WO2017093672A1 - Procede d'evaluation du risque de complications chez les patients qui presentent un syndrome de reponse inflammatoire systemique (sirs) - Google Patents
Procede d'evaluation du risque de complications chez les patients qui presentent un syndrome de reponse inflammatoire systemique (sirs) Download PDFInfo
- Publication number
- WO2017093672A1 WO2017093672A1 PCT/FR2016/053164 FR2016053164W WO2017093672A1 WO 2017093672 A1 WO2017093672 A1 WO 2017093672A1 FR 2016053164 W FR2016053164 W FR 2016053164W WO 2017093672 A1 WO2017093672 A1 WO 2017093672A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- sample
- days
- il7r
- patient
- septic shock
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/112—Disease subtyping, staging or classification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/118—Prognosis of disease development
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Definitions
- the present invention relates to the medical field in general, and in particular the field of risk prediction. More specifically, the invention relates to a method for evaluating the risk of complication in a patient having undergone an aggression, such as surgery, burn, trauma ..., generating a syndrome of systemic inflammatory response or SIRS or in a patient experiencing a infection causing SIRS, and in particular in a patient in sepsis, that is to say a patient with sepsis, including severe sepsis, also called severe sepsis, and preferably in a septic shock patient or having undergone septic shock.
- an aggression such as surgery, burn, trauma ...
- SIRS systemic inflammatory response
- sepsis that is to say a patient with sepsis, including severe sepsis, also called severe sepsis, and preferably in a septic shock patient or having undergone septic shock.
- SIRS systemic inflammatory response syndrome
- Nosocomial infections are an important public health problem. Inpatient patients often have, by their nature, diminished or impaired immune defenses, either because of pathologies that directly affect their immune skills, or because of their general condition. These patients, especially those who are malnourished or at extreme ages of life (elderly, infants) are especially susceptible to infections in general, and in particular to the occurrence of nosocomial infections. The prevalence of nosocomial infections is significantly higher in intensive care units than in other hospital sectors.
- sepsis is an inflammatory systemic response syndrome related to an infection.
- Severe sepsis is a sepsis associated with arterial hypotension and / or hypoperfusion and / or dysfunction of at least one organ.
- Septic shock is severe sepsis associated with persistent hypotension despite adequate fills and vasopressor therapy. The difference between sepsis, severe sepsis and septic shock lies mainly in the importance of the disruption of all vital functions.
- the severity of the condition of a patient admitted to intensive care is generally estimated using various clinical and physiological parameters. These make it possible in particular to define predictive scores in terms of survival / mortality, among which we can notably mention the severity scores SOFA for Sequential Organ Failure Assessment or Sepsis-related Organ Failure Assessment (Vincent et al., 1996) and SAPSII for Simplified! Acute Physiology Score II, also known in French as IGS II for Simplified Severity Index II (Le Gall et al., 1993). These composite scores, defined on consistent cohorts of resuscitation patients, include several clinico-biological parameters such as circulating platelet count, bilirubinemia, diuresis, age, or body temperature.
- the application WO 2013/140103 proposes a method for determining the susceptibility to nosocomial infections in a patient, comprising the following steps:
- the application WO 2015/040328 describes, for its part, a method for evaluating the risk of mortality in a patient who has suffered an aggression or an infection generating a systemic inflammatory response, comprising the following steps:
- SCD127 is the soluble or plasma form of CD 127, also known as the alpha chain of the IL-7 receptor or IL-7R-ALPHA or IL-7RA or CDw127 (UnlProtKB P16871).
- CD127 is a 75 kDa glycoprotein that is a member of the hematopoietic growth factor receptor superfamily. It is expressed at the membrane level and is associated with CD132 (chain v c shared) to form the receptor I1L-7. This receptor plays an important role in differentiation, survival and lymphocyte proliferation.
- CD 127 consists of an extracellular portion of 219 amino acids (aa), a transmembrane portion of 25 aa and an intracytoplasmic portion of 195 aa (Jiang et al., 2005).
- CD127 may be present in plasma or serum in soluble form, named "SCD127” (Carini et al., 1994; Vranjkovic et al., 2007).
- SCD127 is meant the soluble or circulating form (also called plasmatic or serum form) of the IL-7 receptor.
- the mechanisms responsible for the release of the soluble form are poorly described and the results of the literature are contradictory.
- the work of Vranjkovic et al., 2007 leads to the conclusion that the soluble form would come from a cleavage of the membrane form.
- Goodwln et al., 1990 as well as Rose et al., 2009 conclude that transcription regulation is achieved by alternative splicing of the IL7R gene encoding CD127.
- the application WO 2009/115478 describes, for its part, a method for detecting and differentiating in vitro different pathophysiological states.
- the detection method described in this document is defined in particular in claim 1 and uses the detection of several polynucleotide markers. Different physiopathological states including SIRS, sepsis, septic shock are cited. But it is question of detection in vitro, of differentiation or of the observation of a progression and not of the evaluation of a risk thus concerning a future state.
- the gene of I1L7R is cited among 669 polynucleotides.
- the markers are used as markers for identifying subjects in SIRS or sepsis state, as is apparent from the title of the example. 3 in particular. These examples in no way concern a method of in vitro or ex vivo evaluation of the risk of complication in a patient having undergone an aggression or infection, but the diagnosis of SIRS or sepsis.
- the IL7R gene is composed of 8 exons, the exon 6 coding for the transmembrane domain.
- the reference nucleic sequence for the IL7R gene is SEQ ID No. 1 (Ensembl: ENSG00000168685).
- the IL7R-001 transcript comprises exon 6 and therefore corresponds to the membrane protein form of CD127. All other transcripts that can theoretically result in the translation of a protein do not include exon 6 and therefore potentially correspond to soluble forms of CD 127. Table 1.
- the study by Rose et al., 2009 showed that the sequence of the soluble protein form sCD127 purified from plasma corresponded to the form obtained following the translation of the IL7R-003 transcript. According to this study, the soluble protein did not originate from the translation of the IL7R-002 transcript, nor from a cleavage of the membrane protein form.
- soluble protease forms corresponding to transcripts that can potentially be translated IL7R-002, IL7R-004, IL7R-006, IL7R-007 and IL7R-010, have not been observed experimentally.
- the inventors of the present patent application propose a method for the in vitro or ex vivo evaluation of the risk of complication in a patient having undergone an aggression or an infection that adopts a solution other than detection.
- soluble proteins which is based on the evaluation of one or more IL7R gene transcripts.
- the inventors have demonstrated that in the case of transcripts, it was not useful nor preferred to be limited to transcripts coding for the soluble portion SCD127 of CD127.
- the present invention proposes to provide a new biomarker predictive of a risk of complication, and especially mortality, in a patient who has suffered a severe aggression (surgery, burn, trauma, ...) or infection, said aggression or infection generating a systemic inflammatory response syndrome (SIRS).
- SIRS systemic inflammatory response syndrome
- the invention relates to a method of in vitro or ex vivo evaluation of the risk of complication in a patient having undergone an aggression or infection, said aggression or infection generating a syndrome of systemic inflammatory response, wherein the detection, preferably the quantification in a biological sample from said patient, at least one IL7R gene transcript is produced.
- systemic inflammatory response syndrome means a response associating at least two of the following criteria: Temperature> 38 ° C or ⁇ 36 ° C, heart rate> 90 / minute, Respiratory rate> 20 / minute or paC0 2 ⁇ 32 mmHg, Leukocytes> 12000 / mm 3 or ⁇ 4000 / mm 3 (Bone et al., 1992).
- a SIRS may be due to an infection or other type of assault such as burns, surgery or trauma. Sepsis, severe sepsis and septic shock all correspond to SIRS due to infection.
- SIRS In these septic patients (sepsis, severe sepsis and septic shock), which therefore have SIRS following infection, said infection that caused the SIRS may be of various origins, and in particular of bacterial, viral or fungal origin.
- SIRS is accompanied by at least one other manifestation, which is in the case of severe sepsis, hypotension and / or hypoperfusion and / or dysfunction of at least one organ in which, in the case of septic shock, persistent hypotension is added despite adequate filling and requiring the use of vasopressors.
- a patient presenting with SIRS is generally admitted to intensive care when his condition involves continuous monitoring of vital functions and, where appropriate, the use of alternative methods (transfusion of blood derivatives, vascular filling, mechanical ventilation, catecholamines, hemodialysis, circulation). extracorporeal, etc.).
- the ultimate goal of resuscitation is the restoration of homeostasis.
- “Complication” means an infection, other than that which may have caused the systemic inflammatory response syndrome, which infection is then named secondary, or a primary infection when the Systemic Inflammatory Response Syndrome is caused by an aggression other than an infection, or “complication” means the death of the patient.
- the said primary or secondary infection may be nosocomial or not. Nosocomial infections are exclusively contracted in the case hospitalization and appear at least 48 hours after the hospitalization.
- risk of complication is meant the susceptibility of a patient to generate a primary or secondary infection, or the susceptibility that the patient has to die.
- the presence of a risk of complication corresponds to the risk of the complication occurring, for example within 60 days, in particular within 40 days, particularly within 30 days, following the admission to intensive care of a patient suffering from a complication.
- the method according to the invention can therefore be a method of evaluating the susceptibility of the patient to generate an infection (which will be primary in the case of a patient who has suffered an attack, and not an infection, which has generated the response syndrome systemic inflammatory reaction and which will be secondary in the case of a patient who has undergone a first infection causing the systemic inflammatory response syndrome).
- the method according to the invention will make it possible to deliver a conclusion as to the presence or absence of a risk for the patient to generate such an infection.
- the method according to the invention is a method implemented in vitro or ex vivo. It has the advantage of being able to easily assess the risk of complication, and in particular of mortality, in particular of a patient who is admitted to the intensive care unit, by having a directly measurable marker, contrary to the severity scores SOFA and SAPSII. for example, and whose measurement can be done in a local laboratory or in the patient's bed.
- the measurement of the quantity of one or more transcripts of the IL7R gene is entirely suitable for being performed by automated analysis or by rapid tests.
- said patient is in septic state, in particular in severe sepsis or in septic shock.
- This state corresponds to the patient's condition at the time of sampling of the test sample or of a state in which the patient has been closely spaced in time with respect to the sampling of the sample to be tested, in particular within 6 days preceding the taking of the sample to test.
- sepsis, severe sepsis or septic shock in particular, it is possible that the patient is in this state, especially upon admission to the intensive care unit and that sepsis, severe sepsis or septic shock has stopped at the time of sampling of the sample to be tested.
- the patient has undergone or has been in a state of septic shock, sepsis or severe sepsis as the case may be.
- the biological sample to be tested is derived from a patient having sepsis, in particular a severe sepsis or having presented a sepsis, in particular a severe sepsis in the 6 days preceding the sampling of the patient.
- biological sample to be tested or the biological sample to be tested is derived from a patient in septic shock state or having been in septic shock state within 6 days preceding the taking of the biological sample to be tested.
- the method according to the invention is also perfectly suited to patients with SIRS due to an aggression other than an infection, including surgery, burn or trauma.
- the risk of complication evaluated in the context of (Invention is the risk of death of the patient
- the method according to the invention may therefore be a method for assessing the susceptibility of the patient to death.
- method according to the invention will provide a conclusion as to the presence or absence of a risk for the patient to die.
- this risk will be evaluated for a death occurring within 60 days, in particular within 40 days, particularly within 30 days, particularly within 28 days, following the admission of the patient to the intensive care unit and in particular, for a death likely to occur during the entire stay in the intensive care unit, or even
- this The invention has a preferred application in patients with sepsis, including severe sepsis, or in patients with septic shock or septic shock.
- the method according to the present invention is used to evaluate the risk of mortality in such patients.
- the method according to the present invention is particularly advantageous for assessing the risk of death in a patient who is or has been in septic shock.
- the risk of death will be assessed for a death occurring within 60 days, in particular within 40 days, particularly within 30 days, particularly within 28 days after the onset of septic shock, and in particular for a death likely to occur during the entire stay in the intensive care unit, or even hospitalization.
- said at least one IL7R gene transcript that is detected and, preferably, quantified is selected from the IL7R-001 transcripts of SEQ ID No. 2, IL7R-002 of SEQ ID N # 3, IL7R-003 of SEQ ID No. 4, IL7R-005 of SEQ ID No. 6 and IL7R-007 of SEQ ID No. 8 and variants thereof, the sequence of a variant having at least 99% identity with one of said sequences.
- Percentage identity is determined through sequence alignment software, such as CLUSTALW (Nudeic Adds Res 1994 Nov 11; 22 (22): 4673-80.) CLUSTAL W: improving the sensitivity of progressive multiple alignment through sequence
- said variant will correspond to a polymorphism of the sequence of the IL7R gene, in particular said at least one IL7R gene transcript is selected from transcripts comprising at least one IL7R gene. part of the transmembrane domain, indeed the entire transmembrane domain, of CD 127, and preferably corresponds to the IL7R-001 transcript of SEQ ID No. 2 or to one of its variants having at least 99% diene with said sequence.
- -001 of SEQ ID No. 2 has the advantage of being detected in large quantities, compared to other transcripts, which facilitates the implementation of the method according to the invention, in the case of the detection of at least this transcript.
- transcript is meant the MRIA, and in particular the messenger RNAs, from the transcription of the IL7R gene. More specifically, transcripts are the RNAs produced by the splicing of the gene. In the context of the invention, the IL7R gene transcript (s) detected and / or quantized is (are) therefore, preferably, an mRNA.
- a method according to the invention implements the steps of:
- At least one IL7R gene transcript is detected in a biological sample from a patient, for which it is desired to evaluate a risk of complication, called sample to be tested. The result resulting from this detection will be compared to a reference value, in order to evaluate the risks of complication.
- the method of the invention may comprise the prior obtaining of the value of reference, to which the quantity dudlt at least one determined transcript that will be detected in the test sample or a value derived from this quantity can be compared, in order to conclude as to the risk of complication, in the patient from which the sample is derived to test. It is also possible that this reference value is available, in the future, during the implementation of the method of the invention.
- the reference value will be determined, from the same transcripts of the IL7R gene, as those detected or quantified in the biological sample to be tested. It may however be determined on a different biological sample but of the same type, coming from the same patient or from another patient or pool of patients. When one or more samples from a reference patient or reference patient pool will be used to determine the reference value, they will preferably have the same type of SIRS (including sepsls, severe sepsis or septic shock) as the patient for whom it is desired to implement the method.
- SIRS including sepsls, severe sepsis or septic shock
- the sample to be tested in the context of the method of the invention is a biological sample from the patient in whom it is desired to evaluate the risk of complication.
- a biological sample is chosen from those likely to contain transcripts of the IL7R gene.
- the sample to be tested comes from a sample obtained within 6 days or 6 days (J6) after admission to the intensive care unit of a patient with a SIRS, preferably within 5 days or at 5 days.
- the test sample is preferably from a sample obtained within 6 days or 6 days (J6) after the onset of shock septic shock, preferably within 5 days or at 5 days (D5) after the onset of septic shock, preferably within 4 days or at 4 days (D4) after the onset of septic shock, more preferably in the 3 days or 3 days (D3) after the onset of septic shock, or within 2 days or 2 days (D2) after the onset of septic shock, or within 24 hours or 24 hours (D1) after the onset of septic shock.
- the sample to be tested is preferably from a sample taken from the patient for whom it is desired to evaluate a risk of complication, within 6 days, within 5 days, within 4 days, within 3 days. days, within 2 days, or within 24 hours, including 6 days, 5 days, 4 days, 3 days, 2 days or 24 hours, after admission to resuscitation or the onset of septic shock , respectively.
- the times indicated within the framework of the description of the invention for the samples concerned will be calculated, not from the admission in service of resuscitation, but to from the beginning of the surgery.
- step iii) it is also possible for the comparison made in step iii) to use a ratio between the amount of transcript (s) determined for a biological sample of said patient corresponding to a sample at a time t (in particular within 3 days or at 3 days (D3)) on the amount of transcript (s) determined for a biological sample of said patient corresponding to a sample at a time f (especially within 24 hours or at 24 hours (Jl) ).
- sample to be tested will be of human origin.
- the sample to be tested may be a biological fluid, for example chosen from blood, especially whole blood as collected from the venous fly, that is to say containing white and red cells, platelets and plasma, or a sample of serum or plasma, as well as components of said fluids, such as Peripheral Blood Mononuclear Cells (PBMC), or excreted vesicles such as apoptotic cells or bodies, excreted vesicles, including exosomes and microvesicles.
- PBMC Peripheral Blood Mononuclear Cells
- the preferred biological samples, whether biological samples to be tested or samples used to determine the reference value are preferably whole blood or PBMC samples.
- the samples from which the reference values can be determined may be of different types, and in particular of a biological nature as mentioned above with respect to the sample to be tested (biological fluids). ), or not, including synthetic samples containing a selected amount of transcripts).
- these reference samples are biological samples, they will be of the same nature as that of the biological sample to be tested or at least of a compatible nature to constitute a reference as to the detection and / or quantification of the selected IL7R gene transcripts).
- a reference biological sample will be a human biological sample. It will also be preferable to use biological samples corresponding to the same biological fluid or even components, for example whole blood samples, for both the test sample and the reference sample.
- any method of detecting and / or quantifying transcripts well known to those skilled in the art can be used for the implementation of the invention.
- such methods use one or more link partners for the selected transcript (s).
- the reference value will be chosen, according to the method used to determine the amount of said at least one IL7R gene transcript and will be representative of the population from which the patient for whom the risk is to be assessed is derived.
- reference value with which the quantity of said at least one transcript determined for said biological sample or the value derived from this quantity used for the comparison must be compared, according to the comparison to be made.
- a suitable statistical test can be used to determine this reference value. For example, it is possible to compare different populations or types of samples, from the evolution over time of the same population or the same type of sample. It must be understood that reference value here is either a discrete value or an interval of values corresponding to a zone of indeterminacy. Of course, when the measured value is included in the indeterminacy interval, or is very close to the reference value in the case of a discrete value, one can not definitively conclude and additional Investigations should be conducted.
- the reference value can be determined in different ways: in particular, either the reference value is obtained from a reference sample from the same patient and obtained during an earlier sampling, either the reference value is obtained from a reference sample of a reference individual or from reference samples of a reference population.
- a reference value obtained from a reference sample from the same patient obtained during a previous sample will be named internal reference value.
- a reference value obtained from a reference sample of a reference individual or reference samples from a reference population will be named external reference value.
- An internal reference value may correspond to, or be derived from, the quantity of said at least one transcript of the IL7R gene measured in a biological sample from the same said patient during an earlier sampling, that is to say in a biological sample from the patient in whom it is desired to evaluate the risk of complication and obtained previously with respect to the sample to be tested.
- Previous or “earlier” is meant earlier in time.
- an internal reference value is obtained from a biological sample which is directly earlier than the sample to be tested, that is to say the one which precedes the sample to be tested in the order of samples taken from the patient
- the internal reference sample is derived from a sample obtained in the 2 days or in the day, or to 2 days or 1 day after the admission in intensive care of the patient, which allows to determine very early the risk of complication of the patient tested. In the case where the patient is in septic shock or has been in septic shock, these delays will be calculated from the onset of septic shock.
- the previous sample is taken within 48 hours after admission to the patient's resuscitation, and preferably at least 24 hours before taking the sample to be tested.
- the previous sample is taken at 24 hours after admission to intensive care
- the sample corresponding to the test sample is taken at 72 hours after admission to intensive care.
- the previous sample will preferably be taken within 48 hours after the onset of septic shock and, preferably, at least 24 hours before the sampling of the sample to be tested.
- the previous sample is taken 24 hours after the onset of septic shock and the sample corresponding to the test sample is made 72 hours after the onset of septic shock.
- the method of the invention makes it possible to conclude that there is a risk of complication, and in particular of patient mortality, when the quantity of said at least one transcript determined for said biological sample to be tested or a value derived from this quantity. measured in the test sample is not significantly increased compared to the internal reference value. It is within the abilities of a person skilled in the art to determine the percentage of significant increase that will depend, in particular, on the type of sample to be tested (for example whole blood, PBMCs, cellular subpopulations), the type of analysis or even of the apparatus on which the analysis is carried out, according to s11 wishes to promote the specificity in the case of an exclusion test or the sensitivity in the case of a test It depends on the treatment to be applied or the pathology of the patient.
- the type of sample to be tested for example whole blood, PBMCs, cellular subpopulations
- the type of analysis or even of the apparatus on which the analysis is carried out according to s11 wishes to promote the specificity in the case of an exclusion test or the sensitivity
- this may correspond to, or be obtained from, the quantity of said at least one transcript, measured in a biological sample from a patient having undergone an attack or infection generating a systemic inflammatory response syndrome known to have known no complication, including a patient with sepsis known to have experienced no complication, and preferably, a patient with septic shock who is known to have known no complications.
- the external reference value may correspond to, or be obtained from, the quantity of said at least one transcript, measured in a reference biological sample derived from a patient having undergone an aggression or infection generating a systemic inflammatory response syndrome that is known to have survived, including a patient with sepsis known to have survived, and preferably a patient with septic shock whose we know that he has survived.
- the measurement of the quantity of said at least one determined transcript used for the external reference value determination is preferably carried out in parallel, that is to say at the same time as measuring the quantity of said reference quantity.
- least one IL7R gene transcript made in the sample from the patient in whom it is desired to evaluate the risk of complication, although the sample of the reference biological sample was taken before that of the sample to be tested.
- the reference value may also correspond to, or be obtained from, an average value of the amount of said at least one transcript that is measured on a pool of samples from patients who have suffered an aggression or an infection generating a syndrome.
- SIRS Systemic Inflammatory Response
- known to have no known complication including patients with sepsis who are known not to have sepsis.
- known complication and, preferably, patients in septic shock who are known to have experienced no complication.
- the reference value may also correspond to, or be obtained from, an average value of the quantity of the said at least one transcript that is measured on a pool of d samples from patients who have been known to have survived, including those with known patients with septic shock who are known to have survived.
- the determination of the external reference value is preferably carried out prior to measuring the amount of said at least one IL7R gene transcript which is made in the sample from the patient in which it is sought to evaluate the risk of mortality, the sampling of the reference samples intended to be "pooled” having been carried out before that of the sample to be tested.
- the prognosis is based on taking into account the quantity of the IL7R-001, IL7R-002, IL7R-003, IL7R-005 or IL7R-007 transcript, or the overall quantity of several transcripts, preferably comprising 2, 3, 4 or all the transcripts chosen from transcripts IL7R-001, IL7R-002, IL7R-003, IL7R-005 and IL7R-007.
- the biological sample to be tested is derived from a patient in septic shock state at the time of sampling of the biological sample to be tested or having been in a state of septic shock and the reference value is said to be external and corresponds to , or is derived from, the amount of said at least one IL7R gene transcript measured in a reference biological sample from a septic shock patient at the time of collection of the reference sample or in a state of shock septic, which is known to have known no complications, and in particular which is known to have survived, or corresponds to an average value of the amount of said at least one IL7R gene transcript which is measured on a pool of reference samples from patients with septic shock at baseline or with septic shock, who are known to have had no complicates one, and in particular that we know they have survived.
- the reference sample (s) used are preferably from persons having the same characteristics or a majority of common characteristics, in particular of the same sex and / or of a similar or identical age, and / or of the same ethnic origin, with those of the subject or patient in whom it is desired to evaluate the risk of complication, and in particular of mortality.
- the reference sample may also in this case be constituted by any sample, biological or non-biological, which has been previously calibrated to contain the amount of said at least one IL7R gene transcript which corresponds to the average amount measured in a pool of samples of patients who have suffered an aggression or an infection generating a systemic inflammatory response syndrome (and in particular patients with sepsis, and preferably patients with septic shock), which are known to have not known complication, and preferably which is known to have survived, or which has been previously calibrated to contain the quantity of said minus one transcript of the IL7R gene which corresponds to the average amount measured in a pool of samples of patients having undergone an aggression or infection generating a systemic inflammatory response syndrome (and in particular of patients with sepsis, and preferably patients in septic shock), which are known to have no complications, and preferably which are known to have survived.
- the biological sample to be tested is derived from a patient in septic shock state at the time of sampling the biological sample to be tested or having been in a state of septic shock and measuring the quantity of said at least one transcript the IL7R gene is carried out in a test sample and, where appropriate, in the biological specimen (s) used to obtain the external reference value, which corresponds to (a) a sample taken within 6 days after the onset of septic shock, preferably the 3rd day after the onset of septic shock, especially 72 hours after the onset of septic shock.
- the measurement of the quantity of said at least one transcript of the IL7R gene is carried out in a test sample and, where appropriate in the biological sample (s) used to obtain the external reference value, from a sample taken, preferably within 6 days after admission. in resuscitation of the patient, preferably on the third day after admission, and in particular 72 hours after admission.
- the comparison may be carried out directly from the quantity of said at least one transcript of the measured IL7R gene, both for the sample to be tested and for the determination of the external reference value, in a biological sample from a sample taken on the third day following the onset of septic shock, and in particular 72 hours later, or from the ratio of the quantity of the at least one transcript of the gene IL7R measured, for both the test sample and for determining the external reference value, in a biological sample from a sample taken 3 rd Aor following the onset of septic shock, and in particular after 72 hours, and the quantity, both for the sample to be tested and for the determination of the reference value, in a biological sample from a sample taken within 24 hours, and 24 hours after the septic shock, in which case the comparison is made in step lii) between:
- the ratio of the quantity of transcripts) determined for a biological sample of the patient or of the reference population corresponding to a sample at a time t (in particular within 3 days or at 3 days (D3) following the onset of septic shock) on the amount of transcript (s) determined for a biological sample of said patient or reference population corresponding to a sample at a time f (especially within 24 hours or 24 hours (31) after the onset of septic shock).
- the comparison is preferably made directly from the quantity of said at least one measured IL7R gene transcript, for the sample to be tested and for the determination of the value of external reference, in a biological sample from a sample taken on the third day after the beginning of the admission of the patient to the intensive care unit (and in particular 72 hours later) or from the ratio of the quantity of the said at least one a transcript of the measured IL7R gene, for the sample to be tested and for the determination of the external reference value, in a biological sample from a sample taken on the third day following admission (and in particular 72 hours later) and the amount measured, for the sample to be tested and for the determination of the reference value, in a biological sample from a sample taken within 24 hours, including 24 hours after septic shock.
- step iii) the comparison is made in step iii) between:
- the detection of a transcript by detection of a transcript, the detection of said transcript itself in the biological sample by direct detection of said transcript, by any method known to those skilled in the art, allows the detection of said transcript.
- the detection will be accompanied by a quantification of the selected transcript (s), that is to say that the concentration of a transcript or of several transcripts, in this case globally or individually , will be determined directly or indirectly.
- the direct detection of a transcript in the biological sample may be carried out by any means known to those skilled in the art, such as, for example, by hybridization with a specific or non-specific binding partner of the transcript to be detected, where appropriate after amplification by PCR technique, with or without probe, or NASBA, or as for example by sequencing (Cloonan et al., 2008; Emrich et al., 2007; Mortazavi et al., 2008).
- hybridization is meant the process in which, under appropriate conditions, two nucleotide fragments bind with stable and specific hydrogen bonds to form a double-stranded complex.
- the binding partners of a transcript to be detected are any partner that is capable of binding to said transcript, and in particular specific binding partners.
- specific binding partners mention may be made of hybridization probes and amplification primers, and any other molecule capable of binding to the transcript to be detected. It is possible to use specific binding partners, that is to say essentially, or even exclusively, binding to a single transcript or binding to several transcripts of the IL7R gene, as illustrated in the examples below.
- hybridization probe a nucleotide fragment comprising from 5 to 100 nucleic motifs, in particular from 10 to 35 motifs. nucleic acids, having hybridization specificity under specified conditions to form a hybridization complex with one or more IL7R gene transcripts.
- the hybridization probe may include a marker for its detection and is then called a detection probe.
- amplification primer means a nucleotide fragment comprising from 5 to 100 nucleic units, preferably from 15 to 30 nucleic units allowing the initiation of an enzymatic polymerization, such as in particular a reaction of enzymatic amplification.
- enzymatic amplification reaction is meant a process generating multiple copies of a nucleotide fragment by the action of at least one enzyme.
- Such amplification reactions are well known to those skilled in the art and may be mentioned in particular the following techniques:
- the specific reagent with one or more transcripts comprises at least 2 amplification primers, which are either specific for the target transcript (s) in the case of one-step RT-PCR (EP 0569272), is specific DNA (s) corresponding to the (x) transcripts) target (s) in the case of two-step RT-PCR (Goblet et al., 1989).
- Detection means either a physical method or a chemical method with an intercalating coloring agent such as SYBR® Green I or ethidium bromide, or a method of detection using a marker. Many detection methods exist for the detection of nucleic acids (Keller G.H., 1993, Kricka, 1999).
- marker is meant a tracer capable of generating a signal that can be detected.
- tracers includes the enzymes that produce a detectable signal for example by colorimetry, fluorescence or luminescence, such as horseradish peroxidase, alkaline phosphatase, beta-galactosidase, glucose-6-phosphate dehydrogenase; chromophores such as fluorescent, luminescent or coloring compounds; electron density groups detectable by electron microscopy or by their electrical properties such as conductivity, by amperometry or visual measurement methods, or by impedance measurements; groups detectable by optical methods such as diffraction, surface plasmon resonance, contact angle variation or by physical methods such as atomic force spectroscopy, tunneling effect, etc. ; radioactive molecules such as 3Z P, 35 S or 125 I.
- the hybridization probe may be a so-called detection probe.
- the so-called detection probe is labeled by means of a marker as defined above. Thanks to the presence of this marker, it is possible to detect the presence of a hybridization reaction between a given detection probe and the transcript to be detected.
- probes can be used TaqMan®, as described by Espy et al., 2006; Held et al., 1996; Holland et al, 1991; molecular beacons also called Molecular Beacons, as described by EEspy et al., 2006; Mhlanga and Malmberg, 2001; Sigma, 2008; adjacent hybridization probes, called HybProbes (FRET); or else CPT (for "Cycling probe technology"), as described by Duck etai, 1990.
- TaqMan® as described by Espy et al., 2006; Held et al., 1996; Holland et al, 1991
- molecular beacons also called Molecular Beacons, as described by EEspy et al., 2006; Mhlanga and Malmberg, 2001; Sigma, 2008
- adjacent hybridization probes called HybProbes (FRET); or else CPT (for "Cycling probe technology"), as described by Duck etai, 1990.
- primers may be scorpion or Scorpion® primers as described in Sigma, 2008; Plexor primers, as described by Buh Gasparic et al., 2010; primers used in the AmpllFiuor® technique, as described by Bio-Rad Laboratories, 2006; Nazarenko etai, 1997; LUX (light upon extension) primers, as described by Bio-Rad Laboratories, 2006; Buh Gasparic et al, 2010; Nazarenko et al., 2002; or BD Qzyme TM primers as described in Bio-Rad Laboratories, 2006; Clontech, 2003.
- the hybridization probe may also be a so-called capture probe.
- the so-called capture probe is immobilized or immobilizable on a solid support by any appropriate means, that is to say directly or indirectly, for example by covalence or adsorption.
- a solid support it is possible to use synthetic materials or natural materials, optionally chemically modified, in particular polysaccharides such as cellulose-based materials, for example paper, cellulose derivatives such as cellulose acetate and cellulose.
- nitrocellulose or dextran polymers, copolymers, especially based on styrene-type monomers, natural fibers such as cotton, and synthetic fibers such as nylon; mineral materials such as silica, quartz, glasses, ceramics; latexes; magnetic particles; metal derivatives; gels etc.
- the solid support may be in the form of a microtiter plate, a membrane as described in application WO-A-94/12670, of a particle. It is also possible to immobilize on the support several different capture probes, each being specific for a target transcript. In particular, it is possible to use as support a biochip on which a large number of probes can be immobilized.
- biochip means a solid support of reduced size which is fixed a multitude of capture probes at predetermined positions.
- the concept of biochip, or DNA chip dates from the early 90's. It is based on a multidisciplinary technology integrating microelectronics, nucleic acid chemistry, image analysis and computer science. The operating principle is based on a round of molecular biology: the hybridization phenomenon, that is to say the complementarity pairing of the bases of two DNA and / or RNA sequences.
- the biochip method relies on the use of capture probes fixed on a solid support on which a sample of target nucleotide fragments labeled directly or indirectly with fluorochromes is activated.
- the capture probes are positioned specifically on the support or chip and each hybridization gives a particular information, in relation to the target nudeteotide fragment.
- the information obtained is cumulative and makes it possible, for example, to quantify a transcript or several target transcripts.
- the support or chip is washed, and the transcript complexes / capture probes are revealed by a high affinity ligand bound for example to a fluorochrome type marker.
- the fluorescence is read, for example, by a scanner and the fluorescence analysis is processed by computer.
- the DNA chips developed by Affymetrix ("Accessing Genetic Information with High-Density DNA Arrays") (Chee et al., 1996, Pease et al., 1994), for diagnostics molecular.
- capture probes are generally of reduced size, around 25 nucleotides.
- Other examples of microarrays are given in numerous publications (Cheng et al., 1998, 1996, Ginot, 1997, Uvache et al., 1994, Ramsay, 1998) or in US Pat. -5,700,637, US-A-5,445,934, US-A- 5,744,305 and US-A-5,807,522.
- the main feature of the solid support must be to maintain the hybridization characteristics of the capture probes on the target nucleotide fragments while generating a minimum background noise for the detection method.
- nucleic acid extraction and purification protocols well known to those skilled in the art.
- the extraction of nucleic acids can be carried out by:
- a step of lysis of the cells present in the biological sample in order to release the nucleic acids contained in the cells of the patient.
- the methods of lysis as described in the patent applications can be used:
- lysis methods such as thermal or osmotic shocks or chemical lyses with chaotropic agents such as guanidium salts (US Pat. No. 5,234,809).
- a purification step allowing separation between the nucleic acids and the other cellular constituents released in the lysis step.
- This step generally allows to concentrate the nucleic addes, and can be adapted to the purification of RNA.
- This nucleic acid purification step is particularly advantageous if it is desired to subsequently amplify said nucleic acids.
- RNAs specifically from a biological sample it is possible in particular to carry out an extraction with phenol, chloroform and alcohol in order to eliminate the proteins and to precipitate the RNA with 100% ethanol.
- the RNA can then be pelleted by centrifugation, washed and redissolved.
- a value derived from the quantity may for example be the absolute concentration, calculated by means of a calibration curve obtained from successive dilutions of a solution of amplicon of known concentration. It may also correspond to the value of the standardized and calibrated quantity, such as the CNRQ (Caiibrated Normalized Relative Quantity, (Heilemans et al., 2007)), which integrates the values of a reference sample, a calibrator and a calibrator. one or more reference genes.
- the amount of said at least one IL7R gene transcript will preferably be measured by quantitative RT-PCR.
- the amount of said at least one IL7R gene transcript will be measured with at least one of the following amplification primer pairs, with or without the mentioned probe:
- another object of the invention is a diagnostic kit comprising the tools and / or reagents necessary for the detection of at least one IL7R gene transcript.
- kits for measuring, in vitro or ex vivo, the amount of at least one IL7R gene transcript in a biological sample comprising:
- control sample which is a sample calibrated to contain the amount of said at least one transcript of the JL7R gene which corresponds to the average amount measured in a pool of samples of patients having undergone an attack or infection generating a systemic inflammatory response syndrome , which are known to have no known complications, and preferably which have been known to survive, and / or a control sample which is a sample calibrated to contain the amount of said at least one corresponding IL7R gene transcript the average amount measured in a pool of samples of patients having undergone an aggression or an infection generating a systemic inflammatory response syndrome, known to have known a complication, and preferably of which it is known that they do not have not survived.
- such a kit contains, as specific reagents making it possible to measure the quantity of said at least one IL7R gene transcript in said biological sample, at least one of the following pairs of amplification primers, with or without the mentioned probe:
- a control sample may be a sample containing a given concentration of target transcript (s) or corresponding complementary DNA, which may be either a synthetic sample containing a calibrated concentration of target transcript (s) or complementary DNA corresponding or a biological sample.
- a control sample may especially be a biological sample from at least one patient having undergone an attack or infection generating a systemic inflammatory response syndrome, which is known to have known no complications, and in particular that it has survived, or again a biological sample from at least one patient having undergone an aggression or an infection generating a systemic inflammatory response syndrome which is known to have had a complication, and in particular that it has not survived.
- This type of control sample is notably derived from one or more patient (s) having undergone an aggression, such as surgery, burn, trauma ..., or an infection generating a Systemic Inflammatory Response Syndrome (SIRS), in particular one or more patient (s) with sepsis, and preferably one or more patients in septic shock.
- an aggression such as surgery, burn, trauma ..., or an infection generating a Systemic Inflammatory Response Syndrome (SIRS)
- SIRS Systemic Inflammatory Response Syndrome
- the invention also covers the use of a kit according to the invention for carrying out the method of the invention, and in particular for evaluating the risk of complication, and in particular of the mortality of a patient having undergone an aggression, such as as surgery, burns, trauma ..., or an infection generating a systemic inflammatory response syndrome (SIRS), especially in a patient with sepsis, including severe sepsis.
- an aggression such as as surgery, burns, trauma ..., or an infection generating a systemic inflammatory response syndrome (SIRS)
- SIRS systemic inflammatory response syndrome
- the use of the kit according to the invention makes it possible to evaluate the risk of mortality in a patient who is in a state of septic shock.
- the subject of the present invention is also the use of the measurement, in vitro or ex vivo, of the quantity of at least one IL7R gene transcript, of at least one IL7R gene corresponding to an mRNA transcript, in a sample of a patient having undergone an aggression or an infection generating a syndrome of systemic inflammatory response, to evaluate the risk of complication, and in particular of mortality, in said patient
- said patient is in a state of sepsis, in particular severe or has undergone surgery, burns or trauma resulting in systemic inflammatory response syndrome.
- the biological sample to be tested comes from a patient in a state of septic shock or septic shock within 6 days prior to collection of the biological specimen to be tested.
- said at least one IL7R gene transcript is chosen from the transcripts IL7R-001 of SEQ ID No. 2, IL7R-002 of SEQ ID No. 3, IL7R-003 of SEQ ID No. 4, IL7R-005 of SEQ ID No. 6 and IL7R-007 of SEQ ID No. 8 and variants thereof, the sequence of a variant having at least 99% identity with one of said sequences.
- said at least one IL7R gene transcript is selected from transcripts comprising at least a part of the transmembrane domain, or even the entire transmembrane domain, of CD 127, and preferably corresponds to the transcript IL7R-001 of SEQ ID No. 2 or one of its variants having at least 99% identity with said sequence.
- the use according to the invention may also comprise the detection and / or quantification of the selected IL7R gene transcript (s), combined with the estimation of at least one of the SOFA and / or SAPSII severity scores for to evaluate the risk of complication of the patient who has suffered an aggression or an infection generating a svstemic inflammatory response (SIRS), and in particular of a patient who is in a state of septic shock.
- the SOFA score is preferably calculated, as described by Vincent et al., 1996, and / or the SAPSII score is preferably calculated as described by Le Gall et al., 1993.
- FIG. 1 is a schematic representation of the splicing of the messenger ARM of the IL7R gene
- PCR-A Transcripts IL7R-001, IL7R-002, IL7R-003, IL7R-005, IL7R-007;
- PCR-B Transcribed IL7R-001;
- PCR-C Transcribed IL7R-007.
- the Mann-Whitney test was used for comparisons between healthy subjects and patients with septic shock on D1 or D3.
- the matched Wilcoxon test was used for comparisons between J1 and J3 in patients with septic shock.
- FIG. 3 represents the levels of expression of different transcripts of the IL7R gene as a function of the occurrence or not of complications in patients with septic shock, J1, J3 or for the J3 / J1 ratio. Expression levels are expressed as "Calibrated Normally Released Quantity" (CNRQ) with HPRT1 as a reference gene and compared by the Mann-Whitney test.
- CNRQ Callibrated Normally Released Quantity
- FIG. 4 represents the levels of expression of different transcripts of the IL7R gene as a function of the occurrence or not of death on day 28 in patients with septic shock, J1, J3 or for the J3 / J1 ratio. Expression levels are expressed in CNRQ with HPRT1 as a reference gene and compared by the Mann-Whitney test.
- PCR-A Transcripts IL7R-001, IL7R-002, IL7R-003, IL7R-005, IL7R-007;
- PCR-B Transcribed IL7R-001;
- PCR-C Transcribed 1L7R-007.
- RNA extraction was performed using the PAXgene Blood RNA kit (PreAnalytix) following the manufacturer's recommendations. The quality of the extracted RNAs was monitored on Bioanalyzer (Agilent Technologies, Santa Clara, CA), using RNA 6000 Nano chips. Prior to the RNA elution step, the residual genomic DNA was removed by the action of a DNAse. The quality of the RNA was then checked using the RNA 6000 Nano kit on a Bioanalyzer (Agilent Technologies), the samples with an RIN (RNA Integrity Number) higher than 6 being considered of good quality. Finally, the RNA concentration was determined by fluorimetry (RNA assay kit on Qubit, Life Technologies).
- RNA 200 ng was then reverse transcribed to complementary DNA using the SuperScript® VILO TM cDNA Synthesis kit (Ufe Technologies, Chicago, IL). The cDNA solution thus obtained was diluted 1/20 and stored at -80 ° C until the quantitative PCR reaction.
- PCR reactions were performed on a LightCycler 480 (Roche Molecular Biochemicals, Basel, Switzerland) with the Taqman Fast Advanced Master Mix PCR kit (Roche), in a final volume of 20 ⁇ L containing 0.5 M primers and 0 , 1 M probe.
- the PCRs were carried out with an initial denaturation step of 10 min at 95 ° C., followed by 45 cycles of amplification in "touchdown PCR" (10 sec at 95 ° C., 29 sec at 68 ° C. for the first cycle, with a decrease of 0.5 ° C at each cycle until reaching 58 ° C, and extension of 1 s at 72 ° C).
- the second derivative maximum method was used via the LightCycler software to automatically determine the Cp ("crossing point") for each sample.
- Calibration curves were generated by carrying out, for 8 1/10 serial dilutions of a standard amplicon stock solution of known concentration. The pairs of primers and probes used are listed in Table 2:
- Expression levels were expressed in Calibrated Normalized Relative Quantity (CNRQ), according to Hellemans et al., 2007, including a reference gene and a calibrator.
- the reference gene used is HPRT1 (hypoxanthine phosphoribosyltransferase 1, NM_000194), measured by PCR (sense primer: CCAAAGATGGTCAAGGTCGC, antisense primer: GACACAAACATGATTCAAATCC, probe CAAGTTTGTTGTAGGATATGCCC).
- the calibrator consisted of an RNA pool of healthy volunteers. This calibrator followed the same process as the clinical samples from the reverse transcription step.
- Comparisons of the expression levels of the IL7R gene transcripts were performed by the Mann-Whitney test, except for comparisons between 31 and J3 in septic shock patients performed by the matched Wilcoxon test.
- the level of expression of the IL7R gene transcripts was measured as described above in whole blood samples from 30 patients. septic shock and 19 healthy volunteers. The results are shown in Figure 2.
- IL7R gene transcripts are detected in healthy subjects and in patients with septic shock on D1 and D3 after the onset of septic shock.
- the level of expression of the transcript coding for the membrane form of CD127 (Transcript IL7R-001) is predominant compared to the transcript corresponding to a potential soluble form (Transcript IL7R-007), in healthy subjects as in patients in septic shock .
- transcript IL7R-001 transcript-PCR-B the transcript encoding the membrane form of CD127
- transcript corresponding to a potential soluble form of CD127 Transcript IL7R-007-PCR-C
- the expression levels of the various IL7R gene transcripts including that encoding the membrane form (Transcript IL7R-001) and that corresponding to a potential soluble form (Transcript IL7R-007), are signi fi cantly lower on day 3 in patients who will have complications (death or nosocomial infection found, which corresponds to "yes" in Figure 3). This observation is also true for the ratio of expression levels J3 / J1.
- the expression levels of different IL7R gene transcripts measured on D3, or the J3 / J1 expression ratio therefore make it possible to discriminate patients who suffer from complications, from those who will not suffer, with areas under the curve greater than 0.8 for 33 and greater than 0.75 for the J3 / J1 expression ratio.
- the expression levels of the different IL7R gene transcripts are significantly lower on D3 in patients who will die (rated "non-survivors" in Figure 4) within 28 days of septic shock, compared with patients who will survive (noted Survivors "in Figure 4) over 28 days. This observation is also true for the ratio of expression levels J3 / J1.
- the levels of expression of different IL7R gene transcripts measured at D3, or the expression ratio D3 / D1 thus make it possible to discriminate the patients who will die from those who will survive, with areas under the curve greater than 0, 75.
- This study shows that the expression levels of different IL7R gene transcripts help to identify the patients most at risk for complications after septic shock. Specifically, on day 3, patients with complications will have lower levels of IL7R gene transcript expression than patients who will not have any complication.
- the evolution of the expression levels of the different IL7R gene transcripts between J1 and J3 is also informative, the expression levels remaining stable in patients who will suffer from complications, whereas they increase in patients who will not suffer no complications.
- the different IL7R gene transcripts which correspond to the membrane form or to soluble forms, and which are dosed simultaneously or individually, are able to identify the patients most at risk of complications.
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Engineering & Computer Science (AREA)
- Analytical Chemistry (AREA)
- Genetics & Genomics (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Investigating Or Analysing Biological Materials (AREA)
Abstract
Description
Claims
Priority Applications (8)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US15/780,573 US11339438B2 (en) | 2015-12-01 | 2016-12-01 | Method for assessing the risk of complications in patients with systemic inflammatory response syndrome (sirs) |
| ES16819968T ES2865339T3 (es) | 2015-12-01 | 2016-12-01 | Procedimiento de evaluación del riesgo de complicaciones en los pacientes que presentan un síndrome de respuesta inflamatoria sistémica (SIRS) |
| AU2016361646A AU2016361646B2 (en) | 2015-12-01 | 2016-12-01 | Method for assessing the risk of complications in patients with systemic inflammatory response syndrome (SIRS) |
| JP2018528223A JP6997709B2 (ja) | 2015-12-01 | 2016-12-01 | 全身性炎症反応症候群(sirs)患者における合併症リスクを評価する方法 |
| EP16819968.5A EP3384047B1 (fr) | 2015-12-01 | 2016-12-01 | Procede d'evaluation du risque de complications chez les patients qui presentent un syndrome de reponse inflammatoire systemique (sirs) |
| BR112018011224-0A BR112018011224A2 (pt) | 2015-12-01 | 2016-12-01 | processo de avaliação do risco de complicações nos pacientes que apresentam uma síndrome da resposta inflamatória sistêmica (sirs) |
| CN201680070662.3A CN108474038A (zh) | 2015-12-01 | 2016-12-01 | 评估全身炎症反应综合征(sirs)患者并发症风险的方法 |
| US17/729,115 US12110556B2 (en) | 2015-12-01 | 2022-04-26 | Kit for assessing the risk of complications in patients with systemic inflammatory response syndrome (SIRS) |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| FR1561671 | 2015-12-01 | ||
| FR1561671A FR3044325B1 (fr) | 2015-12-01 | 2015-12-01 | Procede d'evaluation du risque de complications chez les patients qui presentent un syndrome de reponse inflammatoire systemique (sirs) |
Related Child Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US15/780,573 A-371-Of-International US11339438B2 (en) | 2015-12-01 | 2016-12-01 | Method for assessing the risk of complications in patients with systemic inflammatory response syndrome (sirs) |
| US17/729,115 Division US12110556B2 (en) | 2015-12-01 | 2022-04-26 | Kit for assessing the risk of complications in patients with systemic inflammatory response syndrome (SIRS) |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2017093672A1 true WO2017093672A1 (fr) | 2017-06-08 |
Family
ID=55451318
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/FR2016/053164 Ceased WO2017093672A1 (fr) | 2015-12-01 | 2016-12-01 | Procede d'evaluation du risque de complications chez les patients qui presentent un syndrome de reponse inflammatoire systemique (sirs) |
Country Status (9)
| Country | Link |
|---|---|
| US (2) | US11339438B2 (fr) |
| EP (1) | EP3384047B1 (fr) |
| JP (1) | JP6997709B2 (fr) |
| CN (1) | CN108474038A (fr) |
| AU (1) | AU2016361646B2 (fr) |
| BR (1) | BR112018011224A2 (fr) |
| ES (1) | ES2865339T3 (fr) |
| FR (1) | FR3044325B1 (fr) |
| WO (1) | WO2017093672A1 (fr) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2023281225A2 (fr) | 2021-07-08 | 2023-01-12 | bioMérieux | Procede et kit de detection d'un virus respiratoire replicatif |
| WO2024033461A1 (fr) | 2022-08-12 | 2024-02-15 | bioMérieux | Methode pour determiner la nature virale ou bacterienne d'une infection |
| FR3138815A1 (fr) | 2022-08-12 | 2024-02-16 | bioMérieux | Détermination de la nature virale ou bactérienne d’une infection |
| EP4365308A1 (fr) | 2022-11-03 | 2024-05-08 | Biomérieux | Methode pour determiner la nature virale ou bacterienne d'une infection |
| WO2025172242A1 (fr) | 2024-02-13 | 2025-08-21 | bioMérieux | Procédé d'évaluation du risque de mort d'un patient |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| FR3101358A1 (fr) * | 2019-09-27 | 2021-04-02 | Bioaster | Procédé pour déterminer le risque de survenue d’une infection associée aux soins chez un patient |
| FR3101423A1 (fr) * | 2019-10-01 | 2021-04-02 | bioMérieux | Procédé pour déterminer la capacité d’un individu à répondre à un stimulus |
| EP4038202A1 (fr) * | 2019-10-01 | 2022-08-10 | Biomérieux | Procédé pour déterminer la capacité d'un individu à répondre à un stimulus |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20110098195A1 (en) * | 2008-03-17 | 2011-04-28 | Stefan Russwurm | Method for the in vitro detection and differentiation of pathophysiological conditions |
| WO2015040328A1 (fr) * | 2013-09-18 | 2015-03-26 | bioMérieux | Procédé d'évaluation du risque de mortalité chez des patients qui présentent un syndrome de réponse inflammatoire systémique (sirs) ou un sepsis |
Family Cites Families (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5541308A (en) * | 1986-11-24 | 1996-07-30 | Gen-Probe Incorporated | Nucleic acid probes for detection and/or quantitation of non-viral organisms |
| CN101160528A (zh) * | 2005-02-14 | 2008-04-09 | 惠氏公司 | Il17-f在诊断和治疗气道炎症中的用途 |
| EP2121750A2 (fr) * | 2007-01-16 | 2009-11-25 | Wyeth | Traitement, détection et surveillance de l'inflammation au moyen de trem-1 |
| US9589099B2 (en) * | 2011-07-21 | 2017-03-07 | The Chinese University Of Hong Kong | Determination of gene expression levels of a cell type |
| JP6346602B2 (ja) * | 2012-03-21 | 2018-06-20 | ダナ−ファーバー キャンサー インスティテュート, インコーポレイテッド | ヒトリンパ器官由来の抑制性ストローマ細胞の単離および使用 |
| FR2988479B1 (fr) * | 2012-03-23 | 2014-12-19 | Hospices Civils Lyon | Procede de determination de la susceptibilite aux infections nosocomiales |
-
2015
- 2015-12-01 FR FR1561671A patent/FR3044325B1/fr not_active Expired - Fee Related
-
2016
- 2016-12-01 JP JP2018528223A patent/JP6997709B2/ja active Active
- 2016-12-01 EP EP16819968.5A patent/EP3384047B1/fr active Active
- 2016-12-01 CN CN201680070662.3A patent/CN108474038A/zh active Pending
- 2016-12-01 US US15/780,573 patent/US11339438B2/en active Active
- 2016-12-01 AU AU2016361646A patent/AU2016361646B2/en not_active Ceased
- 2016-12-01 WO PCT/FR2016/053164 patent/WO2017093672A1/fr not_active Ceased
- 2016-12-01 BR BR112018011224-0A patent/BR112018011224A2/pt not_active Application Discontinuation
- 2016-12-01 ES ES16819968T patent/ES2865339T3/es active Active
-
2022
- 2022-04-26 US US17/729,115 patent/US12110556B2/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20110098195A1 (en) * | 2008-03-17 | 2011-04-28 | Stefan Russwurm | Method for the in vitro detection and differentiation of pathophysiological conditions |
| WO2015040328A1 (fr) * | 2013-09-18 | 2015-03-26 | bioMérieux | Procédé d'évaluation du risque de mortalité chez des patients qui présentent un syndrome de réponse inflammatoire systémique (sirs) ou un sepsis |
Non-Patent Citations (3)
| Title |
|---|
| DATABASE EMBL [online] 16 October 2009 (2009-10-16), "Sequence 541 from US-Patent US-2011/098195", retrieved from EBI accession no. EM_PAT:HC023537 Database accession no. HC023537 * |
| MICHAEL BAUER ET AL: "A Transcriptomic Biomarker to Quantify Systemic Inflammation in Sepsis - A Prospective Multicenter Phase II Diagnostic Study", EBIOMEDICINE, vol. 6, 8 March 2016 (2016-03-08), pages 114 - 125, XP055290123, ISSN: 2352-3964, DOI: 10.1016/j.ebiom.2016.03.006 * |
| WILLEMIJN M. PASSTOORS ET AL: "IL7R gene expression network associates with human healthy ageing", IMMUNITY & AGEING, vol. 25, no. 1, 11 November 2015 (2015-11-11), pages 402, XP055290637, DOI: 10.1186/s12979-015-0048-6 * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2023281225A2 (fr) | 2021-07-08 | 2023-01-12 | bioMérieux | Procede et kit de detection d'un virus respiratoire replicatif |
| FR3125065A1 (fr) | 2021-07-08 | 2023-01-13 | bioMérieux | Procédé et kit de détection d’un virus respiratoire réplicatif |
| WO2024033461A1 (fr) | 2022-08-12 | 2024-02-15 | bioMérieux | Methode pour determiner la nature virale ou bacterienne d'une infection |
| FR3138815A1 (fr) | 2022-08-12 | 2024-02-16 | bioMérieux | Détermination de la nature virale ou bactérienne d’une infection |
| EP4365308A1 (fr) | 2022-11-03 | 2024-05-08 | Biomérieux | Methode pour determiner la nature virale ou bacterienne d'une infection |
| WO2025172242A1 (fr) | 2024-02-13 | 2025-08-21 | bioMérieux | Procédé d'évaluation du risque de mort d'un patient |
Also Published As
| Publication number | Publication date |
|---|---|
| US11339438B2 (en) | 2022-05-24 |
| EP3384047B1 (fr) | 2021-01-27 |
| FR3044325A1 (fr) | 2017-06-02 |
| JP2019503663A (ja) | 2019-02-14 |
| CN108474038A (zh) | 2018-08-31 |
| EP3384047A1 (fr) | 2018-10-10 |
| US12110556B2 (en) | 2024-10-08 |
| AU2016361646B2 (en) | 2023-01-19 |
| US20190017118A1 (en) | 2019-01-17 |
| JP6997709B2 (ja) | 2022-02-10 |
| AU2016361646A1 (en) | 2018-06-21 |
| US20220259661A1 (en) | 2022-08-18 |
| ES2865339T3 (es) | 2021-10-15 |
| FR3044325B1 (fr) | 2019-05-03 |
| BR112018011224A2 (pt) | 2018-11-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP3384047B1 (fr) | Procede d'evaluation du risque de complications chez les patients qui presentent un syndrome de reponse inflammatoire systemique (sirs) | |
| CN101918589B (zh) | 糖尿病的诊断生物标志物 | |
| EP2904118B1 (fr) | Arnm d'exosome d'urine et procédés d'utilisation de ceux-ci pour détecter une néphropathie diabétique | |
| WO2024008779A1 (fr) | Determination du risque de deces d'un sujet infecte par un virus respiratoire par la mesure du niveau d'expression du gene adgre3 | |
| WO2010082004A1 (fr) | Procedes pour determiner la susceptibilite a contracter une infection nosocomiale chez un patient et pour etablir un pronostic d'evolution d'un syndrome septique | |
| FR2855832A1 (fr) | Procede de diagnostic et/ou de pronostic d'un syndrome septique | |
| WO2024008780A1 (fr) | Determination du risque de deces d'un sujet infecte par un virus respiratoire par mesure du niveau d'expression du gene oas2 | |
| EP3211096A1 (fr) | Combinaison de miarns permettant la prediction de l'evolution clinique du cancer du rectum | |
| CN118406751B (zh) | 用于预测、诊断或监测脓毒血症急性肾损伤的tsRNA、试剂盒及其应用 | |
| CN111455037B (zh) | 基于血浆外泌体环状rna的冠心病分子诊断标志物及其应用 | |
| WO2013057293A1 (fr) | Méthode de quantification de marqueurs rénaux par dosage urinaire | |
| CA2816947A1 (fr) | Methode de depistage du cancer colorectal | |
| EP2943588B1 (fr) | Procede et kit pour etablir in vitro un pronostic de severite chez un patient en choc septique | |
| US20210087634A1 (en) | Determination of risk for development of cardiovascular disease by measuring urinary levels of podocin and nephrin messenger rna | |
| WO2021064327A1 (fr) | Procédé pour déterminer la capacité d'un individu à répondre à un stimulus | |
| FR3101423A1 (fr) | Procédé pour déterminer la capacité d’un individu à répondre à un stimulus | |
| WO2022106795A1 (fr) | Procédé de classification d'un individu | |
| Rajendiran | Diagnostic Utility of Circulating MicroRNA-21 in Acute Myocardial Infarction. | |
| FR3158744A1 (fr) | Biomarqueurs et outil pronostique pour les patients atteint de lymphomes b diffus a grandes cellules | |
| EP3781948A1 (fr) | Evaluation du risque de complication chez un patient suspecté d'avoir une infection ayant un score sofa inférieur à deux |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 16819968 Country of ref document: EP Kind code of ref document: A1 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2018528223 Country of ref document: JP |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112018011224 Country of ref document: BR |
|
| ENP | Entry into the national phase |
Ref document number: 2016361646 Country of ref document: AU Date of ref document: 20161201 Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2016819968 Country of ref document: EP |
|
| ENP | Entry into the national phase |
Ref document number: 112018011224 Country of ref document: BR Kind code of ref document: A2 Effective date: 20180601 |
















