WO2017077999A1 - Method for detecting tuberculosis complex-derived dna - Google Patents

Abstract

As a result of in-depth research of primary and probe designs, digital PCR conditions, and the like with which the various bacterial strains of tuberculosis complex can be detected in order to establish a method for detecting tuberculosis complex-derived DNA in plasma by digital PCR, the inventors of the present invention established a method with which tuberculosis complex-derived DNA can be detected from the plasma of a tuberculosis patient on a level of several copies/20 µL reaction solution by digital PCR using a specific primer and probe targeting IS6110 and gyrB.

Description

Method for detecting DNA derived from Mycobacterium tuberculosis

The present invention relates to a primer and probe set for detecting DNA derived from Mycobacterium tuberculosis by digital PCR (hereinafter sometimes referred to as “dPCR”), and DNA derived from Mycobacterium tuberculosis from a blood sample using the set. It relates to the detection method.

Pulmonary tuberculosis is still one of the threatening infectious diseases, and 9 million people develop and 1.5 million people die every year worldwide (Non-patent Document 1). As a diagnostic method for pulmonary tuberculosis, sputum smear and culture tests are the gold standard. However, this test method often has difficulty in diagnosis, and delays in diagnosis may cause problems such as spread of infection and induction of tuberculosis resistance.

Nucleic acid amplification testing methods such as PCR and LAMP have been developed as diagnostic methods to compensate for the drawbacks (Non-Patent Documents 2 to 8). In the diagnosis by the nucleic acid amplification test method, a repetitive sequence IS6110, a gyrase subunit B (gyrB) gene, and the like are used as target regions for specifically detecting Mycobacterium tuberculosis (Patent Documents 1 and 2, etc.). However, specimens usually use sputum in the nucleic acid amplification test method. When collecting sputum samples, careful precautions are required to prevent the spread of pathogens. Sometimes it is difficult to collect sputum, and diagnosis is often difficult. Moreover, since tuberculosis bacteria infect other than respiratory organs, invasive treatment may be necessary to obtain a suitable specimen.

Nucleic acid amplification test methods using urine, peripheral blood mononuclear cells, etc. have been reported as a sample that replaces the minimally invasive sputum (Non-Patent Documents 9 to 14). However, these examination methods have not yet been clinically used in terms of sensitivity.

US Patent Application No. 2013/0164756 Japanese Patent Laid-Open No. 11-290079

An object of the present invention is to provide means capable of accurately and promptly diagnosing Mycobacterium tuberculosis infection using a sample that is minimally invasive, has a low risk of infection spread, and can be collected stably.

Due to the fact that M. tuberculosis DNA is detected in the urine, the present inventors may have a very low concentration of cell-free free M. tuberculosis DNA in the plasma of patients infected with M. tuberculosis. I thought that there was sex. Focusing on the recently developed digital PCR technology that can demonstrate high sensitivity in detecting extremely low copy number DNA, we aim to establish a method to detect M. tuberculosis-derived DNA in plasma by digital PCR. As a result of diligent research on the design of primers and probes capable of detecting various strains of, and the conditions of digital PCR, plasma of tuberculosis patients was obtained by digital PCR using specific primer and probe sets targeting IS6110 and gyrB. The present invention was completed by successfully detecting M. tuberculosis group-derived DNA at a level of several copies / 20 μL reaction solution.

That is, the present invention is a digital PCR primer for detecting Mycobacterium tuberculosis group IS6110, comprising a forward primer having the base sequence shown in SEQ ID NO: 1, a reverse primer having the base sequence shown in SEQ ID NO: 2, and a probe having the base sequence shown in SEQ ID NO: 3. And a probe set. The present invention also relates to a digital PCR primer for detecting Mycobacterium tuberculosis group gyrB, comprising a forward primer having the base sequence shown in SEQ ID NO: 4, a reverse primer having the base sequence shown in SEQ ID NO: 5, and a probe having the base sequence shown in SEQ ID NO: 6. And a probe set. Furthermore, the present invention comprises a tuberculosis group comprising DNA PCR extracted from a blood sample isolated from a subject and performing digital PCR using at least one of the primer and probe set of the present invention. Provided is a method for detecting a derived DNA. Furthermore, the present invention provides a tuberculosis group-derived DNA detection reagent or kit for digital PCR, comprising at least one of the primer and probe set of the present invention.

According to the present invention, for the first time, a means for specifically detecting a tuberculosis group-derived DNA by distinguishing it from non-tuberculous mycobacteria from a plasma sample to enable detection of M. tuberculosis group infection and the like is provided. According to the present invention, M. tuberculosis group-derived DNA can be detected even with a low copy number of less than 10 copies per reaction solution, and the detection sensitivity is extremely high. Blood samples can be obtained stably, and samples can be obtained from subjects such as children who are difficult to collect respiratory-derived samples such as sputum and endoscope washing liquid. Even in cases infected with respiratory organs, blood samples can be collected with minimal invasiveness. There is no risk of spreading pathogens like collecting sputum samples. Quantitative detection of Mycobacterium tuberculosis group-derived DNA in plasma not only detects Mycobacterium tuberculosis infection, but also monitors Mycobacterium tuberculosis infection or disease status, evaluates the risk of developing Mycobacterium tuberculosis, It is possible to determine the therapeutic effect of infectious disease or tuberculosis.

It is the result of examining the annealing temperature of the dPCR primer for IS6110 detection and the dPCR primer for gyrB detection using the constructed DNA standard as a template. It is the result of performing dPCR using the constructed DNA standard as a template at the concentration shown in the figure, and the annealing and extension reaction temperature at 54 ° C. It is the result of performing dPCR using a DNA standard in the state of plasmid DNA (before digestion) and an insert DNA excised with a restriction enzyme (after digestion) as a template. It is the result of examining the use concentration of a primer and a probe using IS6110 detection system. It is the result of comparing and examining the probe concentration at 125 nM and 250 nM in both the IS6110 detection system and the gyrB detection system. It is the result of having analyzed the blood sample of PTB patient, control, and NTM patient by dPCR. The concentration of MTB DNA input into 20 μL of dPCR reaction solution was calculated by Poisson distribution. The average number of results from two dPCR assays was plotted. The horizontal bar shows the median and standard deviation of the two assays. It is the result of evaluating the detectability of MTB-derived DNA in PTB patient plasma of each dPCR assay by ROC analysis. This is the result of detecting MTB DNA in plasma by a dPCR IS6110 detection system for disseminated MTB infection cases for which MTB infection could not be diagnosed by conventional testing methods. NTC: Negative control with no addition of mold.

In the present invention, a minute amount of DNA derived from Mycobacterium tuberculosis group contained in the plasma of a patient infected with Mycobacterium tuberculosis group is detected by digital PCR. Digital PCR is a technique in which a PCR reaction solution is divided into a large number of small compartments, PCR is performed, and target DNA is detected and quantified based on the number of small compartments in which amplification is detected.

The term tuberculosis group includes Mycobaterium tuberculosis (MTB), M. bovis, M. 、 africanum, M. microti, M. canettii, M. caprae, and M. pinnipedii. Of these, the one that causes tuberculosis in humans is primarily M. tuberculosis. Since the gene region targeted in the present invention is conserved in the above-mentioned Mycobacterium belonging to the Mycobacterium group, various strains of the Mycobacterium group can be detected. In the present invention, the term “detection” includes qualitative detection, quantitative detection, and semi-quantitative detection.

One of the digital PCR primers and probe sets for detecting Mycobacterium tuberculosis is targeted at the repetitive sequence IS6110 (GenBank accession number X17348 etc.) present in the Mycobacterium tuberculosis complex genome. The nucleotide sequences of the forward primer, reverse primer, and probe for detecting IS6110 are shown in SEQ ID NOs: 1 to 3, respectively. This set for detecting IS6110 targets the region from position 311 to position 381 in the base sequence shown in SEQ ID NO: 11. SEQ ID NO: 11 is a part of the IS6110 sequence of Mycobacterium tuberculosis M. tuberculosis, and is a region adopted as a DNA standard for IS6110 in the following examples.

Another digital PCR primer and probe set for detecting Mycobacterium tuberculosis group targets genes encoding gyrase subunit B (gyrB, GenBank accession number AL123456.3, etc.). The base sequences of gyrB detection forward primer, reverse primer and probe are shown in SEQ ID NOs: 4 to 6, respectively. This set for detecting gyrB targets the region at positions 217 to 334 in the base sequence shown in SEQ ID NO: 12. SEQ ID NO: 12 is a part of the gyrB sequence of Mycobacterium tuberculosis M. tuberculosis and is a region adopted as a DNA standard for gyrB in the following examples.

The dPCR probe can basically adopt the same principle as the real-time PCR probe. The dPCR probe for detecting IS6110 and the dPCR probe for detecting gyrB may detect amplification by any of the intercalator method, TaqMan (registered trademark) probe method, and cycling probe method, but TaqMan (registered trademark) ) The probe method can be preferably employed. In the TaqMan (registered trademark) probe method, a fluorescent dye as a reporter substance is bound to one end of the probe, and a quencher substance is bound to the other end. Generally, a reporter substance is bound to the 5 ′ end and a quencher substance is bound to the 3 ′ end. Various fluorescent dyes and quencher substances are known. Any fluorescent dye and quencher substance can be used for the dPCR probe for IS6110 detection and the dPCR probe for gyrB detection as long as the quenching of fluorescence before probe decomposition and the generation of fluorescence after probe decomposition occur appropriately. May be.

As a method of digital PCR, in addition to a method of forming a droplet of a PCR reaction solution of a small volume in oil and performing an amplification reaction in an emulsion, a PCR reaction solution is divided and injected into a very small reaction well. The technique of performing is known. Any digital PCR may be used in the present invention. In this specification, for convenience, the former method is called a droplet method, and the latter method is called a microwell method. In the droplet method, droplets formed in oil correspond to “small compartments”, and in the microwell method, reaction wells into which PCR reaction solutions are dividedly injected correspond to “small compartments”.

When dPCR is performed using the above primer and probe set, a very small amount of free (cell-free) Mycobacterium tuberculosis group-derived DNA present in the blood of a subject infected with M. tuberculosis group It can be detected with sensitivity. The Mycobacterium spp. That cause diseases by infecting mammals such as humans include a group of bacteria collectively called non-tuberculous mycobacteria in addition to the Mycobacterium tuberculosis group. According to dPCR, it is possible to specifically detect the Mycobacterium tuberculosis group in distinction from nontuberculous mycobacteria.

Hereinafter, each step of the method for detecting DNA derived from Mycobacterium tuberculosis by dPCR using the primer and probe set of the present invention will be described. It should be noted that at least one of IS6110 detection primer and probe set and gyrB detection primer and probe set may be used for detection of DNA derived from Mycobacterium tuberculosis group. If each assay is performed using two sets for one specimen, the accuracy of detection of Mycobacterium tuberculosis group can be further increased.

DNA used as a dPCR sample is prepared from a blood sample isolated from a subject. The subject is a mammal, typically a human. The term blood sample includes whole blood, plasma, and serum. Although DNA may be extracted from serum, it is convenient and preferable to separate plasma from a whole blood sample and extract DNA from plasma to obtain a dPCR sample. Extraction of plasma DNA can be easily performed using a commercially available kit or the like. Methods for detecting M. tuberculosis-specific DNA in peripheral blood mononuclear cells are known (Condos R, et al. Lancet 1996, 347 (9008), p.1082-5 .; Taci N, et al. Respir Med 2003, 97 (6), p.676-81 .; Ahmed N, et al. J Clin Microbiol 1998, 36 (10), p.3094-5. Since M. tuberculosis group DNA is targeted, complicated steps such as a treatment step for separating peripheral blood mononuclear cells from whole blood and adjustment of the number of cells used for DNA purification are unnecessary.

The dPCR reaction solution can be prepared using a commercially available dPCR reagent containing a heat-resistant polymerase. In both the IS6110 detection system and the gyrB detection system, the primer concentration is preferably about 700 nM to 1100 nM, for example, about 800 nM to 1000 nM, and the probe concentration is about 100 nM to 150 nM, for example, 110 nM to 135 nM. . If the concentration of the primer is lower than this, the intensity of the fluorescence signal from each small section after the amplification reaction is greatly reduced, which is not desirable. Also, if the probe concentration is higher than this, it is easy to generate false positives or gray zone subdivisions (called rain drops in the droplet method) that show intermediate fluorescence intensities that are difficult to determine as either positive or negative. Is not desirable. As for the amount of the subject DNA sample, when the total amount of the reaction solution is 20 μL, DNA corresponding to about 20 μL of plasma may be used.

Next, the dPCR reaction solution is divided into a large number of small compartments. In the droplet method, the dPCR reaction solution is divided into a large number of small droplets in oil to form an emulsion. In the microwell method, the dPCR reaction solution is dividedly injected into a microreaction well on the chip. In any method, division into small sections can be performed using a commercially available dedicated device. The dPCR reaction solution may be divided so that the target DNA has a concentration of about 1 to 2 copies or less in a small compartment, and is not particularly limited, but the PCR reaction solution containing the subject DNA sample with the above total DNA amount What is necessary is just to divide 20 microliters into about tens of thousands, for example, about 10,000 to 30,000 small sections.

After dividing into small sections, perform an amplification reaction using an appropriate PCR device. The number of samples that can be processed simultaneously in a single run of an amplification reaction varies depending on the dPCR system used, but it is usually preferable to perform the amplification reaction immediately after the division of the dPCR reaction solution (particularly in the case of the droplet method). Divide the dPCR reaction solution as much as can be processed in one run. As conditions for the amplification reaction, it is desirable that the temperature of annealing and extension reaction be about 52 ° C. to 55 ° C. in both the IS6110 detection system and the gyrB detection system. When an annealing and extension reaction is performed at this temperature, a high fluorescence signal can be obtained after the amplification reaction.

After the amplification reaction, the fluorescence signal from each small compartment is detected with an appropriate fluorescence reader. A commercially available fluorescence reader dedicated to the dPCR system used may be used. Since the fluorescence signal is generated in the small compartment where the amplification has occurred, the number is counted with the small compartment producing the fluorescence as the positive small compartment. When several or more (for example, 3 or more, 4 or more, or 5 or more) positive subcompartments are detected in the subject sample, the tuberculosis group-derived DNA is present in the blood of the subject, Therefore, it can be determined that the subject is infected with the Mycobacterium tuberculosis group. In addition, since the number of positive subdivisions reflects the amount of DNA derived from Mycobacterium tuberculosis group in the blood, and hence the amount of Mycobacterium tuberculosis group in the body of the subject, the method of the present invention detects the infection of Mycobacterium tuberculosis group. In addition, it can also be used for monitoring tuberculosis group infection or the disease state of tuberculosis, evaluating the risk of developing tuberculosis, and determining the therapeutic effect of tuberculosis group infection or tuberculosis. That is, the method of the present invention can be performed to assist these actions by the physician.

In order to discriminate between positive and negative of a small block appropriately, it is desirable to set a threshold for determining a positive small block. The threshold can be set by dPCR using an appropriate DNA standard as a template. As the DNA standard, a target gene region partial fragment containing the amplified region of the dPCR primer may be used. For example, as a DNA standard for the IS6110 detection system, a DNA fragment having the base sequence shown in SEQ ID NO: 11 is used, and as a DNA standard for the gryB detection system, a DNA fragment having the base sequence shown in SEQ ID NO: 12 is used. be able to. Such a DNA fragment can be obtained by amplification by PCR using the genomic DNA of the Mycobacterium tuberculosis group (for example, M. tubatuberculosis standard strain) as a template. The DNA standard is used as a template in the form of a linear DNA fragment, not in the form of circular DNA incorporated into plasmid DNA. By using it in a straight chain, the occurrence of gray zone small sections called rain drops in the droplet method can be greatly reduced, and an appropriate threshold value can be set.

The DNA standard reaction may be performed at least once per run of amplification reaction. When the dPCR reaction solution after dividing into small compartments is transferred to a 24-well plate or a 96-well plate and an amplification reaction is performed, it is sufficient to provide at least one well of the DNA standard reaction per plate. In the microwell method, at least one DNA standard microwell chip may be added to one run.

After the amplification reaction of the DNA standard, the fluorescence signal of each subcompartment is detected by the fluorescence reader in the same way as the subject sample, and the positive and negative subcompartments are appropriately determined by cluster analysis of the signal intensity of each subcompartment. The threshold value to be divided is determined. In this case, the cluster analysis is preferably performed by the nearest neighbor method. For example, the known k-nearest neighbor algorithm “definetherain” (Jones M, et al. J Virol Methods 2014; 202: 46-53.) Is preferably used. Can do.

The determined threshold value is applied to the subject sample that has been amplified simultaneously with the DNA standard. For example, when the amplification reaction of a large number of subject-derived samples is performed twice on two plates, the DNA standard added to the same first plate for the sample on the first plate Apply the threshold determined from the dPCR result of the sample, and apply the threshold determined from the dPCR result of the DNA standard added to the second plate to the second plate sample. Judgment of positive / negative of a small section of a sample derived from a person. A small compartment with a signal intensity exceeding the threshold is judged positive. In order to check for false positives, dPCR may also be performed as a negative control for the reaction solution without addition of template DNA.

The above-mentioned primers and probe sets for detecting DNA derived from Mycobacterium tuberculosis can be provided as a DNA detection reagent or kit for Mycobacterium tuberculosis for dPCR. Only one of the two types of primers and probe sets may be included, or both may be included. The primer and probe may be in a dried form, in a form dissolved in a buffer solution or the like, or in a form in which the dried primer and probe are combined with a buffer solution or the like. The reagent or kit may be in the form of a set of the linear DNA standards described above. Furthermore, the reagent or kit may be in the form of a set of other reagents necessary for dPCR. Reagents other than primers and probes necessary for dPCR are well known. For example, a buffer solution for preparing a dPCR reaction solution, a heat resistant polymerase, or a dPCR containing a heat resistant polymerase and dNTPs in the buffer solution. Examples include a premix solution for preparing a reaction solution. Instructions for use are usually attached to the reagent or kit.

Hereinafter, the present invention will be described more specifically based on examples. However, the present invention is not limited to the following examples.

<Materials and methods>
Subjects and bacterial strains Pulmonary tuberculosis (PTB) patients were patients who were diagnosed with sputum smear positive pulmonary tuberculosis and were isolated and treated at Yokohama City University Hospital. PTB was diagnosed by a conventional nucleic acid amplification test using sputum specimens that were positive for acid-fast bacteria. Healthy controls were selected from the health care workers at the hospital. Regarding healthy controls, it was confirmed that there was no MTB infection history by a commercially available ELISPOT assay (T-SPOT.TB). Non-tuberculous mycobacteria (NTM) patients were patients who met the diagnostic criteria of the American Thoracic Society and the American Infectious Diseases Society (Gutierrez-Aguirre I, et al. Methods Mol Biol 2015, 1302, p. 331-47.). Eleven strains of NTM obtained from sputum or bronchial lavage fluid of NTM patients (M. abscessus, M. avium, M. chelonae, M. fortuitum, M. gordonae, M. intracellulare, M. kansasii, M. marinum, M. scrofulaceum, M. szulgai, M. terrae). This study was conducted with the approval of an independent ethics committee at the Yokohama City University School of Medicine and was registered in the University Hospital Medical Information Network Clinical Trial Registration System (UMIN-CTR) (no. UMIN000016464). Prior to enrollment in the study, written informed consent was obtained from all cases.

Sample preparation Peripheral blood was collected from each subject using a vacutainer blood collection tube (Terumo) containing ETDA-2Na. Whole blood was centrifuged at 1500 rpm for 10 minutes to obtain a plasma sample. Total DNA was extracted from 200 μL of each plasma sample using Qiagen DNeasy Blood and Tissue Kit (Qiagen). The kit was basically used according to the attached instructions except that the amount of Buffer AE used during elution was reduced to 40 μL. All samples were processed within 8 hours after collection. Genomic DNA of each NTM strain was extracted from colonies on an egg-based solid medium (Ogawa medium) using the Qiagen DNeasy Blood and Tissue Kit. The extracted DNA sample was stored at −80 ° C. until analysis.

dPCR Primers and Probes Two sets of primers and probes were designed for detection of MTB specific genomic DNA sequences. One targeted the insertion sequence 6110 (IS6110; GenBank accession number X17348). This insertion sequence is conserved within the Mycobacterium tuberculosis group including M. tuberculosis (MTB), M. bovis, M. africanum, M. microti, M. canettii, M. caprae, and M. pinnipedii (Thierry D , et al. J Clin Microbiol 1990, 28 (12), p.2668-73.). The base sequences of primers and probes used for amplification of IS6110 are shown below. The probe was bound with 6-carboxyfluorescein (FAM) as a reporter dye at the 5 'end and black hole quencher (BHQ-1) as a quencher dye at the 3' end.
IS6110 forward: GGCGTACTCGACCTGAAAGA (SEQ ID NO: 1)
IS6110 reverse: CTGAACCGGATCGATGTGTA (SEQ ID NO: 2)
IS6110 probe: [FAM] -CCACCATACGGATAGGGGAT- [BHQ-1] (SEQ ID NO: 3)

The other target was Gyrase subunit B (gyrB; GenBank accession number AL123456.3). gyrB is also conserved within the Mycobacterium tuberculosis group (Kasai H, et al. J Clin Microbiol 2000, 38 (1), p.301-8; Niemann S, et al. J Clin Microbiol 2000, 38 (9), p.3231-4.). The base sequences of primers and probes used for amplification are shown below. The dye was bound to the probe in the same manner as the IS6110 probe.
gyrB forward: AAGGACCGCAAGCTACTGAA (SEQ ID NO: 4)
gyrB reverse: GTGTTGCCCAACTTGGTCTT (SEQ ID NO: 5)
gyrB probe: [FAM] -ACCTCACCGGTGACGATATC- [BHQ-1] (SEQ ID NO: 6)

All of the above primers and probes are known mutation regions (A. Salah Eldin NMM, SI Mostafac. Egyptian Journal of Chest Diseases and Tuberculosis 2012, 61 (4), p.349-53 .; Long Q, et al. Int J Antimicrob Agents 2012, 39 (6), p.486-9 .; Aryan E, et al. Microbiol Res 2010, 165 (3), p.211-20.) It was confirmed in silico using BLAST software (www.ncbi.nlm.nih.gov/BLAST) that the primers and probes are specific for the Mycobacterium tuberculosis group and not the NTM strain (Table 1, 2). Oligonucleotides used for primers and probes were synthesized by Sigma-Aldrich.

Construction of standards for IS6110 and gyrB The double-stranded DNA fragment containing the region to be detected is the MTB standard strain (JATA KK11-291) genomic DNA as a template, and the primer set is IS6110 PC-F (AACGGCTGATGACCAAACTC, SEQ ID NO: 7) And IS6110 PC-R (GATCGTCTCGGCTAGTGCAT, SEQ ID NO: 8), or gyrB PC-F (CAAGAACGCGATTCATAGCA, SEQ ID NO: 9) and gyrB PC-R (TGGGTCAGCTGTTCGTTACA, SEQ ID NO: 10). Each fragment was ligated into pCR-Blunt II TOPO vector (Invitrogen) and introduced into E. coli DH5α (TOYOBO). Recombinant clones were selected on LB agar medium containing kanamycin (KM) and cultured in LB liquid medium containing KM. Plasmids were isolated using HighSpeed Plasmid Midi Kit (Qiagen) according to manufacturer's instructions. The concentration of plasmid DNA was calculated based on the molecular weight of the DNA, and the DNA solution was diluted with Tris-EDTA Buffer (Sigma-Aldrich) to 1.0 × 10 ⁴ copies / μL.

Optimization of dPCR and reaction conditions dPCR reaction solution for clinical specimen assay was prepared as follows; mix 10 μL dPCR Probe Supermix (BioRad), 900 nM each primer, 125 nM probe, 4 μL sample. DNase and RNase-free ultrapure water was used to make 20 μL. The reaction solution was loaded on a QX200 Droplet Generator (BioRad) to generate microdroplets. The produced emulsion of droplets was transferred to a 96-well PCR plate (Eppendorf), sealed with a foil heat seal (Eppendorf), and heated at 180 ° C. for 5 seconds. Subsequently, amplification reaction was performed using C1000 touch thermal cycler (BioRad). The reaction conditions were 95 ° C. for 10 minutes → (thermal denaturation at 94 ° C. for 30 seconds → extension reaction at 54 ° C. for 90 seconds), 40 cycles → 98 ° C. for 10 minutes. The temperature gradient rate was set to 2.0 ° C./second. The emulsion produced by the Droplet Generator was immediately subjected to an amplification reaction, and the endpoint fluorescence signal from each droplet in the emulsion was measured using a QX200 Droplet Reader (BioRad). Each sample and each target assay was performed in duplicate. To avoid contamination inside the QX200 Droplet Reader, the standard fluorescence was analyzed last.

Data analysis The fluorescence intensity data after amplification reaction of each droplet was exported as a csv file from QuantaSoft droplet reader software (version 1.7.4, BioRad). The threshold for selecting positive droplets depends on the fluorescence intensity of the standard droplets applied to the k-nearest neighbor algorithm “definetherain” (Jones M, et al. J Virol Methods 2014, 202, p.46-53.). Were determined.

<Result>
1. Optimization of dPCR conditions
(1) Examination of annealing temperature The dPCR reaction conditions were optimized using DNA standards prepared for each of the two target genes. First, gradient PCR amplification was performed in the range of 50 ° C. to 60 ° C. in order to determine the annealing temperature. As a result, all of the IS6110 detection primer and the gyrB detection primer had Tm values of about 60 ° C., but the fluorescence intensity was highest at 54 ° C. in any assay (FIG. 1). Therefore, the temperature of annealing and extension reaction in dPCR of clinical specimens was set to 54 ° C.

(2) Setting of threshold value In dPCR, a droplet called “rain drop”, which shows an intermediate fluorescence intensity that is difficult to judge as positive or negative, is often observed. Figure 2 shows the result of dPCR using the DNA standard prepared above as a template at a concentration of 10 ⁴ to 10 ⁹ and an annealing and extension reaction temperature of 54 ° C. Drop was recognized. Since it is not possible to define an appropriate threshold value as it is, measures for this rain drop were examined.

Since the DNA standard is incorporated in the plasmid DNA, the plasmid was cleaved on both sides of the insert by EcoRI digestion, and dPCR was performed using the linearized insert fragment as a template. As a result, as shown in FIG. 3, raindrops were significantly reduced. This makes it possible to accurately define the threshold value.

(3) Optimization of primer and probe concentrations The recommended manufacturer concentration of primers and probes is 900 nM for the primer and 250 nM for the probe. With the aim of optimizing the concentration of the primer and probe developed this time, first, the primer and probe for IS6110 were subjected to dPCR using EcoRI-digested standard DNA as a template and the primer and probe concentrations varied. The primer concentration was 450 nM and 900 nM, and the probe concentration was 125 nM and 250 nM. The results are shown in FIG. When the primer concentration was 450 nM, the fluorescence intensity was significantly reduced. Therefore, it was considered that the primer should be 900 nM.

Next, the probe concentration was compared between 125 nM and 250 nM in both the IS6110 detection system and the gyrB detection system. The results are shown in FIG. At a probe concentration of 250 nM, one false positive droplet was observed in the IS6110 detection system. Also, 250nM had more raindrops than 125nM. The purpose of this study was to detect low copy number of DNA, so the appropriate probe concentration was 125 nM with few false positives.

Based on the above results, in the assay system developed this time, it was decided to use a primer concentration of 900 nM and a probe concentration of 125 nM.

2. Detection of IS6110 and gyrB genes in blood samples
(1) Patient characteristics Whole blood samples of 43 subjects were obtained from January to August 2015. The characteristics of the subject are shown in Table 3. Of the 43 subjects, 24 were PTB patients, 4 were lung NTM patients, and 15 were control subjects. All PTB patients were confirmed to have no HIV infection by HIV Ag / Ab combo test (Abbott Laboratories). Eight out of 24 patients with PTB were diagnosed as having extrapulmonary MTB lesions by direct sampling or imaging findings. Of the 4 NTM patients, 3 were infected with M. avium, one of which was superinfected with M. abscessus. The remaining one was infected with M. intracellulare.

(2) dPCR result of blood sample The concentration of MTB DNA input in 20 μL of the dPCR reaction solution was calculated by Poisson distribution. Good reproducibility was obtained with all dPCR assays repeated twice (IS6110, p = 0.0001, r = 0.71; gyrB, p <0.0001, r = 0.84, Spearman correlation). Data on the average number of replicated assays is shown in FIG. The results of each assay targeting IS6110 and gyrB were significantly correlated (p = 0.011, r = 0.51, Spearman correlation). In PTB patient samples, a significantly different high copy number of IS6110 was detected compared to healthy control subjects. Similar results were observed in the gyrB target assay, with significant differences between PTB patients and control subjects.

Detectability of plasma DNA in PTB patients was evaluated by receiver operating characteristic (ROC) analysis (FIG. 7). The AUC of the ROC curve was 0.87 (95% CI, 0.76 to 0.99; P = 0.0001) for the IS6110 detection assay, and 0.77 (95% CI, 0.62 to 0.91; P = 0.0056) for the gyrB detection assay. In addition, the sensitivity of IS6110 detection is 83% and the specificity is 93% at the DNA concentration of the 1.5 copy / 20 μL reaction solution, and the sensitivity of gyrB detection is 58% and the specificity at the DNA concentration of the 0.35 copy / 20 μL reaction solution. Was 93%.

All samples from control subjects and lung NTM patients had at most one positive droplet per assay (1.6-2.2 copies / 20 μL, calculated by Poisson distribution), but negative control (no sample response) This was presumed to be a false positive because the frequency of positive droplets was the same in liquid. Gender (IS6110; p = 0.089, gyrB; p = 0.51), age (IS6110; p = 0.83, gyrB; p = 0.68), lung lesion distribution (unilateral or bilateral) (IS6110; p = 0.89, gyrB; p = 0.10), presence / absence of cavity (IS6110; p = 0.13, gyrB; p = 、 0.47), presence of extrapulmonary lesions (IS6110; p = 0.37, gyrB; p = 0.99) There was no statistically significant difference in copy number. In patients with disseminated tuberculosis, the IS6110 detection assay was 36 copies / 20 μL and the gyrB detection assay was 6.3 copies / 20 μL. In 2 patients with PTB, the IS6110 detection assay was over 2000 copies / 20 μL (2430 and 2260 copies / 20 μL, respectively). One of the two had very severe clinical symptoms and died 3 weeks after starting standard treatment.

NTM strains showed a maximum of 2 positive droplets per assay and were evaluated as false positives as above.

As described above, the dPCR assay system established here was able to detect cell-free M. tuberculosis group DNA present in minute amounts in the blood of patients infected with M. tuberculosis group. Even less than 10 copies per reaction solution can be quantified, confirming that the detection sensitivity is very high.

3. Comparison of detection sensitivity between dPCR and real-time PCR Detection sensitivity was compared between quantitative real-time PCR (qPCR) and the dPCR assay system established by the present inventors using blood samples from 24 patients with sputum smear-positive pulmonary tuberculosis . qPCR uses the same primers and probes used in dPCR, including 10 μL TaqMan Fast Advanced Master Mix (Applied Biosystems, USA Foster City), 900 nM each primer, 125 nM probe, 4 μL template DNA The reaction was performed in 20 μL of the reaction solution. Reaction solutions were prepared in duplicate for each sample, and the reaction was performed in a 96-well reaction plate using StepOnePlus Real-Time PCR System (Applied Biosystems). The reaction conditions were 95 ° C. for 20 seconds and 60 ° C. for 20 seconds for 40 cycles. A 10-fold serial dilution series of plasmid DNA standards of IS6110 and gyrB was prepared in duplicate and included in each plate, and these were measured to create a standard curve.

Data is shown in Table 6. Many of the samples that were negative in qPCR had positive dPCR results, confirming that dPCR had better detection sensitivity.

4). Diagnosis of MTB infection by digital PCR We report a case of disseminated MTB infection that could be diagnosed only by dPCR detection of MTB DNA in plasma.

The patient was a 63-year-old male who was severely immunocompromised due to hematopoietic stem cell transplantation for the treatment of acute myeloid leukemia. Fever and inflammation continued, with pancytopenia and abnormal clotting. Whole body CT scan revealed many granular shadows throughout the lung, suggesting disseminated MTB infection. However, anti-acid staining, culture and conventional MTB real-time PCR test (Cobas TaqMan MTB, Roche Diagnostics, Basel, Switzerland) and T-SPOT. TB test (Oxford Immunotec, Oxford UK) are all negative. Met. The urine Mycobacterium culture was positive, but the real-time PCR test (Cobas TaqMan MTB / MAI, Roche Diagnostics) for MTB and MAC (Mycobacterium avium complex) was negative. It was not possible to identify what was cultured. A biopsy of the liver or bone marrow for further examination was infeasible due to bleeding characteristics.

Therefore, circulating MTB-DNA in plasma was detected using the blood sample of the patient by the dPCR assay system targeting the IS6110 gene established by the inventors of the present invention as described above. As constructed above, the conditions for dPCR were such that the primer concentration was 900 nM, the probe concentration was 125 nM, and the annealing and extension reaction temperatures were 54 ° C. The threshold was determined manually, and droplets exceeding the threshold were considered positive. As the DNA standard, the plasmid DNA containing the IS6110 gene fragment constructed above was digested with EcoRI and linearized. The results of repeated analysis were all positive (16.4 copies / well, 9.8 copies / well), and MTB infection was detected (FIG. 8).

An autopsy performed after the death of the patient confirmed a large number of dry buty granuloma with an acid-acid-positive gonococci in the liver, kidney and left lung. Although the Mycobacterium culture was negative, the results of real-time PCR (Cobas TaqMan MTB, Roche Diagnostics) on formalin-fixed paraffin-embedded tissue sections of the liver were positive, and the diagnosis was confirmed as disseminated MTB infection. All real-time PCR tests and T-SPOT. TB tests were commissioned to SRL (Tokyo, Japan).

Claims (9)

1. A digital PCR primer and probe set for detecting Mycobacterium tuberculosis group IS6110, comprising a forward primer of the base sequence shown in SEQ ID NO: 1, a reverse primer of the base sequence shown in SEQ ID NO: 2, and a probe of the base sequence shown in SEQ ID NO: 3.
2. A digital PCR primer and probe set for detecting Mycobacterium tuberculosis group gyrB, comprising a forward primer having the base sequence shown in SEQ ID NO: 4, a reverse primer having the base sequence shown in SEQ ID NO: 5, and a probe having the base sequence shown in SEQ ID NO: 6.
3. A DNA derived from Mycobacterium tuberculosis, which comprises performing DNA PCR using at least one of the primer and probe set according to claim 1 using DNA extracted from a blood sample isolated from a subject as a template. Detection method.
4. The method according to claim 3, wherein the blood sample is plasma or serum.
5. The method according to claim 3 or 4, wherein the concentration used for each primer is 700 nM to 1100 nM and the concentration used for the probe is 100 nM to 150 nM.
6. Digital PCR is performed using a DNA standard that is a linear DNA containing a partial region of the Mycobacterium tuberculosis group gene including the amplification target region of the digital PCR primer as a template, and by cluster analysis of the signal intensity of each small section of the DNA standard, The method according to any one of claims 3 to 5, further comprising determining a threshold value for discrimination of a positive sub-compartment.
7. The method according to claim 6, wherein the DNA standard for the IS6110 detection system contains the base sequence shown in SEQ ID NO: 11, and the DNA standard for the gyrB detection system contains the base sequence shown in SEQ ID NO: 12.
8. Requested to assist in detection of Mycobacterium tuberculosis infection, monitoring of Mycobacterium tuberculosis infection or disease status, evaluation of the risk of developing Mycobacterium tuberculosis, or determining the therapeutic effect of Mycobacterium tuberculosis infection or Mycobacterium tuberculosis. Item 8. The method according to any one of Items 3 to 7.
9. A tuberculosis group-derived DNA detection reagent or kit for digital PCR, comprising at least one of the primer and probe set according to claim 1 and 2.

Images