CN109797193A - A kind of Drug Resistance of Mycobacterium Tuberculosis detection method - Google Patents
A kind of Drug Resistance of Mycobacterium Tuberculosis detection method Download PDFInfo
- Publication number
- CN109797193A CN109797193A CN201910117243.6A CN201910117243A CN109797193A CN 109797193 A CN109797193 A CN 109797193A CN 201910117243 A CN201910117243 A CN 201910117243A CN 109797193 A CN109797193 A CN 109797193A
- Authority
- CN
- China
- Prior art keywords
- mycobacterium tuberculosis
- gene
- pyrazinamide
- pnca
- drug resistance
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to technical field of biotechnology, specifically a kind of Drug Resistance of Mycobacterium Tuberculosis detection method, this method comprises the following steps: cracking mycobacterium tuberculosis is used for the template of PCR reaction；PCR primer is designed, pyrazinamidase (pncA) gene of overall length is expanded；The pncA genetic fragment of concentration amplification is simultaneously quantitative；PncA enzyme is expressed using wheat embryo cell-free expression system；The pncA enzymatic conversion pyrazinamide of measurement expression is the activity of pyrazine acid, and with the pncA activity ratio of the tubercle bacillus standard sensitive strain and persister equally expressed compared with measurement mycobacterium tuberculosis pyrazinamide drug resistance；By the present invention in that drug resistance caused by capable of being measured because of pncA gene mutation with pair of primers；The primer sequence that overall length pncA gene is suitble to wheat embryo cell-free expression system expression pyrazinamidase again can be expanded from tubercle bacillus gene group by also disclosing；And then realize quick, Sensitive Detection mycobacterium tuberculosis pyrazinamide drug resistance, and be not necessarily to Bacteria Culture.
Description
Technical field
The invention belongs to technical field of biotechnology, specifically a kind of Drug Resistance of Mycobacterium Tuberculosis detection method.
Background technique
Tuberculosis is to threaten one of maximum infectious disease to the mankind, although mycobacterium bovis vaccine (BCG) and respectively
Kind of antituberculotic is widely applied in the world, but in recent years, with increasing for movement of population and the density of population,
The appearance of tubercle bacillus multiple antibiotic resistant strain and same human immunodeficiency virus (HIV) double infection, tuberculosis is in flourishing state
Family and developing country are in wreak havoc situation once again.It is reported that global about 880 Wan Xinfa tuberculosis patients in 2005, every year about
There are 1,600,000 people to die of tuberculosis.Due to lungy with a long history, status of drug resistance lungy is extremely serious, multidrug resistant and
The appearance of super persister a, it has also become problem in tuberculotherapy.The Resistance detection of tubercle bacillus faces guidance
Bed correctly taking drugs and effectively control tuberculosis have very important effect.Since the growth of mycobacterium tuberculosis is very slow,
Traditional drug sensitive test needs that clinical application cannot be instructed in time up to 1~2 month, may make to infect drug resistance tuberculosis
Patient cannot correctly treat in this period.Therefore, quickly, sensitive, the method for specific detection Mycobacterium tuberculosis drug-resistant is to knot
Early diagnosis, effective chemotherapy and the control of core disease, which are propagated, extremely important meaning.
Used at present for treating in clinical medicine lungy, pyrazinamide is one of line antituberculotic.
The drug resistance method for clinically detecting pyrazinamide at present can be mainly divided into Phenotypic examination (Bacteria Culture) and genetic test two
Class, and based on the former.Due to tulase slow growth, not only need up to 1~2 month, but also to pyrazinamide
Resistance detection needs carry out in acid medium, height are required to the pH value control of culture medium, even often leading to same
The result of laboratory different time measurement is also inconsistent.And the method for genetic test is mainly measured and is produced with detection of pyrazinamide resistance
The site mutation of raw closely related pyrazinamide enzyme gene (pncA).Reported method has genetic chip, gene sequencing column
The methods of.All gene testers can only according to it has been reported that there is the mutational site of correlation to judge with drug resistance
Whether drug resistance.But due to many site mutations of pncA gene, can all lead to the generation of detection of pyrazinamide resistance, and newly
Mutational site is also constantly reporting that therefore, the result of various genetic tests is easy to produce false negative, can only also need as reference
Traditional drug sensitive experiment is wanted to be verified.It is a series of studies have shown that detection of pyrazinamide resistance generate with tuberculosis pncA gene expression
Pyrazinamidase loss of activity have 90% or more correlation, therefore also someone report by directly measure tuberculosis branch bar
The pyrazinamide enzymatic activity of bacterium measures the detection of pyrazinamide resistance of tubercle bacillus.But due to pyrazinamidase in tubercle bacillus
Content is few, and this method also needs just to can be carried out after carrying out tubercle bacillus culture amplification, the time needed and traditional susceptibility
Time is similar.Based on above reason, there are no the measurement mycobacterium tuberculosis pyrazinamide drug resistances of standard in the world at present
The method of property.
External protein Cell free expression system is one kind using exogenous DNA as template, utilizes the albumen in cell extract
Synthesis machine, the protein folding factor and other related enzyme systems are realized by addition amino acid, T7 polymerase and energy matter etc.
The system quickly expressed outside aleuroplast.What is be commonly used has the cell cracking of rabbit reticulated red blood cells, wheat embryo, Escherichia coli
Liquid.Using rabbit reticulated red blood cells expression system, Japanese Scientists reported a kind of measurement mycobacterium tuberculosis pyrazine in 2001
The method of amide drug resistance.Since in rabbit reticulated red blood cells expression system, solution is peony, with pyrazinamide enzyme assay
Reaction product color it is close, need to carry out decolorization to solution, increase detection time and cost, decoloration not exclusively also can
Bring new error.In this report, wheat embryo expression system is also used, but effect is unobvious, detection sensitivity degree compares rabbit
Far short of what is expected times of reticulated red blood cells.In addition, the PCR primer used in this report, since part is overlapped with pncA gene order, PCR
Primer covers the pncA gene mutation site of part, results in the need for using at least two pairs of primers, could be to a tuberculosis branch
Bacillus detection of pyrazinamide resistance is detected completely, increases the complexity and cost of detection.
Summary of the invention
In order to make up for the deficiencies of the prior art, a kind of Drug Resistance of Mycobacterium Tuberculosis detection method proposed by the present invention.This
The rapid detection method that invention is mainly used for mycobacterium tuberculosis pyrazinamide drug resistance reagent (PCR primer design method and draws
Object sequence), the present invention can quickly (24 hours), and sensitive, specific detection mycobacterium tuberculosis pyrazinamide drug resistance has operation
Simplicity, it is at low cost, be not necessarily to Bacteria Culture the features such as.It, which is mainly characterized by, can accurately measure tuberculosis using pair of primers
Mycobacteria is because of drug resistance caused by pncA gene mutation.
The technical solution adopted by the present invention to solve the technical problems is: a kind of mycobacterium tuberculosis of the present invention is resistance to
Pharmacological property detection method, this method comprises the following steps:
S1: being realized by liquid nitrogen cryogenics grinding method and be crushed the bacterium wall of mycobacterium tuberculosis, and mycobacterium tuberculosis is discharged
Genome；Mycobacterium tuberculosis is cracked by non-cryogenic grinding process, can guarantee mycobacterium tuberculosis to greatest extent
The integrality of genome, and then PCR primer sequence is quickly designed according to the mycobacterium tuberculosis gene group；
S2: according to the upstream and downstream sequence design of overall length pyrazinamide enzyme gene in the tubercle bacillus gene group after being cracked in S1
PCR primer sequence, primer sequence is not Chong Die with pyrazinamidase gene order, complete to react overall length pncA gene, and PCR primer
Simultaneous with the promoter of suitable wheat embryo cell-free expression system in sequence, or simultaneous with promoter and Enhanced expressing
Son；
The primer sequence of the promoter are as follows: 5'-TAATACGACTCACTATAGG-3'；
The primer sequence of the expression enhancer are as follows:
5'-ATACTCCCCCACAACAGCTTACAATACTCCCCCACACAGC-3'；
S3: the tubercle bacillus gene group in S2 is concentrated by high speed centrifugation method, is carried out during concentration
It vacuumizes；Quantitative Treatment is carried out to the tubercle bacillus gene group by ultraviolet absorption method simultaneously, is realized by ultraviolet radiator accurate
The intensity of light is controlled, and then realizes that high-precision control is used to express the gene template amount of pyrazinamidase；Pass through high speed centrifugation
Method tubercle bacillus gene group is concentrated, on the one hand can be realized and quickly tubercle bacillus gene group be concentrated,
On the other hand the purity of tubercle bacillus gene group concentration, and then accuracy when guarantee quantitative Treatment are improved；
S4: it takes the tubercle bacillus gene group 5-15 microgram in S3 to be implanted into wheat embryo cell-free body and is expressed, expressed
Time is 1-24 hours；
S5: being the activity of pyrazine acid by the pyrazinamide enzymatic conversion pyrazinamide expressed in spectrophotometric determination S4,
And the pyrazinamidase expression activitiy with the mycobacterium tuberculosis standard sensitive strain and persister equally expressed, measure tuberculosis branch
Bacillus detection of pyrazinamide resistance；It can be realized by spectrophotometer and quickly determine pyrazinamide enzymatic activity, while guaranteeing to survey
Fixed precision is higher, and then prepares for the drug resistance of later period more in-depth study mycobacterium tuberculosis；
Preferably, the promoter of the wheat embryo cell-free expression system is T7 promoter, Enhanced expressing
For 5 ' end noncoding region enhancers and/or 3 ' end noncoding region enhancers.
The overall length pncA gene of the present invention that can expand from tubercle bacillus gene group is suitble to wheat embryo without thin again
The primer pair sequence of the promoter containing T7 of cellular expression system expression pyrazinamidase.
Primer pair P1: upstream primer sequence 5'-TAATACGACTCACTATAGGCCCGCCCGAACG-3'(SEQNO.1),
Downstream primer sequence: 5'-GCCGCCAACAGTTC-3'(SEQNO.2).
The overall length pncA gene that can expand from tubercle bacillus gene group is suitble to wheat embryo cell-free expression system
The promoter containing T7 of Enhanced expressing pyrazinamidase of uniting and the primer pair sequence of 5 ' end noncoding region enhancers: primer pair P2: column
Lift three sets of upstream primer sequences that noncoding region enhancer is held comprising difference 5 ':
5'-TAATACGACTCACTATAGGTATTTTTACAACAATTACCAACAACAACAAACAACAAACAACATTA
CAATTACTATTTACAATTACACCCGAACGTAAGGAGGACGT-3'(SEQNO.3)；Or
5'-TAATACGACTCACTATAGGATACTCCCCCACAACAGCTTACAATACTCCCCCACACAGCTTACAA
ATACTCCCCCAGTCGCCCGAACGTAAGGAGGACGT-3'(SEQNO.4)；Or
5'-TAATACGACTCACTATAGGGATTGTGAGCGATTTGCGTGCGTGCATCCCGCTTCACTGATCTCTT
GTTAGATCTTTTTATAATCAGTCGCCCGAACGTAAGGAGGACGT-3'(SEQNO.5)；
Downstream primer sequence: 5'-GCCGCCAACAGTTCATCCCGGT-3'(SEQNO.6).
By using above method provided by the invention and PCR primer, so that it may realize in 24 hours to tubercle bacillus
Detection of pyrazinamide resistance detection.
Beneficial effects of the present invention are as follows:
1. the present invention has been selected when designing PCR amplification tubercle bacillus pyrazinamidase gene primer in pyrazinamidase
Sequence is closed in the tubercle bacillus gene group of gene upstream and downstream.In this way, primer sequence will not be with pyrazinamidase gene order
It repeats, amplified production can include the pyrazinamide enzyme gene of overall length, all to the mutation in any site in pyrazinamide enzyme gene
It can be carried out detection.
2. the present invention on pyrazinamidase gene PCR primer by adding promoter, such as T7 promoter, so that wheat
Bud cell free in vitro protein expression system can express the protein gene of PCR amplification, not need to be building up on plasmid vector.
3. the present invention can introduce suitable raising albumen combined coefficient further in promoter, after T7 promoter
Sequence, such as the enhancer of 5 ' noncoding regions；The sequence for improving albumen combined coefficient can also be introduced in downstream primer sequence,
Such as the enhancer of 3 ' noncoding regions, to reach in a short time, more purposes for expressing albumen, when so as to shorten protein expression
Between, realize quickly detection.
Detailed description of the invention
Fig. 1 is a kind of Drug Resistance of Mycobacterium Tuberculosis detection method schematic diagram；
Fig. 2 is a kind of pyrazinamide enzyme gene upstream and downstream sequence and PCR primer design diagram；
Fig. 3 is that a kind of PCR primer contains suitable wheat embryo cell-free expression system promoter schematic diagram；
Fig. 4 is that PCR primer contains suitable wheat embryo cell-free expression system promoter and enhancer schematic diagram.
A, contain the primer schematic diagram of promoter and 5 ' noncoding region enhancers；
B, contain the primer schematic diagram of promoter and 3 ' noncoding region enhancers；
C, contain promoter, the primer schematic diagram of 5 ' noncoding region enhancers and 3 ' noncoding region enhancers simultaneously；
Fig. 5 is the gene magnification of pyrazinamide enzyme gene in the PCR primer amplification tuberculosis group using tape starting
Detection effect figure (B) after electrophoretogram (A) and the expression of wheat embryo cell-free vitro expression systems；
Fig. 6 is to expand pyrazinamide in tuberculosis group using the PCR primer of tape starting and 5 ' noncoding region enhancers
Detection effect figure (B) after gene magnification electrophoretogram (A) and wheat embryo cell-free the vitro expression systems expression of enzyme gene；
Specific embodiment
In order to be easy to understand the technical means, the creative features, the aims and the efficiencies achieved by the present invention, tie below
Specific embodiment is closed, the present invention is further explained.
As shown in Figures 1 to 6, the present invention is a kind of Drug Resistance of Mycobacterium Tuberculosis detection method, below with reference to Fig. 1 to this
Invention is described in further detail.
Embodiment 1:
Using the PCR amplification overall length tubercle bacillus pyrazinamidase of promoter containing T7 gene primer-wheat embryo cell-free body
The detection of pyrazinamide resistance of outer protein expression measurement tuberculosis pyrazinamide sensitive strain (H37RA) and pyrazinamide persister (BCG).
1. liquid nitrogen cryogenics grinding cracking mycobacterium tuberculosis quickly prepares the template for PCR reaction: taking tuberculosis bacterium solution
1ml, 4000rpm are centrifuged 1min, remove supernatant, after collecting thallus, 500ul liquid nitrogen cryogenics are added and grind 5min, then
6000rpm is centrifuged 3min, the careful template for drawing supernatant as amplification pyrazinamide enzyme gene (pncA).
The design of primers of 2.PCR amplification pncA gene.
Upstream primer sequence P1:5'-TAATACGACTCACTATAGGCCCGCCCGAACG-3',
Downstream primer sequence: 5'-GCCGCCAACAGTTC-3'.
PCR amplification condition:
UsingHigh-FidelityDNAPolymerase is as the archaeal dna polymerase in PCR reaction.98 DEG C pre-
It is denaturalized 30s, is denaturalized 98 DEG C of 10s, the 60 DEG C of 1min that anneal extend 72 DEG C of 30s totally 35 circulations.
Using the above primer pair tuberculosis pyrazinamide sensitive strain (H37Rv) (be purchased from American Type Culture Collecti,
) and the pyrazinamidase base of pyrazinamide persister (BCG) (be purchased from American Type Culture Collecti, ATCC19015) ATCC25177
Because of the amplification of (pncA), through gel electrophoresis, typical consequence such as Fig. 5 A, it is seen that obtained good amplification.
3. the pncA genetic fragment of amplification is concentrated:
(1) certain density DNA solution is prepared；
(2) DNA solution is added in high speed centrifugation concentrator；
(3) it is centrifuged 10 minutes for 15,000rpm4 DEG C；
(4) solution is abandoned, white precipitate on high speed centrifugation concentrator inner wall is retained；
(5) 70% (V/V, same as below) ethyl alcohol 3ml of -25 DEG C of pre-coolings is added, gently turn upside down washing precipitating.
(6) 15,000rpm4 DEG C centrifugation 3 minutes after carefully discard ethyl alcohol.
(7) 70% (V/V) the ethyl alcohol 2ml for adding -25 DEG C of pre-coolings, gently turn upside down washing precipitating.
(8) 15,000rpm4 DEG C centrifugation 3 minutes after carefully discard ethyl alcohol, be dried in vacuo.
4. using the pncA genetic fragment concentration of BioTek company's T ake3Multi-VolumePlate accurate quantification concentration.
Suitable pncA genetic fragment concentration is generally 0.1-100 microgram/ml.
5. the RTS100WheatGermCECFKit kit using the production of U.S. 5PRIMER company is cell-free 24 DEG C external
Reaction 1-20 hours.Express express target protein: pyrazinamidase.
6. the measurement of enzyme activity: after the completion of vivoexpression, taking the 10ul in system that the pyrazine acyl of 60ul10mg/ml concentration is added
Amine (PZA), 37 DEG C are incubated for 1 hour.It is pyrazine acid by the pyrazinamide enzymatic conversion pyrazinamide that spectrophotometric determination is expressed
Activity, and the pyrazinamidase expression activitiy with the mycobacterium tuberculosis standard sensitive strain and persister equally expressed, measurement
Mycobacterium tuberculosis pyrazinamide drug resistance.
To the pyrazinamide Enzyme assay of tuberculosis pyrazinamide sensitive strain (H37Ra) and pyrazinamide persister (BCG)
As a result as shown in Figure 5 B, using the absorption value of spectrophotometer solution after 450nm measures enzyme reaction.
Embodiment 2:
Using promoter containing T7 and enhancer PCR amplification overall length tubercle bacillus pyrazinamidase gene primer-wheat embryo
The pyrazine acyl of the measurement of cell free in vitro protein expression tuberculosis pyrazinamide sensitive strain (H37RA) and pyrazinamide persister (BCG)
Amine drug resistance.
1. liquid nitrogen cryogenics grinding cracking mycobacterium tuberculosis quickly prepares the template for PCR reaction: taking tuberculosis bacterium solution
1ml, 4000rpm are centrifuged 1min, remove supernatant, after collecting thallus, 500ul liquid nitrogen cryogenics are added and grind 5min, then
6000rpm is centrifuged 3min, the careful template for drawing supernatant as amplification pyrazinamide enzyme gene (pncA).
2.PCR expands to obtain the segment of pncA gene.
Upstream primer sequence P2:
5'-TAATACGACTCACTATAGGTATTTTTACAACAATTACCAACAACAACAAACAACAAACAACATTA
CAATTACTATTTACAATTACACCCGAACGTAAGGAGGACGT-3',
Or
5'-TAATACGACTCACTATAGGATACTCCCCCACAACAGCTTACAATACTCCCCCACACAGCTTACAA
ATACTCCCCCAGTCGCCCGAACGTAAGGAGGACGT-3'；
Or it uses
5'-TAATACGACTCACTATAGGGATTGTGAGCGATTTGCGTGCGTGCATCCCGCTTCACTGATCTCTT
GTTAGATCTTTTTATAATCAGTCGCCCGAACGTAAGGAGGACGT-3',
Downstream primer sequence: 5'-GCCGCCAACAGTTCATCCCGGT-3'.
PCR amplification condition:
UsingHigh-FidelityDNAPolymerase (being purchased from U.S. NEB company) is as in PCR reaction
Archaeal dna polymerase.98 DEG C of initial denaturation 30s are denaturalized 98 DEG C of 10s, and the 60 DEG C of 1min that anneal extend 72 DEG C of 30s totally 35 circulations.
Using the above primer pair tuberculosis pyrazinamide sensitive strain (H37Ra) (be purchased from American Type Culture Collecti,
) and the pyrazinamidase base of pyrazinamide persister (BCG) (be purchased from American Type Culture Collecti, ATCC19015) ATCC25177
Because of the amplification of (pncA), through gel electrophoresis, typical consequence such as Fig. 6 A, it is seen that obtained good amplification.
3. the pncA genetic fragment of amplification is concentrated:
(1) certain density DNA solution is prepared；
(2) DNA solution is added in high speed centrifugation concentrator；
(3) it is centrifuged 10 minutes for 15,000rpm4 DEG C；
(4) solution is abandoned, white precipitate on high speed centrifugation concentrator inner wall is retained；
(5) 70% (V/V, same as below) ethyl alcohol 3ml of -25 DEG C of pre-coolings is added, gently turn upside down washing precipitating.
(6) 15,000rpm4 DEG C centrifugation 3 minutes after carefully discard ethyl alcohol.
(7) 70% (V/V) the ethyl alcohol 2ml for adding -25 DEG C of pre-coolings, gently turn upside down washing precipitating.
(8) 15,000rpm4 DEG C centrifugation 3 minutes after carefully discard ethyl alcohol, be dried in vacuo.
4. using the pncA genetic fragment concentration of BioTek company's T ake3Multi-VolumePlate accurate quantification concentration.
Suitable pncA genetic fragment concentration is generally 0.1-100 microgram/ml.
5. using the external cell-free 24 DEG C of reactions of the RTS100WheatGermCECFKit kit of 5PRIMER company production
1-20 hours.Express express target protein: pyrazinamidase.
6. the measurement of enzyme activity: after the completion of vivoexpression, taking the 10ul in system that the pyrazine acyl of 60ul10mg/ml concentration is added
Amine (PZA), 37 DEG C are incubated for 1 hour.It is pyrazine acid by the pyrazinamide enzymatic conversion pyrazinamide that spectrophotometric determination is expressed
Activity, and the pyrazinamidase expression activitiy with the mycobacterium tuberculosis standard sensitive strain and persister equally expressed, measurement
Mycobacterium tuberculosis pyrazinamide drug resistance.
To the pyrazinamide Enzyme assay of tuberculosis pyrazinamide sensitive strain (H37Ra) and pyrazinamide persister (BCG)
As a result as shown in Figure 5 B, using the absorption value of spectrophotometer solution after 450nm measures enzyme reaction.
The basic principles, main features and advantages of the invention have been shown and described above.The technical staff of the industry should
Understand, the present invention is not limited to the above embodiments, and the above embodiments and description only describe originals of the invention
Reason, without departing from the spirit and scope of the present invention, various changes and improvements may be made to the invention, these changes and improvements
It all fall within the protetion scope of the claimed invention.The claimed scope of the invention is by appended claims and its equivalent circle
It is fixed.
Sequence table
<110>Anhui University of Science and Technology
<120>a kind of Drug Resistance of Mycobacterium Tuberculosis detection method
<130>a kind of Drug Resistance of Mycobacterium Tuberculosis detection method
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 31
<212> DNA
<213>artificial synthesized (Artificial synthesis)
<400> 1
taatacgact cactataggc ccgcccgaac g 31
<210> 2
<211> 14
<212> DNA
<213>artificial synthesized (Artificial synthesis)
<400> 2
gccgccaaca gttc 14
<210> 3
<211> 106
<212> DNA
<213>artificial synthesized (Artificial synthesis)
<400> 3
taatacgact cactataggt atttttacaa caattaccaa caacaacaaa caacaaacaa 60
cattacaatt actatttaca attacacccg aacgtaagga ggacgt 106
<210> 4
<211> 100
<212> DNA
<213>artificial synthesized (Artificial synthesis)
<400> 4
taatacgact cactatagga tactccccca caacagctta caatactccc ccacacagct 60
tacaaatact cccccagtcg cccgaacgta aggaggacgt 100
<210> 5
<211> 109
<212> DNA
<213>artificial synthesized (Artificial synthesis)
<400> 5
taatacgact cactataggg attgtgagcg atttgcgtgc gtgcatcccg cttcactgat 60
ctcttgttag atctttttat aatcagtcgc ccgaacgtaa ggaggacgt 109
<210> 6
<211> 22
<212> DNA
<213>artificial synthesized (Artificial synthesis)
<400> 6
gccgccaaca gttcatcccg gt 22
Claims (4)
1. a kind of Drug Resistance of Mycobacterium Tuberculosis detection method, which is characterized in that this method comprises the following steps:
S1: being realized by liquid nitrogen cryogenics grinding method and be crushed the bacterium wall of mycobacterium tuberculosis, and M. tuberculosis genes are discharged
Group；
S2: according to the upstream and downstream sequence design PCR of overall length pyrazinamide enzyme gene in the tubercle bacillus gene group after being cracked in S1
Primer sequence, primer sequence is not Chong Die with pyrazinamidase gene order, complete to react overall length pncA gene, and PCR primer sequence
Simultaneous with the promoter of suitable wheat embryo cell-free expression system on column, or simultaneous with promoter and Enhanced expressing
Son；
The primer sequence of the promoter are as follows: 5'-TAATACGACTCACTATAGG-3'；
The primer sequence of the expression enhancer are as follows: 5'-ATACTCCCCCACAACAGCTTACAATACTCCCCCACACAGC-
3'；
S3: being concentrated the tubercle bacillus gene group in S2 by high speed centrifugation method, carries out taking out during concentration true
It is empty；Quantitative Treatment is carried out to the tubercle bacillus gene group by ultraviolet absorption method simultaneously, accurate control is realized by ultraviolet radiator
The intensity of light, and then realize that high-precision control is used to express the gene template amount of pyrazinamidase；
S4: taking the tubercle bacillus gene group 5-15 microgram in S3 to be implanted into wheat embryo cell-free body and expressed, expression time
It is 1-24 hours；
S5: being the activity of pyrazine acid by the pyrazinamide enzymatic conversion pyrazinamide expressed in spectrophotometric determination S4, and with
The pyrazinamidase expression activitiy of the mycobacterium tuberculosis standard sensitive strain and persister equally expressed measures mycobacterium tuberculosis
Detection of pyrazinamide resistance.
2. a kind of Drug Resistance of Mycobacterium Tuberculosis detection method according to claim 1, it is characterised in that: the wheat
The promoter of germ cell-free expression system is T7 promoter, and Enhanced expressing is 5 ' end noncoding region enhancers and/or 3 ' ends
Noncoding region enhancer.
3. a kind of Drug Resistance of Mycobacterium Tuberculosis detection method described in claim 1, it is characterised in that: the tubercle bacillus
The promoter containing T7 that overall length pncA gene is suitble to wheat embryo cell-free expression system expression pyrazinamidase is expanded on genome
Primer pair sequence:
Upstream primer series 5'-TAATACGACTCACTATAGGCCCGCCCGAACG-3',
Downstream primer sequence: 5'-GCCGCCAACAGTTC-3'.
4. a kind of Drug Resistance of Mycobacterium Tuberculosis detection method described in claim 1, it is characterised in that: the tubercle bacillus
Overall length pncA gene is expanded on genome is suitble to opening containing T7 for wheat embryo cell-free expression system Enhanced expressing pyrazinamidase
The primer pair sequence of mover and 5 ' end noncoding region enhancers: three sets are enumerated and holds the upstream of noncoding region enhancer to draw containing difference 5 '
Object sequence
5'-TAATACGACTCACTATAGGTATTTTTACAACAATTACCAACAACAACAAACAACAAACAACATTACAAT
TACTATTTACAATTACACCCGAACGTAAGGAGGACGT-3'；Or
5'-TAATACGACTCACTATAGGATACTCCCCCACAACAGCTTACAATACTCCCCCACACAGCTTACAAATAC
TCCCCCAGTCGCCCGAACGTAAGGAGGACGT-3'；Or
5'-TAATACGACTCACTATAGGGATTGTGAGCGATTTGCGTGCGTGCATCCCGCTTCACTGATCTCTTGTTA
GATCTTTTTATAATCAGTCGCCCGAACGTAAGGAGGACGT-3'；
Downstream primer sequence: 5'-GCCGCCAACAGTTCATCCCGGT-3'.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910117243.6A CN109797193A (en) | 2019-02-15 | 2019-02-15 | A kind of Drug Resistance of Mycobacterium Tuberculosis detection method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910117243.6A CN109797193A (en) | 2019-02-15 | 2019-02-15 | A kind of Drug Resistance of Mycobacterium Tuberculosis detection method |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109797193A true CN109797193A (en) | 2019-05-24 |
Family
ID=66560926
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910117243.6A Pending CN109797193A (en) | 2019-02-15 | 2019-02-15 | A kind of Drug Resistance of Mycobacterium Tuberculosis detection method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109797193A (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20030030266A (en) * | 2001-10-09 | 2003-04-18 | 주식회사 에스제이하이테크 | Microarray comprising probes for mycobacteria genotyping, m. tuberculosis strain differentiation and antibiotic-resistance detection |
| CN102174652A (en) * | 2011-02-28 | 2011-09-07 | 中国科学院武汉病毒研究所 | Detection method of mycobacterium tuberculosis pyrazinamide drug resistance |
| CN102925554A (en) * | 2012-09-18 | 2013-02-13 | 中国科学院武汉病毒研究所 | Joint detection method for drug resistance of mycobacterium tuberculosis and pyrazinamide in clinical sample |
| WO2017095271A1 (en) * | 2015-12-01 | 2017-06-08 | Общество С Ограниченной Ответственностью "Энджентикс" | Method for the molecular genetic detection of mycobacterium tuberculosis resistance to second-line anti-tuberculosis drugs (fluoroquinolines, aminoglycosides and capreomycin) |
-
2019
- 2019-02-15 CN CN201910117243.6A patent/CN109797193A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20030030266A (en) * | 2001-10-09 | 2003-04-18 | 주식회사 에스제이하이테크 | Microarray comprising probes for mycobacteria genotyping, m. tuberculosis strain differentiation and antibiotic-resistance detection |
| CN102174652A (en) * | 2011-02-28 | 2011-09-07 | 中国科学院武汉病毒研究所 | Detection method of mycobacterium tuberculosis pyrazinamide drug resistance |
| CN102925554A (en) * | 2012-09-18 | 2013-02-13 | 中国科学院武汉病毒研究所 | Joint detection method for drug resistance of mycobacterium tuberculosis and pyrazinamide in clinical sample |
| WO2017095271A1 (en) * | 2015-12-01 | 2017-06-08 | Общество С Ограниченной Ответственностью "Энджентикс" | Method for the molecular genetic detection of mycobacterium tuberculosis resistance to second-line anti-tuberculosis drugs (fluoroquinolines, aminoglycosides and capreomycin) |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110541022A (en) | mycobacterium tuberculosis complex detection kit based on CRISPR-Cas12a system | |
| CN106947838A (en) | African swine fever virus nonstructural gene real-time fluorescence LAMP detection primer group, kit and detection method | |
| CN102174652A (en) | Detection method of mycobacterium tuberculosis pyrazinamide drug resistance | |
| CN102925554B (en) | For detecting the primer sets of mycobacterium tuberculosis and the resistance to pyrazinoic acid amide property of medicine thereof | |
| CN109680056A (en) | A kind of kit, detection method and its application detecting MCR gene | |
| CN111518877B (en) | One-tube method nest type real-time quantitative PCR detection kit for detecting echinococcus multilocularis and echinococcus granulosus by parting trace samples | |
| CN104946758A (en) | LAMP detection primer set, detection kit and detection method for candida albicans | |
| CN109182569A (en) | The loop-mediated isothermal amplification detection method and kit of high virulence helicobacter pylori | |
| CN109439800B (en) | Kit and method for detecting gene mutation of PR region and RT region of HIV-1 gene | |
| CN110438205A (en) | Joint multiplex PCR nest-type PRC and touchdown PCR are used for the kit of pathogenic mycobacterium tuberculosis detection | |
| CN107419008B (en) | Method and kit for accurately diagnosing Parkinson's disease in early stage | |
| CN109797193A (en) | A kind of Drug Resistance of Mycobacterium Tuberculosis detection method | |
| CN112280876A (en) | Primer, probe, kit and application for recombinase-mediated isothermal amplification detection | |
| CN104630328B (en) | Mycoplasma pneumoniae 23S rRNA 2064 site A:G mutation detection specific primer and probe | |
| CN108624658A (en) | The qPCR methods and reagent of fast detecting Staphylococcus aureus MRSA | |
| CN114807416A (en) | RPA-LFS detection primer probe combination of candida tropicalis and application thereof | |
| CN114438238A (en) | Primer for detecting infectious endocarditis pathogen and digital PCR kit | |
| CN113186304A (en) | Fluorescence isothermal amplification primer, probe, kit and detection method for orientia tsutsutsugamushi nucleic acid | |
| CN106978512A (en) | RT PCR primers and its kit for detecting new bamboo rat source Ah card's pinta poison | |
| CN103789335B (en) | Construction method of recombinant plasmid of PD-L1 (programmed death-ligand 1) in chicken peripheral blood mononuclear lymphocytes, real-time gene abundance detection method and application of detection method | |
| CN106701994A (en) | Double PCR (Polymerase chain reaction) primer for simultaneous detection of Klebsiella pneumoniae and Aeromonas caviae and detection method of double PCR primer | |
| CN111996272A (en) | RPA detection primer group, kit and method for drug-resistant gene mcr-8 | |
| CN102692509B (en) | Method for diagnosing bovine tuberculosis mediated by recombinant protein mixture and regent thereof | |
| CN114574611B (en) | Cattle green alga-free PCR primer and application thereof | |
| CN111394484A (en) | Mycobacterium tuberculosis nucleic acid detection quality control product simulated by heterologous strains |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |