions 91 and 94, in which probes are used that are complementary to the (-) DNA strands of the template at positions 89 and 90. Probes for specific hybridization with codons 89-91 of the arc gene region, optimized for hybridization temperature in the same temperature range of 64-67 ° C, are proposed as follows:
SEQ ID NO 9: 90-91 FL2-TAGATCGACGCGTCGCCGT-BHQ2  SEQ ID NO 9: 90-91 FL2-TAGATCGACGCGTCGCCGT-BHQ2
SEQ ID NO 10: 91 -90 FL2-ACGGCGACGCGTCGATCTACG-BHQ2  SEQ ID NO 10: 91 -90 FL2-ACGGCGACGCGTCGATCTACG-BHQ2
где FL2- флуорофор, который выбирается независимо и, в частности представляет собой флуорофор ROX.  where FL2 is a fluorophore that is independently selected and, in particular, is a ROX fluorophore.
Принцип дифференциальной детекции основных мутаций в гене дугА реализуется таким образом, что например, мутация в 94 кодоне гена дугА детектируется по отсутствию кривой накопления по одному каналу узнавания флуорофора, например, FAM с одновременным присутствием кривой накопления по другому каналу узнавания флуорофора, например, ROX с эффективностью прироста флуоресценции близкой к 100%. Мутации в кодоне 91 гена дугА выявляются по одновременному отсутствию кривых накопления по обоим каналам узнавания флуорофоров.  The principle of differential detection of the main mutations in the arcA gene is implemented in such a way that, for example, a mutation in the 94 codon of the arcA gene is detected by the absence of an accumulation curve for one fluorophore recognition channel, for example, FAM with the simultaneous presence of an accumulation curve for another fluorophore recognition channel, for example, ROX with the efficiency of the increase in fluorescence close to 100%. Mutations in the codon of the 91A gene are detected by the simultaneous absence of accumulation curves through both fluorophore recognition channels.
Отсутствие мутаций в кодонах 89 и 90 гена дугА определяется по наличию кривых накопления по обоим каналам, например, FAM и ROX, с эффективностью прироста флуоресценции близкой к 100%.  The absence of mutations in codons 89 and 90 of the arc gene is determined by the presence of accumulation curves for both channels, for example, FAM and ROX, with an efficiency of fluorescence increase close to 100%.
Мутации в кодоне 94 детектируются по отсутствию кривой накопления по каналу FAM с эффективностью прироста флуоресценции менее 10%.  Mutations in codon 94 are detected by the absence of an accumulation curve on the FAM channel with a fluorescence gain of less than 10%.
Мутации в кодонах 89 и 90 гена дугА детектируются по присутствию кривой накопления по одному каналу, например, FAM, с эффективностью прироста флуоресценции близкой к 100% и менее 40% соответственно, тогда как по другому каналу, например, ROX для обеих мутаций характерно отсутствие кривой накопления. Наличие полиморфизма в кодоне 95 определяется также гибридизацией с зондом, комплементарным участку с кодоном 94, и выявляется по кривой накопления с эффективностью прироста флуоресценции близкой к 70%, что не влияет на способность дифференцировать мутантные и дикие формы по кодону 94.  Mutations in codons 89 and 90 of the arc gene are detected by the presence of an accumulation curve along one channel, for example, FAM, with fluorescence growth efficiencies close to 100% and less than 40%, respectively, whereas the absence of a curve is characteristic for the other channels, for example, ROX accumulation. The presence of polymorphism in codon 95 is also determined by hybridization with a probe complementary to region with codon 94, and is detected by the accumulation curve with a fluorescence growth efficiency close to 70%, which does not affect the ability to differentiate mutant and wild forms from codon 94.
Интерпретация результатов детекции мутаций в кодонах 89, 90, 91 и 94 гена дугА по амплитуде сигнала детекции для двух зондов представлена в таблице 1 .  Interpretation of mutation detection results in codons 89, 90, 91 and 94 of the arc gene according to the amplitude of the detection signal for two probes is presented in table 1.
Таблица 1. Детекция мутаций устойчивости к фторхинолонам по амплитуде сигнала детекции.  Table 1. Detection of mutations of resistance to fluoroquinolones by the amplitude of the detection signal.
Figure imgf000016_0001
91 <100-20 <10-20
Figure imgf000016_0001
91 <100-20 <10-20
90 <30-40 <10-20 90 <30-40 <10-20
89 100 <10-20 89 100 <10-20
95 70-75 100 wt 100 100 wt -амплитуда сигнала детекции. 95 70-75 100 wt 100 100 wt - amplitude of the detection signal.
Таким образом, предлагаемый нами вариант детекции мутаций в близко расположенных кодонах 89, 90, 91 и 94 участка гена дугА обеспечивается проведением мультиплексной ПЦР-амплификации с использованием только двух гибридизационных зондов, комплементарных или одной, или обеим цепям анализируемого участка ДНК, но выбранным для гибридизации в одном температурном диапазоне 64-67°С.  Thus, our proposed option for detecting mutations in closely located codons of the 89, 90, 91, and 94 regions of the archA gene is ensured by multiplex PCR amplification using only two hybridization probes, complementary to one or both chains of the analyzed DNA region, but chosen for hybridization in one temperature range 64-67 ° С.
Кроме того, используемый подход позволяет избегать детекции близкорасположенного однонуклеотидного полиморфизма в кодоне 95, тем самым детектируя только мутации устойчивости к фторхинолонам.  In addition, the approach used allows one to avoid detection of nearby single-nucleotide polymorphism in codon 95, thereby only detecting fluoroquinolone resistance mutations.
Был также выбран гибридизационный зонд, специфичный к участку гена gyrB в позициях 539-540 как прямой, так и комплементарный, из следующей группы :  A hybridization probe specific for the gyrB gene site at positions 539-540, both direct and complementary, from the following group was also selected:
SEQ ID NO 1 1 : FL3-TAAAGAACACCGAAGTTCAGGCG-BHQ1  SEQ ID NO 1 1: FL3-TAAAGAACACCGAAGTTCAGGCG-BHQ1
SEQ ID NO 12: FL3-AAAGAACACCGAAGTTCAGGCG-BHQ1  SEQ ID NO 12: FL3-AAAGAACACCGAAGTTCAGGCG-BHQ1
SEQ ID NO 13: FL3-CGCCTGAACTTCGGTGTTCTTTA-BHQ1  SEQ ID NO 13: FL3-CGCCTGAACTTCGGTGTTCTTTA-BHQ1
SEQ ID NO 14: FL3-CGCCTGAACTTCGGTGTTCTTT-BHQ1  SEQ ID NO 14: FL3-CGCCTGAACTTCGGTGTTCTTT-BHQ1
где FL3- флуорофор, который выбирается независимо и, в частности представляет собой флуорофор HEX.  where FL3 is a fluorophore that is independently selected and, in particular, is a HEX fluorophore.
Предпочтительным является SEQ ID NO 11 , т.к. обеспечивает лучшую детекцию возможных замен в любом из кодонов 539-540.  Preferred is SEQ ID NO 11, because provides the best detection of possible substitutions in any of the codons 539-540.
Следующим этапом была разработка способа детекции мутаций устойчивости в микобактериях туберкулеза к инъекционным противотуберкулезным препараты резервного ряда (канамицин, амикацин и капреомицин).  The next step was the development of a method for detecting resistance mutations in mycobacterium tuberculosis against injectable anti-tuberculosis drugs of the reserve series (kanamycin, amikacin and capreomycin).
Наши секвенационные данные определения мутаций устойчивости МВТ к канамицину, амикацину и капреомицину, а также имеющиеся литературные данные свидетельствуют о необходимости поиска мутаций как в позициях 1401 , 514, 517 гена rrs, так и в промоторной области гена eis в позициях -10, -12 и -37.  Our sequencing data for the determination of mutations in the resistance of MBT to kanamycin, amikacin, and capreomycin, as well as available literature data indicate the need to search for mutations both at positions 1401, 514, 517 of the rrs gene, and in the promoter region of the eis gene at positions -10, -12, and -37.
Невысокий GC состав и протяженность промоторной области гена eis позволяют использовать метод мультиплексной ПЦР-амплификации с одновременным применением двух гибридизационных зондов против участка с позициями -10/-12 и против позиции -37 для детекции интересующих нас мутаций. Соответственно, для амплифицирования специфичного участка промоторной области гена eis были выбраны пары праймеров следующего состава: The low GC composition and extent of the promoter region of the eis gene allows the use of multiplex PCR amplification with simultaneous use two hybridization probes against the site with positions -10 / -12 and against position -37 for detection of mutations of interest to us. Accordingly, to amplify a specific region of the promoter region of the eis gene, pairs of primers of the following composition were selected:
SEQ ID N0 15: Прямой 5'-ATCGCGTGATCCTTTGCCAG-3'  SEQ ID N0 15: Direct 5'-ATCGCGTGATCCTTTGCCAG-3 '
SEQ ID NO 16: Обратный 5'-GCGGCCAGTAGGAACATCC-3'  SEQ ID NO 16: Inverse 5'-GCGGCCAGTAGGAACATCC-3 '
Определение видоспецифичности выбранных праймеров проводили при помощи сравнительного анализа нуклеотидных последовательностей из базы данных GenBank с помощью программы BLAST и e-PCR. Было установлено отсутствие кросс-реакций при использовании выбранных праймеров с ДНК других видов микроорганизмов и человека.  The species specificity of the selected primers was determined using a comparative analysis of the nucleotide sequences from the GenBank database using the BLAST program and e-PCR. It was found that there are no cross-reactions when using selected primers with DNA of other types of microorganisms and humans.
Далее были выбраны гибридизационные зонды для постановки мультиплексной ПЦР-амплификации вместе с выбранными праймерами для выявления мутаций в позициях -10 и -12, а также в позиции -37 промоторной области гена eis. Для дифференцирования мутаций в позициях -10 и -12 выбраны следующие зонды с диапазоном температур гибридизации 65-67°С:  Next, hybridization probes were selected to perform multiplex PCR amplification together with the selected primers to detect mutations at positions -10 and -12, as well as at position -37 of the promoter region of the eis gene. To differentiate the mutations in positions -10 and -12, the following probes with a hybridization temperature range of 65-67 ° C were selected:
SEQ ID NO 17: eis-10 FL1 - CATATGCCACAGTCGGATTCTGTGAC-BHQ1  SEQ ID NO 17: eis-10 FL1 - CATATGCCACAGTCGGATTCTGTGAC-BHQ1
SEQ ID NO 18: eis-12 мутант FL2-ATATGCCACAATCGGATTCTGTGACTGTG-BHQ1 где FL1 - флуорофор, который выбирается независимо и, в частности, представляет собой флуорофор FAM;  SEQ ID NO 18: eis-12 mutant FL2-ATATGCCACAATCGGATTCTGTGACTGTG-BHQ1 where FL1 is a fluorophore that is independently selected and, in particular, is a fluorophore FAM;
FL2- флуорофор, который выбирается независимо и, в частности представляет собой флуорофор ROX.  FL2 is a fluorophore that is independently selected and, in particular, is a ROX fluorophore.
При этом зонд SEQ ID NO 18, меченный другим флуорофором, позволяет детектировать только мутантную форму с мутацией в позиции -12 промоторной области гена eis в биологических образцах микобактерий туберкулеза.  In this case, the probe SEQ ID NO 18, labeled with a different fluorophore, allows you to detect only a mutant form with a mutation at position -12 of the promoter region of the eis gene in biological samples of mycobacterium tuberculosis.
Гибридизационный зонд, узнающий вариант дикого типа в позиции -37, был выбран следующий:  A hybridization probe recognizing the wild-type variant at position -37 was selected as follows:
SEQ ID NO 19: eis-37 FL3- TCGTCGTAATATTCACGTGCACGT-BHQ1  SEQ ID NO 19: eis-37 FL3- TCGTCGTAATATTCACGTGCACGT-BHQ1
где FL3- флуорофор, который выбирается независимо и, в частности представляет собой флуорофор HEX.  where FL3 is a fluorophore that is independently selected and, in particular, is a HEX fluorophore.
В способе по изобретению могут использоваться стандартные праймеры для амплификации и зонды для детекции, которые известны из уровня техники (Suzuki Y.C. и соавт. Detection of kanamycin-resistant Mycobacterium tuberculosis by identifying mutations in the 16S rRNA gene.// J. Clin. Microbiol. - 1998. - v. 36. - p. 1220-1225) и применяются для определения устойчивости к препаратам резервного ряда для лечения туберкулеза по наличию или отсутствию мутаций в гене rrs. Но для достижения наилучшей выявляемое™ мы создали праймеры и зонды, которые более подробно описаны ниже.  The method of the invention can use standard amplification primers and detection probes that are known in the art (Suzuki YC et al. Detection of kanamycin-resistant Mycobacterium tuberculosis by identifying mutations in the 16S rRNA gene.// J. Clin. Microbiol. - 1998. - v. 36. - p. 1220-1225) and are used to determine the resistance to reserve drugs for the treatment of tuberculosis by the presence or absence of mutations in the rrs gene. But to achieve the best detectable ™, we created primers and probes, which are described in more detail below.
Для выявления известных специфичных мутаций устойчивости микобактерий туберкулеза к канамицину/ амикацину и капреомицину в позиции 1401 гена rrs, а также мутаций в 514 и 517, ассоциированных с устойчивостью к канамицину/ амикацину, были подобраны пары праймеров и гибридиза ионные зонды для амплифи ирования специфичных фрагментов, фланкирующих эти мутации генов. To identify known specific mutations in the resistance of mycobacterium tuberculosis to kanamycin / amikacin and capreomycin at position 1401 of the rrs gene, as well as mutations in 514 and 517 associated with resistance to kanamycin / amikacin, pairs of primers and hybridization of ion probes were selected to amplify specific fragments flanking these gene mutations.
Для обеспечения видоспецифичности выбранных праймеров для амплифицирования высококонсервативных участков гена rrs, где локализованы мутации, предварительно проводили сравнительный анализ нуклеотидных последовательностей длиной 80-1 10 п. о., отстоящих от позиции мутаций, слева и справа от них, с базой данных GenBank с помощью программы BLAST и e-PCR. Было выбраны праймеры, обеспечивающие отсутствие кросс-реакций с ДНК других видов микроорганизмов и человека. Праймеры для амплификации участка гена rrs, фланкирующие участок 1390- 1490:  To ensure species-specificity of the selected primers for amplification of highly conserved regions of the rrs gene where mutations are localized, a preliminary analysis of nucleotide sequences 80-1 10 bp in length, located at the left and right of the mutations, was performed with the GenBank database using the program BLAST and e-PCR. Primers were selected to ensure the absence of cross-reactions with DNA of other types of microorganisms and humans. Primers for amplification of the rrs gene region flanking the region 1390-1490:
SEQ ID NO 20: Прямой 5'- CGCGAGGTTAAGCGAATCCTTA-3'  SEQ ID NO 20: Direct 5'- CGCGAGGTTAAGCGAATCCTTA-3 '
SEQ ID NO 21 : Прямой 5'-GCGAGGTTAAGCGAATCCTTA-3'  SEQ ID NO 21: Direct 5'-GCGAGGTTAAGCGAATCCTTA-3 '
SEQ ID NO 22: Обратный 5'- TCGACAGCTCCCTCCCGA-3'  SEQ ID NO 22: Inverse 5'- TCGACAGCTCCCTCCCGA-3 '
SEQ ID NO 23: Обратный 5'-CGACAGCTCCCTCCCGAG-3'  SEQ ID NO 23: Inverse 5'-CGACAGCTCCCTCCCGAG-3 '
Для проведения ПЦР-амплификации участка гена rrs в температурном интервале отжига 61 -64°С предпочтительными оказалась пара праймеров SEQ ID NO 21 и SEQ ID NO 22.  For PCR amplification of the rrs gene region in the annealing temperature range of 61-64 ° C, a pair of primers SEQ ID NO 21 and SEQ ID NO 22 turned out to be preferable.
Праймеры для участка гена rrs, фланкирующие мутации в позициях 514 и 517, не находятся в области высокой консервативности. Определение видоспецифичности выбранных праймеров проводили также при помощи сравнительного анализа нуклеотидных последовательностей из базы данных GenBank с помощью программы Primers for the rrs gene region flanking mutations at positions 514 and 517 are not in the region of high conservatism. The species specificity of the selected primers was also determined using a comparative analysis of the nucleotide sequences from the GenBank database using the program
BLAST и e-PCR. Было установлено отсутствие кросс-реакций при использовании выбранных праймеров с ДНК других видов микроорганизмов и человека. BLAST and e-PCR. It was found that there are no cross-reactions when using selected primers with DNA of other types of microorganisms and humans.
Соответственно, для амплифицирования специфичного участка гена rrs, включающего позиции 514 и 517, в том же температурном интервале 61-64°С были выбраны пара праймеров следующего состава:  Accordingly, to amplify a specific region of the rrs gene, including positions 514 and 517, in the same temperature range of 61-64 ° C, a pair of primers of the following composition were selected:
SEQ ID NO 24: Прямой 5'- CGAAGGTCCGGGTTCTCTCG -3'  SEQ ID NO 24: Direct 5'- CGAAGGTCCGGGTTCTCTCG -3 '
SEQ ID NO 25: Обратный 5'- CGCCCAGTAATTCCGGACA -3'  SEQ ID NO 25: Inverse 5'- CGCCCAGTAATTCCGGACA -3 '
Далее были выбраны гибридизационные зонды для постановки мультиплексной ПЦР-амплификации вместе с выбранными праймерами для выявления мутаций в участках 514 и 517 гена rrs. Зонды выведены как в прямом, так и обратном направлении для обеспечения гибридизации в температурном интервале: 64-67°С.  Next, hybridization probes were selected for the multiplex PCR amplification with the selected primers to detect mutations in regions 514 and 517 of the rrs gene. The probes were withdrawn both in the forward and reverse directions to ensure hybridization in the temperature range: 64-67 ° C.
SEQ ID NO 26: 514/517for1 FL2- TGCCAGCAGCCGCGGTAAT -BHQ2  SEQ ID NO 26: 514 / 517for1 FL2- TGCCAGCAGCCGCGGTAAT -BHQ2
SEQ ID NO 27: 514/517for2 FL2- CCAGCAGCCGCGGTAATACGT -BHQ2  SEQ ID NO 27: 514 / 517for2 FL2- CCAGCAGCCGCGGTAATACGT -BHQ2
SEQ ID NO 28: 514/517rev1 FL2-ATTACCGCGGCTGCTGGCA-BHQ2  SEQ ID NO 28: 514 / 517rev1 FL2-ATTACCGCGGCTGCTGGCA-BHQ2
SEQ ID NO 29: 514/517rev2 FL2- ACGTATTACCGCGGCTGCTGG -BHQ2, где FL2- флуорофор, который выбирается независимо и, в частности представляет собой флуорофор ROX. 514/517for1 , 514/517for2 обозначает зонды, выбранные в прямом направлении (forward) для выявления мутаций 514 и 517. SEQ ID NO 29: 514 / 517rev2 FL2-ACGTATTACCGCGGCTGCTGG -BHQ2, where FL2 is a fluorophore that is independently selected and, in particular, is a ROX fluorophore. 514 / 517for1, 514 / 517for2 indicates probes selected in the forward direction to detect mutations 514 and 517.
514/517rev1 , 514/517rev2 обозначает зонды, выбранные в обратном направлении (reverse) для выявления мутаций 514 и 517.  514 / 517rev1, 514 / 517rev2 denotes probes selected in the reverse direction to detect mutations 514 and 517.
Предпочтительным оказался вариант зонда SEQ ID NO 28, т.к. обеспечивает лучшую детекцию при гибридизации с возможными заменами в любой из позиций а514с и с517t.  The preferred option was the probe SEQ ID NO 28, because provides better detection during hybridization with possible replacements in any of the positions a514c and c517t.
Для детекции мутаций в позиции 1401 и крайне редкой мутации в позиции 1402 были выбраны следующие зонды с диапазоном температур гибридизации 64-67°С:  To detect mutations at position 1401 and an extremely rare mutation at position 1402, the following probes with a hybridization temperature range of 64-67 ° C were selected:
SEQ ID NO 30: rrs1401 FL1 - ACCGCCCGTCACGTCATGAA-BHQ1  SEQ ID NO 30: rrs1401 FL1 - ACCGCCCGTCACGTCATGAA-BHQ1
SEQ ID NO 31 : rrs 1401 мутант FL2-ACCGCCCGTCGCGTCATGAA-BHQ1 где FL1 - флуорофор, который выбирается независимо и, в частности, представляет собой флуорофор FAM;  SEQ ID NO 31: rrs 1401 mutant FL2-ACCGCCCGTCGCGTCATGAA-BHQ1 where FL1 is a fluorophore that is independently selected and, in particular, is a fluorophore FAM;
FL2- флуорофор, который выбирается независимо и, в частности представляет собой флуорофор ROX.  FL2 is a fluorophore that is independently selected and, in particular, is a ROX fluorophore.
При этом зонд SEQ ID NO 31 , меченный другим флуорофором, позволяет детектировать только мутантную форму с мутацией а1401 g в биологических образцах микобактерий туберкулеза.  In this case, the probe SEQ ID NO 31, labeled with another fluorophore, allows only the mutant form with the a1401 g mutation to be detected in biological samples of tuberculosis mycobacteria.
Таким образом, были подобраны праймеры, специфичные гибридизационные зонды для амплифицирования (61 -63°С) и детекции в одном температурном режиме (64- 67°С) мутаций устойчивости к фторхинолонам и канамицину, амикацину и капреомицину.  Thus, primers were selected, specific hybridization probes for amplification (61-63 ° C) and detection in the same temperature regime (64-67 ° C) of mutations of resistance to fluoroquinolones and kanamycin, amikacin and capreomycin.
Условия проведения ПЦР для всех мишеней представляют собой следующие: 1 -й этап - 95° -6- 8 мин; 2-й этап - 95° - 15 сек, 62° - 20 сек, 72° - 25 сек (9 циклов); 3-й этап: 95° - 15 сек, 66-67° - 40 сек. (30-35 циклов в режиме чтения).  The PCR conditions for all targets are as follows: 1st stage - 95 ° -6-8 min; 2nd stage - 95 ° - 15 sec, 62 ° - 20 sec, 72 ° - 25 sec (9 cycles); 3rd stage: 95 ° - 15 sec, 66-67 ° - 40 sec. (30-35 cycles in read mode).
Для выбора оптимальных условий проведения мультиплексной ПЦР- амплификации был также подобран состав реакционного буфера, в котором важными составляющими являются соотношение количества вносимых праймеров и зондов, концентрация трифосфатов, концентрация ионов магния. В реакционный объем мультиплексной смеси 22-24 мкл, содержащей 10 мМ Трис-НС1 рН 8,8 - 9,0; 50-70 мМ KCI; 0,5% Твин 20, 1 ,8-3,5 мМ MgCI2, 3,0 - 4,0 ед. Taq полимеразы, 200 мкМ каждого нуклеозидтрифосфата, 5-9 пмоль каждого олигонуклеотидного праймера и 5-10 пмоль зондов вносили 12 мкл образца ДНК. To select the optimal conditions for multiplex PCR amplification, the composition of the reaction buffer was also selected, in which the important components are the ratio of the number of introduced primers and probes, the concentration of triphosphates, and the concentration of magnesium ions. In the reaction volume of the multiplex mixture is 22-24 μl containing 10 mM Tris-HC1 pH 8.8 - 9.0; 50-70 mM KCI; 0.5% Tween 20, 1, 8-3.5 mM MgCI 2 , 3.0 - 4.0 units Taq polymerase, 200 μM of each nucleoside triphosphate, 5-9 pmol of each oligonucleotide primer and 5-10 pmol of probes contributed 12 μl of the DNA sample.
Используемая нами методика включала следующие этапы: выращивание культур МВТ в селективной среде ВАСТЕС с антибиотиками, тем самым определение на устойчивость или чувствительность, выделение ДНК из фенотипически охарактеризованных культур, постановка МПЦР и проверка наличия мутаций секвенированием. ДНК выделяли из культур МВТ, полученных на жидкой питательной среде Middlebrook 7Н9 в автоматизированной системе ВАСТЕС MGIT 960 (Becton Dickinson, США), прогреванием при 95°С в течение 20 мин в ТЕ буфере с 1 % тритоном (рН 8,8). The technique we used included the following steps: growing MBT cultures in a WASTES selective medium with antibiotics, thereby determining for resistance or sensitivity, isolating DNA from phenotypically characterized cultures, staging MPCR and checking for mutations by sequencing. DNA was isolated from MBT cultures obtained on Middlebrook 7H9 liquid nutrient medium in the WASTEC MGIT 960 automated system (Becton Dickinson, United States), by heating at 95 ° С for 20 min in TE buffer with 1% Triton (pH 8.8).
Для амплификации участков генов rrs и eis использовали оптимизированную 2Х реакционную смесь, аналогичную предложенной для дугА и дугВ. ПЦР-амплификацию проводили в общем объеме до 24 мкл, с количеством вносимой ДНК до 12 мкл.  To amplify regions of the rrs and eis genes, an optimized 2X reaction mixture similar to that proposed for arcs and arcs was used. PCR amplification was performed in a total volume of up to 24 μl, with the amount of introduced DNA up to 12 μl.
Температурный режим амплификации был выбран единым, как и для дугА, так и для дугВ: 1 -ый этап - 95°- 6-8 мин; 2-ой этап - 95° - 15 сек, 62° - 20 сек, 72° - 25 сек (9 циклов); 3-ий этап: 95° - 15 сек, 66° - 40 сек (35 циклов - в режиме чтения).  The temperature regime of amplification was chosen uniform, both for arcs and for arcs: 1st stage - 95 ° - 6-8 min; 2nd stage - 95 ° - 15 sec, 62 ° - 20 sec, 72 ° - 25 sec (9 cycles); 3rd stage: 95 ° - 15 sec, 66 ° - 40 sec (35 cycles - in read mode).
Настоящее изобретение относится также к набору зондов детекции для осуществления способа по изобретению, в котором указанные зонды включают нуклеотидные последовательности, выбранные из группы, состоящей из представленных в SEQ ID NO: 7-14, 17-19, 26- 31 или их комбинации.  The present invention also relates to a set of detection probes for implementing the method of the invention, wherein said probes include nucleotide sequences selected from the group consisting of those presented in SEQ ID NOs: 7-14, 17-19, 26-31, or a combination thereof.
Кроме того, настоящее изобретение относится к набору праймеров амплификации для осуществления способа по любому из пп. 1 -1 1 , в котором указанные праймеры включают нуклеотидные последовательности, выбранные из группы, состоящей из представленных в SEQ ID NO: 1 -6, 15, 16, 20-25 или их комбинации.  In addition, the present invention relates to a set of amplification primers for implementing the method according to any one of paragraphs. 1 -1 1, in which these primers include nucleotide sequences selected from the group consisting of those presented in SEQ ID NO: 1 -6, 15, 16, 20-25, or a combination thereof.
Указанные наборы могут также включать инструкции по применению в способе определения устойчивости микобактерий туберкулеза к противотуберкулезным препаратам второго и резервного ряда.  These kits may also include instructions for use in a method for determining the resistance of Mycobacterium tuberculosis to second and reserve row anti-TB drugs.
Пример 1  Example 1
Детекция мутаций устойчивости к торхинолонам (офлоксацин, моксифлоксацин, левофлоксацин) в генах дугА и дугВ на изолятах, выделенных из клинических образцов.  Detection of mutations of resistance to torquinolones (ofloxacin, moxifloxacin, levofloxacin) in the arcs and arcs of genes on isolates isolated from clinical samples.
Проводился МПЦР-анализ проб из 39 изолятов, монокультур, выделенных из клинических образцов, охарактеризованных фенотипически культивированием в среде ВАСТЕС с концентрацией офлоксацина (OFX) и левофлоксацина (LVX) по 2 мг /л, и моксифлоксацина (MFX) - 0,25 мг/л. Образцы устойчивые и чувствительные к данным антибиотикам верифицировались секвенированием генов дугА и дугВ. Во всех случаях результаты анализа ДНК совпадали с фенотипическими данными.  A PCR analysis of samples from 39 isolates, monocultures isolated from clinical samples characterized by phenotypic cultivation in WASTES medium with a concentration of ofloxacin (OFX) and levofloxacin (LVX) at 2 mg / l and moxifloxacin (MFX) 0.25 mg / l Samples resistant and sensitive to these antibiotics were verified by sequencing of the arcs of arcs and arcs. In all cases, the results of DNA analysis coincided with phenotypic data.
ПЦР-анализ проводился с использованием 10-12 мкл очищеной ДНК, выделенной из каждого изолята сорбцией на магнитных частицах коммерческим набором Promega, которую добавляли в 2х-кратную реакционную смесь (конечный объем 24 мкл), содержащую 5-6 пмоль каждого из праймеров, 5-10 пмоль каждого зонда, 2,5 мМ MgCI2, 3 ед. Taq ДНК полимеразы (MBI Fermentas), и 200 микроМ каждого из дНТФ. ПЦР- реакции проводили на амплификаторе ДТ-96 («ДНК-технология», РФ) в одинаковых условиях по протоколу с преамплификацией: 1 -й этап - 95° - 6 мин; 2-й этап - 95° - 15 сек, 62° - 20 сек, 72° - 25 сек (9 циклов); 3-й этап: 95° - 15 сек, 66° - 40 сек (30 циклов с чтением). Результаты детекции мутаций устойчивости к фторхинолонам предложенным способом и верификация секвенированием некоторых изолятов представлены в таблице 2. Секвенированием был выявлен полиморфизм с заменой аминокислоты S95T как в устойчивых к фторхинолонам образцах, так и в чувствительных. Тем не менее, при ПЦР- детекции предлагаемым способом данный полиморфизм не интерферировал с настоящими близкорасположенными мутациями в кодоне 94. PCR analysis was performed using 10-12 μl of purified DNA, isolated from each isolate by magnetic particle sorption with a commercial Promega kit, which was added to a 2-fold reaction mixture (final volume 24 μl) containing 5-6 pmol of each primer, 5 -10 pmol of each probe, 2.5 mm MgCI 2 , 3 units Taq DNA polymerase (MBI Fermentas), and 200 microM each of dNTP. PCR reactions were performed on a DT-96 thermocycler (DNA technology, RF) under identical conditions according to the protocol with preamplification: 1st stage - 95 ° - 6 min; 2nd stage - 95 ° - 15 sec, 62 ° - 20 sec, 72 ° - 25 sec (9 cycles); 3rd stage: 95 ° - 15 sec, 66 ° - 40 sec (30 cycles with reading). The results of the detection of mutations of resistance to fluoroquinolones by the proposed method and verification by sequencing of some isolates are presented in Table 2. Sequencing revealed a polymorphism with the replacement of the S95T amino acid in both fluoroquinolone-resistant and sensitive samples. However, during PCR detection by the proposed method, this polymorphism did not interfere with these closely spaced mutations in codon 94.
Таблица 2. Результаты ПЦР-определения устойчивости или чувствительности к фторхинолонам в образцах ДНК монокультур, культивированных на жидких средах eBactec MGIT 960 с фторхинолонами.  Table 2. Results of PCR determination of resistance or sensitivity to fluoroquinolones in monoculture DNA samples cultured on eBactec MGIT 960 liquid media with fluoroquinolones.
Figure imgf000022_0001
13-3387 wt wt He выявлено S S S
Figure imgf000022_0001
13-3387 wt wt He detected SSS
13-3632 wt wt He выявлено S S S 13-3632 wt wt He detected S S S
14-1219 94 wt D94A,S95T R R R 14-1219 94 wt D94A, S95T R R R
13-3537 wt wt He выявлено S S S 13-3537 wt wt He detected S S S
He выявлено, He revealed
13-3538 wt wt S S S  13-3538 wt wt S S S
S95T  S95t
14-1 126 94 wt D94N R S R 14-1 126 94 wt D94N R S R
13-3617 wt wt He выявлено S S S 13-3617 wt wt He detected S S S
13-3848 wt wt He выявлено S S S 13-3848 wt wt He detected S S S
He выявлено, He revealed
13-3849 wt wt S S S  13-3849 wt wt S S S
S95T  S95T
Wl - дикого типа; S - чувствительный; R - резистентный.  Wl — wild type; S is sensitive; R is resistant.
Пример 2 Example 2
Детекция мутаций устойчивости к инъекционным противотуберкулезным препаратам резервного ряда (канамицину, амикацину и капреомицину) в генах rrs и eis на изолятах, выделенных из клинических образцов.  Detection of mutations of resistance to injectable anti-TB drugs of the reserve series (kanamycin, amikacin and capreomycin) in the rrs and eis genes on isolates isolated from clinical samples.
Анализ проб из 39 изолятов, монокультур, выделенных из клинических образцов, охарактеризованных фенотипически культивированием в среде ВАСТЕС с концентрацией канамицина, амикацина и капреомицина 30 мг/л был проведен с использованием предлагаемого МПЦР-способа с последующей верификацией результатов секвенированием. Во всех случаях результаты анализа ДНК из тех же штаммов совпадали с фенотипическими данными.  Analysis of samples from 39 isolates, monocultures isolated from clinical samples characterized by phenotypic cultivation in WASTES medium with a concentration of kanamycin, amikacin and capreomycin of 30 mg / l was carried out using the proposed MPCR method with subsequent verification of the results by sequencing. In all cases, the results of DNA analysis from the same strains coincided with phenotypic data.
ПЦР-анализ проводился с использованием 10-12 мкл очищеной ДНК, выделенной из изолятов сорбцией на магнитных частицах коммерческим набором Promega, которую добавляли в 2х-кратную реакционную смесь (конечный объем 24 мкл), содержащую 5-6 пмоль каждого из праймеров, 5-10 пмоль каждого зонда, 2.5 мМ MgCI2, 3 ед. Taq ДНК полимеразы (MBI Fermentas), и 200 микроМ каждого из дНТФ. ПЦР- реакции проводили на амплификаторе ДТ-96 («ДНК-технология», РФ) в одинаковых условиях по протоколу с преамплификацией: 1 -й этап - 95° - 6 мин; 2-й этап - 95° - 15 сек, 62° - 20 сек, 72° - 25 сек (9 циклов); 3-й этап: 95° - 15 сек, 66° - 40 сек (30 циклов с чтением). Результаты детекции устойчивости к канамицину, амикацину и капреомицину полученных методом культивирования бактериальных культур, предлагаемым способом МПЦР и секвенированием представлены в таблице 3. В результате показано, что предложенным способом в изолятах образцов с фенотипом ШЛУ детектируются не только мутации устойчивости к аминогликазидам и капреомицину в гене rrs, такие как в позиции 1401 , мутации устойчивости только к аминогликазидам в позицииях 514с и 517t гена rrs, а также мутации в промоторной области гена eis в позициях -10 и -37. Мутации, детектированные в позиции -12 гена eis, также вызывают устойчивость к капреомицину, что имеет диагностическую значимость. PCR analysis was performed using 10-12 μl of purified DNA, isolated from isolates by magnetic particle sorption with a commercial Promega kit, which was added to a 2-fold reaction mixture (final volume 24 μl) containing 5-6 pmol of each of the primers, 5- 10 pmol of each probe, 2.5 mm MgCI 2 , 3 units Taq DNA polymerase (MBI Fermentas), and 200 microM each of dNTP. PCR reactions were performed on a DT-96 thermocycler (DNA technology, RF) under identical conditions according to the protocol with preamplification: 1st stage - 95 ° - 6 min; 2nd stage - 95 ° - 15 sec, 62 ° - 20 sec, 72 ° - 25 sec (9 cycles); 3rd stage: 95 ° - 15 sec, 66 ° - 40 sec (30 cycles with reading). The results of the detection of resistance to kanamycin, amikacin and capreomycin obtained by cultivating bacterial cultures, the proposed method of MPCR and sequencing are presented in table 3. As a result, it is shown that not only mutations of resistance to aminoglycosides and capreomycin in the rrs gene are detected in isolates of the XDR phenotype , such as at position 1401, mutations of resistance to aminoglycosides only at positions 514c and 517t of the rrs gene, as well as mutations in the promoter region of the eis gene at positions -10 and -37. Mutations detected at the -12 position of the eis gene also cause capreomycin resistance, which is of diagnostic significance.
Таблица 3. Результаты ПЦР-определения устойчивости или чувствительности к канамицину, амикацину и капреомицину в образцах ДНК монокультур, культивированных на жидких средах Bactec MGIT 960 с канамицином, амикацином и капреомицином в концентрации 30 мг/л.  Table 3. The results of PCR determination of resistance or sensitivity to kanamycin, amikacin and capreomycin in DNA samples of monocultures cultured on Bactec MGIT 960 liquid media with kanamycin, amikacin and capreomycin at a concentration of 30 mg / l.
Figure imgf000024_0001
14-3935 wt wt wt wt n/d S S
Figure imgf000024_0001
14-3935 wt wt wt wt wt n / d SS
14-4009 wt wt wt wt n/d S S 14-4009 wt wt wt wt n / d S S
14-7074 wt wt wt wt n/d S S  14-7074 wt wt wt wt wt n / d S S
14-731 1 wt wt wt wt n/d S S  14-731 1 wt wt wt wt n / d S S
13-3537 wt wt wt wt n/d S S  13-3537 wt wt wt wt n / d S S
13-3292 wt wt wt wt n/d S S  13-3292 wt wt wt wt wt n / d S S
13-3085 wt wt wt wt n/d S S  13-3085 wt wt wt wt wt n / d S S
13-3617 wt wt wt wt n/d S S  13-3617 wt wt wt wt wt n / d S S
13-3632 wt wt wt wt n/d S S  13-3632 wt wt wt wt wt n / d S S
wt - дикого типа; S - чувствительный; R - резистентный; n/d - не выявлено; mut - мутация wt - wild type; S is sensitive; R is resistant; n / d - not detected; mut - mutation
Пример 3.  Example 3
Детекция мутаций устойчивости микобактерий туберкулеза к фторхинолонам и инъекционным противотуберкулезным препаратам в изолятах, выделенных из клинических образцов мокроты, предложенным способом для определения диагностической эффективности (чувствительности и специфичности) прототипа диагностической тест-системы  Detection of mutations in the resistance of tuberculosis mycobacteria to fluoroquinolones and injectable anti-TB drugs in isolates isolated from clinical sputum samples by the proposed method for determining the diagnostic effectiveness (sensitivity and specificity) of a prototype diagnostic test system
Анализ проб из 68 изолятов, монокультур, выделенных из клинических образцов, был проведен предлагаемым способом одновременной постановки МПЦР-детекции мутаций устойчивости к фторхинолонам (офлоксацин) и канамицину, амикацину и капреомицину. Все образцы были ранее фенотипически определены культивированием в среде ВАСТЕС, а также секвенированием, как 34 с широкой лекарственной устойчивостью и 34 чувствительных к антибиотикам второго ряда. Во всех случаях результаты секвенирования ДНК из тех же штаммов совпадали с фенотипическими данными.  Analysis of samples from 68 isolates, monocultures, isolated from clinical samples, was carried out by the proposed method for the simultaneous formulation of MPCR detection of mutations of resistance to fluoroquinolones (ofloxacin) and kanamycin, amikacin and capreomycin. All samples were previously phenotypically determined by cultivation in WASTES medium, as well as sequencing, as 34 with extensive drug resistance and 34 sensitive to second-line antibiotics. In all cases, the results of DNA sequencing from the same strains coincided with phenotypic data.
ПЦР-анализ проводился с использованием 10-12 мкл очищенной ДНК, выделенной из изолятов сорбцией на магнитных частицах коммерческим набором Promega, которую добавляли в 2х-кратную реакционную смесь (конечный объем 24 мкл), содержащую 5-6 пмоль каждого из праймеров, 5-10 пмоль каждого зонда, 2,5 мМ MgCI2, 3 ед. Taq ДНК полимеразы (MBI Fermentas), и 200 микроМ каждого из дНТФ. Все ПЦР-реакции проводятся в одинаковых условиях по протоколу с преамплификацией: 1 -й этап - 95° - 6 мин; 2-й этап - 95° - 15 сек, 62° - 20 сек, 72° - 25 сек (9 циклов); 3-й этап: 95° - 15 сек, 66° - 40 сек (30 циклов с чтением). PCR analysis was carried out using 10-12 μl of purified DNA isolated from isolates by sorption on magnetic particles with a commercial Promega kit, which added to a 2-fold reaction mixture (final volume 24 μl) containing 5-6 pmol of each of the primers, 5-10 pmol of each probe, 2.5 mm MgCI 2 , 3 units Taq DNA polymerase (MBI Fermentas), and 200 microM each of dNTP. All PCR reactions are carried out under identical conditions according to the protocol with preamplification: 1st stage - 95 ° - 6 min; 2nd stage - 95 ° - 15 sec, 62 ° - 20 sec, 72 ° - 25 sec (9 cycles); 3rd stage: 95 ° - 15 sec, 66 ° - 40 sec (30 cycles with reading).
Общая продолжительность амплификации составила 1 час 30 минут.  The total duration of amplification was 1 hour 30 minutes.
Таблица 4. Результаты ПЦР-определения устойчивости или чувствительности к фторхинолонам и канамицину, амикацину и капреомицину в образцах ДНК монокультур, культивированных на жидких средах Bactec MGIT 960  Table 4. Results of PCR determination of resistance or sensitivity to fluoroquinolones and kanamycin, amikacin and capreomycin in monoculture DNA samples cultured on Bactec MGIT 960 liquid media
Gyr A  Gyr a
Rrs Rrs eis eis Gyr В  Rrs Rrs eis eis Gyr B
Образец Фенотип 94/91/ Секвенирование  Sample Phenotype 94/91 / Sequencing
1401 514/517 -10/-12 -37 539/540  1401 514/517 -10 / -12 -37 539/540
90/89  90/89
Rrs 1401 g, 514c,gyrA Rrs 1401 g, 514c, gyrA
14-2210 ШЛУ m m wt wt ml wt 14-2210 XDR m m wt wt ml wt wt
94G 94g
Wt/wt/ Wt / wt /
14-1216 ШЛУ m wt wt wt m Rrs1401 g, gyr90V m/wt  14-1216 XDR m wt wt wt wt m Rrs1401 g, gyr90V m / wt
Rrs 514c, eis-10a, Rrs 514c, eis-10a,
14-2020 ШЛУ wt m m wt ml wt 14-2020 XDR wt m m wt ml wt
gyr A 94G gyr A 94G
14-1224 ШЛУ wt wt wt m ml wt Eis -37a, gyrA 94N14-1224 XDR wt wt wt m ml wt Eis -37a, gyrA 94N
14-101 1 ШЛУ wt wt m wt ml wt Eis-10, gyrA 94A 14-101 1 XDR wt wt m wt ml wt Eis-10, gyrA 94A
Wt/wt/  Wt / wt /
14-1 155 ШЛУ wt wt m wt wt Eis-10a, gyrA 90V m/wt  14-1 155 XDR wt wt m wt wt Eis-10a, gyrA 90V m / wt
Rrs 514, 517, gyrA Rrs 514, 517, gyrA
14-1056 ШЛУ wt m wt wt ml m 14-1056 XDR wt m wt wt ml m
94N 94N
14-4519 ШЛУ wt wt m wt ml wt Eis-12a, gyrA 94A14-4519 XDR XT wt wt m wt ml wt Eis-12a, gyrA 94A
14-2036 ШЛУ wt wt wt m ml wt Eis-37, gyrA 94G14-2036 XDR, wt wt wt m ml wt Eis-37, gyrA 94G
14-2228 ШЛУ wt wt m wt wt m Eis-10a, gyrB 539N m/wt/wt 14-2228 XDR wt wt m wt wt m Eis-10a, gyrB 539N m / wt / wt
14-2282 ШЛУ wt wt m wt wt Eis-10a, gyrA 94H  14-2282 XDR XT wt wt m wt wt Eis-10a gyrA 94H
/wr  / wr
14-2287 ШЛУ m wt wt wt ml wt Rrs 1401 g, gyrA 94H  14-2287 XDR m wt wt wt wt wt wt Rrs 1401 g, gyrA 94H
Rrs 1401 g, 517, gyrA Rrs 1401 g, 517, gyrA
14-2238 ШЛУ m m wt wt m wt 14-2238 XDR m m wt wt m wt
94A 94A
Rrs517, eis-10,Rrs517, eis-10,
14-2239 ШЛУ wt m m wt wt wt 14-2239 XDR wt m m wt wt wt
gyrA 94N gyrA 94N
14-2426 ШЛУ m wt wt wt m wt Rrs 1401 g, gyrA 94G 14-2426 XDR m wt wt wt m wt Rrs 1401 g, gyrA 94G
Rrs 1401 g, дуг В Rrs 1401 g, arc B
14-2426 ШЛУ m wt wt wt wt m 14-2426 XDR m wt wt wt wt wt m
540D 540D
Wt/m/w Wt / m / w
14-2427 ШЛУ m wt wt wt wt Rrs 1401 g, gyrA 91 P t/wt  14-2427 XDR m wt wt wt wt wt Rrs 1401 g, gyrA 91 P t / wt
14-7518 Чувств. wt wt wt wt wt wt n/d 14-7518 Senses. wt wt wt wt wt wt wt n / d
14-7519 Чувств. wt wt wt wt wt wt n/d14-7519 Senses. wt wt wt wt wt wt wt n / d
14-7536 Чувств. wt wt wt wt wt wt n/d14-7536 Senses. wt wt wt wt wt wt wt n / d
14-7578 Чувств. m wt wt m wt wt n/d14-7578 Senses. m wt wt m wt wt n / d
14-7673 Чувств. wt wt wt wt wt wt n/d14-7673 Senses. wt wt wt wt wt wt wt n / d
14-7696 Чувств. wt wt wt wt wt wt n/d14-7696 Senses. wt wt wt wt wt wt wt n / d
14-7715 Чувств. wt wt wt wt wt wt n/d14-7715 Senses. wt wt wt wt wt wt wt n / d
14-7752 ШЛУ wt m wt wt wt wt Rrs 517, n/d14-7752 XDR wt m wt wt wt wt wt Rrs 517, n / d
14-7760 ШЛУ wt wt wt wt wt m n/d, gyr B 539N14-7760 XDR XT wt wt wt wt wt wt m n / d, gyr B 539N
14-7793 Чувств. wt wt wt wt wt wt n/d14-7793 Senses. wt wt wt wt wt wt wt n / d
14-7838 Чувств. wt wt wt wt wt wt n/d14-7838 Senses. wt wt wt wt wt wt wt n / d
14-7839 Чувств. wt wt wt wt wt wt n/d14-7839 Senses. wt wt wt wt wt wt wt n / d
14-7846 Чувств. wt wt wt wt wt wt n/d Rrs 1401 g, дуг В14-7846 Senses. wt wt wt wt wt wt wt n / d Rrs 1401 g, arc B
14-7849 ШЛУ m wt wt wt wt m 14-7849 XDR m wt wt wt wt wt m
539P 539P
14-4001 Чувств. wt wt wt wt wt wt wt 14-4001 Senses. wt wt wt wt wt wt wt wt
Rrs 1401 g, rrs 517, Rrs 1401 g, rrs 517,
14-4096 ШЛУ m m wt wt m wt 14-4096 XDR m m wt wt m wt
gyr A 94N gyr A 94N
14-41 16 ШЛУ m wt wt wt m wt Rrs 1401 g, gyr A 94G14-41 16 XDR m wt wt wt m wt Rrs 1401 g, gyr A 94G
14-4284 ШЛУ wt wt m wt m wt Eis-12, gyrA 90V14-4284 XDR XT wt wt m wt m wt Eis-12, gyrA 90V
14-4842 Чувств. wt wt wt m wt wt n/d14-4842 Senses. wt wt wt m wt wt n / d
13-3085 Чувств. wt wt wt wt wt wt n/d13-3085 Senses. wt wt wt wt wt wt wt n / d
14-5724 Чувств. wt wt wt wt wt wt n/d 14-5724 Senses. wt wt wt wt wt wt wt n / d
Rrs 1401 g, eis-10, Rrs 1401 g, eis-10,
14-5729 ШЛУ m wt m wt m wt 14-5729 XDR m wt m wt m wt
gyrA 94N gyrA 94N
14-5754 ШЛУ m wt wt wt m wt Rrs 1401 g, gyrA 94H14-5754 XDR m wt wt wt m wt Rrs 1401 g, gyrA 94H
14-6009 Чувств. wt wt m wt m m n/d14-6009 Senses. wt wt m wt m m n / d
14-6072 Чувств. wt wt wt wt wt wt n/d14-6072 Senses. wt wt wt wt wt wt wt n / d
14-6386 Чувств. wt wt wt wt wt wt n/d14-6386 Senses. wt wt wt wt wt wt wt n / d
14-6449 Чувств. wt wt m wt wt wt n/d14-6449 Senses. wt wt m wt wt wt n / d
14-6494 Чувств. wt wt wt wt wt wt n/d14-6494 Senses. wt wt wt wt wt wt wt n / d
14-6835 Чувств. wt wt wt wt wt wt n/d14-6835 Senses. wt wt wt wt wt wt wt n / d
14-6939 Чувств. wt wt wt wt wt wt n/d14-6939 Senses. wt wt wt wt wt wt wt n / d
14-6969 Чувств. wt wt wt wt wt wt n/d14-6969 Senses. wt wt wt wt wt wt wt n / d
14-7173 Чувств. wt wt wt wt wt wt n/d14-7173 Senses. wt wt wt wt wt wt wt n / d
14-541 1 Чувств. wt wt wt wt wt wt n/d14-541 1 Senses. wt wt wt wt wt wt wt n / d
14-5462 Чувств. wt wt wt wt wt wt n/d14-5462 Senses. wt wt wt wt wt wt wt n / d
14-5432 Чувств. wt wt wt wt wt wt n/d14-5432 Senses. wt wt wt wt wt wt wt n / d
14-1028 Чувств. wt wt wt wt wt wt n/d 14-1028 Senses. wt wt wt wt wt wt wt n / d
wt - дикого типа; S - чувствительный; R - резистентный; n/d - не выявлено; m - мутация  wt - wild type; S is sensitive; R is resistant; n / d - not detected; m - mutation
По результатам детекции мутаций устойчивости к инъекционным противотуберкулезным препаратам канамицину, амикацину и капреомицину (SL) и фторхинолону офлоксацину (FQ) предложенным способом и верификации секвенированием были определены диагностические характеристики (чувствительность и специфичность), как представлено в таблице 5. Предлагаемым МПЦР способом только в трех из 34 образцов ШЛУ не было детектировано мутаций устойчивости к фторхинолонам в позициях 89, 90, 91 и 94 в гене gyrA, 539 и 540 в гене gyrB, что было подтверждено секвенированием полной рамки считывания этих генов. В пяти из 34 образцов ШЛУ не было детектировано известных мутаций устойчивости к канамицину, амикацину и капреомицину, а также предлагаемых к детекции мутаций в промотороной области гена eis, что также подтверждено секвенированием генов rrs и eis.  According to the results of detection of mutations in resistance to injectable anti-tuberculosis drugs kanamycin, amikacin and capreomycin (SL) and fluoroquinolone ofloxacin (FQ) by the proposed method and verification by sequencing, diagnostic characteristics (sensitivity and specificity) were determined, as presented in Table 5. Only three of 34 XDR samples, no fluoroquinolone resistance mutations were detected at positions 89, 90, 91 and 94 in the gyrA gene, 539 and 540 in the gyrB gene, which was confirmed by complete sequencing reading frames of these genes. In five of 34 XDR samples, no known mutations of resistance to kanamycin, amikacin, and capreomycin were detected, as well as mutations proposed in the promoter region of the eis gene, which is also confirmed by sequencing of the rrs and eis genes.
Диагностическая чувствительность по выявлению устойчивости к офлоксацину составила 91 ,2% (31/34), тогда как диагностическая чувствительность устойчивости к инъекционным противотуберкулезным препаратам составила 82,4% (28/34), что выше, чем у существующих коммерческих тест-систем, таких как GenoType MTBDRp/us /GenoType MTBDRs/, из-за отсутствия в них детекции мутаций в промотороной области гена eis. Вклад мутаций в промотороной области гена eis в позициях -10, -12 и -37 составил около 39% среди всех образцов ШЛУ, если учитывать, что в некоторых из них также были обнаружены мутации c517t и а514с гена rrs. Только мутации в позициях -10, - 12 и -37 гена eis были обнаружены в 23.5% (8/34) всех ШЛУ образцов с устойчивостью к канамицину и амикацину, что, видимо, отражает диагностическую значимость этих мутаций. The diagnostic sensitivity for the detection of ofloxacin resistance was 91.2% (31/34), while the diagnostic sensitivity for injectable anti-tuberculosis drugs was 82.4% (28/34), which is higher than the existing commercial test systems, such as GenoType MTBDRp / us / GenoType MTBDRs /, due to the lack of detection of mutations in the promoter region of the eis gene. The contribution of mutations in the promoter region of the eis gene at positions –10, –12, and –37 was about 39% among all XDR samples, if we take into account that mutations c517t and a514c of the rrs gene were also found in some of them. Only mutations at positions –10, –12, and –37 of the eis gene were found in 23.5% (8/34) of all XDR specimens with resistance to kanamycin and amikacin, which apparently reflects the diagnostic significance of these mutations.
Диагностическая специфичность составила 100%, т.к. мутаций среди чувствительных образцов выявлено не было.  Diagnostic specificity was 100%, because no mutations were detected among sensitive samples.
Таблица 5. Диагностическая характеристики детекции мутаций устойчивости к канамицину, амикацину и капреомицину (SL) и фторхинолону (FQ) на выборке изолятов предлагаемым способом. Table 5. Diagnostic characteristics of the detection of mutations of resistance to kanamycin, amikacin and capreomycin (SL) and fluoroquinolone (FQ) in a sample of isolates by the proposed method.
Figure imgf000028_0001
Figure imgf000028_0001

Claims

Формула изобретения Claim
1. Способ определения устойчивости микобактерий туберкулеза к противотуберкулезным препаратам второго ряда, где указанный способ включает одновременную детекцию мутаций в ДНК микобактерий туберкулеза биологического образца, приводящих к устойчивости микроорганизмов к противотуберкулезным препаратам второго ряда в участках генов gyrA, дугВ, rrs и промоторной области eis посредством мультиплексной полимеразной цепной реакции в режиме реального времени с использованием праймеров для амплификации и зондов детекции, которые комплементарны указанным участкам генов gyrA, дугВ, rrs и промоторной области eis, где противотуберкулезные препараты второго ряда представляют собой фторхинолоны, аминогликозиды и капреомицин.  1. A method for determining the resistance of Mycobacterium tuberculosis to second-line anti-TB drugs, where the method includes the simultaneous detection of mutations in the DNA of Mycobacterium tuberculosis of a biological sample, leading to the resistance of microorganisms to anti-TB drugs of the second row in the regions of the gyrA, arcs, rrs and eis promoter regions by multiplex real-time polymerase chain reaction using amplification primers and detection probes that are complementary the indicated regions of the genes gyrA, arcs, rrs and the promoter region of eis, where second-line anti-TB drugs are fluoroquinolones, aminoglycosides and capreomycin.
2. Способ по п. 1 , где аминогликозиды представляют собой канамицин и амикацин, фторхинолоны представляют собой офлоксацин, моксифлоксацин, левофлоксацин.  2. The method of claim 1, wherein the aminoglycosides are kanamycin and amikacin, the fluoroquinolones are ofloxacin, moxifloxacin, levofloxacin.
3. Способ по п. 1 , где все реакции детекции мутаций устойчивости к противотуберкулезным препаратам второго ряда осуществляются в одном температурном режиме амплификации.  3. The method according to p. 1, where all the reactions of the detection of mutations of resistance to second-line anti-TB drugs are carried out in the same temperature amplification mode.
4. Способ по п.1 , отличающийся тем, что указанный биологический образец представляет собой непосредственно материал клинического образца или предварительно выращенную культуру микроорганизмов.  4. The method according to claim 1, characterized in that said biological sample is directly a material of a clinical sample or a pre-grown culture of microorganisms.
5. Способ по п.1 , отличающийся тем, что способ проводят для более чем одного биологического образца.  5. The method according to claim 1, characterized in that the method is carried out for more than one biological sample.
6. Способ по п. 1 , где указанные участки генов выбраны из группы, включающей кодоны 89, 90, 91 и 94 гена gyrA, кодоны 539 и 540 гена дугВ, позиции 1401 , 514 и 517 гена rrs, позиции -10, -12 и -37 промоторной области гена eis или их комбинации.  6. The method according to p. 1, where these sections of the genes are selected from the group comprising codons 89, 90, 91 and 94 of the gyrA gene, codons 539 and 540 of the arc gene, positions 1401, 514 and 517 of the rrs gene, positions -10, -12 and the -37 promoter region of the eis gene, or combinations thereof.
7. Способ по любому из пп. 1-6, где указанные зонды детекции представляют собой олигонуклеотидные последовательности длиной 19-23 нуклеотида, применяемые для детекции мутаций в кодонах 89, 90, 91 и 94 гена gyrA и в кодонах 539 и 540 гена дугВ для выявления мутаций устойчивости к фторхинолонам.  7. The method according to any one of paragraphs. 1-6, where these detection probes are oligonucleotide sequences of 19-23 nucleotides in length used to detect mutations in codons 89, 90, 91 and 94 of the gyrA gene and in codons 539 and 540 of the arc gene to detect mutations of resistance to fluoroquinolones.
8. Способ по любому из пп. 1-6, где указанные зонды детекции представляют собой олигонуклеотидные последовательности длиной 24-29 нуклеотида, применяемые для детекции мутаций в позициях -10, -12 и -37 промоторной области гена eis для выявления мутаций устойчивости к канамицину, амикацину и/или капреомицину.  8. The method according to any one of paragraphs. 1-6, wherein said detection probes are 24-29 nucleotide oligonucleotide sequences used to detect mutations at positions -10, -12 and -37 of the promoter region of the eis gene to detect mutations in resistance to kanamycin, amikacin and / or capreomycin.
9. Способ по любому из пп. 1-6, где указанные зонды детекции представляют собой олигонуклеотидные последовательности длиной 19-20 нуклеотида, применяемые для детекции мутаций в позиции 1401 , 514 и 517 гена rrs для выявления мутаций устойчивости к канамицину, амикацину и /или капреомицину.  9. The method according to any one of paragraphs. 1-6, where these detection probes are 19-20 nucleotide oligonucleotide sequences used to detect mutations at positions 1401, 514 and 517 of the rrs gene to detect mutations in resistance to kanamycin, amikacin and / or capreomycin.
27 27
ЗАМЕНЯЮЩИЙ ЛИСТ (ПРАВИЛО 26) SUBSTITUTE SHEET (RULE 26)
10. Способ по любому из пп. 1-6, где указанные зонды включают нуклеотидные последовательности, выбранные из представленных в SEQ ID NO:7-14, 17-19, 26- 31 или их комбинации. 10. The method according to any one of paragraphs. 1-6, where these probes include nucleotide sequences selected from those presented in SEQ ID NO: 7-14, 17-19, 26-31, or combinations thereof.
11. Способ по любому из пп. 1-6, где указанные праймеры для амплификации включают нуклеотидные последовательности, выбранные из представленных в SEQ ID NO: 1-6, 15, 16, 20-25 или их комбинации.  11. The method according to any one of paragraphs. 1-6, where these primers for amplification include nucleotide sequences selected from those presented in SEQ ID NO: 1-6, 15, 16, 20-25, or combinations thereof.
12. Набор зондов детекции для осуществления способа по любому из пп. 1-11 , в котором указанные зонды включают нуклеотидные последовательности, выбранные из группы, состоящей из представленных в SEQ ID NO: 7-14, 17-19, 26- 31 или их комбинации.  12. A set of detection probes for implementing the method according to any one of paragraphs. 1-11, in which these probes include nucleotide sequences selected from the group consisting of those presented in SEQ ID NO: 7-14, 17-19, 26-31, or a combination thereof.
13. Набор праймеров амплификации для осуществления способа по любому из пп. 1-11 , в котором указанные праймеры включают нуклеотидные последовательности, выбранные из группы, состоящей из представленных в SEQ ID NO: 1-6, 15, 16, 20-25 или их комбинации.  13. A set of amplification primers for implementing the method according to any one of paragraphs. 1-11, in which these primers include nucleotide sequences selected from the group consisting of those presented in SEQ ID NO: 1-6, 15, 16, 20-25, or a combination thereof.
14. Применение способа по любому из пп. 1-11 для подтверждения клинического диагноза туберкулеза с широкой лекарственной устойчивостью.  14. The application of the method according to any one of paragraphs. 1-11 to confirm the clinical diagnosis of extensively drug-resistant tuberculosis.
28 28
ЗАМЕНЯЮЩИЙ ЛИСТ (ПРАВИЛО 26)  SUBSTITUTE SHEET (RULE 26)
PCT/RU2016/050051 2015-12-01 2016-10-17 Method for the molecular genetic detection of mycobacterium tuberculosis resistance to second-line anti-tuberculosis drugs (fluoroquinolines, aminoglycosides and capreomycin) WO2017095271A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
RU2015151395A RU2633507C2 (en) 2015-12-01 2015-12-01 Method for molecular-genetic detection of tuberculosis microbacteria resistance to antitubercular preparations of second series (fluoroquinolones, aminoglycosides and capreomicin)
RU2015151395 2015-12-01

Publications (1)

Publication Number Publication Date
WO2017095271A1 true WO2017095271A1 (en) 2017-06-08

Family

ID=58797544

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/RU2016/050051 WO2017095271A1 (en) 2015-12-01 2016-10-17 Method for the molecular genetic detection of mycobacterium tuberculosis resistance to second-line anti-tuberculosis drugs (fluoroquinolines, aminoglycosides and capreomycin)

Country Status (2)

Country Link
RU (1) RU2633507C2 (en)
WO (1) WO2017095271A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109797193A (en) * 2019-02-15 2019-05-24 安徽理工大学 A kind of Drug Resistance of Mycobacterium Tuberculosis detection method

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
RU2562866C1 (en) * 2014-11-11 2015-09-10 Федеральное Государственное Бюджетное Учреждение Науки Институт Молекулярной Биологии Им. В.А. Энгельгардта Российской Академии Наук (Имб Ран) Detection method of dna of tuberculosis causative agent with simultaneous identification of its genotype and determination of genetic determinants of multiple and wide drug resistance, oligonucleotide microchip, set of primers and set of oligonucleotide probes, which are used in method
WO2015172734A1 (en) * 2014-05-15 2015-11-19 中国疾病预防控制中心传染病预防控制所 Combination of specific fragments of drug resistance gene for four kinds of second-line drugs of mycobacterium tuberculosis and use thereof

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2015172734A1 (en) * 2014-05-15 2015-11-19 中国疾病预防控制中心传染病预防控制所 Combination of specific fragments of drug resistance gene for four kinds of second-line drugs of mycobacterium tuberculosis and use thereof
RU2562866C1 (en) * 2014-11-11 2015-09-10 Федеральное Государственное Бюджетное Учреждение Науки Институт Молекулярной Биологии Им. В.А. Энгельгардта Российской Академии Наук (Имб Ран) Detection method of dna of tuberculosis causative agent with simultaneous identification of its genotype and determination of genetic determinants of multiple and wide drug resistance, oligonucleotide microchip, set of primers and set of oligonucleotide probes, which are used in method

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
BESPIATYKH IU.A. ET AL.: "Opredelenie lekarstvennoi ustoichivosti genotipirovanie klinicheskikh shtammov Mycobacterium tuberculosis pri pomoshchi eksperimentalnogo nabora ''TB-TEST''.", PULMONOLOGIIA, 2013, pages 77 - 81 *
LIU Q. ET AL.: "Triplex real-time PCR melting curve analysis for detecting Mycobacterium tuberculosis mutations associated with resistance to second-line drugs in a single reaction .", J. ANTIMICROB CHEMOTHER, vol. 68, 2013, pages 1097 - 1103, XP055225177 *
RODWELL T.C. ET AL.: "Predicting extensively drug-resistant Mycobacterium tuberculosis phenotypes with genetic mutations.", JOURNAL OF CLINICAL MICROBIOLOGY, vol. 52, no. 3, 2014, pages 781 - 789, XP055387650 *
ZIMENKOV D.V. ET AL.: "Detection of second-line drag resistance in Mycobacterium tuberculosis using oligonucleotide microarrays.", BMC INFECTIOUS DISEASES, vol. 13, 2013, pages 240 - 247, XP021152041 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109797193A (en) * 2019-02-15 2019-05-24 安徽理工大学 A kind of Drug Resistance of Mycobacterium Tuberculosis detection method

Also Published As

Publication number Publication date
RU2015151395A (en) 2017-07-19
RU2633507C2 (en) 2017-10-12

Similar Documents

Publication Publication Date Title
Soini et al. Molecular diagnosis of mycobacteria
Guo et al. Rapid, accurate determination of multidrug resistance in M. tuberculosis isolates and sputum using a biochip system
Thomas et al. Development of a real-time Staphylococcus aureus and MRSA (SAM-) PCR for routine blood culture
US20130095489A1 (en) Process for detection of multidrug resistant tuberculosis using real-time pcr and high resolution melt analysis
CN102471806B (en) Composition for separately detecting mycobacterium tuberculosis complex and mycobacterium genus, and method for simultaneously detecting mycobacterium tuberculosis and mycobacteria genus by real-time multiplex polymerase chain reaction using the composition
Reddington et al. Novel multiplex real-time PCR diagnostic assay for identification and differentiation of Mycobacterium tuberculosis, Mycobacterium canettii, and Mycobacterium tuberculosis complex strains
KR100454585B1 (en) Microarray comprising probes for Mycobacteria genotyping, M. tuberculosis strain differentiation and antibiotic-resistance detection
Nasr Esfahani et al. Rapid and accurate identification of Mycobacterium tuberculosis complex and common non-tuberculous mycobacteria by multiplex real-time PCR targeting different housekeeping genes
Isola et al. A Pyrosequencing assay for rapid recognition of SNPs in Mycobacterium tuberculosis embB306 region
KR101377070B1 (en) Method for distinguishing between Mycobacterium tuberculosis and nontuberculous mycobacteria and composition therefor
EP2947158B1 (en) Diagnostic method
Imperiale et al. Rapid detection of multidrug-resistant Mycobacterium tuberculosis by multiplex allele-specific polymerase chain reaction
Wang et al. Identification of Mycobacterium species in direct respiratory specimens using reverse blot hybridisation assay
Jung et al. Evaluation of three real-time PCR assays for differential identification of Mycobacterium tuberculosis complex and nontuberculous mycobacteria species in liquid culture media
Brossier et al. Molecular detection methods of resistance to antituberculosis drugs in Mycobacterium tuberculosis
Malhotra et al. Rapid detection of rifampicin resistance in Mycobacterium tuberculosis by high-resolution melting curve analysis
WO2002022872A1 (en) Multiplex pcr method and kit and oligonucleotides for detection and identification of mycobacteria using the multiplex pcr method
RU2619258C2 (en) Method for determination of mycobacterium tuberculosis resistance to rifampicin and isoniazid
RU2633507C2 (en) Method for molecular-genetic detection of tuberculosis microbacteria resistance to antitubercular preparations of second series (fluoroquinolones, aminoglycosides and capreomicin)
EA028354B1 (en) Use of type ii toxin-antitoxin system genes to genotype strains of mycobacterium tuberculosis
Han et al. Simultaneous detection and identification of bacteria and fungi in cerebrospinal fluid by TaqMan probe-based real-time PCR
Glennon et al. Detection and diagnosis of mycobacterial pathogens using PCR
Wang et al. Evaluation of the quantamatrix multiplexed assay platform system for simultaneous detection of Mycobacterium tuberculosis and the rifampicin resistance gene using cultured mycobacteria
AU2004271214C1 (en) Primers for use in detecting beta-lactamases
CA2481517A1 (en) Detection of mycobacteria in clinical material

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16871134

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

32PN Ep: public notification in the ep bulletin as address of the adressee cannot be established

Free format text: NOTING OF LOSS OF RIGHTS PURSUANT TO RULE 112(1) EPC (EPO FORM 1205A DATED 11.10.2018)

122 Ep: pct application non-entry in european phase

Ref document number: 16871134

Country of ref document: EP

Kind code of ref document: A1