CN105316313B - A kind of efficient cell fusion method - Google Patents
A kind of efficient cell fusion method Download PDFInfo
- Publication number
- CN105316313B CN105316313B CN201510737388.8A CN201510737388A CN105316313B CN 105316313 B CN105316313 B CN 105316313B CN 201510737388 A CN201510737388 A CN 201510737388A CN 105316313 B CN105316313 B CN 105316313B
- Authority
- CN
- China
- Prior art keywords
- cell
- protoplast
- fusion method
- avidin
- biotin
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/10—Cells modified by introduction of foreign genetic material
- C12N5/12—Fused cells, e.g. hybridomas
- C12N5/16—Animal cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/91—Cell lines ; Processes using cell lines
Abstract
The present invention provides a kind of cell fusion methods, it is characterised in that：Substance with the characteristic that be combined with each other is connected respectively to A cells（Or protoplast）And B cell（Or protoplast）Surface, promote the bonding of A cells and B cell, improve the efficiency of cell fusion.The cell fusion efficiency of the present invention is 10~20 times or more of conventional fusion method, and small to cellular damage, and cell has high bioactivity.
Description
Technical field
The invention belongs to biotechnologies, relate generally to the fusion method of cell or protoplast.
Technical background
Iuntercellular or protoplast are the common technologies of INVENTIONModern cell engineering with intercellular merge, by fusion, one
Genetic fragment is transferred in another cell, and integrator cell genome in kind cell or protoplast, so as to obtain required tool
There is the cell of specific hereditary capacity.The technology is related in monoclonal antibody preparation, the research and development of animals and plants transgenosis, anti-cancer vaccine
Key acts on.The method that such as Li and zou is merged using Yeast Protoplast with embryonic stem cell has been born with million rank bases
Super large genetic fragment transgenic mice (Nature protocols, 2013,8：1567-1582；Patent title：
SPHEROPLAST FUSION：Inventors：Marianne Bruggemann, XiangangZou；Publication
date：14/05/2004；Patent number：WO/2004/101802).
Existing cell-fusion techniques are less efficient, and particularly compared with embryonic stem cell, Yeast Protoplast is thin with body
The fusion efficiencies of born of the same parents are extremely low.Contacting with each other between cell is the basis of cell fusion, and to improve fusion efficiencies, the present invention is to thin
Cellular surface is chemically modified, and two kinds of substances with the characteristic that be combined with each other are connected respectively to the surface of A cells and B cell,
So as to promote the bonding of A cells and B cell, the efficiency of cell fusion is improved.
Invention content
The present invention provides a kind of efficient cell fusion methods.
The purpose of the present invention is what is realized by following measures：
A kind of cell fusion method, it is characterised in that：Substance with the characteristic that be combined with each other is connected respectively to A cells
The surface of (or protoplast) and B cell (or protoplast) promotes the bonding of A cells and B cell, improves the effect of cell fusion
Rate.
The above-mentioned substance with the characteristic that be combined with each other can be biotin (biotin) and Avidin (avidin), can also
It is albumin (albumin) and PEG-NHS, 4 arm PEG-NHS esters (PEG4-NHS ester) and 4 arm polyethylene glycol-mercaptan
(PEG4-thiol) etc..
The substance of the above-mentioned characteristic that be combined with each other is respectively incorporated to the surface of A cells and B cell by the mediation of dopamine.Example
Such as, a kind of cell fusion method, protoplast or cell carry biotin (biotin) or Avidin (avidin).Pass through DOPA
The mediation of amine makes biotin or Avidin be respectively incorporated to the surface of A cells and B cell.
Above-mentioned substance and the dopamine with the characteristic that be combined with each other is dissolved in Tris-HCl buffer solutions, makes to have and be combined with each other
The substance of characteristic is attached to cell (or protoplast) surface under DA Mediated in Tris-HCl buffer solution systems.Its
In, dopamine preferred concentration is 1-3g/L, more preferably 2g/L.Preferred NaCl concentration 6-12g/l in Tris-HCl buffer solutions,
KCl concentration 0.1-0.3g/l, pH=8-9.It is highly preferred that NaCl concentration 9g/l, KCl concentration 0.2g/l, pH=8.5.Dopamine
In lysate, the osmotic pressure being on close level with cell physiological, reduction pair can be provided by improveing Na, K ion in Tris-HCl buffer solutions
The damage of cell.
For example, the substance with the characteristic that be combined with each other is biotin and Avidin, biotin or Avidin and dopamine are molten
Solution, by the effect of dopamine, makes biotin or Avidin be attached to carefully in Tris-HCl buffer solutions, then added in cell
Cellular surface.
A kind of cell fusion method, includes the following steps：
(1) cell or protoplast are attached to DA Mediated biotin on cell membrane；
(2) another cell or protoplast are attached to DA Mediated avitin on cell membrane；
(3) it treated two kinds of cells or will mix with protoplast, be handled by regular growth fusion method；
(4) through cultivating and screening, fused cell is obtained.
The fusion method of the present invention can be used for transgenosis cell strain or antibody secreted hybridoma etc..
Above-mentioned conventional cell fusion method, such as PEG mediated fusions or electro photoluminescence mediated fusion.
Above-mentioned cell or protoplast are acellular wall or the biomorph structure for removing cell wall, can be prokaryotic cells,
It can also be eukaryocyte.Such as yeast, bacterium, plant cell.
Advantageous effect
1. the cell fusion efficiency of the present invention is 10~20 times or more of conventional fusion method, and small to cellular damage, carefully
Born of the same parents have high vital activity.
2. the method for the present invention is ingenious, easy to operate, it either can all realize in laboratory or large-scale production and effectively melt
It closes, and merges and stablize, even if cell carries super large segment recombinant nucleic acid molecules and can still carry out the fusion effectively stablized, and keep
Bioactivity.
Description of the drawings
The cell clone photo (Giemsa staining) that Fig. 1 embodiments 1 using the method for the present invention screen after cell fusion
The partial enlargement picture that individual cells are cloned in Fig. 2 Fig. 1
(1-7 swimming lanes are HIgKV2.30 amplified productions to cytogene detection figure after Fig. 3 embodiments 1 merge；9-12,14-16
For HIgKV3.15 amplified bands；13 be marker；18-24 is HIgKDe amplified productions)
The detection of the mRNA of human Ig Kappa in Fig. 4 embodiments 2
The protein expression detection figure of human immunoglobulin(HIg) Kappa in 2 transgenic pig of Fig. 5 embodiments
The human immunoglobulin(HIg) Kappa light chain gene clustering architecture figures of cell are transferred in Fig. 6 specific embodiments
Specific embodiment
With reference to embodiment, the invention will be further described, but the present invention is not limited to this.
1 yeast cells of embodiment with tire pig is fibroblastic merges
1. reagent prepares
1) YPD culture mediums (1000ml)：Yeast extract (Yeast extract, Y1625-250G) 10g, bacterioprotein
Peptone (Bacto Peptone, P0431-250G) 20g, high pressure sterilization, room temperature preservation.
40% glucose solution is prepared, crosses 0.22 μm of filter membrane degerming, room temperature preservation.
During using YPD culture mediums, addition glucose solution, final concentration of 2%.
2) 150 ml of STE (matching while using is put)：
| Component | Stock | Volume |
| 1 M Sorbitol | 2M | 75ml |
| 10 mM Tris-HCl(pH7.4) | 1M | 1.5ml |
| 10 mM EDTA-Na2 | 500mM | 3.0ml |
| ddH2O | 70.5ml |
3) SPEM solution 500ml
4) STDC solution (10ml)：
| Component | Stock | Volume |
| 1M Sorbitol | 2M | 5ml |
| 20mM CaCl2·2H2O | 1M | 0.2ml |
| Tris-HCl-Dopamine(Dopamine 2mg/ml) | 0.2ml | |
| ddH2O | 4.6ml |
5) Tris-HCl improves pH of buffer=8.5：
0.1MTris solution 25ml, 0.1MHCl solution 7.35ml is taken, adds NaCl (final concentration 9g/l), KCl is (dense eventually
Spend 0.2g/l), water is added to be settled to 50 milliliters to get to the Tris-HCl of pH=8.5.
5)Tris-HCl-Dopamine(2mg/ml)10ml：Dopamine (Dopamine) 20mg is weighed, is dissolved in improvement
In Tris-HCl buffer solutions in (pH=8.5).
2nd, the preparation and processing of saccharomycete
1) by saccharomycete bacterium solution, (with human immunoglobulin(HIg) Kappa light chain gene clusters, structure is shown in Fig. 6, and contains
Neomycin screening-genes) it is added in YPD, 30 DEG C, shaken over night under the conditions of 220rpm.
2) bacterium solution adds 50ML SPEM, mixing through washing, after 1M sorbitol washes, then add 75ul 14mM 2-ME and
100UL Zymolase carry out wall and handle.
3) Yeast Protoplast after wall is gone to add in the 70% STDC solution of pH8.5,3~5min is stood, treats yeast
After adapting to compared with Hyposmolality, then the Tris-HCl-Dopamine (pH=of final concentration of 0.1mg/ml Avitin are added in thereto
8.5) solution is blown uniformly with rifle, 37 DEG C of incubation 30min.
3rd, the fibroblastic preparation of tire pig
1) the tire pig fibroblast of conventional digestion culture centrifuges away liquid, retains cell precipitation.
2) with 0.1mg/ml Biotin solution (Tris-HCl-Dopamine (pH=8.5) solution) be resuspended cell, 38.5
DEG C be incubated 30min.
4th, Yeast Protoplast and pig tire pig are fibroblastic merges and screening
1) will the centrifugation of treated Yeast Protoplast, remove supernatant, add in that treated cell, mixing, then centrifuge reservation
A small amount of liquid.
2) PEG8000 processing is added in.
3) cell after cleaning fusion with DMEM culture mediums, is inoculated in culture dish.
4) cell adherent 50% or so adds G418 to carry out resistance screening.Number of cell clones after observation screening.
As a result：It is repeated by 10 experiments, there is the cell clone after fusion to generate every time using the method for the present invention, it is average
The number of cell clones generated every time is 4.7 ± 0.56；Control group that is, without the processing of this test method, is directly carried out with PEG8000
Broken wall Yeast Protoplast merged with tire pig fibroblast, only successfully obtain fused cell, the cell of fusion 1 time 10 times
Clone is 2.
5th, the genetic test of fused cell
Extract the DNA of fused cell, the genetic fragment carried in PCR detection yeast cells, the primer such as table 1, electrophoresis
(1-7 swimming lanes are HIgKV2.30 amplified productions to testing result as shown in Figure 3；9-12,14-16 are HIgKV3.15 amplified bands；13
For marker；18-24 is HIgKDe amplified productions).
HIgKDe, HIgKV3.15, HIgKV2.30 be human immunoglobulin(HIg) Kappa light chain genes in before, during and after three
The segment divided.With human immunoglobulin(HIg) Kappa light chain gene clusters in saccharomycete before fusion, including HIgKDe,
These genetic fragments of HIgKV3.15, HIgKV2.30 detect these genetic fragments in the tire pig fibroblast after fusion, say
The fusion method of the bright present invention, has mediated the genetic fragment carried in yeast to be completely integrated into pig fibroblast.
Table 1
The substance with the characteristic that be combined with each other of the present invention, such as albumin (albumin) and PEG-NHS, PEG4-
NHS ester and PEG4-thiol etc. have the effect of similary efficient, low damage in cell fusion experiment.
Embodiment 2 utilizes the cell culture super large segment transgene pig merged
Using conventional clone technology, the pig fibroblast for the fusion that embodiment 1 is obtained is cloned, and cultivation turns base
Because of pig.The transgene pig at 1 monthly age after birth is taken a blood sample, extracts blood rna, the super large segment human that the detection of RT-PCR methods is inserted into
The expression of Ig Kappa (HIGK, human immunoglobulin(HIg) kappa light chain).5 primer pair Insert Fragments of this experimental design
The expression of middle HIGK-V1, HIGK-V2, HIGK-V3, HIGK-V4, HIGK-V5 gene is detected (primer is shown in Table 2).Such as
Shown in Fig. 4, transgene pig can detect to obtain the mRNA of HIGK and wild type pig does not have the mRNA expression of HIGK, illustrate what is be transferred to
Immunoglobulin gene can be reset, and illustrate that the function for the gene being transferred to is normal.Further, our utilization western
Blot methods are detected (Fig. 5) the human immunoglobulin(HIg) lamdba in pig blood.The antibody used is Rabbit
Monoclonal H19-5 Anti-Human kappa light chain (ab125919, abcam) and Mouse
Monoclonal 2A9 Anti-Rabbit IgG heavy chain (HRP) (ab99702, abcam).With people and common pig point
Not Zuo Wei positive and negative control, result figure 5, it is seen that can mediate super large segment transgenosis, and cultivate using integration technology
Transgene pig being capable of the gene that is transferred to of high efficient expression.
The mRNA detection primers of 2 human Ig Kappa of table
| Name of Primers | Sequences |
| HIGK-V1F | ATGAGGGTCCCCGCTCAG |
| HIGK-V1R | GTTTCTCGTAGTCTGCTTTGCTCAG |
| HIGK-V2F | GACATGAGAGTCCTCGCTCAGC |
| HIGK-V2R | GTTTCTCGTAGTCTGCTTTGCTCAG |
| HIGK-V3F | TTCCTCCTGCTACTCTGGCTC |
| HIGK-V3R | GTTTCTCGTAGTCTGCTTTGCTCAG |
| HIGK-V4F | CAGACCCAGGTCTTCATTTCTC |
| HIGK-V4R | GTTTCTCGTAGTCTGCTTTGCTCAG |
| HIGK-V5F | GTCCCAGGTTCACCTCCTCAG |
| HIGK-V5R | GTTTCTCGTAGTCTGCTTTGCTCAG |
Claims (11)
1. a kind of cell fusion method, it is characterised in that：By the mediation of dopamine, by the substance with the characteristic that be combined with each other point
It is not connected to the surface of A cells or protoplast, B cell or protoplast, the substance with the characteristic that be combined with each other is made a living
Object element and Avidin, dopamine concentration 1-3g/L.
2. cell fusion method as described in claim 1, dopamine concentration 2g/L.
3. cell fusion method as claimed in claim 1 or 2, described to have the substance for the characteristic that be combined with each other and DOPA amine solvent
In Tris-HCl buffer solutions, the substance with the characteristic that be combined with each other is tied under DA Mediated in Tris-HCl buffer solution systems
Close cell or protoplast surface.
4. cell fusion method as claimed in claim 3, NaCl concentration 6-12g/l, KCl concentration in Tris-HCl buffer solutions
0.1-0.3g/l, pH=8-9.
5. cell fusion method as claimed in claim 4, NaCl concentration 9g/l, KCl concentration 0.2g/l, pH=8.5.
6. the cell fusion method as described in claim 1,2,4 or 5, biotin or Avidin are dissolved in Tris- with dopamine
In HCl buffer solutions, then added in cell, biotin or Avidin is made to be attached to cell surface.
7. cell fusion method as claimed in claim 3, biotin or Avidin are dissolved in Tris-HCl bufferings with dopamine
In liquid, then added in cell, biotin or Avidin is made to be attached to cell surface.
8. the cell fusion method as described in claim 1,2,4 or 5, includes the following steps：
（1）Cell or protoplast A are attached to DA Mediated biotin on cell membrane；
（2）Another cell or protoplast B are attached to DA Mediated Avidin on cell membrane；
（3）It treated two kinds of cells or will mix with protoplast, be handled by regular growth fusion method；
（4）Through cultivating and screening, fused cell is obtained.
9. cell fusion method as claimed in claim 3, includes the following steps：
（1）Cell or protoplast A are attached to DA Mediated biotin on cell membrane；
（2）Another cell or protoplast B are attached to DA Mediated Avidin on cell membrane；
（3）It treated two kinds of cells or will mix with protoplast, be handled by regular growth fusion method；
（4）Through cultivating and screening, fused cell is obtained.
10. cell fusion method as claimed in claim 6, includes the following steps：
（1）Cell or protoplast A are attached to DA Mediated biotin on cell membrane；
（2）Another cell or protoplast B are attached to DA Mediated Avidin on cell membrane；
（3）It treated two kinds of cells or will mix with protoplast, be handled by regular growth fusion method；
（4）Through cultivating and screening, fused cell is obtained.
11. transgenosis cell strain or antibody secreted hybridoma are used for using any cell fusion methods of claim 1-10
Preparation.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510737388.8A CN105316313B (en) | 2015-11-03 | 2015-11-03 | A kind of efficient cell fusion method |
| PCT/CN2015/095731 WO2017075853A1 (en) | 2015-11-03 | 2015-11-27 | Cell fusion method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510737388.8A CN105316313B (en) | 2015-11-03 | 2015-11-03 | A kind of efficient cell fusion method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105316313A CN105316313A (en) | 2016-02-10 |
| CN105316313B true CN105316313B (en) | 2018-06-26 |
Family
ID=55244631
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510737388.8A Active CN105316313B (en) | 2015-11-03 | 2015-11-03 | A kind of efficient cell fusion method |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN105316313B (en) |
| WO (1) | WO2017075853A1 (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108342364A (en) * | 2018-02-05 | 2018-07-31 | 翁炳焕 | A kind of SPA mediates the hybridoma technology of double antibody capture |
| CN109207470A (en) * | 2018-10-30 | 2019-01-15 | 广西大学 | A kind of method of Protoplasts of Sugarcane electro' asion |
| CN112195173A (en) * | 2019-11-26 | 2021-01-08 | 李洪江 | Method for fusing myocardial cells and tumor cells |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1543339A (en) * | 2001-06-22 | 2004-11-03 | 诺丁汉大学 | Porous matrix comprising cross-linked particles |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7824672B2 (en) * | 2004-03-26 | 2010-11-02 | Emory University | Method for coating living cells |
| US20070105206A1 (en) * | 2005-10-19 | 2007-05-10 | Chang Lu | Fluidic device |
| CN102206612A (en) * | 2010-10-09 | 2011-10-05 | 云南省地方病防治所 | Hybridoma cell and preparation method and application thereof |
| CN103599569B (en) * | 2013-11-27 | 2015-04-29 | 天津大学 | Preparation method of titanium alloy surface growth factor composite coating |
-
2015
- 2015-11-03 CN CN201510737388.8A patent/CN105316313B/en active Active
- 2015-11-27 WO PCT/CN2015/095731 patent/WO2017075853A1/en active Application Filing
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1543339A (en) * | 2001-06-22 | 2004-11-03 | 诺丁汉大学 | Porous matrix comprising cross-linked particles |
Non-Patent Citations (1)
| Title |
|---|
| 基于多巴胺自聚合及多肽固定的聚三亚甲基碳酸酯的细胞相容性评价;张江等;《功能材料》;20141231;全文 * |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2017075853A1 (en) | 2017-05-11 |
| CN105316313A (en) | 2016-02-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Motte et al. | Molecular and environmental regulation of root development | |
| CN101402938B (en) | Method for producing protoplast | |
| CN105316313B (en) | A kind of efficient cell fusion method | |
| CN106282216A (en) | A kind of preparation method of recombinant long-acting chicken interferon α | |
| Marzec et al. | Importance of symplasmic communication in cell differentiation | |
| CN104498500B (en) | A kind of aptamer for identifying adriamycin-resistant breast cancer cell and its screening technique and application | |
| CN108004206A (en) | It is a kind of from the preparation method of people's olfactory mucosa mescenchymal stem cell excretion body and the application of excretion body | |
| CN106987559A (en) | A kind of construction method of recombinant C HOK1 cell lines and its application | |
| CN110699416B (en) | Efficient protein subcellular localization detection method based on citrus protoplast | |
| CN115785280A (en) | Recombinant human fibronectin and expression method thereof in pichia pastoris | |
| CN111057654B (en) | Cas9 gene knockout vector applicable to morinda officinalis endophytic fungus A761 and construction method and application thereof | |
| CN102220247B (en) | Glycyrrhiza endophytic fungi for producing glycyrrhetic acid | |
| CN106929496A (en) | A kind of pharmaceutical grade recombined human kininogenase industrialization production method | |
| CN112625141A (en) | Protein standard substance of tomato spotted wilt virus and application thereof | |
| CN105887208A (en) | Anti-goatpox virus bactrian camel VHH heavy-chain single-domain antibody cDNA library and preparation method thereof | |
| CN107653230A (en) | A kind of II type pseudoabies poison strain and its application | |
| CN104109637B (en) | A kind of gene recombinaton rose dark brown rod spore mycete If01 GM and application thereof | |
| CN110468093A (en) | A kind of protoplast preparation of Chinese cabbage and genetic transforming method | |
| CN103484466B (en) | A kind of Diamond back moth antibacterial peptide moricin and preparation method thereof and application | |
| CN108130320A (en) | Verticillium dahliae pathogenesis related protein and its encoding gene, application and mutant | |
| CN106754722A (en) | Vero cell line of stabilization expression bovine trypsinogen and application thereof | |
| CN105132459A (en) | Preparing method and application of human PTX3 recombinant protein | |
| CN105132438A (en) | Eukaryotic expression method of fish viral hemorrhagic septicemia virus G gene | |
| CN105734097B (en) | A kind of MIM-I-BAR protein extraction purification process | |
| CN103215309A (en) | Method for expressing polypeptide |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C41 | Transfer of patent application or patent right or utility model | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20161122 Address after: 402460 Chang Chang street, Rongchang, Chongqing Chang Chang Avenue, No. 53, Applicant after: Chongqing Jin Bo Bo Biotechnology Co., Ltd. Address before: 402460 Chongqing Changlong Road, Rongchang County, No. 51 Applicant before: Chongqing Academy of Animal Sciences Applicant before: Zou Xiangang |
|
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CB03 | Change of inventor or designer information | ||
| CB03 | Change of inventor or designer information |
Inventor after: Ge Liangpeng Inventor after: Ding Yuchun Inventor after: Liu Zuohua Inventor after: Liu Xueqin Inventor after: Zou Xiangang Inventor after: You Xiaoyan Inventor after: Wu Meng Inventor after: Yang Xi Inventor after: Lang Qiaoli Inventor after: Yang Songquan Inventor before: Ge Liangpeng Inventor before: Ding Yuchun Inventor before: Liu Zuohua Inventor before: Liu Xueqin Inventor before: Zou Xiangang Inventor before: You Xiaoyan Inventor before: Wu Meng Inventor before: Yang Xi Inventor before: Langqiaoli Inventor before: Yang Songquan |