WO2017058896A1 - Cibles pour le traitement du carcinome hépatocellulaire et procédés associés - Google Patents

Cibles pour le traitement du carcinome hépatocellulaire et procédés associés Download PDF

Info

Publication number
WO2017058896A1
WO2017058896A1 PCT/US2016/054150 US2016054150W WO2017058896A1 WO 2017058896 A1 WO2017058896 A1 WO 2017058896A1 US 2016054150 W US2016054150 W US 2016054150W WO 2017058896 A1 WO2017058896 A1 WO 2017058896A1
Authority
WO
WIPO (PCT)
Prior art keywords
cancer
ccl5
agent
ccr5
antibody
Prior art date
Application number
PCT/US2016/054150
Other languages
English (en)
Inventor
Mei Yee KOH
Garth Powis
Carl F. Ware
Original Assignee
Sanford Burnham Prebys Medical Discovery Institute
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Sanford Burnham Prebys Medical Discovery Institute filed Critical Sanford Burnham Prebys Medical Discovery Institute
Publication of WO2017058896A1 publication Critical patent/WO2017058896A1/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/335—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
    • A61K31/365—Lactones
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/655—Azo (—N=N—), diazo (=N2), azoxy (>N—O—N< or N(=O)—N<), azido (—N3) or diazoamino (—N=N—N<) compounds
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7028—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages
    • A61K31/7034—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages attached to a carbocyclic compound, e.g. phloridzin
    • A61K31/704—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages attached to a carbocyclic compound, e.g. phloridzin attached to a condensed carbocyclic ring system, e.g. sennosides, thiocolchicosides, escin, daunorubicin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7042—Compounds having saccharide radicals and heterocyclic rings
    • A61K31/7052—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides
    • A61K31/706—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom
    • A61K31/7064—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom containing condensed or non-condensed pyrimidines
    • A61K31/7068—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom containing condensed or non-condensed pyrimidines having oxo groups directly attached to the pyrimidine ring, e.g. cytidine, cytidylic acid
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7042—Compounds having saccharide radicals and heterocyclic rings
    • A61K31/7052—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides
    • A61K31/706—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom
    • A61K31/7064—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom containing condensed or non-condensed pyrimidines
    • A61K31/7076—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom containing condensed or non-condensed pyrimidines containing purines, e.g. adenosine, adenylic acid
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5011—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing antineoplastic activity
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57407—Specifically defined cancers
    • G01N33/57438—Specifically defined cancers of liver, pancreas or kidney
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/52—Assays involving cytokines
    • G01N2333/521—Chemokines
    • G01N2333/523—Beta-chemokines, e.g. RANTES, I-309/TCA-3, MIP-1alpha, MIP-1beta/ACT-2/LD78/SCIF, MCP-1/MCAF, MCP-2, MCP-3, LDCF-1or LDCF-2

Definitions

  • the invention relates generally to treating disease, and more specifically to treatment and detection of CCL5 mediated disease.
  • Hypoxia is a state of reduced oxygen pressure below its physiological threshold, which impacts both normal and disease processes. Hypoxia characterizes virtually every site of inflammation, thus requiring infiltrating immune cells to undergo a metabolic switch toward anaerobic pathways to maintain energy requirements.
  • the hypoxia-inducible factor (HIF) transcription factors are central regulators of hypoxic response.
  • the HIFs are heterodimers comprising one of three major oxygen labile HIF-a subunits (HIF- la, HIF-2a, and HIF-3a), and a constitutive HIF- ⁇ subunit, which together form the HIF-1, HIF-2, and HIF-3 transcriptional complexes, respectively.
  • HIF-1 plays an essential role in survival and function of immune cells by facilitating energy generation through anaerobic glycolysis.
  • HIF-a is hydroxylated by oxygen-dependent prolyl hydroxylases, promoting ubiquitination by the von Hippel-Lindau protein (pVHL) E3 ligase complex resulting in HIF-a proteasomal degradation.
  • pVHL binding is abrogated and HIF-a is stabilized and heterodimerizes with HIF- ⁇ to transactivate a variety of hypoxia-responsive genes.
  • HIF- ⁇ can also be induced under non-hypoxic conditions by proinflammatory cytokines, which allow initiation of an inflammatory response before tissues become hypoxic.
  • hypoxia-associated factor (HAF; encoded by SART1) is an isoform-specific E3 ubiquitin ligase that specifically degrades HIF- ⁇ (but not HIF-2a) in an oxygen-independent manner. Also known as SART1, HAF is expressed in both normal and malignant proliferating tissue and is important for spliceosome assembly and cell division.
  • HCC Hepatocellular carcinoma
  • cytokines The inflammatory response results in mobilization of immune cells, resulting in infiltration of inflamed tissue, which plays decisive roles at different stages of tumor development, including initiation, promotion, malignant conversion, invasion, and metastasis.
  • a number of cytokines has been associated with HCC development including the interleukins (IL-la, IL- ⁇ , IL-2, IL-6, 1L-12) and non-interleukins such as tumor necrosis factor alpha (TNF-a) and Interferon gamma (IFN-y).
  • interleukins IL-la, IL- ⁇ , IL-2, IL-6, 1L-12
  • non-interleukins such as tumor necrosis factor alpha (TNF-a) and Interferon gamma (IFN-y).
  • Chemokines and their receptors such as the CXCL12-CXCR4 axis, CX3CL1- CX3CR1 axis, CCL5/CCL1-CCR3 and CCL20-CCR6 have been also been implicated in HCC.
  • the complex interplay between hepatocytes and immune infiltrating cells in the presence of growth factors, cytokines and chemokines within the inflammatory tumor microenvironment is believed to drive HCC development and progression.
  • the present invention is based on the finding of a new tumor-suppressor role for HAF in immune cell function by preventing inappropriate HIF-1 activation in SART1 +/" male mice.
  • the findings identify RANTES (Regulated on Activation, Normal T cell Expressed and Secreted; also named Chemokine (C-C motif) ligand 5 (CCL5)) as a novel therapeutic target for cancer, such as nonalcoholic steatohepatitis (NASH)-driven hepatocellular carcinoma (HCC) as well as other liver pathologies which lead to HCC.
  • NASH nonalcoholic steatohepatitis
  • HCC hepatocellular carcinoma
  • the invention provides a method of treating or preventing cancer in a subject.
  • the method includes administering to the subject a therapeutically effective amount of an agent which inhibits CCL5/CCR5 signal transduction, thereby treating or preventing cancer in the subject.
  • the cancer is hepatocellular carcinoma.
  • the invention provides a method of treating or preventing a CCL5 mediated liver disease or disorder in a subject.
  • the method includes administering to the subject a therapeutically effective amount of an agent which inhibits CCL5/CCR5 signal transduction, thereby treating or preventing the CCL5 mediated disease in the subject.
  • the CCL5 mediated liver disease or disorder is inflammation, cancer, fatty liver disease, alcohol induced fatty liver disease, non-alcohol induced fatty liver disease, cirrhosis, steatosis, steatohepatitis, viral infection or fibrosis.
  • the invention provides a method of diagnosing a subject as having, or at risk of having, hepatocellular carcinoma.
  • the method includes obtaining a sample from the subject; detecting the presence or expression level of CCL5 in the sample; and diagnosing the subject as having, or at risk of having, hepatocellular carcinoma when the presence or expression level of CCL5 in the sample is elevated as compared to a corresponding normal sample.
  • the method further includes administering to the subject a therapeutic regime, such as administering a chemotherapeutic agent or a therapeutically effective amount of an agent which inhibits CCL5/CCR5 signal transduction.
  • the invention provides a method for determining susceptibility of a subject to a therapeutic regime to treat hepatocellular carcinoma, or monitoring progression of hepatocellular carcinoma in a subject.
  • the method includes detecting the presence or expression level of CCL5 in a sample from the subject; and assessing the therapeutic regime or hepatocellular carcinoma progression based on the detection, thereby determining susceptibility of a subject to a therapeutic regime to treat hepatocellular carcinoma, or monitoring progression of hepatocellular carcinoma in a subject.
  • the invention provides a transgenic mouse whose genome includes a heterozygous disruption of the squamous cell carcinoma antigen recognized by T-cells 1 (SART1) gene.
  • the invention provides a method for identifying an agent for preventing or treating cancer utilizing the transgenic mouse of the disclosure.
  • the method includes contacting the transgenic mouse of the disclosure with a test agent and monitoring tumor growth or liver neutrophilic infiltration in the mouse, wherein a reduction or inhibition of tumor growth or liver neutrophilic infiltration in the mouse is indicative of the test agent as an agent for preventing or treating cancer.
  • the invention provides a kit which includes the transgenic mouse of the disclosure and one or more reagents for performing an assay, such as an assay to identifying an agent for preventing or treating cancer.
  • the invention provides a method of screening for an agent to treat cancer, for example by inhibiting CCL5/CCR5 signal transduction.
  • the method includes contacting a sample with a test agent; and detecting CCL5/CCR5 mediated signal transduction, wherein a reduction in CCL5/CCR5 mediated signal transduction as compared to a control sample is indicative of the test agent as being an agent to treat cancer.
  • the method includes contacting a sample with a test agent; and detecting binding of CCL5 to CCR5, wherein a reduction in binding as compared to a control sample is indicative of the test agent as being an agent to treat cancer by inhibiting CCL5/CCR5 signal transduction.
  • the invention also provides a method of identifying a CCR5 antagonist.
  • the method includes contacting CCR5 with one or more test agents in the presence of CCL5, and identifying an agent that selectively inhibits CCR5 signal transduction, the test agent being characterized as a CCR5 antagonist.
  • Figures 1A-1B are a series of schematic and graphical representations pertaining to generation of SART1+/- knockout heterozygous mice.
  • Figure 1A is a schematic of a gene trap construct used to disrupt the HAF (SARTl) gene.
  • Figure IB is a graphical representation of HAF levels in a panel of tissues from 2-month-old male SART1 +/" and WT mice.
  • Figures 3A-3F are a series of graphical and pictorial representations pertaining to hepatic steatosis in male SART1 +/" mice.
  • Figure 3A includes images showing hematoxylin and eosin sections showing microvesicular hepatic steatosis and preneoplastic foci of cellular alteration in 6-month-old SART1 +/" livers.
  • Figure 3B is a graph depicting quantitation along with a flowchart of age related progression of liver pathology in male SART1 +/" mice versus WT littermates [#mice].
  • Figure 3C is a western blot showing HAF expression in WT and SART1 +/" livers according to age with quantitation Figure 3D.
  • Figure 3D is a graph depicting quantitation of Figure 3C.
  • Figure 3E is a gene expression heatmap of a SART1 +/" liver tumor (T) normalized to a WT liver (N) showing regions enriched for genes involved in FAO and inflammatory response with enlarged heatmap showing FAO genes at RHS.
  • Figure 3F depicts TaqmanTM validation for a select number of FAO genes using 3 additional mice/group with western blotting validation.
  • Figures 4A-4D are a series of graphical representations depicting Seahorse (Seahorse Bioscience, North Billerica, MA) metabolic analysis of OCR.
  • Figure 4A shows analysis of OCR of primary hepatocytes isolated from male SART1 +/" or WT mice (age, 4 months).
  • Figure 4B shows quantitation of data (3 mice/group).
  • Figure 4C shows analysis of OCR of Huh7 cells transfected with HAF siRNA.
  • Figure 4D shows quantitation of data from three replicate wells of Figure 4C. Data are mean 6 standard deviation.
  • Figures 5A-5E are a series of representations illustrating that HAF loss is associated with increased HIF-la and RANTES production.
  • Figure 5 A shows western blotting and quantitation of HIF-la levels in PBMCs and spleen-adherent and -nonadherent mononuclear cells from male SART1 +/" and WT mice (age, 6 months).
  • Figure 5B is flow cytometry scatterplots showing LacZ-FITC intensity in peripheral blood cells from male SART1 +/" and WT mice (age, 4 months).
  • Figure 5C depicts Lac Z intensities of immune cells from spleens of male SART1 +/" (Het) and wild-type (Wt) mice (age, 4 months; 4 mice/group). Each data point represents a single mouse with mean 6 standard deviation.
  • Figure 5D depicts quantitation of secreted cytokines from KCs isolated from male SART1 +/" livers normalized to wild-type with arrays depicted inset (pooled from 4 mice/group).
  • Figure 5E depicts quantitation of RANTES secretion by TFIP-1 cells transfected with siRNAs to HAF with western blotting validation on RHS. Data are mean 6 standard error.
  • Figures 6A-6C are a series of representations associated with biomarkers for assessing HCC progression and therapeutic efficacy.
  • Figure 6A illustrates a timeline for liver dysfunction manifestation in SART1 +/" mice accompanied by observable elevation in biomarker levels compared to age matched wild-type mice.
  • Figure 6B depicts levels of blood liver enzyme alanine aminotransferase (ALT), aspartate aminotransferase (AST) and alkaline phosphatase (ALP) in SART1 +/" versus age-matched wild-type mice. Note that ALP levels are highest in younger mice.
  • ALT blood liver enzyme alanine aminotransferase
  • AST aspartate aminotransferase
  • ALP alkaline phosphatase
  • Figure 6C shows elevation of genes encoding glycolytic enzymes (Slc2Al, Hkl and Pkm) and CCL5 in livers of SART1 +/" mice of indicated ages normalized to levels in age-matched wild-type litter mates. Data were obtained from at least 3 mice per wild-type or SART1 +/" age group for each panel.
  • Figures 7A-7C are a series of representations pertaining to identification of a central role for RANTES/CCL5 in HCC in SART1 +/" mice.
  • Figure 7A depicts measurement of cytokine/chemokine secretion from Kupffer cells isolated from livers of 6-month old SART1 +/" mice normalized to age matched wild-type mice. Note elevation of RANTES/CCL5 to >100-fold over control.
  • Figure 7B shows elevation of CCL5 mRNA in livers of SART1 +/" mice of indicated ages normalized to levels in age-matched wild-type litter mates. Note: SART1 +/" mice develop visible HCC tumors at 10 months.
  • Figure 7C shows percentage of neutrophils of total cell count determined by flow cytometry (Ly6G+) in livers of SART1 +/" and wild type mice of indicated ages.
  • the present invention is based on the discovery of a new tumor-suppressor role for HAF in immune cell function as well as identification of RANTES as a novel therapeutic target for NASH and NASH-driven HCC.
  • SART1/HAF is a protein that acts as a molecular switch regulating the balance between the cellular levels of the hypoxia inducible proteins HIF-1 and HIF-2.
  • the inventors have found that SART1/HAF knockout is embryonic lethal in mice. Unexpectedly it was found that SART1/HAF haploinsufficient mice with germ line deletion of 1 copy of the SART 1 gene develop hepatocellular carcinoma (HCC) after about 10 months.
  • HCC hepatocellular carcinoma
  • Gene expression and functional studies suggest that HCC development in these mice is promoted by RANTES/CCL5 and its receptor CCR5, which promote immune cell infiltration into the liver and chronic liver inflammation. This suggests that inhibition of RANTES/CCL5 or its receptor(s) might provide therapeutic benefit by shutting down the inflammatory response that drives HCC. Due to the accessibility of RANTES/CCL5 as a circulating ligand, and its receptor CCR5 located on the cell surface, these targets can be suitably inhibited to treat RANTES/CCL5
  • the invention provides a method of treating or preventing cancer in a subject.
  • the method includes administering to the subject a therapeutically effective amount of an agent which inhibits CCL5/CCR5 signal transduction, thereby treating or preventing cancer in the subject.
  • the invention also provides a method of treating or preventing a CCL5 mediated liver disease or disorder in a subject.
  • the method includes administering to the subject a therapeutically effective amount of an agent which inhibits CCL5/CCR5 signal transduction, thereby treating or preventing the CCL5 mediated disease in the subject.
  • a CCL5 mediated liver disease or disorder may include inflammation, cancer, fatty liver disease, alcohol induced fatty liver disease, non-alcohol induced fatty liver disease, cirrhosis, steatosis, steatohepatitis, viral infection or fibrosis.
  • cancer includes a variety of cancer types which are well known in the art, including but not limited to, dysplasias, hyperplasias, solid tumors and hematopoietic cancers. Many types of cancers are known, such as, but in no way limited to, the following organs or systems: brain, cardiac, lung, gastrointestinal, genitourinary tract, liver, bone, nervous system, gynecological, hematologic, skin, breast, and adrenal glands.
  • gliomas (Schwannoma, glioblastoma, astrocytoma), neuroblastoma, pheochromocytoma, paraganlioma, meningioma, adrenal cortical carcinoma, medulloblastoma, rhabdomyoscarcoma, kidney cancer, vascular cancer of various types, osteoblastic osteocarcinoma, prostate cancer, ovarian cancer, uterine leiomyomas, salivary gland cancer, choroid plexus carcinoma, mammary cancer, pancreatic cancer, colon cancer, and megakaryoblastic leukemia; and skin cancers including malignant melanoma, basal cell carcinoma, squamous cell carcinoma, Karposi's sarcoma, moles dysplastic nevi, lipoma, angioma, dermatofibroma, keloids, sarcomas such as fibrosarcoma or hemangiosarcoma, and melanom
  • CCL5 tissue or plasma CCL5 is a marker of an unfavorable outcome or metastatic disease in patients with a variety of cancer types which may be targeted by the present invention.
  • RANTES is elevated in advanced breast carcinoma. Additionally, the expression of CCR5 and RANTES/CCL5 correlates with a metastatic phenotype of basal breast cancer, both in clinical samples and in cell lines, and treatment with CCR5 antagonists reduced the risk of lung metastasis in a mouse model of breast cancer. Serum RANTES/CCL5 concentration is also significantly elevated in ovarian cancer patients compared to benign ovarian cyst patients, and values correlated with the stage of disease and the extent of residual tumor mass.
  • plasma RANTES/CCL5 levels are found to be higher with increasing stages. Furthermore, in these patients, marked increases in plasma RANTES/CCL5 level was found in patients with progressive malignancy but in none of those in clinical remission. Markedly elevated levels of plasma RANTES/CCL5 were also observed in patients with stage IV gastric cancer, and might be useful for identifying patients with metastatic disease, RANTES/CCL5 polymorphisms also conferred increased risk for development of pancreatic adenocarcinoma.
  • the axis of RANTES/CCL5 and its receptor i.e., CCR5
  • CCR5 RANTES/CCL5 and its receptor
  • the inhibition/neutralization of RANTES/CCL5 or its receptor(s) using, for example, targeted therapeutic antibodies has clinical utility for the treatment of all forms of HCC including that caused by chronic inflammation, such as Hepatitis B and Hepatitis C infection, alcohol induced fatty liver disease (AFLD), non-alcohol induced fatty liver-disease (NAFLD) and other metabolic overload causes; FLD, NAFLD and other liver conditions at high risk for progressing to cirrhosis, liver failure or HCC.
  • chronic inflammation such as Hepatitis B and Hepatitis C infection, alcohol induced fatty liver disease (AFLD), non-alcohol induced fatty liver-disease (NAFLD) and other metabolic overload causes
  • the SARTl/HAF heterozygous knockout mouse of the disclosure models the progression of human HCC from hepatic steatosis through cirrhosis without requiring additional manipulation with chemicals, diets or mutagens, which is currently the norm for producing mouse models of HCC. Additionally loss of 1 copy of the SART1 gene is sufficient to mediate a phenotype.
  • the SART1/HAF haploinsufficient mice are therefore a more physiological model of human HCC and fatty liver disease.
  • This model enabled identification of RANTES/CCL5, and its receptor CCR5 as playing a causal role in HCC development and progression.
  • This model enables one to test the efficacy of agents specifically targeted to inhibit CCL5/CCR5 signal transduction, for example, specifically targeted antibodies blocking RANTES/CCL5/CCR5 activation for the treatment of HCC.
  • the invention provides a transgenic mouse whose genome includes a heterozygous disruption of the SARTl gene.
  • HCC HCC is the primary malignancy of the liver and the third leading cause of cancer deaths worldwide, with over 500,000 people affected.
  • the incidence of HCC is highest in Asia and Africa, where the endemic high prevalence of hepatitis B and hepatitis C strongly predisposes to the development of chronic liver disease and subsequent development of HCC.
  • HCC accounts for more than 12,000 deaths a year in the United States and is being diagnosed more frequently. It is more common in men than women and in African Americans than whites. Resection may benefit certain patients, albeit mostly transiently, although most patients are not candidates because of the advanced stage of their cancer at diagnosis.
  • HCC ulcerative colitis
  • doxorubicin-based regimens appear to have the greatest efficacy.
  • hormonal and biologic agents including tamoxifen, antiandrogens (eg, cyproterone, ketoconazole), interferon, interleukin 2 (IL-2), and octreotide.
  • Sorafenib (Nexavar®) was approved in 2007 by the FDA for patients with unresectable HCC being able to extend the life of patients by 3 months, from 8 months to 11 months.
  • HCC hepatocellular carcinoma
  • livers of SART1 +/" mice were consistent with constitutive activation of HIF-1, including a 10-fold induction of the HIF-1 target gene: RANTES/CCL5.
  • CCL5 is a chemoattractant for a variety of immune cells including neutrophils.
  • Chronic liver inflammation mediated by liver-associated immune cells is a key component for HCC development in humans.
  • Tumor development in the SART1 +/" mice was preceded at 6 months of age, by a >100- fold increase in CCL5 secretion by liver- associated Kupffer cells compared to age- matched wild-type littermates. This was accompanied by a >10-fold elevation in liver neutrophil infiltration.
  • Hepatic steatosis and cellular alterations including pre-neoplastic lesions were already apparent in mice of this age although no neoplastic lesions were observed. Elevated liver neutrophil infiltration and CCL5 expression was observed in mice as early as 1 month of age, hence preceding hepatic steatosis and all other liver dysfunction and cellular alteration associated with HCC development. This suggests that increased RANTES/CCL5 expression in the livers of SART1+/- mice is a key factor promoting HCC initiation and progression.
  • HAF is an E3 ligase for the hypoxia inducible factor, HIF-la, which has been implicated in the development of liver disease and HCC.
  • SART1 +/ mice with germline heterozygosity for HAF (SART1 +/" ) were generated. These mice developed multiple large tumors (histologically confirmed as hepatocellular carcinoma, HCC) within their livers when they reached 10 months of age. It was found that 60-80% of male SART1 +/" mice developed HCC at 12 months. This was accompanied by steatohepatitis - lipid deposition accompanied by extensive immune cell infiltration; hallmarks of fatty liver disease in humans.
  • livers of SART1 +/" mice were consistent with constitutive activation of HIF-1, including induction of HIF target genes involved in glycolysis ( Figure 6).
  • hepatic HIF-1 a regulates the expression of glucose transporters as well as glycolytic enzymes, and is thought to contribute to the glycolytic phenotype of HCCs.
  • Livers of SART1 +/" mice also show a 10- fold induction of the HIF-1 target gene RANTES/CCL5.
  • CCL5 is a chemoattractant for a variety of immune cells including neutrophils.
  • the present invention utilizes an agent that antagonizes or inhibits (i.e., blocks) CCL5/CCR5 signal transduction.
  • agents capable of inhibiting CCL5/CCR5 signal transduction can include a variety of different types of molecules.
  • An agent or candidate agent useful in any method of the invention can be any type of molecule, for example, a polynucleotide, a peptide, a peptidomimetic, peptoids such as vinylogous peptoids, chemical compounds, such as organic molecules or small organic molecules, or the like.
  • the agent or candidate agent may be a peptide, such as an antibody, or fragment thereof, that specifically binds CCL5 and/or CCR5 thereby blocking binding of CCL5 to CCR5.
  • polypeptide is used in its broadest sense to refer to a polymer of subunit amino acids, amino acid analogs, or peptidomimetics, including proteins and peptoids.
  • the polypeptides may be naturally occurring full length proteins or fragments thereof, processed forms of naturally occurring polypeptides (such as by enzymatic digestion), chemically synthesized polypeptides, or recombinantly expressed polypeptides.
  • the polypeptides may comprise D- and/or L-amino acids, as well as any other synthetic amino acid subunit, and may contain any other type of suitable modification, including but not limited to peptidomimetic bonds and reduced peptide bonds.
  • antibody refers to an immunoglobulin molecule which is able to specifically bind to a specific epitope on an antigen.
  • Antibodies can be intact immunoglobulins derived from natural sources or from recombinant sources and can be immunoreactive portions of intact immunoglobulins.
  • Antibodies are typically tetramers of immunoglobulin molecules.
  • the antibodies in the present invention may exist in a variety of forms including, for example, polyclonal antibodies, monoclonal antibodies, Fv, Fab and F(ab) 2 , as well as single chain antibodies and humanized antibodies.
  • the antibody may be a single chain antibody, a monoclonal antibody, a bi- specific antibody, a chimeric antibody, a synthetic antibody, a polyclonal antibody, a humanized antibody, a fully human antibody, and active fragments or homologs thereof.
  • an "antibody heavy chain,” as used herein, refers to the larger of the two types of polypeptide chains present in all antibody molecules.
  • an "antibody light chain,” as used herein, refers to the smaller of the two types of polypeptide chains present in all antibody molecules.
  • synthetic antibody as used herein, is meant to include an antibody which is generated using recombinant DNA technology, such as, for example, an antibody expressed by a bacteriophage as described herein.
  • the term should also be construed to mean an antibody which has been generated by the synthesis of a DNA molecule encoding the antibody and which DNA molecule expresses an antibody protein, or an amino acid sequence specifying the antibody, wherein the DNA or amino acid sequence has been obtained using synthetic DNA or amino acid sequence technology which is available and well known in the art.
  • binding refers to the adherence of molecules to one another, such as, but not limited to, enzymes to substrates, ligands to receptors, antibodies to antigens, DNA binding domains of proteins to DNA, and DNA or RNA strands to complementary strands.
  • Binding partner refers to a molecule capable of binding to another molecule.
  • biologically active fragments or “bioactive fragment” of a polypeptide encompasses natural or synthetic portions of the full-length protein that are capable of specific binding to their natural ligand or of performing the function of the protein.
  • a "ligand” is a compound that specifically binds to a target receptor.
  • a "receptor” is a compound that specifically binds to a ligand.
  • receptor CCR5 specifically binds ligand CCL5.
  • a ligand or a receptor "specifically binds to” or “is specifically immunoreactive with” an agent when the ligand or receptor functions in a binding reaction which is determinative of the presence of the compound in a sample of heterogeneous compounds.
  • the ligand or receptor binds preferentially to a particular compound and does not bind in a significant amount to other compounds present in the sample.
  • a polynucleotide specifically binds under hybridization conditions to a compound polynucleotide comprising a complementary sequence; an antibody specifically binds under immunoassay conditions to an antigen bearing an epitope against which the antibody was raised.
  • immunoassay formats may be used to select antibodies specifically immunoreactive with a particular protein.
  • solid-phase ELISA immunoassays are routinely used to select monoclonal antibodies specifically immunoreactive with a protein. See Harlow and Lane (1988, Antibodies, A Laboratory Manual, Cold Spring Harbor Publications, New York) for a description of immunoassay formats and conditions that can be used to determine specific immunoreactivity.
  • an agent or candidate agent is a polynucleotide, such as an antisense oligonucleotide or RNA molecule.
  • the agent or candidate agent may be a polynucleotide, such as an antisense oligonucleotide or RNA molecule, such as microRNA, dsRNA, siRNA, stRNA, and shRNA.
  • the polynucleotide inhibits expression or activity of CCL5, CCR5 or both.
  • Polynucleotides of the present invention such as antisense oligonucleotides and RNA molecules may be of any suitable length.
  • length are suitable for antisense oligonucleotides or RNA molecule to be used to regulate gene expression.
  • Such molecules are typically from about 5 to 100, 5 to 50, 5 to 45, 5 to 40, 5 to 35, 5 to 30, 5 to 25, 5 to 20, or 10 to 20 nucleotides in length.
  • the molecule may be about 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 40, 45 or 50 nucleotides in length.
  • Such polynucleotides may include from at least about 15 to more than about 120 nucleotides, including at least about 16 nucleotides, at least about 17 nucleotides, at least about 18 nucleotides, at least about 19 nucleotides, at least about 20 nucleotides, at least about 21 nucleotides, at least about 22 nucleotides, at least about 23 nucleotides, at least about 24 nucleotides, at least about 25 nucleotides, at least about 26 nucleotides, at least about 27 nucleotides, at least about 28 nucleotides, at least about 29 nucleotides, at least about 30 nucleotides, at least about 35 nucleotides, at least about 40 nucleotides, at least about 45 nucleotides, at least about 50 nucleotides, at least about 55 nucleotides, at least about 60 nucleotides, at least about 65 nucleotides, at least about 70 nucleo
  • polynucleotide or “nucleotide sequence” or “nucleic acid molecule” is used broadly herein to mean a sequence of two or more deoxyribonucleotides or ribonucleotides that are linked together by a phosphodiester bond.
  • the terms include RNA and DNA, which can be a gene or a portion thereof, a cDNA, a synthetic polydeoxyribonucleic acid sequence, or the like, and can be single stranded or double stranded, as well as a DNA/RNA hybrid.
  • nucleic acid molecules which can be isolated from a cell
  • synthetic polynucleotides which can be prepared, for example, by methods of chemical synthesis or by enzymatic methods such as by the polymerase chain reaction (PCR).
  • PCR polymerase chain reaction
  • the nucleotides comprising a polynucleotide are naturally occurring deoxyribonucleotides, such as adenine, cytosine, guanine or thymine linked to 2'- deoxyribose, or ribonucleotides such as adenine, cytosine, guanine or uracil linked to ribose.
  • a polynucleotide also can contain nucleotide analogs, including non-naturally occurring synthetic nucleotides or modified naturally occurring nucleotides.
  • Nucleotide analogs are well known in the art and commercially available, as are polynucleotides containing such nucleotide analogs.
  • the covalent bond linking the nucleotides of a polynucleotide generally is a phosphodiester bond.
  • the covalent bond also can be any of numerous other bonds, including a thiodiester bond, a phosphorothioate bond, a peptide-like bond or any other bond known to those in the art as useful for linking nucleotides to produce synthetic polynucleotides.
  • a polynucleotide or oligonucleotide comprising naturally occurring nucleotides and phosphodiester bonds can be chemically synthesized or can be produced using recombinant DNA methods, using an appropriate polynucleotide as a template.
  • a polynucleotide comprising nucleotide analogs or covalent bonds other than phosphodiester bonds generally will be chemically synthesized, although an enzyme such as T7 polymerase can incorporate certain types of nucleotide analogs into a polynucleotide and, therefore, can be used to produce such a polynucleotide recombinantly from an appropriate template.
  • antisense oligonucleotides or RNA molecules include oligonucleotides containing modifications.
  • modifications are known in the art and contemplated for use in the present invention.
  • oligonucleotides containing modified backbones or non-natural internucleoside linkages are contemplated.
  • oligonucleotides having modified backbones include those that retain a phosphorus atom in the backbone and those that do not have a phosphorus atom in the backbone.
  • modified oligonucleotides that do not have a phosphorus atom in their internucleoside backbone can also be considered to be oligonucleosides.
  • modified oligonucleotide backbones include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3'-alkylene phosphonates, 5'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3 '-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, selenophosphates and borano-phosphates having normal 3'-5' linkages, 2 -5' linked analogs of these, and those having inverted polarity wherein one or more internucleotide linkages is a 3' to 3', 5' to 5' or 2' to 2' linkage.
  • Certain oligonucleotides having inverted polarity comprise a single 3' to 3' linkage at the 3'-most internucleotide linkage i.e. a single inverted nucleoside residue which may be abasic (the nucleobase is missing or has a hydroxyl group in place thereof).
  • Various salts, mixed salts and free acid forms are also included.
  • modified oligonucleotide backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages.
  • morpholino linkages formed in part from the sugar portion of a nucleoside
  • siloxane backbones sulfide, sulfoxide and sulfone backbones
  • formacetyl and thioformacetyl backbones methylene formacetyl and thioformacetyl backbones
  • riboacetyl backbones alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH 2 component parts.
  • oligonucleotide mimetics both the sugar and the internucleoside linkage, i.e., the backbone, of the nucleotide units are replaced with novel groups.
  • the base units are maintained for hybridization with an appropriate nucleic acid target compound.
  • One such oligomeric compound an oligonucleotide mimetic that has been shown to have excellent hybridization properties, is referred to as a peptide nucleic acid (PNA).
  • PNA peptide nucleic acid
  • the sugar-backbone of an oligonucleotide is replaced with an amide containing backbone, in particular an aminoethylglycine backbone.
  • oligonucleotides may include phosphorothioate backbones and oligonucleosides with heteroatom backbones. Modified oligonucleotides may also contain one or more substituted sugar moieties.
  • oligonucleotides comprise one of the following at the 2' position: OH; F; 0-, S-, or N-alkyl; 0-, S-, or N-alkenyl; 0-, S- or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl may be substituted or unsubstituted C 1 to C 10 alkyl or C 2 to C 10 alkenyl and alkynyl. Particularly preferred are 0[(CH 2 ) n O] m CH 3 , 0(CH.sub.
  • n and m are from 1 to about 10.
  • oligonucleotides comprise one of the following at the 2' position: Ci to Cio lower alkyl, substituted lower alkyl, alkenyl, alkynyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH 3 , OCN, CI, Br, CN, CF 3 , OCF 3 , SOCH 3 , S0 2 CH 3 , ON0 2 , N0 2 , N3, H 2 , heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkyl amino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an oligonucleotide, or a group for improving the pharmacodynamic properties of an oligonucleotide, and other substituents having similar properties.
  • Another modification includes 2'-methoxyethoxy(2'OCH 2 CH 2 O
  • the present invention includes use of Locked Nucleic Acids (LNAs) to generate antisense nucleic acids having enhanced affinity and specificity for the target polynucleotide.
  • LNAs are nucleic acid in which the 2'-hydroxyl group is linked to the 3' or 4' carbon atom of the sugar ring thereby forming a bicyclic sugar moiety.
  • the linkage is preferably a methelyne (— CH 2 -) n group bridging the 2' oxygen atom and the 4' carbon atom wherein n is 1 or 2.
  • modifications include 2'-methoxy(2'-0— CH 3 ), 2'-aminopropoxy(2'- OCH 2 CH 2 CH 2 NH 2 ), 2'-allyl (2'-CH-CH-CH 2 ), 2'-0-allyl (2'-0-CH 2 -CHCH 2 ), 2 * -fluoro (2'-F), 2' -amino, 2'-thio, 2'-Omethyl, 2'-methoxymethyl, 2' -propyl, and the like.
  • the 2'- modification may be in the arabino (up) position or ribo (down) position.
  • a preferred 2'- arabino modification is 2'-F.
  • Oligonucleotides may also have sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar.
  • Oligonucleotides may also include nucleobase modifications or substitutions.
  • "unmodified” or “natural” nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U).
  • Modified nucleobases include other synthetic and natural nucleobases such as 5- methylcytosine, 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6- methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5- halouracil and cytosine, 5-propynyl uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo,
  • nucleobases include tricyclic pyrimidines such as phenoxazine cytidine (lH-pyrimido[5,4-b][l,4]benzoxazi-n-2(3H)-one), phenothiazine cytidine (lH-pyrimido[5,4-b][l,4]benzothiazin-2(3H)-one), G-clamps such as a substituted phenoxazine cytidine (e.g.
  • nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone. Further nucleobases are known in the art.
  • nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds described herein.
  • These include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine.
  • 5- methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2 C and are presently preferred base substitutions, even more particularly when combined with 2'-0-methoxyethyl sugar modifications.
  • Another modification of the antisense oligonucleotides described herein involves chemically linking to the oligonucleotide one or more moieties or conjugates which enhance the activity, cellular distribution or cellular uptake of the oligonucleotide.
  • the antisense oligonucleotides can include conjugate groups covalently bound to functional groups such as primary or secondary hydroxyl groups.
  • Conjugate groups include intercalators, reporter molecules, polyamines, polyamides, polyethylene glycols, polyethers, groups that enhance the pharmacodynamic properties of oligomers, and groups that enhance the pharmacokinetic properties of oligomers.
  • Typical conjugates groups include cholesterols, lipids, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and dyes.
  • Groups that enhance the pharmacodynamic properties include groups that improve oligomer uptake, enhance oligomer resistance to degradation, and/or strengthen sequence-specific hybridization with RNA.
  • Groups that enhance the pharmacokinetic properties include groups that improve oligomer uptake, distribution, metabolism or excretion.
  • Conjugate moieties include but are not limited to lipid moieties such as a cholesterol moiety, cholic acid, a thioether, e.g., hexyl-5-tritylthiol, a thiocholesterol, an aliphatic chain, e.g., dodecandiol or undecyl residues, a phospholipid, e.g., dihexadecyl-rac- glycerol or triethylammonium l,2-di-0-hexadecyl-rac-glycero-3-H-phosphonate, a polyamine or a polyethylene glycol chain, or adamantane acetic acid, a palmityl moiety, or an octadecylamine or hexylaminocarbonyloxycholesterol moiety.
  • lipid moieties such as a cholesterol moiety, cholic acid, a thioether, e
  • the invention provides a method for identifying an agent for preventing or treating cancer or other CCL5 mediated disease utilizing the SART1 +/" transgenic mouse of the disclosure.
  • the method includes contacting the transgenic mouse of the disclosure with a test agent and monitoring tumor growth or liver neutrophilic infiltration in the mouse, wherein a reduction or inhibition of tumor growth or liver neutrophilic infiltration in the mouse is indicative of the test agent as an agent for preventing or treating cancer.
  • test agent and “candidate agent” are used interchangeably and refer to agents that are known to, or are being investigated for their ability to inhibit CCL5/CCR5 signal transduction.
  • the invention also provides a method of screening for an agent to treat cancer, for example by inhibiting CCL5/CCR5 signal transduction.
  • the method includes contacting a sample with a test agent; and detecting CCL5/CCR5 mediated signal transduction, wherein a reduction in CCL5/CCR5 mediated signal transduction as compared to a control sample is indicative of the test agent as being an agent to treat cancer.
  • the method includes contacting a sample with a test agent; and detecting binding of CCL5 to CCR5, wherein a reduction in binding as compared to a control sample is indicative of the test agent as being an agent to treat cancer by inhibiting CCL5/CCR5 signal transduction.
  • the invention also provides a method of identifying a CCR5 antagonist.
  • the method includes contacting CCR5 with one or more test agents in the presence of CCL5, and identifying an agent that selectively inhibits CCR5 signal transduction, the test agent being characterized as a CCR5 antagonist.
  • a screening assay used in a method of the invention for identifying a CCR5 antagonist can involve detecting a signal produced by binding of CCL5 to CCR5, i.e., CCL5/CCR5 mediated signal transduction.
  • receptor signal is intended to mean a readout, detectable by any analytical means, that is a qualitative or quantitative indication of activation of signal transduction through CCR5.
  • signals used to determine such qualitative or quantitative activation of signal transduction are referred to below as “signaling assays.”
  • a signaling assay can be performed to determine whether a test agent is a CCR5 antagonist.
  • a signaling assay can be performed to determine whether a test agent is a CCR5 antagonist.
  • CCR5 is contacted with one or more test agents under conditions wherein CCR5 produces a signal in response to an agonist, and an agent is identified that reduces production of the signal.
  • CCR5 is a G protein coupled receptor which functions as a chemokine receptor in the CC chemokine group.
  • Signaling through G proteins can lead to increased or decreased production or liberation of second messengers, including, for example, arachidonic acid, acetylcholine, diacylglycerol, cGMP, cAMP, inositol phosphate, such as inositol-1,4,5- trisphosphate, and ions, including Ca ++ ions; altered cell membrane potential; GTP hydrolysis; influx or efflux of amino acids; increased or decreased phosphorylation of intracellular proteins; or activation of transcription.
  • second messengers including, for example, arachidonic acid, acetylcholine, diacylglycerol, cGMP, cAMP, inositol phosphate, such as inositol-1,4,5- trisphosphate, and ions, including Ca ++ ions; altered cell membrane potential; GTP hydrolysis; influx
  • Assays to detect and measure G-protein-coupled signal transduction can involve first contacting a sample containing CCR5, such as an isolated cell, membrane or artificial membrane, such as a liposome or micelle, with a detectable indicator.
  • a detectable indicator can be any molecule that exhibits a detectable difference in a physical or chemical property in the presence of the substance being measured, such as a color change.
  • Calcium indicators, pH indicators, and metal ion indicators, and assays for using these indicators to detect and measure selected signal transduction pathways are described, for example, in Haugland, Molecular Probes Handbook of Fluorescent Probes and Research Chemicals, Sets 20-23 and 25 (1992-94).
  • calcium indicators and their use are well known in the art, and include agents like Fluo-3 AM, Fura-2, Indo-1, FURA RED, CALCIUM GREEN, CALCnJM ORANGE, CALCR7M CRFMSON, BTC, OREGON GREEN BAPTA, which are available from Molecular Probes, Inc., Eugene OR, and described, for example, in U.S. Patent Nos. 5,453,517, 5,501,980 and 4,849,362.
  • An assay to identify agents that function as CCR5 antagonists are generally performed under conditions in which contacting the receptor with a known receptor agonist would produce a receptor signal.
  • An antagonist that prevents CCL5 from binding CCR5, or indirectly decreases the signaling activity of CCR5 can be identified.
  • the test agent can be tested at a range of concentrations to establish the concentration where half-maximal signaling occurs; such a concentration is generally similar to the dissociation constant (Kd) for CCR5 binding.
  • a binding assay can be performed to identify agents that are CCR5 antagonists.
  • CCR5 is contacted with one or more test agents under conditions in which an agent that binds CCL5, an agent that binds CCR5 or an agent that reduces binding of CCL5 to CCR5 can be identified.
  • Contemplated binding assays can involve detectably labeling a test agent, or competing an unlabeled test agent with a detectably labeled CCR5 agonist.
  • a detectable label can be, for example, a radioisotope, fluorochrome, ferromagnetic substance, or luminescent substance.
  • Exemplary radiolabels useful for labeling agents include 125 I, 14 C and 3 H.
  • the amount of binding of a given amount of the detectably labeled CC15 is determined in the absence of the test agent. Generally the amount of detectably labeled CC15 will be less than its K d , for example, 1/10 of its K4.
  • An exemplary assay for determining binding of detectably labeled CCL5 is the radioligand filter binding assay described in Li et al. Molecular Pharmacology 59:692-698 (2001)).
  • Either low- and high-throughput assays suitable for detecting selective binding interactions between a receptor and a ligand include, for example, fluorescence correlation spectroscopy (FCS) and scintillation proximity assays (SPA) reviewed in Major, J. Receptor and Signal Transduction Res. 15:595-607 (1995); and in Sterrer et al., J. Receptor and Signal Transduction Res. 17:511-520 (1997)).
  • Binding assays can be performed in any suitable assay format including, for example, cell preparations such as whole cells or membranes that contain a CCR5, or substantially purified CCR5, either in solution or bound to a solid support.
  • test agents to test in the methods of the invention will depend on the application of the method. For example, one or a small number of test agents can be advantageous in manual screening procedures, or when it is desired to compare efficacy among several predicted ligands, agonists or antagonists. However, it will be appreciated that the larger the number of test agents, the greater the likelihood of identifying an agent having the desired activity in a screening assay. Additionally, large numbers of agents can be processed in high-throughput automated screening assays.
  • Assay methods for identifying agents that selectively bind to or inhibit signaling through a CCR5 generally involve comparison to a control.
  • a control is a preparation that is treated identically to the test preparation, except the control is not exposed to the test agent.
  • Another type of "control” is a preparation that is similar to the test preparation, except that the control preparation does not express the receptor, or has been modified so as not to respond selectively to CCL5. In this situation, the response of the test preparation to a test agent is compared to the response (or lack of response) of the control preparation to the same agent under substantially the same reaction conditions.
  • An agent identified to be an agonist or antagonist of CCR5 can be tested for its ability to modulate one or more effects on the function of a cell or animal.
  • a CCR5 antagonist can be tested for an ability to reduce or inhibit tumor growth, reduce or inhibit liver neutrophilic infiltration, treat cancer, such as HCC, or treat a liver disease or disorder such as inflammation, cancer, fatty liver disease, alcohol induced fatty liver disease, non-alcohol induced fatty liver disease, cirrhosis, steatosis, steatohepatitis, viral infection, and fibrosis.
  • the invention provides a method for diagnosing or prognosing cancer in a subject.
  • the invention provides a method of diagnosing a subject as having, or at risk of having, cancer, for example, hepatocellular carcinoma.
  • the method includes obtaining a sample from the subject; detecting the presence or expression level of CCL5 in the sample; and diagnosing the subject as having, or at risk of having, hepatocellular carcinoma when the presence or expression level of CCL5 in the sample is elevated as compared to a corresponding normal sample.
  • the method further includes administering to the subject a therapeutic regime, such as administering a chemotherapeutic agent or a therapeutically effective amount of an agent which inhibits CCL5/CCR5 signal transduction.
  • Diagnosing includes determining, monitoring, confirmation, subclassification, and prediction of the relevant disease, complication, or risk.
  • Determining relates to becoming aware of a disease, complication, risk, and the like.
  • Monitoring relates to keeping track of an already diagnosed disease, complication, or risk factor, e.g., to analyze the progression of the disease or the influence of a particular treatment on the progression of disease or complication.
  • Consfirmation relates to the strengthening or substantiating of a diagnosis already performed using other indicators or markers.
  • Classification or “subclassification” relates to further defining a diagnosis according to different subclasses of the diagnosed disease, disorder, or condition, e.g., defining according to mild, moderate, or severe forms of the disease or risk.
  • Prediction relates to prognosing a disease, disorder, condition, or complication before other symptoms or markers have become evident or have become significantly altered.
  • risk relates to the possibility or probability of a particular event occurring either presently, or, at some point in the future.
  • Record stratification refers to an arraying of known clinical risk factors to allow physicians to classify patients into a low, moderate, high or highest risk of developing of a particular disease, disorder, or condition.
  • subject refers to any individual or patient to which the subject methods are performed. Generally the subject is human, although as will be appreciated by those in the art, the subject may be an animal. Thus other animals, including mammals such as rodents (including mice, rats, hamsters and guinea pigs), cats, dogs, rabbits, farm animals including cows, horses, goats, sheep, pigs, etc., and primates (including monkeys, chimpanzees, orangutans and gorillas) are included within the definition of subject.
  • rodents including mice, rats, hamsters and guinea pigs
  • cats dogs, rabbits, farm animals including cows, horses, goats, sheep, pigs, etc.
  • primates including monkeys, chimpanzees, orangutans and gorillas
  • the invention further provides a method for determining susceptibility of a subject to a therapeutic regime to treat cancer, i.e., hepatocellular carcinoma, or monitoring progression of cancer, i.e., hepatocellular carcinoma in a subject.
  • the method includes detecting the presence or expression level of CCL5 in a sample from the subject; and assessing the therapeutic regime or hepatocellular carcinoma progression based on the detection, thereby determining susceptibility of a subject to a therapeutic regime to treat hepatocellular carcinoma, or monitoring progression of hepatocellular carcinoma in a subject.
  • assessments be made over a particular time course in various intervals to assess a subject's progression and pathology. For example, analysis may be performed at regular intervals such as one day, two days, three days, one week, two weeks, one month, two months, three months, six months, or one year, in order to track level tumor progression or regression as a function of time. In the case of existing cancer patients, this provides a useful indication of the progression of the disease and assists medical practitioners in making appropriate therapeutic choices.
  • additional analysis may also be performed to characterize disease to provide additional clinical assessment.
  • PCR techniques may be employed, such as multiplexing with primers specific for particular cancer markers to obtain information such as the type of tumor, metastatic state, and degree of malignancy.
  • cell size, DNA or RNA analysis, proteome analysis, or metabolome analysis may be performed as a means of assessing additional information regarding characterization of the patient's cancer.
  • the additional analysis may provide data sufficient to make determinations of responsiveness of a subject to a particular therapeutic regime, or for determining the effectiveness of a candidate agent in the treatment of disease, i.e., cancer.
  • the present invention provides a method of determining responsiveness of a subject to a particular therapeutic regime or determining the effectiveness of a candidate agent in the treatment of cancer. For example, once a drug treatment is administered to a patient, it is possible to determine the efficacy of the drug treatment using the methods of the invention. For example, a sample taken from the patient before the drug treatment, as well as one or more cellular samples taken from the patient concurrently with or subsequent to the drug treatment, may be processed using the methods of the invention. By comparing the results of the analysis of each processed sample, one may determine the efficacy of the drug treatment or the responsiveness of the patient to the agent. In this manner, early identification may be made of failed compounds or early validation may be made of promising compounds.
  • administration or “administering” are defined to include an act of providing a compound and/or therapeutic agent, or agent of the invention to a subject in need of treatment. Administration may be via any appropriate route, depending on the type of therapeutic.
  • an agent that inhibits CCL5/CCR5 signal transduction may be coadministered with known chemotherapeutic agents, including but not limited to, Aclacinomycins, Actinomycins, Adriamycins, Ancitabines, Anthramycins, Azacitidines, Azaserines, 6-Azauridines, Bisantrenes, Bleomycins, Cactinomycins, Carmofurs, Carmustines, Carubicins, Carzinophilins, Chromomycins, Cisplatins, Cladribines, Cytarabines, Dactinomycins, Daunorubicins, Denopterins, 6-Diazo-5-Oxo-L-Norleucines, Doxifluridines, Doxorubicins, Edatrexates, Emitefurs, Enocitabines, Fepirubicins, Fludarabines, Fluorouracils, Gemcitabines, Idarubicin
  • hypoxia-inducible factor HIF-1
  • HIF-1 hypoxia-associated factor
  • mice were embryonic lethal, whereas male SART1 + 1 ' mice spontaneously recapitulated key features of nonalcoholic steatohepatitis (NASH)-driven hepatocellular carcinoma (HCC), including steatosis, fibrosis, and inflammatory cytokine production.
  • NASH nonalcoholic steatohepatitis
  • HCC hepatocellular carcinoma
  • Kupffer cells derived from male, but not female, SART1 + 1 ' mice produced increased levels of the HIF-1 -dependent chemokine, regulated on activation, normal T-cell expressed and secreted (RANTES), compared to wild type. This was associated with increased liver-neutrophilic infiltration, whereas infiltration of lymphocytes and macrophages were not significantly different. Neutralization of circulating RANTES decreased liver neutrophilic infiltration and attenuated HCC tumor initiation/growth in SART1 + 1 ' mice.
  • This work establishes a new tumor- suppressor role for HAF in immune cell function by preventing inappropriate HIF-1 activation in male mice and identifies RANTES as a novel therapeutic target for NASH and NASH-driven HCC.
  • mice were derived from the Texas Institute for Genomic Medicine gene trap C57BL/6 SARTl " " ES cell line (Clone IST11321E11). Genotyping was performed using allele-specific polymerase chain reaction PCR (Supplemental Methods). All animal procedures were performed in accord with institutional animal care and use protocols. [0094] GENE EXPRESSION ANALYSES
  • Human HCC (of unknown etiology) was purchased from US Biomax Inc (Rockville, MD). Additional sections were from formalin-fixed, paraffin-embedded nonalcoholic steatohepatitis (NASH)-associated HCC tumors collected during surgical resections and liver transplants (normal liver samples) at the Mayo Clinic between 1997 and 2013. Sections were examined by a pathologist, graded histologically, and classified by etiology. The study was approved by the Mayo Clinic Institutional Review Board.
  • NASH nonalcoholic steatohepatitis
  • MRI Magnetic resonance imaging
  • Wild-type gene SARTl wt F/R (896 bp product in wild-type and heterozygous mice): GAAACGCGATGACGGCTACGAGG (SEQ ID NO: 1) /
  • LacZ disruption V76 F/ SART1 wt R (het/ko yields product 578 bp - no product in wild-type mice):
  • Huh7 human hepatoma cells and THP-1 human monocyte cells were purchased from Japanese Collection of Research Bioresources (JCRB, NIBIO Osaka, Japan) and American Type Culture Collection (ATCC, Manassas VA) respectively and verified by STR fingerprinting.
  • Huh7 and THP-1 cells were transfected with siRNA using LipofectamineTM 2000 (Invitrogen, Life Technologies, Grand Island NY) or DharmafectTM 4 (GE Dharmacon Lafayette, CO) respectively according to the manufacturer's protocol.
  • THP-1 cells were differentiated with 25ng/ml phorbol myristate acetate (PMA, Sigma - Aldrich, St. Louis MO) 24 hours prior to siRNA transfection.
  • PMA phorbol myristate acetate
  • siRNA 72 hours prior to assay HAF (SARTI) siRNA was ON-Targetplus SMARTpoolTM (Dharmacon L-017283, siHAF or siHAF l), and Hs_SARTl_3 (siHAF_2, Qiagen, Germantown MD).
  • Control siRNA (siCon) was si GENOMETM Non-targeting siRNA#3 (Dharmacon). All siRNAs were transfected at a final concentration of 40nM.
  • HIF-la/CD68 dual staining was performed using Chromoplexl DualTM detection (DS 9477, Leica Biosystems, Buffalo Grove IL).
  • IHC for HIF-la and HAF was performed as previously described.
  • IHC antibodies for Ly6G, Cd68 and RANTES were from BD Pharmingen (#559286 BD Biosciences San Jose CA), Novus Biologicals (NB 100-2086 Littleton, CO) and Abeam (#ab9679, Cambridge, MA) respectively, whereas HIF-la and HIF-2a antibodies used in mouse tissue were from Novus (NBlOO-479, NBlOO-122).
  • WB was performed using Acsll, Cyp2bl0, actin and HAF from Cell signaling Technology (4047S, Danvers MA), EMD Millipore (AB9916), Santa Cruz Biotechnology Inc. (1-19, Dallas, TX), or made-in house respectively.
  • KCs were isolated using in vitro collagenase incubation following liver perfusion as previously described. After Percoll purification and RBC lysis, cells were washed twice in RPMI 1640TM media (Life Technologies) containing 10% FBS, and seeded at a density of 106 cells in 6-well plates. After washing to remove non-adherent cells, cells were left to recover for 24-36 hours, after which media was changed for an additional 6 hours. Media was then removed for cytokine analysis using the Mouse Cytokine ArrayTM C3 (Raybiotech Inc, Norcross GA) according to manufacturer's protocol. Films were scanned using the CanoScan 9000 scanner and quantitated by Raybiotech using in-house analysis software.
  • Hepatocytes were isolated using proprietary Liver Perfusion and Liver Digest MediumTM (Life Technologies) according to the manufacturer's protocol. Purified hepatocytes were seeded at 8000 cells/well in XF96 cell culture microplates (Seahorse Bioscience, MA) pre-coated with rat tail Collagen I (12 ⁇ g/cm2, GeltrexTM), starved overnight, then run on the XFe96 extracellular flux analyzer the next day according to the manufacturer protocol.
  • Huh7 cells from JCRB, confirmed by STR fingerprinting
  • Huh7 cells were reverse transfected with HAF or non-targeting siRNA (L-017283-00-0005, D-001210-05- 20; GE Dharmacon, Lafayette CO) using Dharmafect 4TM and seeded at 6500 cells/well in an XF96 cell culture microplate.
  • OCR analysis was performed 72 hours after siRNA transfection.
  • PBMCs and spleen mononuclear cells were prepared by standard protocols (5). For induction of HIF-la, spleen cells were seeded at 4E6 cells/well 6-well plates and exposed to hypoxia (1% 0 2 . 5% C0 2 , InVivo2400, Baker Ruskinn Sanford ME) for 2 hours prior to lysis. PBMCs were lysed immediately after purification. [00119] FLOW CYTOMETRY
  • Mouse liver profiling Ly6G-FITC, CDl lc-PE, CD3-APC, TCRgd-PE Cy7, CD45-Pacific Blue, CD 19 Alexa fluor700.
  • Spleen profiling TCRp-PECy7, CD19-PE, F4/80-APC,Ly6G-APC Cy7, TCRy5- PE, CDl lc-APC, 7AAD-APCefiuor780.
  • LacZ activity was quantitated using the Fluoreporter LacZTM kit (Life Technologies F-1930) according to manufacturer's protocol.
  • tumor nodules were discerned based on their separation in 3D space from neighboring tumor nodules. All tumor growth in the liver was manually segmented on each slice in which tumor growth was resolved using the Amira Segmentation Editor. The presence of hepatic tumor nodules was confirmed grossly at necropsy, which was performed 48 hours after imaging, and by histopathologic examination of H&E stained sections.
  • HAF heterozygous (het) mice (SART1 +/" ) were generated using C57BL/6 embryonic stem cells produced by the gene trap method ( Figure 1 A). Tissue-wide profiling of male WT and SARTl +/ mice confirmed expression of HAF in multiple organs, including skin, lung, heart, liver, kidney, spleen, and colon, with highest expression within the spleen (data not shown). HAF heterozygosity was associated with significant decreases of HAF in heart, liver, and kidney and caused more subtle decreases in other tissues in which HAF could be detected (Figure IB).
  • mice heterozygous for HAF appeared to develop normally and displayed no anatomically observable defects.
  • male SART1 +/" mice were significantly smaller and had ruffled fur compared to their WT counterparts (data not shown).
  • Necropsy revealed multifocal large liver tumors (histologically confirmed as HCC) in -83% (5 of 6) of male SART1 +/" mice, which were absent from their WT littermates (data not shown), whereas both WT and SART1 +/" male mice exhibited severe hepatic steatosis (HS).
  • Livers of the SART1 +/" mice displayed hallmarks of NASH-driven HCC, including HS (confirmed by Oil Red O staining), fibrosis (confirmed by Sirius Red staining), and foci of immune cell infiltration (data not shown).
  • Visual analysis of additional male SART1+/- mice confirmed grossly visible tumors in an additional 90% (9 of 10) of mice.
  • livers of age- matched SART1 +/" females showed minimal steatosis, and no malignant tumors were detected either grossly or histologically (0 of 4, not shown).
  • Liver tumors were detected by MRI in a further 57% (4 of 7) of male SART1 +/" mice ages 16-18 months (data not shown), but were not detected in male mice under 10 months (0 of 21) nor in female SART1 +/" mice ages 16-19 months (0 of 3). Rapid growth of the liver tumors was apparent when tumor growth was monitored in one 16- to 18-month-old mouse, where multiple large liver tumor nodules (data not shown) confirmed histologically as HCC were found. No other obvious abnormalities were observed in blood or any of the other major organs apart from age-related changes. Hence, germline haploinsufficiency of HAF promotes spontaneous HCC development only in male mice >age 10 months.
  • livers of 1-month-old SART1 +/" mice were indistinguishable from those of their WT littermates (data not shown).
  • SART1 +/" livers showed moderate to marked microvesicular HS with increased severity in the centri-lobular/periacinar and midzonal regions and also showed multiple foci of altered hepatocytes with atypical nuclei ( Figure 3A). These foci were composed of hypertrophic or cytomegalic hepatocytes and showed increased proliferation supported by the increased number of mitotic and binucleated hepato-cytes.
  • livers of WT littermates showed only very mild steatosis and no preneoplastic lesions. Consistent with the age-related progression to HCC, elevation of the serum transaminases, alanine aminotransferase, aspartate aminotransferase, or alkaline phosphatase, in SART1 +/" mice versus WT become apparent from 6 months of age (data not shown). The age-associated liver phenotypes of SART1 +/" mice are summarized in Figure 3B.
  • IP A the top biological functions associated with these differentially expressed genes were those involved in the inflammatory response, cancer, and lipid metabolism (data not shown). Highly significant changes were also observed in genes associated with hepatocyte hyperplasia/proliferation, steatosis, and HCC. All these expression changes were consistent with the observed steatosis/ steatohepatitis/HCC phenotype in SART1 +/" livers.
  • SART1 +/" hepatocytes When treated with the mitochondrial uncoupler, p-triflouromethoxyphenylhydrazone (FCCP), which induces maximal respiration, SART1 +/" hepatocytes showed an almost 4-fold decrease in the ability to utilize exogenous palmitate compared to WT hepatocytes ( Figures 4A-4B). Similar results were obtained using Huh7 human hepatoma cells transiently transfected with control or HAF (SARTl) small interfering (si)RNA ( Figures 4C-4D). Thus, the enhanced HS observed in the SART1 +/" livers is likely attributable to defective FAO.
  • FCCP p-triflouromethoxyphenylhydrazone
  • SART1 +/ - MICE SHOW MARKED UP-REGULA TION OF HIF-la IN IMMUNE CELLS [00140]
  • SART1 " livers showed changes consistent with increased inflammatory cell activation and trafficking (Figure 3E). Indeed, SART1 +/" livers showed extensive immune cell infiltration, distributed randomly and sporadically, often in clusters, throughout liver parenchyma (data not shown). These included cells positive for F4/80 or Ly6G, suggesting that these clusters contained macrophages and neutrophils respectively (data not shown).
  • Kupffer cell (KC) hyperplasia (likely a result of phagocytosis of disrupted hepatocytes) was observed in 100% (6 of 6) of the SART1 +/" livers, but not in WT livers (data not shown).
  • liver-infiltrating immune cells were markedly HIF-la positive in SART1 +/" , but not in WT, livers.
  • Increases in HIF-la was manifest primarily in SART1 +/" immune cells, but not in SART1 +/" hepatocytes, suggesting that HIF-la up-regulation was not attributable to a general hypoxic environment within livers (data not shown).
  • HIF-la up-regulation played a causal role in HCC carcinogenesis in SARTl +/ ⁇ mice, or occurred as a result of the HCC already present
  • the inventors isolated mononuclear cells from peripheral blood (PBMCs) and spleens of 6- month-old SARTl +/ ⁇ and WT mice.
  • HIF-la protein levels were significantly elevated in both PBMCs and splenocytes from SARTl +/ ⁇ versus WT mice, but not in primary hepatocytes (Figure 5A).
  • splenocytes did not express detectable HIF-la unless exposed to hypoxia (only cells exposed to hypoxia are depicted), suggesting some intrinsic differences in HIF-la expression in these cell types. These findings were associated with a reduction in HAF protein levels expected of the SARTl +/ ⁇ genotype (data not shown).
  • the inventors did not detect up-regulation of HIF-la in PBMCs or splenocytes isolated from 6-month-old female SARTl +/ ⁇ mice and only detected subtle decreases in HAF levels (data not shown).
  • the data suggest that HIF-la up-regulation in immune cells was intrinsic to male SARTl +/ ⁇ mice and occurred independently of HCC.
  • the inventors measured activity of the LacZ reporter transgene used to disrupt the SART1 gene.
  • the inventors detected LacZ positivity in a wide variety of cell populations, including spleen- and bone-marrow-derived cells and peripheral blood leukocytes (Fig 5B).
  • Fig 5B peripheral blood leukocytes
  • the inventors stained splenocytes with surface markers CD 19 (B cells), TCRb (T cells), Ly6G (neutrophils), and F4/80 (macrophages) before the Lac Z activity assay.
  • LacZ/FITC fluorescein isothiocyanate
  • HCC IS PRECEDED BY INCREASED RANTES SECRETION AND ELEVATED NEUTROPHILIC INFILTRATION
  • HIF-la up-regulation the inventors also detected an age-dependent, albeit delayed, increase (compared to RANTES) in transcription of HIF-1 target genes facilitated glucose transporter 1 (Slc2al), hexokinase 1 (Hkl), and pyruvate kinase (muscle) 1 (Pkml) in SART1 +/" livers, indicating a general shift toward glycolytic metabolism.
  • the inventors did not observe any differences in secretion of RANTES or other cytokines by KCs from similar-aged female SART1 +/" livers compared to WT (data not shown).
  • the inventors also observed a 3 -fold increase in Ly6G + neutrophils within livers of 1-month-old SART1 +/" mice, which was not observed in spleens, suggesting that increased neutrophilic infiltration was an early event independent of HS and was not attributable to systemic elevation of the neutrophil population (data not shown).
  • SART1 +/" KCs secrete elevated levels of cytokines/chemokines, including a > 100-fold increase in RANTES. This was associated with increased neutrophilic infiltration in male SART1 +/" livers before development of steatosis or HCC.
  • the inventors also observed a significant decrease in Ly6G + -infiltrating neutrophils in both tumor and adjacent normal tissue of mice treated with RANTES compared to those treated with saline alone (data not shown).
  • RANTES neutralization inhibits both initiation/promotion and growth of liver tumors and attenuates neutrophilic infiltration in livers of SART1 +/" mice.
  • HIF- la-positive immune infiltrating cells in the context of largely HIF-la-negative hepatocytes was also observed in human HCC, including NASH-derived HCC (data not shown).
  • RANTES expression in both hepatocytes and immune infiltrating cells was also up-regulated in NASH-derived HCC compared to normal liver (data not shown).
  • HAF staining was detected primarily in infiltrating cells in normal human liver, but was largely negative in human NASH-derived HCC (data not shown), thus supporting a role for HAF as a tumor suppressor for HCC.
  • HCC is the most common primary malignancy of the liver, with more than 750,000 new patients diagnosed globally each year. HCC frequently develops in the context of chronic hepatitis, which may arise from infection with hepatitis B or hepatitis C virus (HCV), and from alcoholic or nonalcoholic fatty liver disease (NAFLD).
  • HCV hepatitis B
  • NASH nonalcoholic fatty liver disease
  • HCC pathogenesis has been described by the "two-hit" hypothesis whereby the first hit— steatosis/ viral infection— sensitizes the liver to a variety of second hits, such as oxidative stress and abnormal cytokine production, which lead to necroinflammation and fibrosis.
  • HCC human HCC
  • infiltrating immune cells are known human HCC have confounded the identification of to be involved in HCC initiation and progression, the individual key cytokines to target for therapy.
  • the robust timeline for HCC development in the male SART1 +/" mice enabled identification of RANTES as an early, non-redundant event driving HCC initiation and progression, likely by promoting neutrophil infiltration.
  • increased circulating RANTES has been associated with obesity in humans and is up-regulated in patients with NAFLD/ NASH, suggesting that RANTES might be involved in the progression to NASH-driven HCC.
  • the evaluation of the relevance of HIF- 1/RANTES to NASH-driven HCC is currently being investigated in a larger patient set.
  • RANTES elevation has also been observed in patients with alcoholic and viral hepatitis, whereas RANTES polymorphisms correlate to susceptibility to HCC, suggesting that RANTES may be a valid therapeutic target for HCC regardless of etiology.
  • mice Female SART1 +/" and WT mice, even at >16 months of age, develop only mild HS, if at all, and do not become obese like their male counterparts (unpublished observations).
  • HAF oxygen-independent ubiquitin ligase
  • this study identifies a novel tumor-suppressor function of HAF by maintaining regular hepatic metabolism, and in preventing inappropriate immune cell activation, possibly by suppressing HIF- ⁇ . Additionally, the inventors described a novel mouse model of NASH-derived HCC, which closely recapitulates the human disease. These findings highlight a central role of the HIF-l/RANTES axis in HCC initiation and progression, thus identifying a novel target for therapy.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Biomedical Technology (AREA)
  • Urology & Nephrology (AREA)
  • Hematology (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • Cell Biology (AREA)
  • Pathology (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Food Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • General Physics & Mathematics (AREA)
  • Toxicology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Hospice & Palliative Care (AREA)
  • Oncology (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

La présente invention concerne la découverte d'un nouveau rôle suppresseur de tumeur pour HAF dans la fonction cellulaire immune par la prévention de l'activation inappropriée de HIF-1 chez une souris mâle SART1+/". La découverte a permis d'identifier la RANTES (lymphocyte T normal régulé par activation, exprimé et sécrété, également nommée ligand de chémokine (motif C-C) 5 ou CCL5) en tant que cible thérapeutique pour une maladie induite par le CCL5, telle que le cancer. En tant que telle, la présente invention concerne, en partie, une méthode de traitement d'une maladie induite par le CCL5 par l'administration d'un agent qui inhibe la transduction de signal CCL5/CCR5.
PCT/US2016/054150 2015-09-28 2016-09-28 Cibles pour le traitement du carcinome hépatocellulaire et procédés associés WO2017058896A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201562233773P 2015-09-28 2015-09-28
US62/233,773 2015-09-28

Publications (1)

Publication Number Publication Date
WO2017058896A1 true WO2017058896A1 (fr) 2017-04-06

Family

ID=58427344

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2016/054150 WO2017058896A1 (fr) 2015-09-28 2016-09-28 Cibles pour le traitement du carcinome hépatocellulaire et procédés associés

Country Status (1)

Country Link
WO (1) WO2017058896A1 (fr)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110075121A (zh) * 2018-07-26 2019-08-02 中国人民解放军空军军医大学第一附属医院 miR-4295在制备治疗胃癌的药物中的用途
WO2019229615A1 (fr) 2018-05-28 2019-12-05 Université De Genève Méthodes d'inhibition de l'inflammation cérébrale
WO2021231648A3 (fr) * 2020-05-12 2021-12-23 Gigagen, Inc. Agents thérapeutiques contre le cancer comprenant une chimiokine ou son analogue
CN115992244A (zh) * 2022-11-28 2023-04-21 武汉大学 Sart1在肝癌治疗中的作用

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20130303512A1 (en) * 2012-05-14 2013-11-14 Richard G. Pestell Use of modulators of CCR5 in the treatment of Cancer and cancer metastasis

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20130303512A1 (en) * 2012-05-14 2013-11-14 Richard G. Pestell Use of modulators of CCR5 in the treatment of Cancer and cancer metastasis

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
ASANO ET AL.: "Preparation and Activities of Macromolecule Conjugates of the CCR5 Antagonist Maraviroc.", ACS MED CHEM LETT., vol. 5, no. 2, 13 February 2014 (2014-02-13), pages 133 - 137, XP055385232 *
OCHOA-CALLEJERO ET AL.: "Maraviroc, a CCR5 Antagonist, Prevents Development of Hepatocellular Carcinoma in a Mouse Model.", PLOS ONE, vol. 8, no. 1, 2013, pages e53992, XP055385231 *

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019229615A1 (fr) 2018-05-28 2019-12-05 Université De Genève Méthodes d'inhibition de l'inflammation cérébrale
CN110075121A (zh) * 2018-07-26 2019-08-02 中国人民解放军空军军医大学第一附属医院 miR-4295在制备治疗胃癌的药物中的用途
CN110075121B (zh) * 2018-07-26 2022-01-21 中国人民解放军空军军医大学第一附属医院 miR-4295在制备治疗胃癌的药物中的用途
WO2021231648A3 (fr) * 2020-05-12 2021-12-23 Gigagen, Inc. Agents thérapeutiques contre le cancer comprenant une chimiokine ou son analogue
CN115992244A (zh) * 2022-11-28 2023-04-21 武汉大学 Sart1在肝癌治疗中的作用
CN115992244B (zh) * 2022-11-28 2024-06-04 武汉大学 Sart1在肝癌治疗中的作用

Similar Documents

Publication Publication Date Title
Usami et al. Intercellular adhesion molecule‐1 (ICAM‐1) expression correlates with oral cancer progression and induces macrophage/cancer cell adhesion
Pan et al. Annexin A3 promotes tumorigenesis and resistance to chemotherapy in hepatocellular carcinoma
Mazzocca et al. Lysophosphatidic acid receptor LPAR6 supports the tumorigenicity of hepatocellular carcinoma
Tilli et al. Both osteopontin‐c and osteopontin‐b splicing isoforms exert pro‐tumorigenic roles in prostate cancer cells
US20100015128A1 (en) GRP78 as a Predictor of Responsiveness to Therapeutic Agents
Zhou et al. Upregulation of REG Iα accelerates tumor progression in pancreatic cancer with diabetes
Parker et al. Primary tumour expression of the cysteine cathepsin inhibitor Stefin A inhibits distant metastasis in breast cancer
US8133692B2 (en) Methods of predicting responsiveness to chemotherapeutic agents and selecting treatments
US20080311039A1 (en) Therapeutic and Prognostic Factor Yy1 in Human Cancer
WO2017058896A1 (fr) Cibles pour le traitement du carcinome hépatocellulaire et procédés associés
Wang et al. Long noncoding RNA DIO3OS hinders cell malignant behaviors of hepatocellular carcinoma cells through the microRNA-328/Hhip Axis
WO2016152352A1 (fr) Biomarqueur spécifique du mélanome et son utilisation
Zou et al. LINC00261 elevation inhibits angiogenesis and cell cycle progression of pancreatic cancer cells by upregulating SCP2 via targeting FOXP3
US20110052667A1 (en) Compositions and methods for inhibiting angiogenesis and tumorigenesis
US7820401B2 (en) Collagen VI and cancer
WO2017078318A1 (fr) Composition de biomarqueur permettant une prédiction de la sensibilité au sorafénib
Chen et al. KRT17 promotes the activation of HSCs via EMT in liver fibrosis
JP7281833B2 (ja) 新規膵臓癌上皮間葉移行マーカー
Zhou et al. HUS1 checkpoint clamp component (HUS1) is a potential tumor suppressor in primary hepatocellular carcinoma
WO2011129427A1 (fr) Agent de diagnostic et agent thérapeutique pour les cancers
US7407763B2 (en) Systems and methods for detecting and regulating metastasis
EP3460476B1 (fr) Composition de biomarqueur comprenant lrp-1 en tant que principe actif pour le diagnostic du cancer résistant à l&#39;irradiation ou la prédiction du pronostic d&#39;une radiothérapie
KR101983435B1 (ko) Rnf20의 신장암 또는 간암 진단, 치료 및 치료제 스크리닝 용도
JP7249044B2 (ja) 腫瘍細胞の悪性化抑制剤及び抗腫瘍剤
KR101974509B1 (ko) 보체 단백질의 간암 진단 용도

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16852475

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 16852475

Country of ref document: EP

Kind code of ref document: A1