WO2017075853A1 - Cell fusion method - Google Patents

Abstract

Provided is a cell fusion method. Substances having a mutual binding property are respectively connected to the surfaces of a cell/protoplast A and a cell/protoplast B, so that the binding of the cell A and the cell B is promoted, and the efficiency of cell fusion is improved.

Description

[Name of invention established by ISA according to Rule 37.2] Cell fusion method Technical field

The invention belongs to the field of biotechnology, and mainly relates to a method for fusing cells or protoplasts.

technical background

Intercellular or protoplast-to-cell fusion is a commonly used technique in modern cell engineering. After fusion, a gene fragment in a cell or protoplast is transferred into another cell, and the cell genome is integrated to obtain the specific Genetically characteristic cells. This technology plays a key role in the development of monoclonal antibody preparation, animal and plant transgenic, and anti-cancer vaccines. For example, Li and zou have used a fusion method of yeast protoplasts and embryonic stem cells to produce a super gene fragment transgenic mouse with a mega-base (Nature protocols, 2013, 8: 1567-1582; Patent title: SPHEROPLAST FUSION: Inventors : Marianne Bruggemann, Xiangang Zou; Publication date: 14/05/2004; Patent number: WO/2004/101802).

Existing cell fusion techniques are less efficient, especially when compared to embryonic stem cells, yeast protoplasts and somatic cells are extremely inefficient. The mutual contact between cells is the basis of cell fusion. In order to improve the fusion efficiency, the present invention chemically modifies the cell surface, and connects two substances having mutual binding properties to the surface of A cells and B cells, thereby promoting A cells. Adhesion to B cells increases the efficiency of cell fusion.

Summary of the invention

The present invention provides an efficient cell fusion method.

The object of the invention is achieved by the following measures:

A cell fusion method characterized in that a substance having a mutual binding property is attached to a surface of an A cell (or a protoplast) and a B cell (or a protoplast), respectively, to promote adhesion of A cells and B cells, and to enhance cells. The efficiency of integration.

The above substances having mutual binding properties may be biotin and avidin, or may be albumin and PEG-NHS, 4-arm PEG-NHS ester (PEG4-NHS ester) and 4 arms. Ethylene glycol-thiol (PEG4-thiol) and the like.

The substances of the above-mentioned mutual binding properties are bound to the surfaces of A cells and B cells, respectively, by dopamine mediated. For example, a cell fusion method in which protoplasts or cells carry biotin or avidin. Biotin or avidin is bound to the surface of A cells and B cells, respectively, by dopamine mediated.

The above substances having mutual binding characteristics and dopamine are dissolved in Tris-HCl buffer, and substances having mutual binding characteristics are bound to the surface of the cells (or protoplasts) in a Tris-HCl buffer system under dopamine-mediated. Among them, the dopamine has a preferred concentration of 1-3 g/L, more preferably 2 g/L. The concentration of NaCl in the Tris-HCl buffer is preferably 6-12 g/l, the KCl concentration is 0.1-0.3 g/l, and the pH is 8-9. More preferably, the NaCl concentration is 9 g/l, the KCl concentration is 0.2 g/l, and the pH is 8.5. In the dopamine lysate, the modified Nas and K ions in the Tris-HCl buffer provide osmotic pressure close to the physiological level of the cells and reduce damage to the cells.

For example, a substance having a mutual binding property is biotin and avidin, biotin or avidin and dopamine are dissolved in Tris-HCl buffer, and then added to cells, and biotin or avidin is acted upon by dopamine. Binds to the cell surface.

A cell fusion method comprising the following steps:

(1) cells or protoplasts are mediated by dopamine to attach biotin to the cell membrane;

(2) another cell or protoplast is mediated by dopamine to attach to the cell membrane;

(3) mixing the treated two cells or the protoplasts, and treating them by a conventional cell fusion method;

(4) After culturing and screening, fused cells were obtained.

The fusion method of the present invention can be used for a transgenic cell strain or a hybridoma secreted by an antibody or the like.

The above conventional cell fusion methods, such as PEG-mediated fusion or electrical stimulation-mediated fusion, and the like.

The above cells or protoplasts are biological cell structures having no cell wall or decellularized cells, and may be prokaryotic cells or eukaryotic cells. Such as yeast, bacteria, plant cells, etc.

Beneficial effect

1. The cell fusion efficiency of the present invention is 10 to 20 times higher than that of the conventional fusion method, and the cell damage is small, and the cell has high life activity.

2. The method of the invention is ingenious and simple to operate, and can be effectively integrated in laboratory or large-scale production, and the fusion is stable, and the cells can carry out effective and stable fusion even if the cells carry the large-sized recombinant nucleic acid molecules, and maintain the organism. active.

DRAWINGS

Figure 1 Example 1 Photograph of cell clones screened after cell fusion using the method of the present invention (Gimsa staining)

Figure 2 is a partially enlarged picture of a single cell clone in Figure 1.

Figure 3 is a diagram showing the gene detection of the fusion of Example 1 (the lanes 1-7 are HIgKV2.30 amplification products; 9-12, 14-16 are HIgKV3.15 amplification bands; 13 is marker; 18-24 is HIgKDe expansion) Product increase)

Figure 4 Detection of mRNA of human Ig Kappa in Example 2

Figure 5 is a diagram showing the protein expression of human immunoglobulin Kappa in transgenic pigs in Example 2.

Figure 6 is a diagram showing the structure of human immunoglobulin Kappa light chain gene cluster transferred into cells in a specific embodiment.

detailed description

The invention is further described below in conjunction with the examples, but the invention is not limited thereto.

Example 1 Fusion of yeast cells with fetal pig fibroblasts

1. Reagent preparation

1) YPD medium (1000 ml): yeast extract (Yeast extract, Y1625-250G) 10 g, bacterial peptone (Bacto Peptone, P0431-250G) 20 g, autoclaved, and stored at room temperature.

A 40% glucose solution was prepared, sterilized by a 0.22 μm filter, and stored at room temperature.

When YPD medium was used, a glucose solution was added to a final concentration of 2%.

2) STE (current configuration) 150ml:

Component	Stock	Volume
1M Sorbitol	2M	75ml
10mM Tris-HCl (pH 7.4)	1M	1.5ml
10mM EDTA-Na2	500mM	3.0ml
ddH2O		70.5ml

3) SPEM solution 500ml

4) STDC solution (10ml):

Component	Stock	Volume
1M Sorbitol	2M	5ml
20mM CaCl2·2H2O	1M	0.2ml
Tris-HCl-Dopamine (Dopamine 2mg/ml)		0.2ml
ddH2O		4.6ml

5) Tris-HCl modified buffer pH=8.5:

Take 25ml of 0.1MTris solution, 7.35ml of 0.1M HCl solution, add NaCl (final concentration 9g/l), KCl (final concentration 0.2g/l), and dilute to 50ml with water to obtain Tris-HCl with pH=8.5.

5) Tris-HCl-Dopamine (2 mg/ml) 10 ml: 20 mg of dopamine was weighed and dissolved in a modified Tris-HCl buffer (pH = 8.5).

2. Preparation and processing of yeast

1) Yeast bacterial liquid (with human immunoglobulin Kappa light chain gene cluster, the structure of which is shown in Figure 6, and containing the neomycin screening gene) was added to YPD, and shaken overnight at 30 ° C and 220 rpm.

2) After the bacterial solution was washed with water and washed with 1 M sorbitol, 50 ml SPEM was added, mixed, and 75 ul of 14 mM 2-ME and 100 UL Zymolase was added for de-walling treatment.

3) Remove the yeast protoplasts from the wall and add 70% STDC solution at pH 8.5 for 3 to 5 minutes. After the yeast is adapted to the lower osmotic pressure, add Tris with a final concentration of 0.1 mg/ml Avitin. -HCl-Dopamine (pH = 8.5) solution, uniformly sprayed with a gun, and incubated at 37 ° C for 30 min.

3. Preparation of fetal pig fibroblasts

1) Routinely digested fetal pig fibroblasts, centrifuged to remove the liquid, and retain the cell pellet.

2) The cells were resuspended in 0.1 mg/ml Biotin solution (Tris-HCl-Dopamine (pH = 8.5) solution) and incubated at 38.5 ° C for 30 min.

4. Fusion and screening of yeast protoplasts and pig fetal pig fibroblasts

1) Centrifuge the treated yeast protoplasts, remove the supernatant, add the treated cells, mix, and centrifuge to retain a small amount of liquid.

2) Add PEG 8000 for processing.

3) The fused cells were washed with DMEM medium and inoculated into a Petri dish.

4) The cells were adhered to about 50%, and G418 was added for resistance screening. The number of cell clones after screening was observed.

RESULTS: After 10 trials and repeated experiments, the cells cloned after fusion were produced by the method of the present invention, and the average number of cell clones produced per time was 4.7±0.56; the control group, ie, was not treated by the test method, directly used PEG8000 The protoplasts of the broken wall yeast were fused with the fetal pig fibroblasts, and the fusion cells were successfully obtained only once in 10 times, and the number of the fused cell clones was two.

5, genetic testing of fusion cells

The DNA of the fused cells was extracted, and the gene fragments carried in the yeast cells were detected by PCR. The primers used are shown in Table 1. The electrophoresis results are shown in Figure 3 (the lanes 1-7 are HIgKV2.30 amplification products; 9-12, 14-16) Amplification band for HIgKV3.15; 13 for marker; 18-24 for HIgKDe amplification product).

HIgKDe, HIgKV3.15, and HIgKV2.30 are fragments of the front, middle, and back portions of the human immunoglobulin Kappa light chain gene. The pre-fusion yeast carries the human immunoglobulin Kappa light chain gene cluster, including The gene fragments of HIgKDe, HIgKV3.15, and HIgKV2.30 were detected in the fetal pig fibroblasts after fusion, indicating that the fusion method of the present invention mediates the complete integration of the gene fragments carried in the yeast into the pigs. In fiber cells.

Table 1

The substances having mutual binding characteristics according to the present invention, such as albumin and PEG-NHS, PEG4-NHS ester and PEG4-thiol, have the same high efficiency and low damage effect in cell fusion experiments.

Example 2 Incubation of a large fragment of transgenic pigs using fused cells

The fused porcine fibroblasts obtained in Example 1 were cloned using conventional cloning techniques to breed transgenic pigs. Blood samples were collected from pigs at the age of 1 month after birth, and blood RNA was extracted. The expression of the inserted large fragment human Ig Kappa (HIGK, human immunoglobulin kappa light chain) was detected by RT-PCR. In this experiment, five primers were designed to detect the expression of HIGK-V1, HIGK-V2, HIGK-V3, HIGK-V4, and HIGK-V5 genes in the insert (see Table 2 for primers). As shown in Figure 4, transgenic pigs were able to detect HIGK mRNA and wild-type pigs did not have HIGK mRNA expression, indicating that the transferred immunoglobulin gene can be rearranged, indicating that the transferred gene functions normally. Further, we used western blot to detect human immunoglobulin lamdba in pig blood (Fig. 5). The antibodies used were Rabbit monoclonal H19-5 Anti-Human kappa light chain (ab125919, abcam) and Mouse monoclonal 2A9 Anti-Rabbit IgG heavy chain (HRP) (ab99702, abcam). Human and normal pigs were used as positive and negative controls, respectively. As shown in Fig. 5, it can be seen that the fusion technology can mediate the large-scale transgene, and the transgenic pigs can efficiently express the transferred genes.

Table 2 mRNA detection primers for human Ig Kappa

Name of Primers

Sequences

HIGK-V1F	ATGAGGGTCCCCGCTCAG
HIGK-V1R	GTTTCTCGTAGTCTGCTTTGCTCAG
HIGK-V2F	GACATGAGAGTCCTCGCTCAGC
HIGK-V2R	GTTTCTCGTAGTCTGCTTTGCTCAG
HIGK-V3F	TTCCTCCTGCTACTCTGGCTC
HIGK-V3R	GTTTCTCGTAGTCTGCTTTGCTCAG
HIGK-V4F	CAGACCCAGGTCTTCATTTCTC
HIGK-V4R	GTTTCTCGTAGTCTGCTTTGCTCAG
HIGK-V5F	GTCCCAGGTTCACCTCCTCAG
HIGK-V5R	GTTTCTCGTAGTCTGCTTTGCTCAG

Claims (9)

1. A cell fusion method characterized in that substances having mutual binding properties are attached to the surfaces of A cells (or protoplasts) and B cells (or protoplasts), respectively.
2. The cell fusion method according to claim 1, wherein said substance having mutual binding properties is biotin and avidin, albumin and PEG-NHS, or 4-arm PEG-NHS ester and 4-arm polyethylene glycol-thiol .
3. The cell fusion method according to claim 1 or 2, wherein the substance which binds to each other is bound to the surface of the A cell and the B cell by mediated by dopamine.
4. The cell fusion method according to claim 3, wherein the dopamine concentration is preferably 1-3 g/L, more preferably 2 g/L.
5. The cell fusion method according to claim 3 or 4, wherein the substance having a mutual binding property and dopamine are dissolved in a Tris-HCl buffer, and the substance having a mutual binding property is dopamine-mediated in a Tris-HCl buffer system. Binds to the surface of a cell (or protoplast).
6. The cell fusion method according to claim 5, wherein the Tris-HCl buffer has a NaCl concentration of 6-12 g/l, a KCl concentration of 0.1-0.3 g/l, and a pH of 8-9; more preferably, the NaCl concentration is 9 g/ l, KCl concentration 0.2g / l, pH = 8.5.
7. The cell fusion method according to any one of claims 1 to 6, wherein the substance having a mutual binding property is biotin and avidin, and biotin or avidin and dopamine are dissolved in Tris-HCl buffer and then added to the cells. To bind biotin or avidin to the cell surface.
8. The cell fusion method according to any one of claims 1 to 7, comprising the steps of:

   (1) cells or protoplast A mediated the attachment of biotin to the cell membrane by dopamine;

   (2) another cell or protoplast B is mediated by dopamine on the cell membrane;

   (3) mixing the treated two cells or the protoplasts, and treating them by a conventional cell fusion method;

   (4) After culturing and screening, fused cells were obtained.
9. Use of the cell fusion method of any of claims 1-8 for the preparation of a hybridoma of a transgenic cell line or antibody secretion.

Images