WO2017073971A1 - Anks1a 단백질 발현 또는 활성 억제제를 유효성분으로 포함하는 암 예방 또는 치료용 조성물 및 이의 스크리닝 방법 - Google Patents

Anks1a 단백질 발현 또는 활성 억제제를 유효성분으로 포함하는 암 예방 또는 치료용 조성물 및 이의 스크리닝 방법 Download PDF

Info

Publication number
WO2017073971A1
WO2017073971A1 PCT/KR2016/011964 KR2016011964W WO2017073971A1 WO 2017073971 A1 WO2017073971 A1 WO 2017073971A1 KR 2016011964 W KR2016011964 W KR 2016011964W WO 2017073971 A1 WO2017073971 A1 WO 2017073971A1
Authority
WO
WIPO (PCT)
Prior art keywords
cancer
anks1a
protein
expression
preventing
Prior art date
Application number
PCT/KR2016/011964
Other languages
English (en)
French (fr)
Inventor
박수철
이혜령
Original Assignee
숙명여자대학교산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 숙명여자대학교산학협력단 filed Critical 숙명여자대학교산학협력단
Publication of WO2017073971A1 publication Critical patent/WO2017073971A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/713—Double-stranded nucleic acids or oligonucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing

Definitions

  • the present invention relates to a composition for preventing or treating cancer comprising the Anks1a protein expression or activity inhibitor as an active ingredient, a screening method thereof, and a method for preventing or treating cancer using the Anks1a protein expression or activity inhibitor and a diagnostic method.
  • Cancer malignant tumors
  • the WHO has identified cancer as one of the leading causes of death. It is the leading disease with the highest mortality rate in modern society, and there are no technological treatments despite many studies to date.
  • Treatment of cancer with chemotherapy, such as anticancer drugs has some effect, but a lot of research is required due to the various pathogenesis of cancer and the expression of anticancer drug resistance.
  • advances in diagnostic and therapeutic techniques have resulted in a limited positive outcome of improving cancer treatment and functional preservation for cancer treatment, but five-year survival rates range from 5 to 50% for many advanced cancers.
  • These cancers can be characterized by aggressive invasion, lymph node metastasis, distant metastasis and the development of secondary cancers. In some cancers, survival rates have not changed much over the past 20 years despite various studies and treatments.
  • RNA interference (RNAi) technology is frequently used in research in the life sciences, and its usefulness has been widely recognized.
  • RNAi refers to a phenomenon in which mRNA is specifically cleaved by double-stranded RNA, and as a result, expression of a gene is suppressed.
  • siRNA small interference RNA
  • siRNAs are frequently used as a method for suppressing expression of target genes.
  • shRNA which makes up for the shortcomings of siRNA, is also widely used.
  • RNA interference The first consideration in the treatment using such RNA interference is to select the optimal siRNA and shRNA sequence (hereinafter referred to as "interfering RNA") that has the greatest activity in the target sequence.
  • interfering RNA The efficiency of ribonucleic acid mediated interference is known to have a significant effect on the specific binding site to the target transcript.
  • algorithms Based on the database of the past few years, algorithms have been developed and provided to users that can design sequence positions of interfering RNAs that actually inhibit the expression of target ribonucleic acids, rather than just binding to transcripts.
  • all interfering RNAs determined by the in silico method using computer algorithms can effectively inhibit target ribonucleic acid in real cells and in vivo.
  • RNA meets the requirements for complementary binding to target transcripts, several factors have yet to be identified, including the stability and intracellular location of ribonucleic acids and proteins, and the state of proteins involved in ribonucleic acid-mediated interference. Are known to be involved in determining the efficiency of ribonucleic acid mediated interference phenomena. Therefore, it is necessary to carry out a technique for selecting siRNA to select several target sequence positions per transcript of a gene, and discovering the optimal sequence having excellent expression suppression effect among these candidate groups for the target protein.
  • the present invention is intended to provide a composition for preventing or treating cancer comprising the Anks1a protein expression or activity inhibitor as an active ingredient, a screening method thereof, and a method for preventing or treating cancer using the Anks1a protein expression or activity inhibitor and a diagnostic method.
  • the present invention also provides an agent or kit for diagnosing cancer comprising the use of Anks1a protein as a biomarker for cancer diagnosis and an inhibitor of Anks1a protein expression or activity.
  • the present invention provides a composition for preventing or treating cancer comprising an Anks1a protein expression or activity inhibitor as an active ingredient.
  • the Anks1a protein expression or activity inhibitor of the composition for preventing or treating cancer is characterized in that it specifically acts on the ankyrin repeat region (ANK) domain.
  • ANK ankyrin repeat region
  • Anks1a protein expression inhibitor of the composition for preventing or treating cancer is antisense nucleotides, small interfering RNA (siRNA) and short hairpin RNA (combining complementary to the mRNA of the Anks1a gene) short hairpin RNA, shRNA) is characterized in that any one or more selected from the group consisting of.
  • siRNA small interfering RNA
  • shRNA short hairpin RNA
  • the short hairpin RNA of the Anks1a gene of the composition for preventing or treating cancer is characterized in that it has a nucleotide sequence described in SEQ ID NO: 1 or SEQ ID NO: 2.
  • the inhibitor of Anks1a protein activity of the composition for preventing or treating cancer is any one selected from the group consisting of compounds, peptides, peptide mimetics, aptamers, and antibodies that complementarily bind to Anks1a protein It is characterized by the above.
  • the composition for preventing or treating cancer is liver cancer, giant cell tumor, colon cancer, tuberculosis cancer, osteosarcoma, ovarian cancer, brain tumor, colon cancer, bladder cancer, kidney cancer, gastric cancer, breast cancer, cervical cancer, cervical cancer , Prostate cancer, pancreatic cancer, epidermal cancer and lung cancer is characterized in that it is applied to any one selected from the group consisting of cancer.
  • the present invention (a) treating the candidate material to the target cell; (b) measuring the expression or activity of Anks1a protein in the target cell; And (c) selecting the candidate substance to reduce the expression or activity of Anks1a protein from the candidate substance as a result of the measurement.
  • the step of measuring the expression or activity of the Anks1a protein in the screening method for the prophylaxis or treatment of cancer the amount of Anks1a gene expression, the amount of Anks1a protein, other proteins under the action of Anks1a protein Detecting or measuring any one or more selected from the interaction between the Anks1a protein and other proteins, the complex of Anks1a protein with other proteins, and the complex of other proteins subjected to the action of Anks1a protein.
  • the other protein interacting with or forming a complex with the Anks1a protein in the screening method for preventing or treating the cancer is characterized in that EphA2, ErbB2 or a complex thereof.
  • the method for measuring the expression or activity of the Anks1a protein in the screening method for the prevention or treatment of cancer is reverse transcriptase-polymerase chain reaction, real-time polymerase chain reaction Group consisting of real time-polymerase chain reaction, western blot, northern blot, enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA), radioimmunodiffusion and immunoprecipitation assay It is characterized in that selected from.
  • the present invention also provides a composition for preventing or treating cancer, comprising administering an Anks1a protein expression or activity inhibitor to a subject.
  • the subject may be a mammal, for example a human.
  • the Anks1a protein expression or activity inhibitor is characterized in that it specifically acts on the ankyrin repeat region (ANK) domain.
  • the Anks1a protein expression inhibitor is an antisense nucleotide, short interfering RNA (siRNA) and short hairpin RNA (shRNA) and complementary to the mRNA of the Anks1a gene At least one selected from the group consisting of.
  • the short hairpin RNA of the Anks1a gene is characterized in that it has a nucleotide sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2.
  • the Anks1a protein activity inhibitor is characterized in that any one or more selected from the group consisting of compounds, peptides, peptide mimetics, aptamers and antibodies that complementarily bind to Anks1a protein.
  • the method is liver cancer, giant cell tumor, colon cancer, tuberculosis cancer, osteosarcoma, ovarian cancer, brain tumor, colon cancer, bladder cancer, kidney cancer, stomach cancer, breast cancer, cervical cancer, uterine cancer, prostate cancer, pancreatic cancer , Epidermal cancer and lung cancer, characterized in that it is applied to any one selected from the group consisting of cancer.
  • the invention also provides the use of the Anks1a protein or gene encoding it as a biomarker for cancer diagnosis. Specifically, it is a biomarker for diagnosing cancer, including an increase in Anks1a protein or gene expression or activity encoding the same.
  • the present invention also provides an agent or kit for diagnosing cancer, including an Anks1a protein activity inhibitor.
  • the present invention also provides a method for diagnosing cancer by measuring the expression or activity of Anks1a protein or a gene encoding the same or using the agent or kit for diagnosing cancer.
  • the diagnostic method comprises measuring the expression or activity of Anks1a protein in a sample isolated from the subject.
  • the diagnostic method includes reacting a cancer diagnostic agent or kit comprising an Anks1a protein activity inhibitor to a sample isolated from the individual.
  • the Anks1a protein expression inhibitor is an antisense nucleotide, short interfering RNA (siRNA) and short hairpin RNA (shRNA) and complementary to the mRNA of the Anks1a gene At least one selected from the group consisting of.
  • the short hairpin RNA of the Anks1a gene is characterized in that it has a nucleotide sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2.
  • the Anks1a protein activity inhibitor is characterized in that any one or more selected from the group consisting of compounds, peptides, peptide mimetics, aptamers and antibodies that complementarily bind to Anks1a protein.
  • the diagnostic method is liver cancer, giant cell tumor, colon cancer, tuberculosis cancer, osteosarcoma, ovarian cancer, brain tumor, colon cancer, bladder cancer, kidney cancer, stomach cancer, breast cancer, cervical cancer, uterine cancer, prostate cancer, It is characterized by diagnosing cancer which is any one selected from the group consisting of pancreatic cancer, epidermal cancer and lung cancer.
  • the present invention relates to a composition for preventing or treating cancer comprising the Anks1a protein expression or activity inhibitor as an active ingredient, and a screening method thereof, thereby providing a composition having excellent cancer prevention and treatment effect, and to easily screen an anticancer agent It provides a method that can be usefully applied to the medical field.
  • Figures 1a and 1b is the result of Western blotting after the treatment of shks specific to Anks1a in CT26 cell line.
  • FIG. 1C to 1F show the results of measuring cancer formation ability (FIG. 1D) and colony formation ability (FIG. 1E and 1F) of cells after administration of a CT26 cell line treated with Anks1a-specific shRNA to Balb / c mice.
  • Figure 2a is a result of measuring the cancer formation ability when knocked out Anks1a expression in breast cancer-expressing rats (MMTV-Neu).
  • Figure 2b and 2c is a result of measuring the colony forming ability after administration of an Anks1a-specific shRNA to breast cancer-expressing mice (MMTV-Neu).
  • 2D and 2E show the results of measuring the expression of EphA2 and ErbB2 after administration of an Anks1a-specific shRNA to breast cancer-expressing mice (MMTV-Neu).
  • 3A and 3B show the results of measuring the effect of Anks1a on the migration of EphA2 and ErbB2 to the cell surface.
  • the present invention for achieving the above object, provides a composition for preventing or treating cancer comprising the Anks1a protein expression or activity inhibitor as an active ingredient, and a screening method thereof.
  • the present invention will be described in detail with reference to the accompanying drawings.
  • the present invention provides a composition for preventing or treating cancer, comprising the Anks1a protein expression or activity inhibitor as an active ingredient, a method for preventing or treating cancer using the same.
  • the Anks1a protein (Ankyrin repeat and SAM domain-containing protein 1A) is an adapter protein present in the cytoplasm of cells, and is expressed by the Anks1a gene.
  • the Anks1a gene is present on the 6th chromosome (6p21.31) in humans, the nucleotide sequence has a sequence shown in NM_015245.2 of NCBI, and the amino acid sequence may have a sequence shown in NP_056060.2 of NCBI.
  • the Anks1a is expressed in the endoplasmic reticulum, which plays an important role in the production of proteins and transfer to cell membranes.
  • Sec23 protein one of the components of the vesicle moving from the endoplasmic reticulum to the Golgi
  • the ANK of Anks1a interacts with EphA2 to identify the characteristics that can regulate the process of migration from the endoplasmic reticulum of EphA2 to the cell membrane, and by using this composition for preventing or treating cancer comprising Anks1a protein expression or activity inhibitor as an active ingredient
  • the inhibitor of Anks1a expression or activity included in the composition for preventing or treating cancer according to the present invention may specifically act on the ankyrin repeat region (ANK) domain, but is not limited thereto.
  • cancer refers to a state in which a problem arises in the regulation function of the cell itself, and abnormal cells that normally need to be killed proliferate and invade surrounding tissues and organs to form agglomerates and destroy or modify existing structures. It is used in the same sense as a malignant tumor.
  • proliferate or treatment of cancer means inhibiting or preventing the growth of cancer, which reduces cancer growth and cancer metastasis, and decreases resistance to anticancer drugs when treated or untreated. The concept includes making the effect more effective.
  • the metastasis refers to a process in which tumor (cancer) cells are spread to a distant part of the body, and when treating cancer patients using an anticancer agent, "resistant to cancer” or “anticancer drug", This means that there is no therapeutic effect or early cancer treatment effect, but the cancer treatment effect is lost in the continuous treatment process.
  • Anks1a protein expression inhibitors included in the composition for preventing or treating cancer according to the present invention include antisense nucleotides, short interfering RNAs (siRNAs), and short hairpin RNAs that complementarily bind to mRNAs of the Anks1a gene.
  • shRNA short interfering RNAs
  • shRNA may be any one or more selected from the group consisting of, but is not limited thereto.
  • antisense nucleotide refers to a DNA or RNA or a derivative thereof containing a nucleic acid sequence complementary to a sequence of a particular mRNA, which binds to a complementary sequence in the mRNA and inhibits translation of the mRNA into a protein. It may be expressed as 'antisense oligonucleotide'.
  • Antisense nucleotide sequence means a DNA or RNA sequence that is complementary to Anks1a mRNA and capable of binding to Anks1a mRNA, and is essential for the translation of Anks1a mRNA, translocation into the cytoplasm, maturation or any other overall biological function. May inhibit activity.
  • the antisense nucleotides may be 6 to 100 bases, preferably 8 to 60 bases, more preferably 10 to 40 bases.
  • the antisense nucleotides may be modified at the position of one or more bases, sugars or backbones to enhance efficacy.
  • the nucleotide backbone can be modified with phosphorothioate, phosphoester, methyl phosphonate, short chain alkyl, cycloalkyl, short chain heteroatomic, heterocyclic intersaccharide linkages and the like.
  • antisense nucleotides may comprise one or more substituted sugar moieties.
  • Antisense nucleotides may comprise modified bases.
  • Modified bases include hypoxanthine, 6-methyladenine, 5-methyl pyrimidine (particularly 5-methylcytosine), 5-hydroxymethylcytosine (HMC), glycosyl HMC, gentobiosil HMC, 2-aminoadenine, 2-thiouracil, 2-thiothymine, 5-bromouracil, 5-hydroxymethyluracil, 8-azaguanine, 7-deazaguanine, N6 (6-aminohexyl) adenine, 2,6-diaminopurine Etc.
  • the antisense nucleotides of the present invention may be chemically bound to one or more moieties or conjugates that enhance the activity and cellular adsorption of the antisense nucleotides.
  • the antisense nucleotides can be synthesized in vitro in a conventional manner to be administered in vivo or to allow the antisense nucleotides to be synthesized in vivo.
  • synthesizing antisense nucleotides in vitro is using RNA polymerase I.
  • One example of allowing antisense RNA to be synthesized in vivo is to allow the antisense RNA to be transcribed using a vector whose origin is in the opposite direction of the multicloning site (MCS).
  • MCS multicloning site
  • the antisense RNA is preferably such that the translation stop codon is present in the sequence so that it is not translated into the peptide sequence.
  • the design of antisense nucleotides that can be used in the present invention can be readily prepared according to methods known in the art with reference to the nucleotide sequence of the Anks1a gene.
  • small interfering RNA and “siRNA” are nucleic acid molecules capable of mediating RNA interference or gene silencing, and thus can efficiently inhibit expression of a target gene, thereby efficiently knocking down a gene. Or gene therapy methods.
  • siRNA molecule When the siRNA molecule is used in the present invention, a double stranded structure or self-complementary structure (a sequence corresponding to the Anks1a mRNA sequence) and an antisense strand (a sequence complementary to the Anks1a mRNA sequence) are positioned opposite to each other to form a double strand.
  • -complementary can have a single chain structure with sense and antisense strands.
  • siRNAs are not limited to the complete pairing of double-stranded RNA pairs that pair with RNA, but include mismatches (corresponding bases are not complementary), expansion / bulge (bases corresponding to one chain). None) and the like may be included.
  • the siRNA terminal structure can be either blunt or cohesive, as long as the expression of the Anks1a gene can be inhibited by RNA interference (RNAi) effects.
  • RNAi RNA interference
  • the cohesive end structure is possible for both 3'-end protrusion structures and 5'-end protrusion structures.
  • the siRNA molecules of the present invention may have a form in which a short nucleotide sequence is inserted between self-complementary sense and antisense strands, in which case the siRNA molecule formed by expression of the nucleotide sequence is subjected to intramolecular hybridization.
  • a hairpin structure is formed, and as a whole, a stem-and-loop structure is formed.
  • This stem-and-loop structure is processed in vitro or in vivo to produce an active siRNA molecule capable of mediating RNAi.
  • the method of preparing siRNA is a method of directly synthesizing siRNA in vitro and then introducing it into a cell through a transformation process, and transducing the siRNA expression vector or a PCR-derived siRNA expression cassette prepared to express the siRNA into the cell. There is a method of conversion or infection.
  • composition of the present invention comprising the gene-specific siRNA may comprise an agent for promoting the intracellular influx of siRNA.
  • Agents that promote the influx of siRNA into the cell generally can be used agents that promote the influx of nucleic acids. Examples of these include the use of liposomes or the lipophilic of one of many sterols, including cholesterol, cholate and deoxycholic acid. It can be combined with a carrier.
  • poly-L-lysine spermine, polysilazane, polyethylenimine, polydihydroimidazolenium, polyallylamine Cationic polymers such as chitosan), succinylated PLL, succinylated PEI, polyglutamic acid, and polyaspartic acid.
  • anionic polymers such as polyaspartic acid, polyacrylic acid, polymethacylic acid, dextran sulfate, heparin, hyaluronic acid, etc. It is available.
  • short hairpin RNA and “shRNA” are single molecules in which two complementary moieties having a nucleotide sequence of an siRNA form a base pair and are covalently bonded by a hairpin region of a single chain. It is about 50-70 nucleotides in length and has a stem loop structure in vivo. Long RNAs of 19-29 nucleotides complementary to both loop regions of 5-10 nucleotides form base pairs to form a double stranded stem. shRNAs are generally synthesized in vivo by transcription of complementary nucleotide sequences from the Pol III promoter.
  • Pol-III-induced transcription starts at a well-known starting point and terminates at the second residue on the line (-TTTT-) consisting of four or more thymidines to produce a non-poly (A) transcript.
  • Pol III promoter is active in all cells and is capable of expressing shRNA. After transcription, shRNAs are cleaved by dicers and act like siRNAs (Tuschl, T. (2002), Cell 110 (5): 56374). More preferably, the short hairpin RNA of the Anks1a gene of the composition for preventing or treating cancer according to the present invention may have a nucleotide sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2.
  • Anks1a protein activity inhibitor included in the composition for preventing or treating cancer according to the present invention may be any one or more selected from the group consisting of compounds, peptides, peptide mimetics, aptamers, and antibodies that complementarily bind to Anks1a protein, This is not restrictive.
  • peptide mimetics of the present invention is to inhibit the activity of Anks1a protein as a peptide or non-peptide that inhibits the binding domain of Anks1a protein.
  • Major residues of the non-hydrolyzable peptide analogs include ⁇ -turn dipeptide cores (Nagai et al. Tetrahedron Lett 26: 647, 1985), keto-methylene pseudopeptides (Ewenson et al. J Med Chem 29: 295, 1986; And Ewenson et al. In Peptides: Structure and Function (Proceedings of the 9th American Peptide Symposium) Pierce Chemical Co. Rockland, IL, 1985), Huffman et al.
  • aptamer refers to a nucleic acid molecule having binding activity to a given target molecule.
  • the aptamer may inhibit the activity of the polynucleotide or protein by binding to the Anks1a polynucleotide or protein.
  • the aptamers of the invention may be RNA, DNA, modified nucleic acids or mixtures thereof, and may be in linear or cyclic form.
  • the length of the aptamer of the present invention is not particularly limited and may be usually 15 to 200 nucleotides, but is, for example, 100 nucleotides or less, preferably 80 nucleotides or less, more preferably 60 nucleotides or less, even more preferably 45 It may be up to nucleotides.
  • the length of the aptamers of the invention may also be, for example, at least 18, 20 or 25 nucleotides. Less total nucleotides make chemical synthesis and mass production easier and cost-effective. In addition, it is easy to chemical formula, high in vivo stability, low toxicity.
  • the aptamer of this invention can be manufactured by using SELEX method and its improvement method.
  • SELEX Systematic Evolution of Ligands by Exponential Enrichment
  • the oligonucleotide used has a structure in which a random sequence of about 40 residues is sandwiched between primer sequences. This oligonucleotide pool is associated with a target substance to recover only the oligonucleotides bound to the target substance using a filter or the like.
  • the recovered oligonucleotide is amplified by RT-PCR and used as a template for the next round. By repeating this operation about 10 times, an aptamer specifically binding to a target substance can be obtained.
  • aptamers having a stronger binding strength to the target material can be concentrated and selected. Therefore, by adjusting the number of rounds of SELEX or changing the contention state, it is possible to obtain aptamers having different binding forces, aptamers having different binding forms, and aptamers having the same binding force or binding form but different base sequences.
  • the SELEX method includes the amplification process by PCR, by providing a mutation by using manganese ions in the process, it becomes possible to perform a SELEX richer in diversity.
  • aptamers can be obtained by using the Cell-SELEX technique for complex targets, ie, living cells and tissues, in addition to the conventional SELEX technique.
  • the Cell-SELEX technique can be used to detect aptamers for disease cells even when surface marker targets are not known. It has the advantage of being able to develop.
  • the Cell-SELEX technique has advantages over the conventional SELEX process because the isolated protein may not exhibit its original properties, and the target protein in the physiological state allows for a more functional approach in the selection process. have.
  • aptamers bind to the target substance by various binding modes such as ionic bonds using a negative charge of phosphate groups, hydrophobic bonds and hydrogen bonds using ribose, and hydrogen bonds or stacking bonds using nucleic acid bases.
  • the ionic bond using the negative charge of the phosphate group present by the number of nucleotides strongly binds to the positive charge of lysine or arginine on the surface of the protein.
  • the nucleic acid base which is not related to direct binding with a target substance can be substituted.
  • the portion of the stem structure is already made of base pairs and is directed toward the inside of the double helix structure, the nucleic acid base is difficult to bind directly with the target substance.
  • the base can be substituted when the nucleic acid base is not involved in direct binding to the target molecule.
  • the base at the 2 'position of the ribose, it may be a nucleotide in which a hydroxyl group is substituted with any atom or group.
  • arbitrary atoms or groups for example, hydrogen atom, fluorine atom or -O-alkyl group (e.g. -O-CH3), -O-acyl group (e.g. -O-CHO), amino group (e.g.
  • aptamers retain their activity unless they substitute or delete functional groups involved in direct binding to the target molecule.
  • aptamers are easy to modify because they can be chemically synthesized.
  • aptamers predict the secondary structure, or predict the three-dimensional structure by X-ray analysis or NMR analysis, and can predict to what extent nucleotides can be substituted or deleted and where new nucleotides can be inserted. .
  • the aptamer of the predicted new sequence can be easily chemically synthesized and can be confirmed by existing assay systems whether the aptamer is active.
  • the term "antibody” is a substance that is produced by stimulation of an antigen in the immune system and specifically binds to a specific antigen to generate an antigen-antibody reaction.
  • the antibody is specific to Anks1a protein in order to inhibit the activity of Anks1a protein.
  • Antibodies that bind to proteins can be used.
  • an antibody which acts on the ANK domain in the Anks1a protein to inhibit binding to EphA2 or inhibits migration of EphA2 to the cell surface can be used.
  • Antibodies specific for the Anks1a protein that may be used in the present invention may be polyclonal or monoclonal antibodies, preferably monoclonal antibodies.
  • Antibodies specific for Anks1a protein can be prepared by methods commonly practiced in the art, such as fusion methods (Kohler and Milstein, European Journal of Immunology, 6: 511-519 (1976)), recombinant DNA methods (US Pat. No. 4,816,567). Or) phage antibody library methods (Clackson et al, Nature, 352: 624-628 (1991) and Marks et al, J. Mol. Biol., 222: 58, 1-597 (1991)). have.
  • polyclonal antibodies can be obtained by injecting Anks1a protein antigen into a suitable animal, collecting antiserum from the animal, and then separating the antibody from the antiserum using known affinity techniques.
  • the antibody may include a single chain variable region fragment (scFv).
  • the single chain variable region fragment may be composed of "variable region (VL) -linker-heavy chain variable region (VH) of light chain".
  • the linker means an amino acid sequence of a certain length that serves to artificially link the variable regions of the heavy and light chains.
  • composition for preventing or treating cancer according to the present invention is liver cancer, giant cell tumor, colon cancer, tuberculosis cancer, osteosarcoma, ovarian cancer, brain tumor, colon cancer, bladder cancer, kidney cancer, gastric cancer, breast cancer, cervical cancer, uterine cancer, prostate cancer, pancreatic cancer,
  • the present invention may be applied to, but is not limited to, any one selected from the group consisting of epidermal cancer and lung cancer, and preferably breast cancer.
  • composition for preventing or treating cancer according to the present invention may contain one or more active ingredients exhibiting the same or similar functions in addition to the above-described Anks1a protein expression or activity inhibitors.
  • the composition can be administered orally or parenterally during clinical administration and intraperitoneal injection, rectal injection, subcutaneous injection, intravenous injection, intramuscular injection, intrauterine dural injection, cerebrovascular injection or intrathoracic injection during parenteral administration. And can be used in the form of general pharmaceutical formulations.
  • the composition can be used alone or in combination with methods using surgery, radiation therapy, hormone therapy, chemotherapy and biological response modifiers.
  • the daily dosage of the composition is about 0.0001 to 100 mg / kg, preferably 0.001 to 10 mg / kg, preferably administered once or several times a day, but the weight, age, sex, health, diet of the patient The range varies depending on the time of administration, the method of administration, the rate of excretion and the severity of the disease.
  • composition of the present invention may be administered in various parenteral formulations during actual clinical administration, when formulated using a diluent or excipient such as fillers, extenders, binders, wetting agents, disintegrating agents, surfactants, etc., which are commonly used. do.
  • a diluent or excipient such as fillers, extenders, binders, wetting agents, disintegrating agents, surfactants, etc., which are commonly used. do.
  • Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, suppositories.
  • non-aqueous solvent and the suspension solvent propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate, and the like can be used.
  • a base of suppositories witepsol, macrogol, tween 61, cacao butter, laurin butter
  • the present invention (a) treating the candidate material to the target cell; (b) measuring the expression or activity of Anks1a protein in the target cell; And (c) selecting the candidate substance to reduce the expression or activity of Anks1a protein from the candidate substance as a result of the measurement.
  • Anks1a gene expression inhibitor or “Anks1a protein activity inhibitor” of the present invention can be obtained through the above screening method.
  • the term "candidate” refers to an unknown substance used in screening to examine whether it affects the expression of Anks1a gene or the activity of Anks1a protein.
  • the candidates may include, but are not limited to, chemicals, peptides and natural extracts.
  • Candidates analyzed by the screening methods of the present invention may be a single compound or a mixture of compounds and may be obtained from a library of synthetic or natural compounds.
  • Measuring the expression or activity of the Anks1a protein in the screening method for the prophylaxis or treatment of cancer according to the present invention the amount of Anks1a gene expression, the amount of Anks1a protein, other proteins under the action of Anks1a protein, Anks1a protein and other proteins Any one or more selected from interactions with the Anks1a protein and other proteins, and complexes of other proteins subjected to the Anks1a protein, may be detected or measured.
  • Another protein that interacts with or forms a complex with the Anks1a protein may be EphA2, ErbB2 or a complex thereof.
  • measuring the amount of mRNA expression of Anks1a (more preferably the expression of the ANK region gene), quantifying the amount of Anks1a protein, quantifying the amount of EphA2 protein on the cell surface before and after the candidate treatment, or It may be a method of quantifying changes in intracellular and surface EphA2 protein before and after treatment, or quantifying the amount of ErbB / EphA2 complex.
  • the expression or activity of the Anks1a protein may be applied to a method commonly used in the art, and may be used as a reverse transcriptase-polymerase chain. reaction, real time-polymerase chain reaction, Western blot, Northern blot, enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA), radioimmunodiffusion and immunoprecipitation assay It may be selected from the group consisting of (immunoprecipitation assay), but is not limited thereto.
  • step (b) is a step of selecting a candidate to reduce the expression or activity of the Anks1a protein among the candidates as a result of the measurement, wherein the expression of the Anks1a gene or the activity of the Anks1a protein is decreased by the candidate. Downregulation can be measured to determine the substance for the prevention or treatment of cancer.
  • the screening methods of the present invention can be carried out in a variety of ways, in particular in a high throughput manner according to various binding assays known in the art.
  • the candidate or Anks1a protein may be labeled with a detectable label.
  • the detectable label may be a chemical label (eg biotin), an enzyme label (eg horseradish peroxidase, alkaline phosphatase, peroxidase, luciferase, ⁇ -galactosidase and ⁇ - Glucosidase), radiolabels (eg C14, I125, P32 and S35), fluorescent labels (eg coumarin, fluorescein, fluoresein Isothiocyanate (FITC), rhodamine 6G, rhodamine B, TAMRA (6 -carboxy-tetramethylrhodamine), Cy-3, Cy-5, Texas Red, Alexa Fluor, DAPI (4,6-diamidino-2-phenylindole), HEX, TET, Dabsyl, and FAM), luminescent labels, chemiluminescent Label, fluorescence resonance energy transfer (FRET) label or metal label (eg, gold and silver).
  • a chemical label eg
  • anks1a protein or candidate labeled with a detectable label whether or not binding between the Anks1a protein and the candidate occurs can be analyzed by detecting a signal from the label.
  • a signal from the label For example, when alkaline phosphatase is used as a label, bromochloroindolyl phosphate (BCIP), nitro blue tetrazolium (NBT), naphthol-AS-B1-phosphate (naphthol-AS-B1-phosphate) Signal is detected using a chromogenic reaction substrate such as) and enhanced chemifluorescence (ECF).
  • BCIP bromochloroindolyl phosphate
  • NBT nitro blue tetrazolium
  • naphthol-AS-B1-phosphate naphthol-AS-B1-phosphate
  • ECF enhanced chemifluorescence
  • hose radish peroxidase When hose radish peroxidase is used as a label, chloronaphthol, aminoethylcarbazole, diaminobenzidine, D-luciferin, lucigenin (bis-N-methylacridinium nitrate), resorupin benzyl ether, luminol, Amflex Red Reagent (10-acetyl-3,7-dihydroxyphenoxazine), HYR (p-phenylenediamine-HCl and pyrocatechol), TMB (tetramethylbenzidine), ABTS (2,2-Azine-di [3-ethylbenzthiazoline sulfonate ]), o-phenylenediamine (OPD) and substrates such as naphthol / pyronine are used to detect the signal.
  • Amflex Red Reagent 10-acetyl-3,7-dihydroxyphenoxazine
  • HYR
  • binding of candidates to the Anks1a protein may be analyzed without labeling the interactants.
  • a microphysiometer can be used to analyze whether a candidate binds to the Anks1a protein.
  • Microphysiometers are analytical tools that measure the rate at which cells acidify their environment using a light-addressable potentiometric sensor (LAPS). The change in acidification rate can be used as an indicator for binding between the candidate and the Anksla protein (McConnell et al., Science 257: 19061912 (1992)).
  • BIA bimolecular interaction analysis
  • the invention also provides the use of the Anks1a protein or gene encoding it as a biomarker for cancer diagnosis. Specifically, it is a biomarker for diagnosing cancer, including an increase in Anks1a protein or gene expression or activity encoding the same.
  • the present invention also provides an agent or kit for diagnosing cancer, including an Anks1a protein activity inhibitor.
  • the present invention also provides a method for diagnosing cancer by measuring the expression or activity of Anks1a protein or a gene encoding the same or using the agent or kit for diagnosing cancer.
  • the diagnostic method includes measuring the expression or activity of Anks1a protein in a sample isolated from an individual, or reacting an agent or kit for cancer diagnosis comprising an Anks1a protein activity inhibitor to a sample isolated from the individual.
  • Samples isolated from the subject may include blood, urine, saliva, plasma and the like.
  • CT26 cell lines were grown in Dulbecco's modified MEM medium (DMEM) containing 10% FBS.
  • DMEM Dulbecco's modified MEM medium
  • PMTC Primary tumor cells
  • cancer tissues were separated from the rats, washed with PBS, and chopped with a knife. Finely chopped cancer tissue was placed in a 50 ml tube and soaked in collagenase solution (0.2% trypsin, 0.2% collagenase A, 5% FBS, and 5 ⁇ g / ml gentamycin, diluted in DMEM / F12 medium) for 2 hours. It was placed at 37 ° C.
  • the supernatant was discarded by centrifugation at 1,500 rpm for 10 minutes, and the pellet was mixed well with 4 ml of DMEM / F12 containing 2U / ml of DNase and shaken slowly at room temperature for 5 minutes. Then, 6 ml of DMEM / F12 was added and centrifuged at 1,500 rpm for 10 minutes to remove supernatant five times.
  • the supernatant was removed and pelleted into growth medium (1000 ⁇ ITS, 5 ⁇ g / ml epidermal growth factor (EGF), 5% fetal bovine serum (FBS), 500 ⁇ g / ml gentamycin, 10% antibiotic, DMEM / F12 Dilution in the medium) was mixed and spread on a plate and incubated.
  • growth medium 1000 ⁇ ITS, 5 ⁇ g / ml epidermal growth factor (EGF), 5% fetal bovine serum (FBS), 500 ⁇ g / ml gentamycin, 10% antibiotic, DMEM / F12 Dilution in the medium
  • CT26 or PMTC cultured for colony formation analysis was placed in media containing lentiviral for 3 days. And before the analysis, 1.5% agarose mixed with 2X DMEM containing 5% fetal bovine serum 1: 1 and solidified on a 24well plate. This was called base agarose, and after it was completely hardened, the lentiviral infected cells were separated from the plate, mixed with serum-free DMEM, and centrifuged. The supernatant was removed and the cells were mixed with hardened base agarose with top agarose mixed 1 ⁇ with 1% agarose and 2X DMEM containing 5% FBS. After incubation in the incubator for 3 weeks, the photo was taken with a microscope to measure the size of each colony using Image J.
  • CT26 or PMTC infected with lentiviral is incubated on the cover slip.
  • Anti-human IgG was mixed 1: 1 with 2 ⁇ g / ml ephrinA5-Fc, pre-clustering on ice for 1 hour, and then mixed with serum-free DMEM. After 1 hour at 4 ° C., cells were washed three times with phosphate buffered saline (PBS). In addition, a fixed solution containing 4% paraformaldehyde, 2% sucrose, and 3% bovine serum albumin (BSA) was added to fix cells on ice for 30 minutes.
  • PBS phosphate buffered saline
  • ErbB2 staining of the cell surface was fixed by blocking the cells cultured on the cover slip, and then put the anti-ErbB2 antibody in 3% BSA solution and placed in a 4 °C refrigerator overnight. And the next day, washed with PBS and once again blocked and stained with rabbit anti-mouse IgG with TRITC. This was photographed with a fluorescence microscope and the intensity of fluorescence was quantified using Image J.
  • HEK293T cells are grown on 100 mm plates and each gene is transfected and expressed. After 48 hours, cells are washed with PBS and treated with trypsin to remove from the plate. 10 ml of B88-0 (20 mM HEPES (pH 7.2), 250 mM sorbitol, 150 mM KOAc) buffer was added thereto, and 10 ⁇ g / ml of soy trypsin inhibitor was mixed and centrifuged. Thereafter, the supernatant was removed, and 40 ⁇ g / ml digtonin was added to 10 ml of B88-0 buffer, placed on ice for 5 minutes, and centrifuged to collect the cells.
  • B88-0 (20 mM HEPES (pH 7.2), 250 mM sorbitol, 150 mM KOAc) buffer was added thereto, and 10 ⁇ g / ml of soy trypsin inhibitor was mixed and centrifuged. Thereafter, the superna
  • the cells thus obtained were used to make vesicles from donor membranes.
  • Mouse liver cytosol, ATP regenerating system (40nM creatine phosphate, 0.2mg / ml creatine phosphokinase, 1mM ATP), 0.2mM GTP was added to the donor membrane for 1 hour at 30 ° C.
  • the donor membrane was removed by centrifugation at 15,000 rpm for 15 minutes, and the supernatant was further centrifuged at 32,000 rpm for 114 minutes to separate vesicles.
  • solubilization buffer (10 mM Tris-HCl (pH7.6), 100 mM sodium chloride, and 1% Triton X-100 (with phosphatase inhibitor)) and hanged on an SDS-PAGE gel for immunoblotting.
  • CT26 a cell line obtained from mouse colorectal cancer, was used to examine the relationship between Anks1a expression and EphA2.
  • the amount of Anks1a in the cells was reduced using shRNA and confirmed by Western blotting (FIG. 1A).
  • sequence of shRNA-17 is the nucleotide sequence set forth in SEQ ID NO: 1 [(CCGGCGTCCCTTTCAAGATTGGTTTCTCGAGAAACCAATCTTGAAAGGGACGTTTTTG); 3 ′ UTR region]
  • the sequence of shRNA-21 is the nucleotide sequence set forth in SEQ ID NO: 2 [CCCCCCAGATAGTACGTCTGCTCATCTCGAGATGAGCAGACGTACTATCTGGTTTTTG); CDS region].
  • CT26 cell line treated with Anks1a-specific shRNA was injected into Balb / c mice to confirm the degree of cancer production.
  • Anks1a reduced EphA2 on the cell surface
  • This inhibition of cancer formation ability could be confirmed once again by colony formation assay using cells (FIGS. 1E and 1F);
  • cancer cells can survive in extreme conditions and maintain their proliferation, and can determine whether the cells grow on agarose and form a colony of cancer cells. It was confirmed by Western blotting that the reduction of EphA2 on the cell surface reduced Erk activity leading to a decrease in cancer formation ability of these cells (FIG. 1A, 3rd, 4th line).
  • the MMTV promoter induced the strong expression of ErbB2 gene in the breast continuously. After 8 months, MMTV-Neu (ErbB2) mice, which developed breast cancer, were compared with the frequency of breast cancer formation in mice when the amount of Anks1a was reduced.
  • Anks1a influences the migration of EphA2 and ErbB2 to the cell surface and identified EphA2 and ErbB2 present in the vesicles moving from the endoplasmic reticulum to the Golgi, the first step in the movement to the cell surface.
  • the budding assay a well-known experimental method, showed that the movement of EphA2 to the cell surface was effective in the presence of Anks1a (FIG. 3B).
  • cell migration of ErbB2 requires Anks1a and EphA2 together (FIG. 3A).
  • the intracellular expression of ErbB2 is more stable in the presence of EphA2.
  • the movement of Anbbl to the cell surface is increased, which increases the amount of ErbB2 / EphA2 complex present in the cell membrane. It was confirmed that it was elevated to promote cancer formation.
  • Anks1a-specific inhibitors to counteract Anks1a's function could reduce breast cancer by reducing the amount of ErbB2 / EphA2 on the cell surface, especially targeting ANK regions involved in the interaction between Anks1a and EphA2.
  • the development of inhibitors is expected to be highly effective in treating cancer, particularly breast cancer.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Immunology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Epidemiology (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Urology & Nephrology (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • Hematology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Pathology (AREA)
  • Food Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Analytical Chemistry (AREA)
  • Cell Biology (AREA)
  • General Physics & Mathematics (AREA)
  • Physics & Mathematics (AREA)
  • Mycology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Oncology (AREA)
  • Toxicology (AREA)
  • Tropical Medicine & Parasitology (AREA)

Abstract

본 발명은 Anks1a 단백질 발현 또는 활성 억제제를 유효성분으로 포함하는 암 예방 또는 치료용 조성물 및 그 스크리닝 방법에 관한 것으로, 이를 통해, 암 예방 및 치료 효과가 우수한 조성물을 제공하고, 간편하게 항암제를 스크리닝할 수 있는 방법을 제공할 수 있다.

Description

ANKS1A 단백질 발현 또는 활성 억제제를 유효성분으로 포함하는 암 예방 또는 치료용 조성물 및 이의 스크리닝 방법
본 발명은 Anks1a 단백질 발현 또는 활성 억제제를 유효성분으로 포함하는 암 예방 또는 치료용 조성물, 이의 스크리닝 방법 및 Anks1a 단백질 발현 또는 활성 억제제를 이용한 암 예방 또는 치료 방법 및 진단 방법에 관한 것이다.
암(악성 종양)은 암에 대한 연구가 30년 이상 심도 있게 이루어진 현재에도 환경오염, 잘못된 식생활습관 등으로 인하여 암 발생률은 계속 증가하여 전 세계적으로 매년 1,000만 명이 넘는 환자가 발생하고 있으며, 세계보건기구(WHO)는 사망의 주요원인 중 하나로 암을 꼽고 있다. 현대사회에서 사망률 1위를 차지하는 주요 질병으로 현재까지 많은 연구에도 불구하고 획기적인 치료법이 없는 실정이다. 암의 치료에 있어 항암제와 같은 화학요법제를 이용한 치료는 어느 정도 효과를 거두고는 있으나 암의 다양한 발병기작과 항암제 내성 발현으로 인하여 많은 연구가 요구되고 있다. 최근 수십 년간 진단과 치료기술의 발달로 암치료에 대해 제한적으로나마 치료율의 향상과 기능적 보존이라는 긍정적인 결과를 얻기도 했지만 많은 진행성 암에 있어서 5년 생존율은 5 내지 50%에 맴돌고 있다. 이러한 암은 공격적인 침습, 림프절전이, 원격전이와 이차 암의 발생을 특징이라 할 수 있는데 일부 암에 있어서는 다양한 연구와 치료에도 불구하고 지난 20년간 생존율이 크게 변하지 못한 상태이다.
최근에는 이러한 암에 대해 분자생물학적인 접근을 통해 치료효과를 높이려는 시도가 많아지고, 암의 증식, 전이와 세포사멸과 관련된 표적치료에 대한 연구가 활발히 진행되고 있다. 이 중 RNA 간섭(RNA interference: RNAi)기술이 생명과학분야의 연구에서 빈번히 이용되며, 그 유용성은 널리 인식되기에 이르렀다. 여기서, RNAi란 2중쇄 RNA에 의해 그 배열 특이적으로 mRNA가 분해되고, 그 결과 유전자의 발현이 억제되는 현상을 말한다. 2001년에 21염기의 저분자 2중쇄 RNA인 siRNA(small interference RNA)가 포유 동물의 세포 내에서 RNAi를 매개할 수 있음이 보고된 이래[Elbashir S.M. et al., "Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells" Nature, 411 (6836), p.494-498(2001)], siRNA는 표적유전자의 발현 억제 방법으로서 빈번하게 이용되고 있으며, siRNA의 단점을 보완한 shRNA도 많이 활용되고 있다.
이러한 RNA 간섭을 이용한 치료에서 가장 먼저 고려되어야 할 점은 목표로 하는 염기서열에서 가장 큰 활성을 가지는 최적의 siRNA 및 shRNA 서열(이하 "간섭 RNA"라 칭함)을 선정하는 것이다. 리보핵산 매개 간섭현상의 효율은 표적이 되는 전사체에의 특정 결합부위가 큰 영향을 주는 것으로 알려져 있다. 지난 수 년 간의 데이터베이스를 바탕으로 단지 전사체에 결합만 하는 것이 아니라 실제로 표적 리보핵산의 발현을 억제하는 간섭 RNA의 서열위치를 디자인할 수 있는 알고리즘이 개발되어 이용자들에게 제공되고 있다. 그러나 컴퓨터 알고리즘을 이용하여 in silico 방법으로 결정된 모든 간섭 RNA가 실제 세포 및 생체중에서 표적 리보핵산을 효과적으로 억제할 수 있다고는 말할 수 없다. RNA가 표적 전사체와 상보적으로 결합할 수 있는 요구 사항이 충족된다 하더라도 리보핵산과 단백질의 안정성 및 세포내 위치, 리보핵산 매개 간섭현상에 관여하는 단백질들의 상태 등 이 밖에도 아직 규명되지 않은 여러 요소들이 리보핵산 매개 간섭현상의 효율을 결정하는데 관여한다는 것이 알려져 있다. 따라서 한 유전자의 전사체당 여러 개의 표적 서열위치를 선정하여 siRNA를 제조하고 이들 후보군중 발현 억제 효능이 우수한 최적위치의 서열을 발굴하는 기술이 표적 단백질에 대해 수행되는 것이 필요하다. 한편, Anks1a와 관련한 암 연구는 Anks1a와 EphA2간의 결합에 의한 EphA2의 endocytosis 조절을 중점으로만 진행되어 왔다[Flavia Anna Mercurio and et al., "SOLUTION STRUCTURE OF THE FIRST SAM DOMAIN OF ODIN AND BINDING STUDIES WITH THE EPHA2 RECEPTOR" Biochemistry. 2012 March 13; 51(10): 2136-2145].
본 발명은 Anks1a 단백질 발현 또는 활성 억제제를 유효성분으로 포함하는 암 예방 또는 치료용 조성물, 이의 스크리닝 방법 및 Anks1a 단백질 발현 또는 활성 억제제를 이용한 암 예방 또는 치료 방법 및 진단 방법을 제공하고자 한다. 또한, 본 발명은 Anks1a 단백질의 암 진단용 바이오마커로서의 용도 및 Anks1a 단백질 발현 또는 활성 억제제를 포함하는 암 진단용 제제 또는 키트를 제공하고자 한다.
상술한 목적을 달성하기 위하여, 본 발명은 Anks1a 단백질 발현 또는 활성 억제제를 유효성분으로 포함하는 암 예방 또는 치료용 조성물을 제공한다.
본 발명의 일 구현예에 따르면, 상기 암 예방 또는 치료용 조성물의 Anks1a 단백질 발현 또는 활성 억제제는 ANK(ankyrin repeat region) 도메인에 특이적으로 작용하는 것을 특징으로 한다.
본 발명의 일 구현예에 따르면, 상기 암 예방 또는 치료용 조성물의 Anks1a 단백질 발현 억제제는 Anks1a 유전자의 mRNA에 상보적으로 결합하는 안티센스 뉴클레오티드, 작은 간섭 RNA(short interfering RNA, siRNA) 및 짧은 헤어핀 RNA(short hairpin RNA, shRNA)로 이루어진 군에서 선택된 어느 하나 이상인 것을 특징으로 한다.
본 발명의 일 구현예에 따르면, 상기 암 예방 또는 치료용 조성물의 Anks1a 유전자의 짧은 헤어핀 RNA(Short hairpin RNA)는 서열번호 1 또는 서열번호 2에 기재되는 염기 서열을 갖는 것을 특징으로 한다.
본 발명의 일 구현예에 따르면, 상기 암 예방 또는 치료용 조성물의 Anks1a 단백질 활성 억제제는 Anks1a 단백질에 상보적으로 결합하는 화합물, 펩티드, 펩티드 미메틱스, 앱타머 및 항체로 구성된 군으로부터 선택된 어느 하나 이상인 것을 특징으로 한다.
본 발명의 일 구현예에 따르면, 상기 암 예방 또는 치료용 조성물은 간암, 거대세포종, 결장암, 결핵암, 골육종, 난소암, 뇌종양, 대장암, 방광암, 신장암, 위암, 유방암, 자궁경부암, 자궁암, 전립선암, 췌장암, 표피암 및 폐암으로 구성된 군으로부터 선택되는 어느 하나인 암에 적용하는 것을 특징으로 한다.
또한, 본 발명은, (a) 대상세포에 후보물질을 처리하는 단계; (b) 상기 대상세포에서 Anks1a 단백질의 발현 또는 활성을 측정하는 단계; 및 (c) 상기 측정 결과, 상기 후보물질 중에서 Anks1a 단백질의 발현 또는 활성을 감소시키는 후보물질을 선택하는 단계를 포함하는 암의 예방 또는 치료용 물질의 스크리닝 방법을 제공한다.
본 발명의 일 구현예에 따르면, 상기 암의 예방 또는 치료용 물질의 스크리닝 방법에서 Anks1a 단백질의 발현 또는 활성을 측정하는 단계는, Anks1a 유전자 발현양, Anks1a 단백질 양, Anks1a 단백질의 작용을 받은 다른 단백질, Anks1a 단백질과 다른 단백질과의 상호작용, Anks1a 단백질과 다른 단백질과의 복합체, 및 Anks1a 단백질의 작용을 받은 다른 단백질의 복합체 중에서 선택된 어느 하나 이상을 검출 또는 측정하는 것을 특징으로 한다.
본 발명의 일 구현예에 따르면, 상기 암의 예방 또는 치료용 물질의 스크리닝 방법에서 Anks1a 단백질과 상호작용하거나 복합체를 형성하는 다른 단백질은 EphA2, ErbB2 또는 이들의 복합체인 것을 특징으로 한다.
본 발명의 일 구현예에 따르면, 상기 암의 예방 또는 치료용 물질의 스크리닝 방법에서 Anks1a 단백질의 발현 또는 활성의 측정하는 방법은 역전사 중합효소 연쇄반응(reverse transcriptase-polymerase chain reaction), 실시간 중합효소연쇄반응(real time-polymerase chain reaction), 웨스턴 블럿, 노던 블럿, ELISA(enzyme linked immunosorbent assay), 방사선면역분석(RIA: radioimmunoassay), 방사 면역 확산법(radioimmunodiffusion) 및 면역침전분석법(immunoprecipitation assay)으로 이루어진 군 중에서 선택되는 것을 특징으로 한다.
또한, 본 발명은 Anks1a 단백질 발현 또는 활성 억제제를 개체에게 투여하는 것을 포함하는 암 예방 또는 치료용 조성물을 제공한다.
본 발명의 일 구현예에 따르면, 상기 개체는 포유동물일 수 있으며, 예를 들어 인간일 수 있다.
본 발명의 일 구현예에 따르면, 상기 Anks1a 단백질 발현 또는 활성 억제제는 ANK(ankyrin repeat region) 도메인에 특이적으로 작용하는 것을 특징으로 한다.
본 발명의 일 구현예에 따르면, 상기 Anks1a 단백질 발현 억제제는 Anks1a 유전자의 mRNA에 상보적으로 결합하는 안티센스 뉴클레오티드, 작은 간섭 RNA(short interfering RNA, siRNA) 및 짧은 헤어핀 RNA(short hairpin RNA, shRNA)로 이루어진 군에서 선택된 어느 하나 이상인 것을 특징으로 한다.
본 발명의 일 구현예에 따르면, 상기 Anks1a 유전자의 짧은 헤어핀 RNA(Short hairpin RNA)는 서열번호 1 또는 서열번호 2에 기재되는 염기 서열을 갖는 것을 특징으로 한다.
본 발명의 일 구현예에 따르면, 상기 Anks1a 단백질 활성 억제제는 Anks1a 단백질에 상보적으로 결합하는 화합물, 펩티드, 펩티드 미메틱스, 앱타머 및 항체로 구성된 군으로부터 선택된 어느 하나 이상인 것을 특징으로 한다.
본 발명의 일 구현예에 따르면, 상기 방법은 간암, 거대세포종, 결장암, 결핵암, 골육종, 난소암, 뇌종양, 대장암, 방광암, 신장암, 위암, 유방암, 자궁경부암, 자궁암, 전립선암, 췌장암, 표피암 및 폐암으로 구성된 군으로부터 선택되는 어느 하나인 암에 적용하는 것을 특징으로 한다.
본 발명은 또한 Anks1a 단백질 또는 이를 인코딩하는 유전자의 암 진단용 바이오마커로서의 용도를 제공한다. 구체적으로, Anks1a 단백질 또는 이를 인코딩하는 유전자 발현 또는 활성의 증가를 포함하는 암 진단용 바이오마커이다.
또한, 본 발명은 Anks1a 단백질 활성 억제제를 포함하는 암 진단용 제제 또는 키트를 제공한다.
또한, 본 발명은 Anks1a 단백질 또는 이를 인코딩하는 유전자의 발현 또는 활성을 측정하거나 상기 암 진단용 제제 또는 키트를 이용하는 암 진단 방법을 제공한다.
본 발명의 일 구현예에 따르면, 상기 진단 방법은 개체로부터 분리된 시료의 Anks1a 단백질의 발현 또는 활성을 측정하는 것을 포함한다.
본원의 일 구현예에 따르면, 상기 진단 방법은 개체로부터 분리된 시료에 Anks1a 단백질 활성 억제제를 포함하는 암 진단용 제제 또는 키트를 반응시키는 것을 포함한다.
본 발명의 일 구현예에 따르면, 상기 Anks1a 단백질 발현 억제제는 Anks1a 유전자의 mRNA에 상보적으로 결합하는 안티센스 뉴클레오티드, 작은 간섭 RNA(short interfering RNA, siRNA) 및 짧은 헤어핀 RNA(short hairpin RNA, shRNA)로 이루어진 군에서 선택된 어느 하나 이상인 것을 특징으로 한다.
본 발명의 일 구현예에 따르면, 상기 Anks1a 유전자의 짧은 헤어핀 RNA(Short hairpin RNA)는 서열번호 1 또는 서열번호 2에 기재되는 염기 서열을 갖는 것을 특징으로 한다.
본 발명의 일 구현예에 따르면, 상기 Anks1a 단백질 활성 억제제는 Anks1a 단백질에 상보적으로 결합하는 화합물, 펩티드, 펩티드 미메틱스, 앱타머 및 항체로 구성된 군으로부터 선택된 어느 하나 이상인 것을 특징으로 한다.
본 발명의 일 구현예에 따르면, 상기 진단 방법은 간암, 거대세포종, 결장암, 결핵암, 골육종, 난소암, 뇌종양, 대장암, 방광암, 신장암, 위암, 유방암, 자궁경부암, 자궁암, 전립선암, 췌장암, 표피암 및 폐암으로 구성된 군으로부터 선택되는 어느 하나인 암을 진단하는 것을 특징으로 한다.
본 발명은 Anks1a 단백질 발현 또는 활성 억제제를 유효성분으로 포함하는 암 예방 또는 치료용 조성물 및, 그 스크리닝 방법에 관한 것으로, 이를 통하여, 암 예방 및 치료 효과가 우수한 조성물을 제공하고, 간편하게 항암제를 스크리닝할 수 있는 방법을 제공하는 바, 의약분야에 유용하게 응용될 수 있다.
도 1a 및 1b는 CT26 세포주에 Anks1a에 특이적인 shRNA를 처리한 후 웨스턴 블롯팅한 결과이다.
도 1c 내지 1f는 Balb/c 쥐에 Anks1a에 특이적인 shRNA를 처리한 CT26 세포주를 투여한 후, 세포의 암 형성 능력(도 1d) 및 콜로니 형성 능력(도 1e 및 1f)를 측정한 결과이다.
도 2a는 유방암 발현 쥐 (MMTV-Neu)에 Anks1a 발현을 Knockout하였을 때, 암 형성 능력을 측정한 결과이다.
도 2b 및 2c는 유방암 발현 쥐(MMTV-Neu)에 Anks1a에 특이적인 shRNA를 투여한 후, 콜로니 형성 능력을 측정한 결과이다.
도 2d 및 2e는 유방암 발현 쥐(MMTV-Neu)에 Anks1a에 특이적인 shRNA를 투여한 후, EphA2와 ErbB2의 발현을 측정한 결과이다.
도 3a 및 3b는 Anks1a가 EphA2와 ErbB2의 세포 표면으로의 이동에 영향을 측정한 결과이다.
상기 상술한 목적을 달성하기 위한 본 발명은, 본 발명은 Anks1a 단백질 발현 또는 활성 억제제를 유효성분으로 포함하는 암 예방 또는 치료용 조성물 및, 그 스크리닝 방법을 제공한다. 이하 도면을 참조하여 본 발명을 구체적으로 설명한다.
본 발명은 Anks1a 단백질 발현 또는 활성 억제제를 유효성분으로 포함하는 암 예방 또는 치료용 조성물, 이를 이용한 암 예방 또는 치료 방법을 제공한다. 본 발명에서 상기 Anks1a 단백질(Ankyrin repeat and SAM domain-containing protein 1A)은 세포 내 세포질에 존재하는 어뎁터 단백질로, Anks1a 유전자에 의하여 발현된다. 상기 Anks1a 유전자는 인간의 경우 6번째 염색체 상(6p21.31)에 존재하고, 염기서열은 NCBI의 NM_015245.2에 제시된 서열을 갖고, 아미노산 서열은 NCBI의 NP_056060.2에 제시된 서열을 가질 수 있다.
본 발명을 통하여 상기 Anks1a가 단백질의 생성과 세포막으로의 이동에 중요한 기능을 담당하는 소포체에서 발현되고, Anks1a는 ANK (ankyrin repeat region) 도메인을 통해 EphA2와 결합하고 PTB 도메인(Phosphotyrosine Binding Domains)을 통해 Sec23 단백질(소포체로부터 골지체로 이동하는 vesicle의 구성요소 중 하나)과 결합한다는 것을 확인할 수 있었다. 이를 통하여 Anks1a의 ANK가 EphA2와 상호작용하여 EphA2의 소포체로부터 세포막으로의 이동 과정을 조절할 수 있는 특성을 규명하여, 이를 이용하여 Anks1a 단백질 발현 또는 활성 억제제를 유효성분으로 포함하는 암 예방 또는 치료용 조성물을 제공하는 것이다. 일례로, 본 발명에 따른 암 예방 또는 치료용 조성물에 포함되는 Anks1a의 발현 또는 활성 억제제는 ANK(ankyrin repeat region) 도메인에 특이적으로 작용할 수 있으나, 이에 제한되지 않는다.
본 발명에서 용어, "암"은 세포 자체의 조절 기능에 문제가 생겨 정상적으로는 사멸해야 할 비정상 세포들이 과다 증식하여 주위 조직 및 장기에 침입하여 덩어리를 형성하고 기존의 구조를 파괴하거나 변형시키는 상태를 의미하며, 악성 종양과 동일한 의미로 사용된다. 또한, 암의 "예방 또는 치료"는 암의 성장을 억제하거나 예방한다는 것을 의미하고, 이는 치료하거나 처리하지 않았을 때와 비교시에 암의 성장 및 암전이를 감소시키고, 항암제에 대한 내성을 줄여 치료 효과가 더 발휘되도록 하는 것도 포함하는 개념이다. 상기 암전이(metastasis)는 종양(암) 세포가 신체의 멀리 떨어진 부분으로 확산되는 과정을 의미하고, 항암제에 대한 내성" 또는 "항암제 내성"이란 항암제를 이용하여 암 환자를 치료할 때, 치료 초기부터 치료 효과가 없거나 초기에는 암 치료 효과가 있으나 계속적인 치료 과정에서 암 치료 효과가 상실되는 것을 의미한다.
본 발명에 따른 상기 암 예방 또는 치료용 조성물에 포함되는 Anks1a 단백질 발현 억제제는 Anks1a 유전자의 mRNA에 상보적으로 결합하는 안티센스 뉴클레오티드, 작은 간섭 RNA(short interfering RNA, siRNA) 및 짧은 헤어핀 RNA(short hairpin RNA, shRNA)로 이루어진 군에서 선택된 어느 하나 이상일 수 있으나, 이에 제한되지 않는다.
본 발명에서 용어, "안티센스 뉴클레오티드"는 특정 mRNA의 서열에 상보적인 핵산 서열을 함유하고 있는 DNA 또는 RNA 또는 이들의 유도체로서, mRNA 내의 상보적인 서열에 결합하여 mRNA의 단백질로의 번역을 저해하는 작용을 하고, '안티센스 올리고뉴클레오티드'로 표현될 수도 있다. 안티센스 뉴클레오티드 서열은 Anks1a mRNA에 상보적이고 Anks1a mRNA에 결합할 수 있는 DNA 또는 RNA 서열을 의미하고, Anks1a mRNA의 번역, 세포질 내로의 전위(translocation), 성숙(maturation) 또는 다른 모든 전체적인 생물학적 기능에 대한 필수적인 활성을 저해할 수 있다. 안티센스 뉴클레오티드의 길이는 6 내지 100 염기, 바람직하게는 8 내지 60 염기, 보다 바람직하게는 10 내지 40 염기일 수 있다.
상기 안티센스 뉴클레오티드는 효능을 증진시키기 위하여 하나 이상의 염기, 당 또는 골격(backbone)의 위치에서 변형될 수 있다. 상기 뉴클레오티드 골격은 포스포로티오에이트, 포스포트리에스테르, 메틸 포스포네이트, 단쇄 알킬, 시클로알킬, 단쇄 헤테로아토믹, 헤테로시클릭 당간 결합 등으로 변형될 수 있다. 또한, 안티센스 뉴클레오티드는 하나 이상의 치환된 당 모이어티(sugar moiety)를 포함할 수 있다. 안티센스 뉴클레오티드는 변형된 염기를 포함할 수 있다. 변형된 염기에는 하이포크잔틴, 6-메틸아데닌, 5-메틸 피리미딘(특히, 5-메틸시토신), 5-하이드록시메틸시토신(HMC), 글리코실 HMC, 젠토비오실 HMC, 2-아미노아데닌, 2-티오우라실, 2-티오티민, 5-브로모우라실, 5-하이드록시메틸우라실, 8-아자구아닌, 7-데아자구아닌, N6 (6-아미노헥실)아데닌, 2,6-다이아미노퓨린 등이 있다. 또한 본 발명의 안티센스 뉴클레오티드는 상기 안티센스 뉴클레오티드의 활성 및 세포 흡착성을 향상시키는 하나 이상의 모이어티(moiety) 또는 컨쥬게이트(conjugate)와 화학적으로 결합될 수 있다. 콜레스테롤 모이어티, 콜레스테릴 모이어티, 콜릭산, 티오에테르, 티오콜레스테롤, 지방성 사슬, 인지질, 폴리아민, 폴리에틸렌 글리콜 사슬, 아다맨탄 아세트산, 팔미틸 모이어티, 옥타데실아민, 헥실아미노-카르보닐-옥시콜에스테롤 모이어티 등의 지용성 모이어티 등이 있고 이에 제한되지는 않는다. 지용성 모이어티를 포함하는 뉴뉴클레오티드의 제조방법은 본 발명의 기술 분야에서 이미 잘 알려져 있다(미국특허 제5,138,045호, 제5,218,105호 및 제5,459,255호). 상기 변형된 뉴클레오티드는 뉴클레아제에 대한 안정성을 증가시키고 안티센스 뉴클레오티드와 표적 mRNA와의 결합 친화력을 증가시킬 수 있다.
상기 안티센스 뉴클레오티드는 통상의 방법으로 시험관 내에서 합성되어 생체 내로 투여하거나 생체 내에서 안티센스 뉴클레오티드가 합성되도록 할 수 있다. 시험관 내에서 안티센스 뉴클레오티드를 합성하는 한가지 예는 RNA 중합효소 I를 이용하는 것이다. 생체 내에서 안티센스 RNA가 합성되도록 하는 한 가지 예는 다중클로닝부위(MCS)의 기원이 반대 방향에 있는 벡터를 사용하여 안티센스 RNA가 전사되도록 하는 것이다. 상기 안티센스 RNA는 서열 내에 번역 중지 코돈이 존재하도록 하여 펩타이드 서열로 번역되지 않도록 하는 것이 바람직하다. 본 발명에서 이용될 수 있는 안티센스 뉴클레오티드의 디자인은 Anks1a 유전자의 염기 서열을 참조하여 당업계에 공지된 방법에 따라 쉽게 제작할 수 있다.
본 발명에서 용어, "작은 간섭 RNA", "siRNA"는 RNA 방해 또는 유전자 사일런싱(silencing)을 매개할 수 있는 핵산 분자로서, 표적 유전자의 발현을 억제할 수 있기 때문에 효율적인 유전자 녹다운(knockdown) 방법 또는 유전자치료 방법으로 사용된다. 본 발명에서 siRNA 분자가 이용되는 경우, 센스 가닥(Anks1a mRNA 서열에 상응하는 서열)과 안티센스 가닥(Anks1a mRNA 서열에 상보적인 서열)이 서로 반대쪽에 위치하여 이중쇄를 이루는 구조 또는 자기-상보성(self-complementary) 센스 및 안티센스 가닥을 가지는 단일쇄 구조를 가질 수 있다. siRNA는 RNA끼리 짝을 이루는 이중사슬 RNA 부분이 완전히 쌍을 이루는 것에 한정되지 않고 불일치(mismatch)(대응하는 염기가 상보적이지 않음), 팽창/돌출(bulge)(일방의 사슬에 대응하는 염기가 없음) 등에 의하여 쌍을 이루지 않는 부분이 포함될 수 있다. siRNA 말단 구조는 Anks1a 유전자의 발현을 RNA 간섭(RNA interference, RNAi) 효과에 의하여 억제할 수 있는 것이면 평활(blunt) 말단 혹은 점착(cohesive) 말단 모두 가능하다. 점착 말단 구조는 3'-말단 돌출 구조와 5'- 말단 돌출 구조 모두 가능하다.
또한, 본 발명의 siRNA 분자는 자기-상보성(self-complementary) 센스 및 안티센스 가닥 사이에 짧은 뉴클레오티드 서열이 삽입된 형태를 가질 수 있으며, 이 경우 뉴클레오타이드 서열의 발현에 의해 형성된 siRNA 분자는 분자내 혼성화에 의하여 헤어핀 구조를 형성하게 되며, 전체적으로는 스템-앤드-루프 구조를 형성하게 된다. 이 스템-앤드-루프 구조는 인 비트로 또는 인 비보에서 프로세싱되어 RNAi를 매개할 수 있는 활성의 siRNA 분자를 생성한다.
siRNA를 제조하는 방법은 시험관에서 siRNA를 직접 합성한 뒤, 형질전환 과정을 거쳐 세포 안으로 도입시키는 방법과 siRNA가 세포 안에서 발현되도록 제조된 siRNA 발현 벡터 또는 PCR-유래의 siRNA 발현 카세트 등을 세포 안으로 형질전환 또는 감염(infection)시키는 방법이 있다.
상기 유전자 특이적인 siRNA를 포함하는 본 발명의 조성물은 siRNA의 세포내 유입을 촉진시키는 제제를 포함할 수 있다. siRNA의 세포내 유입을 촉진시키는 제제에는 일반적으로 핵산 유입을 촉진하는 제제를 사용할 수 있으며, 이러한 예로는, 리포좀을 이용하거나 콜레스테롤, 콜레이트 및 데옥시콜산을 비롯한 다수의 스테롤류 중 1종의 친유성 담체와 함께 배합할 수 있다. 또한 폴리-L-라이신(poly-L-lysine), 스퍼민(spermine), 폴리실아잔(polysilazane), 폴리에틸레민(PEI:polyethylenimine), 폴리디하이드로이미다졸늄(polydihydroimidazolenium), 폴리알리라민(polyallylamine), 키토산(chitosan) 등의 양이온성 고분자(cationic polymer)를 이용할 수도 있고, 숙실화된 PLL(succinylated PLL), 숙실화된 PEI(succinylated PEI), 폴리글루타믹산(polyglutamic acid), 폴리아스파틱산(polyaspartic acid), 폴리아크릴산(polyacrylic acid), 폴리메타아크릴산(polymethacylic acid), 덱스트란 설페이트(dextran sulfate), 헤파린(heparin), 히아루릭산(hyaluronic acid) 등의 음이온성 고분자(anionic polymer)를 이용할 수 있다.
본 발명에서 용어, "짧은 헤어핀 RNA", "shRNA"는 siRNA의 염기서열을 갖는 두 개의 상보적 부분이 염기쌍을 형성하고 단일쇄의 머리핀(hairpin) 영역에 의해서 공유결합된 단일 분자로서, 단일 사슬로 약 50-70 뉴클레오티드 길이이며, 생체 내에서 스템 루프 구조를 이루고 있다. 5-10 뉴클레오티드의 루프 부위 양쪽으로 상보적으로 19-29 뉴클레오티드의 긴 RNA가 염기쌍을 이루어 이중가닥의 스템을 형성한다. shRNA는 일반적으로 생체 내에서 Pol Ⅲ 프로모터부터 상보적인 염기 서열의 전사에 의해 합성된다. Pol-Ⅲ로 유도된 전사는 익히 알려진 시작점에서 시작되어 4개 이상의 티미딘(thymidine)으로 이루고 있는 선상(-TTTT-)의 두 번째 잔기에서 종결되어 non-poly(A) transcript 생성한다. Pol Ⅲ 프로모터는 모든 세포에서 활성되며 shRNA의 발현이 가능하다. 전사 후 shRNA는 다이서에 의해 루프가 절단되고 siRNA처럼 작용하게 된다 [Tuschl, T. (2002), Cell 110(5): 56374]. 보다 바람직하게는, 본 발명에 따른 암 예방 또는 치료용 조성물의 Anks1a 유전자의 짧은 헤어핀 RNA(Short hairpin RNA)는 서열번호 1 또는 서열번호 2에 기재되는 염기 서열을 가질 수 있다.
본 발명에 따른 암 예방 또는 치료용 조성물에 포함되는 Anks1a 단백질 활성 억제제는 Anks1a 단백질에 상보적으로 결합하는 화합물, 펩티드, 펩티드 미메틱스, 앱타머 및 항체로 구성된 군으로부터 선택된 어느 하나 이상일 수 있으나, 이에 제한되지 않는다.
본 발명의 용어, "펩티드 미메틱스"는 Anks1a 단백질의 결합 도메인을 억제하는 펩티드 또는 비펩티드로서 Anks1a 단백질의 활성을 억제하는 것이다. 비가수분해성 펩티드 유사체의 주요 잔기로는 β-턴 디펩티드 코어(Nagai et al. Tetrahedron Lett 26:647, 1985), 케토-메틸렌 슈도펩티드류(Ewenson et al. J Med Chem 29:295, 1986; 및 Ewenson et al. in Peptides: Structure and Function(Proceedings of the 9th American Peptide Symposium) Pierce Chemical Co. Rockland, IL, 1985), 아제핀(Huffman et al. in Peptides: Chemistry and Biology, G.R. Marshall ed., ESCOM Publisher: Leiden, Netherlands, 1988), 벤조디아제핀 (Freidinger et al. in Peptides; Chemistry and Biology, G.R. Marshall ed., ESCOM Publisher: Leiden, Netherlands, 1988), β-아미노알콜(Gordon et al. Biochem Biophys Res Commun 126:419 1985) 및 치환 감마락 탐환(Garvey et al. in Peptides: Chemistry and Biology, G.R. Marshell ed., ESCOM Publisher: Leiden, Netherlands, 1988)을 사용하여 생성할 수 있다.
본 발명에서 용어, "앱타머(aptamer)"는 소정의 표적 분자에 대한 결합 활성을 갖는 핵산 분자를 말한다. 상기 앱타머는 Anks1a 폴리뉴클레오티드 또는 단백질에 대하여 결합함으로써, 상기 폴리뉴클레오티드 또는 단백질의 활성을 저해할 수 있다. 본 발명의 앱타머는 RNA, DNA, 수식(modified) 핵산 또는 이들의 혼합물일 수 있으며, 직쇄상 또는 환상의 형태일 수 있다. 본 발명의 앱타머의 길이는 특별히 한정되지 않고 통상 15 내지 200 뉴클레오티드일 수 있지만, 예컨대 100 뉴클레오티드 이하이고, 바람직하게는 80 뉴클레오티드 이하이며, 보다 바람직하게는 60 뉴클레오티드 이하이고, 보다 더 바람직하게는 45 뉴클레오티드 이하일 수 있다. 본 발명의 앱타머의 길이는 또한, 예컨대 18, 20 또는 25 뉴클레오티드 이상일 수 있다. 총 뉴클레오티드수가 적으면 화학합성 및 대량 생산이 보다 용이하고, 비용면에서의 장점도 크다. 또한 화학수식도 용이하고, 생체내 안정성도 높으며, 독성도 낮다.
본 발명의 앱타머는, SELEX법 및 그 개량법을 이용함으로써 제작할 수 있다. SELEX(Systematic Evolution of Ligands by EXponential enrichment)법이란, 10 내지 14개 정도의 상이한 뉴클레오티드 서열을 갖는 올리고뉴클레오티드의 풀로부터, 표적 물질에 특이적으로 결합하는 올리고뉴클레오티드를 선별해오는 방법이다. 사용되는 올리고뉴클레오티드는 40잔기 정도의 랜덤 서열을 프라이머 서열로 끼운 구조를 하고 있다. 이 올리고뉴클레오티드 풀을 표적 물질과 회합시켜, 필터 등을 이용하여 표적 물질에 결합한 올리고뉴클레오티드만 회수한다. 회수한 올리고뉴클레오티드는 RT-PCR로 증폭하고, 이것을 다음 라운드의 주형으로서 이용한다. 이 작업을 10회 정도 반복함으로써, 표적 물질과 특이적으로 결합하는 앱타머를 취득할 수 있다. SELEX법으로는 라운드수를 늘리거나 경합 물질을 사용함으로써, 표적 물질에 대하여 보다 결합력이 강한 앱타머가 농축되고, 선별될 수 있다. 따라서, SELEX의 라운드수를 조절하거나 경합 상태를 변화시킴으로써, 결합력이 상이한 앱타머, 결합 형태가 상이한 앱타머, 결합력이나 결합 형태는 동일하지만 염기 서열이 상이한 앱타머를 얻을 수 있다. 또한, SELEX법에는 PCR에 의한 증폭 과정이 포함되지만, 그 과정에서 망간 이온을 사용하는 등으로 변이를 부여함으로써, 보다 다양성이 풍부한 SELEX를 행하는 것이 가능해진다. 또한, 앱타머는 종래 SELEX 기법 이외에 복합 타겟, 즉 살아있는 세포 및 조직에 대해 Cell-SELEX 기법을 이용하여 얻을 수 있는데 Cell-SELEX 기법은 표면 마커 타겟이 알려져 있지 않을 때조차도, 질환 세포에 대한 앱타머를 개발할 수 있게 하는 장점이 있다. 게다가, 분리된 상태에서는 그 본래의 특성을 나타내지 않을 수도 있어, 생리적 상태에 있는 타겟 단백질은 선별과정에서 더 기능적인 접근을 가능하게 하기 때문에, Cell-SELEX기법은 종래의 SELEX 과정에 비하여 장점을 가지고 있다.
한편, 앱타머는 인산기의 마이너스 전하를 이용한 이온결합, 리보오스를 이용한 소수성 결합 및 수소결합, 핵산염기를 이용한 수소결합이나 스태킹(stacking)결합 등 다양한 결합 양식에 의해 표적 물질과 결합한다. 특히, 구성 뉴클레오티드의 수만큼 존재하는 인산기의 마이너스 전하를 이용한 이온결합은 강하게, 단백질의 표면에 존재하는 리신이나 아르기닌의 플러스 전하와 결합한다. 이 때문에, 표적 물질과의 직접적인 결합에 관련되어 있지 않은 핵산염기는 치환할 수 있다. 특히, 스템 구조의 부분은 이미 염기쌍이 만들어져 있고, 또한 이중 나선 구조의 내측을 향하고 있기 때문에, 핵산 염기는, 표적 물질과 직접 결합하기 어렵다. 따라서, 염기쌍을 다른 염기쌍으로 치환하여도 앱타머의 활성은 감소하지 않는 경우가 많다. 루프 구조 등 염기쌍을 만들지 않은 구조에서도, 핵산 염기가 표적 분자와의 직접적인 결합에 관여하지 않는 경우에, 염기의 치환이 가능하다. 예컨대, 리보스의 2' 위치에 있어서, 히드록실기가 임의의 원자 또는 기로 치환되어 있는 뉴클레오티드일 수 있다. 이러한 임의의 원자 또는 기로서는, 예컨대, 수소 원자, 불소 원자 또는 -O-알킬기 (예:-O-CH3), -O-아실기(예, -O-CHO), 아미노기(예, -NH2)로 치환되어 있는 뉴클레오티드를 들 수 있다. 이와 같이 앱타머는, 표적 분자와의 직접적인 결합에 관련되어 있는 관능기를 치환 또는 삭제하지 않는 한, 그 활성을 유지한다. 또한, 앱타머는 화학 합성이 가능하기 때문에 개질이 용이하다. 앱타머는 MFOLD 프로그램을 이용하여 2차 구조를 예측하거나, X선 해석이나 NMR 해석에 의해 입체 구조를 예측함으로써, 어떤 뉴클레오티드를 치환 또는 결손하는 것이 가능한지, 또한 어디에 새로운 뉴클레오티드를 삽입 가능한지 어느 정도 예측할 수 있다. 예측된 새로운 서열의 앱타머는 용이하게 화학 합성할 수 있고, 그 앱타머가 활성을 유지하고 있는지의 여부를 기존의 분석계에 의해 확인할 수 있다.
본 발명에서 용어, "항체"는 면역계 내에서 항원의 자극에 의하여 만들어져 특정 항원과 특이적으로 결합하여 항원-항체반응을 일으키는 물질로서, 본 발명에서는 Anks1a 단백질의 활성을 억제하기 위해서 Anks1a 단백질에 특이적으로 결합하는 항체를 사용할 수 있다. 특히, Anks1a 단백질에서 ANK 도메인에 작용하여 EphA2와의 결합을 억제하거나, EphA2의 세포 표면으로의 이동을 억제하는 항체를 사용할 수 있다. 본 발명에서 이용될 수 있는 Anks1a 단백질에 특이적인 항체는 폴리클로날 또는 모노클로날 항체일 수 있으며, 바람직하게는 모노클로날 항체일 수 있다. Anks1a 단백질에 특이적인 항체는 당업계에서 통상적으로 실시되는 방법, 예를 들어, 융합 방법(Kohler 및 Milstein, European Journal of Immunology, 6:511-519(1976)), 재조합 DNA 방법(미국 특허 제4,816,567호) 또는 파아지 항체 라이브러리 방법(Clackson et al, Nature, 352:624-628(1991) 및 Marks et al, J. Mol. Biol., 222:58, 1-597(1991))에 의해 제조될 수 있다. 항체 제조에 대한 일반적인 과정은 당업계에 공지된 방법을 사용할 수 있으며, 예를 들어, 단일클론 항체를 생산하는 하이브리도마 세포의 제조는 불사멸화 세포주를 항체-생산 림프구와 융합시켜 이루어지며, 이 과정에 필요한 기술은 당업자에게 잘 알려져 있고 용이하게 실시할 수 있다. 폴리클로날 항체는 Anks1a 단백질 항원을 적합한 동물에게 주사하고, 이 동물로부터 항혈청을 수집한 다음, 공지의 친화성(affinity) 기술을 이용하여 항혈청으로부터 항체를 분리하여 얻을 수 있다.
본 발명에서 항체는 단일사슬 가변영역 단편(scFv)을 포함할 수 있다. 상기 단일사슬 가변영역 단편은 "경사슬의 가변성 부위(VL)-링커-중사슬의 가변성 부위(VH)"로 구성될 수 있다. 상기 링커는 중사슬 및 경사슬의 가변성 부위를 인위적으로 연결하는 작용을 하는 일정 길이의 아미노산 서열을 의미한다.
본 발명에 따른 암 예방 또는 치료용 조성물은 간암, 거대세포종, 결장암, 결핵암, 골육종, 난소암, 뇌종양, 대장암, 방광암, 신장암, 위암, 유방암, 자궁경부암, 자궁암, 전립선암, 췌장암, 표피암 및 폐암으로 구성된 군으로부터 선택되는 어느 하나인 암에 적용될 수 있으나 이에 제한되지 않으며, 바람직하게는 유방암일 수 있다.
본 발명에 따른 암 예방 또는 치료용 조성물은 상술한 Anks1a 단백질의 발현 또는 활성 억제제에 추가로 동일 또는 유사한 기능을 나타내는 유효성분을 1종 이상을 함유할 수 있다.
상기 조성물은 임상 투여 시에 경구 또는 비경구로 투여가 가능하며 비경구 투여시 복강내주사, 직장내주사, 피하주사, 정맥주사, 근육내주사, 자궁내 경막주사, 뇌혈관내 주사 또는 흉부내 주사에 의해 투여될 수 있고, 일반적인 의약품 제제의 형태로 사용될 수 있다. 상기 조성물은 단독으로, 또는 수술, 방사선 치료, 호르몬 치료, 화학 치료 및 생물학적 반응 조절제를 사용하는 방법들과 병용하여 사용할 수 있다. 상기 조성물의 일일 투여량은 약 0.0001 내지 100 ㎎/㎏이고, 바람직하게는 0.001 내지 10 ㎎/㎏이며, 하루 1회 내지 수회 나누어 투여하는 것이 바람직하나 환자의 체중, 연령, 성별, 건강상태, 식이, 투여시간, 투여방법, 배설율 및 질환의 중증도 등에 따라 그 범위가 다양하다.
본 발명의 조성물은 실제 임상 투여 시에 비경구의 여러 가지 제형으로 투여될 수 있는데, 제제화할 경우에는 보통 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제된다. 비경구 투여를 위한 제제에는 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조제제, 좌제가 포함된다. 비수성용제, 현탁용제로는 프로필렌글리콜(Propylene glycol), 폴리에틸렌 글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다. 좌제의 기제로는 위텝솔(witepsol), 마크로골, 트윈(tween) 61, 카카오지, 라우린지, 글리세로제라틴 등이 사용될 수 있다
본 발명은, (a) 대상세포에 후보물질을 처리하는 단계; (b) 상기 대상세포에서 Anks1a 단백질의 발현 또는 활성을 측정하는 단계; 및 (c) 상기 측정 결과, 상기 후보물질 중에서 Anks1a 단백질의 발현 또는 활성을 감소시키는 후보물질을 선택하는 단계를 포함하는 암의 예방 또는 치료용 물질의 스크리닝 방법을 제공한다. 본 발명의 "Anks1a 유전자의 발현 억제제" 또는 "Anks1a 단백질의 활성 억제제"는 상기 스크리닝 방법을 통하여 얻을 수 있다.
본 발명에서 용어, "후보물질"은 Anks1a 유전자의 발현 또는 Anks1a 단백질의 활성에 영향을 미치는지 여부를 검사하기 위하여 스크리닝에서 이용되는 미지의 물질을 의미한다. 상기 후보물질은 이에 제한되는 것은 아니나, 화학물질, 펩타이드 및 천연 추출물을 포함할 수 있다. 본 발명의 스크리닝 방법에 의해 분석되는 후보물질은 단일 화합물 또는 화합물들의 혼합물일 수 있으며, 합성 또는 천연 화합물의 라이브러리로부터 얻을 수 있다.
본 발명에 따른 암의 예방 또는 치료용 물질의 스크리닝 방법에서 Anks1a 단백질의 발현 또는 활성을 측정하는 단계는, Anks1a 유전자 발현양, Anks1a 단백질 양, Anks1a 단백질의 작용을 받은 다른 단백질, Anks1a 단백질과 다른 단백질과의 상호작용, Anks1a 단백질과 다른 단백질과의 복합체, 및 Anks1a 단백질의 작용을 받은 다른 단백질의 복합체 중에서 선택된 어느 하나 이상을 검출 또는 측정할 수 있으나, 이에 제한되지 않는다. 상기 Anks1a 단백질과 상호작용하거나 복합체를 형성하는 다른 단백질은 EphA2, ErbB2 또는 이들의 복합체일 수 있다. 일례로, Anks1a의 mRNA 발현양을 측정하거나, (보다 바람직하게는 ANK 지역 유전자의 발현), Anks1a 단백질의 양을 정량하거나, 후보물질 처리 전후의 세포 표면의 EphA2 단백질의 양을 정량하거나, 후보물질 처리 전후 세포 내부 및 표면 EphA2 단백질의 변화 양상을 정량하거나, ErbB/EphA2 복합체의 양을 정량하는 방법일 수 있다.
본 발명에 따른 암의 예방 또는 치료용 물질의 스크리닝 방법에서 상기 Anks1a 단백질의 발현 또는 활성의 측정은 당해 분야에서 통상적으로 사용되는 방법을 적용할 수 있으며, 역전사 중합효소 연쇄반응(reverse transcriptase-polymerase chain reaction), 실시간 중합효소연쇄반응(real time-polymerase chain reaction), 웨스턴 블럿, 노던 블럿, ELISA(enzyme linked immunosorbent assay), 방사선면역분석(RIA: radioimmunoassay), 방사 면역 확산법(radioimmunodiffusion) 및 면역침전분석법(immunoprecipitation assay)으로 이루어진 군 중에서 선택될 수 있으나, 이에 제한되지 않는다.
본 발명에서 상기 (b) 단계는 상기 측정 결과, 상기 후보물질 중에서 Anks1a 단백질의 발현 또는 활성을 감소시키는 후보물질을 선택하는 단계로서, 상기 후보물질에 의하여 Anks1a 유전자의 발현 또는 Anks1a 단백질의 활성이 하향 조절(downregulation) 되는 것을 측정하여 암의 예방 또는 치료용 물질로 판정할 수 있다.
본 발명의 스크리닝 방법은 다양한 방식으로 실시할 수 있으며, 특히 당업계에 공지된 다양한 결합 분석(binding assay)에 따라 고성능(high throughput) 방식으로 실시할 수 있다. 본 발명의 스크리닝 방법에 있어서, 후보물질 또는 Anks1a 단백질은 검출가능한 표지(detectable label)로 표지될 수 있다. 예를 들어, 상기 검출가능한 표지는, 화학적 표지(예컨대, 바이오틴), 효소 표지(예컨대, 호스래디쉬 퍼옥시다아제, 알칼라인 포스파타아제, 퍼옥시다아제, 루시퍼라아제, β-갈락토시다아제 및 β-글루코시다아제), 방사능 표지(예컨대, C14, I125, P32 및 S35), 형광 표지(예컨대, 쿠마린, 플루오레세인, FITC(fluoresein Isothiocyanate), 로다민(rhodamine) 6G, 로다민 B, TAMRA(6-carboxy-tetramethylrhodamine), Cy-3, Cy-5, Texas Red, Alexa Fluor, DAPI(4,6-diamidino-2-phenylindole), HEX, TET, Dabsyl 및 FAM), 발광 표지, 화학발광(chemiluminescent) 표지, FRET(fluorescence resonance energy transfer) 표지 또는 금속 표지(예컨대, 금 및 은)이다. 검출가능한 표지가 표지된 Anks1a 단백질 또는 후보물질을 이용하는 경우, Anks1a 단백질과 후보물질 사이의 결합 발생 여부는 표지로부터 나오는 신호를 검출하여 분석할 수 있다. 예를 들어, 표지로서 알칼린 포스파타아제가 이용되는 경우에는, 브로모클로로인돌일 포스페이트(BCIP), 니트로 블루 테트라졸리움(NBT), 나프톨-AS-B1-포스페이트(naphthol-AS-B1-phosphate) 및 ECF(enhanced chemifluorescence)와 같은 발색반응 기질을 이용하여 시그널을 검출한다. 표지로서 호스 래디쉬 퍼옥시다아제가 이용되는 경우에는 클로로나프톨, 아미노에틸카바졸, 디아미노벤지딘, D-루시페린, 루시게닌(비스-N-메틸아크리디늄 니트레이트), 레소루핀 벤질 에테르, 루미놀, 암플렉스 레드 시약(10-아세틸-3,7-디하이드록시페녹사진), HYR(p-phenylenediamine-HCl 및 pyrocatechol), TMB(tetramethylbenzidine), ABTS(2,2-Azine-di[3-ethylbenzthiazoline sulfonate]), o-페닐렌디아민(OPD) 및 나프톨/파이로닌과 같은 기질을 이용하여 시그널을 검출한다. 택일적으로, 후보물질의 Anks1a 단백질로의 결합 여부는 상호작용물(interactants)의 표지 없이 분석할 수도 있다. 예를 들어, 마이크로피지오미터(microphysiometer)를 이용하여 후보물질이 Anks1a 단백질에 결합하는지 여부를 분석할 수 있다. 마이크로피지오미터는 LAPS(light-addressable potentiometric sensor)를 이용하여 세포가 그의 환경을 산성화하는 속도를 측정하는 분석 도구이다. 산성화 속도의 변화는, 후보물질과 Anks1a 단백질 사이의 결합에 대한 지시자로 이용될 수 있다(McConnell et al., Science 257:19061912(1992)).
후보물질의 Anks1a 단백질과의 결합 능력은 실시간 이분자 상호작용 분석(BIA)를 이용하여 분석할 수 있다(Szabo et al., Curr. Opin. Struct. Biol. 5:699-705(1995)). BIA는 실시간으로 특이적 상호작용을 분석하는 기술로서, 상호작용물(interactants)의 표지 없이 실시할 수 있다(예컨대, BIAcore™). 표면 플라즈몬 공명(SPR)에서의 변화는 분자들 사이의 실시간 반응에 대한 지시자(indicator)로 이용될 수 있다.
본 발명은 또한 Anks1a 단백질 또는 이를 인코딩하는 유전자의 암 진단용 바이오마커로서의 용도를 제공한다. 구체적으로, Anks1a 단백질 또는 이를 인코딩하는 유전자 발현 또는 활성의 증가를 포함하는 암 진단용 바이오마커이다.
또한, 본 발명은 Anks1a 단백질 활성 억제제를 포함하는 암 진단용 제제 또는 키트를 제공한다.
또한, 본 발명은 Anks1a 단백질 또는 이를 인코딩하는 유전자의 발현 또는 활성을 측정하거나 상기 암 진단용 제제 또는 키트를 이용하는 암 진단 방법을 제공한다. 구체적으로, 상기 진단 방법은 개체로부터 분리된 시료의 Anks1a 단백질의 발현 또는 활성을 측정하거나, 개체로부터 분리된 시료에 Anks1a 단백질 활성 억제제를 포함하는 암 진단용 제제 또는 키트를 반응시키는 것을 포함한다.
상기 개체로부터 분리된 시료는 혈액, 소변, 타액, 혈장 등을 포함할 수 있다.
이하에서는 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 다만, 이들 실시예는 오로지 본 발명을 예시하기 위한 것으로서, 본 발명의 범위가 이들 실시예에 의해 제한되는 것으로 해석되지는 않는다 할 것이다.
1. 실험 방법
(1) 세포 배양
CT26 세포주를 10% FBS가 포함된 Dulbecco's modified MEM medium (DMEM)에서 키웠다. Primary tumor cell (PMTC)은 Anks1a+/- MMTV-Neu 쥐로부터 배양하였다. 먼저, 암 조직을 쥐로부터 분리하고 PBS로 세척 후, 칼로 잘게 다져주었다. 잘게 다져진 암 조직을 50㎖ 튜브에 넣어 콜라게네이즈 용액(0.2% 트립신, 0.2% 콜라게네이즈 A, 5% FBS, 및 5㎍/㎖ 젠타마이신, DMEM/F12 배지에 희석)에 담가 2시간 동안 37℃ 에 두었다. 그리고 10분간 1,500 rpm으로 원심분리하여 상층액을 버리고 펠릿을 2U/㎖의 DNase가 포함된 DMEM/F12 4㎖로 잘 섞어 5분간 상온에서 천천히 흔들어 주었다. 그 뒤, DMEM/F12를 6㎖ 더 넣어주고 10분간 1,500 rpm으로 원심분리하여 상층액을 제거해 주는 과정을 5번 반복하였다. 마지막에 상층액을 제거하고 펠릿에 성장배지(1000×ITS, 5㎍/㎖ 표피성장인자(EGF), 5% 우태아혈청(FBS), 500㎍/㎖ 젠타마이신, 10% 항생제, DMEM/F12 배지에 희석)을 넣어 섞어준 뒤 플레이트에 깔아 배양하였다.
콜로니 형성 분석를 위하여 배양한 CT26 또는 PMTC을 렌티바이러스가 들어있는 미디어를 넣어 3일간 두었다. 그리고 분석하기 전, 1.5% 아가로스에 5% 우태아혈청이 포함된 2X DMEM을 1:1로 섞어 24well 플레이트에 깔아 굳혀두었다. 이를 베이스 아가로스라 하며 이것이 완전히 굳은 뒤, 렌티바이러스에 감염된 세포들을 플레이트로부터 분리하여 무혈청 DMEM으로 섞어 원심분리 하였다. 상층액을 제거하고 세포들을 5% FBS가 포함된 2X DMEM과 1% 아가로스를 1:1로 섞은 탑 아가로스(top agarose)로 섞어 굳은 베이스 아가로스 위에 깔아 주었다. 이를 3주간 인큐베이터 안에서 배양한 후 현미경으로 사진을 찍어 Image J 를 이용하여 각 콜로니의 크기를 측정하였다.
(2) 형광 염색
렌티바이러스를 감염시킨 CT26 또는 PMTC를 커버 슬립 위에서 배양한다. 2㎍/㎖의 ephrinA5-Fc에 항-인간 IgG를 1:1로 섞어 1시간 동안 얼음에서 pre-clustering한 후, 무혈청 DMEM에 섞어 세포에 넣어주었다. 4℃에서 1시간 동안 놓은 후, 세포를 인산완충식염수(PBS)로 세 번 세척하였다. 그리고 4% 파라포름알데히드, 2% 수크로스, 3% 소혈청알부민(BSA)이 들어있는 고정 용액을 넣어 30분간 얼음 위에서 세포를 고정하였다. 또 다시 PBS로 세 번 세척한 후, 5% 말혈청, 0.1% 트리톤 X-100, 3% BSA를 넣고 30분간 상온에서 blocking하였다. 그리고 FITC 또는 TRITC가 달린 염소 항-인간 IgG를 3% BSA 용액에 넣고 2시간 동안 상온에서 염색하였다. 이를 형광 현미경으로 사진을 찍고 형광의 세기를 Image J를 이용하여 정량하였다.
세포 표면의 ErbB2염색은 커버 슬립 위에서 배양한 세포를 고정하여 blocking 과정을 거친 뒤, 3% BSA 용액에 항-ErbB2 항체를 넣어 4℃ 냉장고에 하룻밤 두었다. 그리고 다음날, PBS로 세척하여 다시 한번 blocking하고 TRITC가 달린 토끼 항-생쥐 IgG를 넣어 염색하였다. 이를 형광 현미경으로 사진을 찍고 형광의 세기를 Image J를 이용하여 정량하였다.
(3) 생체외 budding assay
HEK293T 세포를 100mm 플레이트에 키운 뒤, 각 유전자를 형질주입하여 발현시킨다. 48시간 뒤, 세포를 PBS 세척하고, 트립신으로 처리하여 플레이트로부터 떨어뜨린다. 그리고 B88-0 (20mM HEPES (pH7.2), 250mM 소르비톨, 150mM KOAc) 버퍼를 10㎖ 넣고, 여기에 대두 트립신 억제제를 10㎍/㎖ 을 섞어 원심분리하였다. 그 후, 상층액을 제거하고 B88-0 버퍼 10㎖에 40㎍/㎖ 디지토닌을 넣고 5분간 얼음에 두었다가 원심분리하여 세포를 모았다. 이렇게 얻어진 세포는 donor membrane으로 vesicle을 만드는데 사용하였다. Donor membrane에 mouse liver cytosol, ATP regenerating system (40nM 크레아틴 인산, 0.2mg/ml 크레아틴 포스포카이네이즈, 1mM ATP), 0.2mM GTP를 넣어 30℃에서 1시간 동안 반응시켰다. 그리고 15,000rpm에서 15분간 원심분리하여 donor membrane을 제거하고 상층액을 다시 32,000rpm에서 114분간 원심분리하여 vesicle을 분리하였다. 이를 가용화 버퍼 (10 mM Tris-HCl (pH7.6), 100 mM 염화나트륨, 및 1% 트리톤 X-100(포스파타아제 억제제 함유)) 로 녹여 SDS-PAGE 젤에 걸어 immunoblotting 하였다.
2. 실험 결과
(1) Anks1a 발현 및 EphA2의 관계
쥐의 대장암으로부터 얻은 세포주인 CT26를 이용하여, Anks1a의 발현과 EphA2의 관계를 규명하였다. 상기 세포에 Anks1a의 양을 shRNA를 이용하여 감소시켰고 이를 Western blotting을 통해 확인하였다 (도 1A). 이때 상기 shRNA-17의 서열은 서열번호 1에 기재된 염기서열로서 [(CCGGCGTCCCTTTCAAGATTGGTTTCTCGAGAAACCAATCTTGAAAGGGACGTTTTTG); 3’ UTR region]이고, shRNA-21의 서열은 서열번호 2에 기재된 염기서열로서 [ (CCGGCCAGATAGTACGTCTGCTCATCTCGAGATGAGCAGACGTACTATCTGGTTTTTG); CDS region]이다.
실험 결과, Anks1a 양의 감소는 세포 내 EphA2의 양을 변화시키지 않지만 (도 1a, 두번째 줄) 세포 표면에 위치하는 EphA2의 양은 감소시키는 것을 확인하였다(도 1b).
또한, Anks1a에 특이적인 shRNA를 처리한 CT26 세포주를 Balb/c 쥐에 주사하여 암 생성 정도를 확인하였다. 실험 결과, Anks1a에 의해 세포 표면의 EphA2가 감소되었을 때, 세포의 암 형성 능력이 저해되는 것을 확인하였다 (도 1d). 이러한 암 형성 능력의 저해는 세포를 이용한 콜로니 형성 분석을 통해 다시 한 번 확인할 수 있었다 (도 1e 및 1f); 일반적으로 암세포는 극한 상황에서도 살아남아 증식을 유지한다는 성질을 이용하여 아가로스 위에서 세포가 자라 세포 군락를 형성하는지 여부에 따라 암세포의 성격을 지니는 지를 확인할 수 있다. 세포 표면의 EphA2의 감소는 Erk 활성을 감소시켜 이러한 세포의 암 형성 능력 저하를 유도하였음을 Western blotting을 통하여 확인하였다(도 1a, 세번째, 네번째 줄).
(2) Anks1a에 의한 EphA2의 세포막 발현과 암 형성
MMTV 프로모터에 의해 ErbB2 유전자가 유방에서 지속적으로 강하게 발현되도록 유도하여 8개월이 지나면 유방암이 생기는 MMTV-Neu(ErbB2) 쥐를 대상으로, Anks1a 양을 감소시켰을 때 쥐의 유방암 형성 빈도를 비교하였다.
*실험 결과, Anks1a의 발현 양이 절반 또는 완전히 감소하였을 때 쥐의 유방암 형성 능력이 이에 의존적으로 감소하는 것을 확인하였다 (도 2a). 정상적으로 유방암이 형성된 쥐의 암조직으로부터 세포를 배양하고 이 세포의 Anks1a 발현을 shRNA를 이용하여 감소시켰을 때, 암 형성 능력이 감소하였음을 콜로니 형성 분석을 통해 다시 한번 확인하였다 (도 2b 및 2c). 또한, 이러한 유방암 형성의 억제는 Anks1a가 감소되었을 때 세포 표면의 EphA2의 감소에 의한 것임을 확인하였고 이와 더불어 ErbB2의 세포 표면 발현이 감소되어 있음을 확인하였다 (도 2d 및 2e).
(3) Anks1a에 의한 EphA2 및 ErbB2의 세포 표면 이동 영향
Anks1a가 EphA2와 ErbB2의 세포 표면으로의 이동에 영향을 미친다는 것을 확인하고 세포 표면으로의 이동에 첫 단계인 소포체로부터 골지체로 이동하는 vesicle에 존재하는 EphA2, ErbB2를 확인하였다. 잘 알려져 있는 실험 방법인 budding assay를 통해 EphA2의 세포 표면으로의 이동은 Anks1a가 있을 때 효과적임을 알 수 있었다 (도 3b). 또한, 놀랍게도 ErbB2의 세포 이동은 Anks1a와 EphA2가 함께 필요하다는 것을 알 수 있었다 (도 3a).
결론적으로, ErbB2의 세포 내 발현은 EphA2가 있을 때 더욱 안정적이며 이 때 Anks1a에 의한 세포 표면으로의 이동이 증가되어 세포막에 존재하는 ErbB2/EphA2 complex의 양이 증가됨으로 세포 내부로의 신호 전달 능력이 상승되어 암 형성이 촉진된다는 것을 확인하였다.
따라서, Anks1a에 특이적인 저해제를 이용하여 Anks1a의 기능을 상쇄시키면 세포 표면의 ErbB2/EphA2 양을 감소시켜 유방암을 억제시킬 수 있을 것이고, 특히 Anks1a와 EphA2간의 상호 작용에 관여하는 ANK 지역을 타겟으로 하는 저해제를 개발한다면 암, 특히 유방암 치료제로써의 효과가 높을 것으로 예상된다.
이상으로 본 발명 내용의 특정한 부분을 상세히 기술하였는 바, 당업계의 통상의 지식을 가진 자에게 있어서, 이러한 구체적 기술은 단지 바람직한 실시 양태일 뿐이며, 이에 의해 본 발명의 범위가 제한되는 것이 아닌 점은 명백할 것이다. 따라서 본 발명의 실질적인 범위는 첨부된 청구항들과 그것들의 등가물에 의하여 정의된다고 할 것이다.

Claims (10)

  1. Anks1a 단백질 발현 또는 활성 억제제를 유효성분으로 포함하는 암 예방 또는 치료용 조성물.
  2. 제1항에 있어서,
    상기 Anks1a 단백질 발현 또는 활성 억제제는 ANK(ankyrin repeat region) 도메인에 특이적으로 작용하는 것을 특징으로 하는 암 예방 또는 치료용 조성물.
  3. 제1항에 있어서,
    상기 Anks1a 단백질 발현 억제제는 Anks1a 유전자의 mRNA에 상보적으로 결합하는 안티센스 뉴클레오티드, 작은 간섭 RNA(short interfering RNA, siRNA) 및 짧은 헤어핀 RNA(short hairpin RNA, shRNA)로 이루어진 군에서 선택된 어느 하나 이상인 것을 특징으로 하는 암 예방 또는 치료용 조성물.
  4. 제3항에 있어서,
    상기 Anks1a 유전자의 짧은 헤어핀 RNA(Short hairpin RNA)는 서열번호 1 또는 서열번호 2에 기재되는 염기 서열을 갖는 것을 특징으로 하는 암 예방 또는 치료용 조성물.
  5. 제1항에 있어서,
    상기 Anks1a 단백질 활성 억제제는 Anks1a 단백질에 상보적으로 결합하는 화합물, 펩티드, 펩티드 미메틱스, 앱타머 및 항체로 구성된 군으로부터 선택된 어느 하나 이상인 것을 특징으로 하는 암 예방 또는 치료용 조성물.
  6. 제 1항에 있어서,
    상기 암은 간암, 거대세포종, 결장암, 결핵암, 골육종, 난소암, 뇌종양, 대장암, 방광암, 신장암, 위암, 유방암, 자궁경부암, 자궁암, 전립선암, 췌장암, 표피암 및 폐암으로 구성된 군으로부터 선택되는 어느 하나인 것을 특징으로 하는 암 예방 또는 치료용 조성물.
  7. (a) 대상세포에 후보물질을 처리하는 단계;
    (b) 상기 대상세포에서 Anks1a 단백질의 발현 또는 활성을 측정하는 단계; 및
    (c) 상기 측정 결과, 상기 후보물질 중에서 Anks1a 단백질의 발현 또는 활성을 감소시키는 후보물질을 선택하는 단계를 포함하는 암의 예방 또는 치료용 물질의 스크리닝 방법.
  8. 제7항에 있어서,
    상기 Anks1a 단백질의 발현 또는 활성을 측정하는 단계는, Anks1a 유전자 발현양, Anks1a 단백질 양, Anks1a 단백질의 작용을 받은 다른 단백질, Anks1a 단백질과 다른 단백질과의 상호작용, Anks1a 단백질과 다른 단백질과의 복합체, 및 Anks1a 단백질의 작용을 받은 다른 단백질의 복합체 중에서 선택된 어느 하나 이상을 검출 또는 측정하는 것을 특징으로 하는 암의 예방 또는 치료용 물질의 스크리닝 방법.
  9. 제8항에 있어서,
    상기 다른 단백질은 EphA2, ErbB2 또는 이들의 복합체인 것을 특징으로 하는 암의 예방 또는 치료용 물질의 스크리닝 방법.
  10. 제7항에 있어서,
    상기 측정은 역전사 중합효소 연쇄반응(reverse transcriptase-polymerase chain reaction), 실시간 중합효소연쇄반응(real time-polymerase chain reaction), 웨스턴 블럿, 노던 블럿, ELISA(enzyme linked immunosorbent assay), 방사선면역분석(RIA: radioimmunoassay), 방사 면역 확산법(radioimmunodiffusion) 및 면역침전분석법(immunoprecipitation assay)으로 이루어진 군에서 선택된 어느 하나 이상의 방법을 사용하는 것을 특징으로 하는 암의 예방 또는 치료용 물질의 스크리닝 방법.
PCT/KR2016/011964 2015-10-28 2016-10-24 Anks1a 단백질 발현 또는 활성 억제제를 유효성분으로 포함하는 암 예방 또는 치료용 조성물 및 이의 스크리닝 방법 WO2017073971A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2015-0149863 2015-10-28
KR1020150149863A KR20170049024A (ko) 2015-10-28 2015-10-28 ANKs1a 단백질 발현 또는 활성 억제제를 유효성분으로 포함하는 암 예방 또는 치료용 조성물 및 이의 스크리닝 방법

Publications (1)

Publication Number Publication Date
WO2017073971A1 true WO2017073971A1 (ko) 2017-05-04

Family

ID=58630518

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2016/011964 WO2017073971A1 (ko) 2015-10-28 2016-10-24 Anks1a 단백질 발현 또는 활성 억제제를 유효성분으로 포함하는 암 예방 또는 치료용 조성물 및 이의 스크리닝 방법

Country Status (2)

Country Link
KR (1) KR20170049024A (ko)
WO (1) WO2017073971A1 (ko)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008104543A2 (en) * 2007-02-26 2008-09-04 Inserm (Institut National De La Sante Et De La Recherche Medicale) Method for predicting the occurrence of metastasis in breast cancer patients
WO2010059742A1 (en) * 2008-11-18 2010-05-27 Collabrx, Inc. Individualized cancer treatment
WO2015018805A1 (en) * 2013-08-05 2015-02-12 Immatics Biotechnologies Gmbh Novel immunotherapy against several tumors, such as lung cancer, including nsclc

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008104543A2 (en) * 2007-02-26 2008-09-04 Inserm (Institut National De La Sante Et De La Recherche Medicale) Method for predicting the occurrence of metastasis in breast cancer patients
WO2010059742A1 (en) * 2008-11-18 2010-05-27 Collabrx, Inc. Individualized cancer treatment
WO2015018805A1 (en) * 2013-08-05 2015-02-12 Immatics Biotechnologies Gmbh Novel immunotherapy against several tumors, such as lung cancer, including nsclc

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
EMADUDDIN, M. ET AL.: "Odin (ANKS1A) is a Src Family Kinase Target in Colorectal Cancer Cells", CELL COMMUNICATION AND SIGNALING, vol. 6, no. 7, 2008, pages 1 - 11, XP021044002 *
TONG, J. ET AL.: "Odin (ANKS1A) Modulates EGF Receptor Recycling and Stability", PLOS ONE, vol. 8, no. 6, 2013, pages 1 - 12, XP055379548 *

Also Published As

Publication number Publication date
KR20170049024A (ko) 2017-05-10

Similar Documents

Publication Publication Date Title
TWI816712B (zh) 癌促進因子表現抑制劑的有效成分之篩選用試藥及其篩選方法、癌之預防或治療劑的有效成分之篩選用試藥及其篩選方法、癌促進因子表現抑制劑及癌之預防或治療劑
JP6437467B2 (ja) 線維化疾患治療において有用な分子標的及び化合物、並びにこれらの同定方法
US12066429B2 (en) Method for inhibiting the expression of inflammation promoting factors
Wu et al. Somatic mutations of CADM1 in aldosterone-producing adenomas and gap junction-dependent regulation of aldosterone production
WO2010140694A1 (ja) アミロイドベータペプチドの産生を促進する因子を用いた阻害剤のスクリーニング方法及びそれによって得られる阻害剤
AU2015229033A1 (en) Asymmetric interfering RNA compositions that silence K-Ras and methods of uses thereof
Li et al. FOXO3 regulates Smad3 and Smad7 through SPON1 circular RNA to inhibit idiopathic pulmonary fibrosis
JP6852926B2 (ja) 細胞遊走調節に関する疾患の予防・治療剤および肺間質の疾患の疾患活動性判定・予後評価
JP2011032236A (ja) 腫瘍血管新生阻害剤
WO2017073971A1 (ko) Anks1a 단백질 발현 또는 활성 억제제를 유효성분으로 포함하는 암 예방 또는 치료용 조성물 및 이의 스크리닝 방법
WO2017007276A1 (ko) Nag-1 억제제를 유효성분으로 포함하는 난소암 환자의 항암제 내성 억제용 약학조성물
KR101862520B1 (ko) ANKs1a 단백질 발현 또는 활성 억제제를 유효성분으로 포함하는 암 예방 또는 치료용 조성물 및 이의 스크리닝 방법
WO2006108225A1 (en) Method of screening for compounds that modulate cell proliferation
WO2016200246A1 (ko) 담도암의 항암제 내성 진단용 신규 바이오마커 및 이의 용도
WO2012148046A1 (en) Anticancer and cancer-sensitizing composition comprising rrp12 inhibitor
WO2019103456A2 (ko) Pmvk를 유효성분으로 포함하는 방사선 저항성 암 진단용 또는 방사선 치료 예후 예측용 바이오마커 조성물
US9611475B2 (en) Prophylactic and/or therapeutic agent for inflammatory disease, and method for screening prophylactic and/or therapeutic drug for inflammatory disease
KR102401005B1 (ko) 고위험군 자궁내막증의 예방 또는 치료용 조성물
WO2015133771A1 (ko) 신규 신경교종의 바이오마커 및 그의 용도
US20110256633A1 (en) Secretory Granules and Granulogenic Factors as a Target for Cancer Treatment
US20190264292A1 (en) Use of h2a.z.1 as a hepatocellular carcinoma biomarker
Hou et al. Overexpression of lncRNA MAGI2-AS3 Retards Tumor Progression and Angiogenesis by Regulating ACY1 via Interacting with Transcription Factor HEY1
WO2012011778A2 (ko) 암 진단 키트 및 암 예방 또는 치료용 약제학적 조성물
WO2016194993A1 (ja) 癌型ｓｌｃｏ１ｂ３を標的とする核酸医薬
WO2015119362A1 (ko) Rip3 발현촉진제를 유효성분으로 포함하는 항암보조용 조성물, rip3 발현을 촉진하여 항암제 감수성을 증진시키는 항암 보조제 스크리닝 방법 및 항암제 감수성 모니터링 방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16860154

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 16860154

Country of ref document: EP

Kind code of ref document: A1