WO2017055518A1 - Moyen et procédé de production d'un composé amide - Google Patents

Moyen et procédé de production d'un composé amide Download PDF

Info

Publication number
WO2017055518A1
WO2017055518A1 PCT/EP2016/073372 EP2016073372W WO2017055518A1 WO 2017055518 A1 WO2017055518 A1 WO 2017055518A1 EP 2016073372 W EP2016073372 W EP 2016073372W WO 2017055518 A1 WO2017055518 A1 WO 2017055518A1
Authority
WO
WIPO (PCT)
Prior art keywords
biocatalyst
buffer
mixture
dried
acrylonitrile
Prior art date
Application number
PCT/EP2016/073372
Other languages
English (en)
Inventor
Michael Guenter BRAUN
Juergen Daeuwel
Peter OEDMAN
Michael Kiefer
Matthias Kleiner
Hans-Juergen Lang
Diego GHISLIERI
Original Assignee
Basf Se
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Basf Se filed Critical Basf Se
Publication of WO2017055518A1 publication Critical patent/WO2017055518A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/02—Amides, e.g. chloramphenicol or polyamides; Imides or polyimides; Urethanes, i.e. compounds comprising N-C=O structural element or polyurethanes

Definitions

  • the present invention relates to a method for producing an amide compound from a nitrile compound in aqueous mixture, the method comprising: (a) a pre-treatment step comprising mixing a dried biocatalyst with an aqueous solution to give a pre-treatment mixture, wherein the pre-treatment mixture comprises a buffer, and (b) converting the nitrile compound to the amide compound using the biocatalyst in a reaction mixture, wherein the reaction mixture comprises said buffer of step (a), and wherein the ratio of the molar concentration of the buffer in the pre-treatment mixture to the molar concentration of said buffer in the reaction mixture is about 2:1 or more.
  • the present invention further relates to an aqueous amide compound mixture obtainable or being obtained by said method.
  • the present invention still further relates to a method of pre-treating a dried biocatalyst for the production of an amide compound from a nitrile compound in aqueous mixture.
  • the present invention provides a composition comprising an amide compound and a biocatalyst, wherein the biocatalyst has been pre-treated according to the method of the present invention.
  • the present invention further relates to a method for increasing the reaction rate of converting a nitrile compound to an amide compound using a biocatalyst in aqueous mixture and a method for reducing the biocatalyst amount necessary for converting a nitrile compound to an amide compound in aqueous mixture.
  • the present invention also provides for the use of an aqueous solution or mixture comprising a buffer for pre-treatment of a dried biocatalyst for the production of an amide compound from a nitrile compound in aqueous mixture.
  • Acrylamide is used as a monomer to form polymers and copolymers of acrylamide.
  • aqueous acrylamide solutions prepared by bioconversion can be used.
  • NHase nitrile hydratase
  • microorganisms having NHase activity have been intensively used for the industrial production of amide compounds. Due to milder reaction conditions compared to the chemical synthesis of amides, the use of NHase producing microorganisms as biocatalysts is more and more on the rise.
  • nitrile bioconversion by NHase producing microorganisms is the manufacture of acrylamide from acrylonitrile.
  • the technical problem underlying the present invention is therefore to provide an improved bioconversion process of a nitrile compound to an amide compound.
  • biocatalyst may be dried in order to improve its long- term stability and that such a dried biocatalyst may then be applied directly into the reaction mixture, or alternatively, the biocatalyst may be dissolved or re-suspended in an aqueous solution prior to the addition to the reaction mixture.
  • bioconversion reactions especially in industrial scale, should preferably be conducted in a rather simple way.
  • the present inventors have considered that keeping the molar concentration of a buffer in the reaction mixture comparably low, preferably as low as possible, has several advantages for the bioconversion process. For example, if a comparably large amount of buffer is present in the reaction mixture, it would consequently be present in the wastewater in comparably large amounts. This means that the buffer will have to be removed from the wastewater again, which will result in additional technical efforts and costs. In addition, the presence of comparably large amounts of a buffer in the product, i.e.
  • the amide solution may negatively influence subsequent reaction steps, such as, for example, polymerization or copolymerization reactions.
  • subsequent reaction steps such as, for example, polymerization or copolymerization reactions.
  • the buffer may result in a decrease of the quality of the product. Consequently, the bioconversion of a nitrile compound to an amide compound is preferably conducted in aqueous solution in the presence of comparably low amounts of buffer.
  • the present inventors have further discovered that keeping the molar buffer concentration in the reaction mixture comparably low has no influence on the bioconversion of a nitrile compound into an amide compound. Furthermore, the present inventors have found that a pH control is not necessary for keeping the pH within a certain range during the bioconversion of a nitrile compound to an amide compound. Typically, the bioconversion may start at a pH in a range of pH 7 to 8.5, preferably pH 7.5 to 8.0 and stays within this range until the end of the bioconversion without pH control and/or addition of further buffer.
  • a dried biocatalyst which has been obtained, for example, by spray drying or freeze drying, may in general be suspended in water, and said aqueous mixture containing the biocatalyst may be then transferred to the reactor in which the bioconversion is carried out and where the biocatalyst is contacted with an aqueous mixture and a nitrile compound that is to be converted into the corresponding amide.
  • the present inventors have surprisingly found that, if a dried biocatalyst is mixed with a non-buffered aqueous solution, the pH of the aqueous mixture containing the biocatalyst will be in a weakly acidic range (e.g. pH 5 to 6.5). This is surprising since prior to drying, e.g. spray drying or freeze drying, the wet biocatalyst is in a medium that typically has a neutral pH (e.g. pH 6.7 to 7.5). Moreover, the reaction mixture during bioconversion is rather weakly basic. Without wishing to be bound by theory, it is believed that during the drying step, ammonia (NH3) strips from the medium which results in the weakly acidic pH of the dried biocatalyst when mixed with an aqueous solution prior to bioconversion.
  • NH3 ammonia
  • the present inventors have surprisingly discovered that the acidic pH of the aqueous mixture of the dried biocatalyst results in a diminished activity of the NHase and that this diminishment may be irreversible, which means that the NHase activity will remain diminished even if the bioconversion is conducted in a reaction mixture that has a neutral or slightly basic pH.
  • the present inventors have conducted various experiments and have found out that if the dried biocatalyst is pre-treated by suspending it in a buffered aqueous solution prior to bioconversion, wherein the solution has a neutral or slightly basic pH (e.g. pH 6.6 to 9), the biocatalyst will have a substantially increased NHase activity. This high NHase activity is maintained even if the pre-treatment mixture (i.e. the buffered aqueous mixture comprising the biocatalyst) is transferred to a non-buffered aqueous solution in order to give the reaction mixture.
  • a neutral or slightly basic pH e.g. pH 6.6 to 9
  • the total reaction time of the bioconversion is crucially decreased as compared to the reaction time of the bioconversion where the same amount of biocatalyst has been suspended in water without buffer after spray drying (Fig. 1 , 2 and 5-13).
  • simply adding the buffer to the reaction mixture does not lead to the same effect as when the dried biocatalyst has been re-suspended in the buffer as pre- treatment before adding to the reaction mixture (Fig. 1 and 3).
  • the biocatalyst also has a substantially increased NHase activity when the buffer is added to the cell suspension after fermentation and the biocatalyst is dried with the buffer and afterwards re-suspended in water (Fig.
  • the pre-treatment of the biocatalyst may be performed by suspending the dried biocatalyst in an aqueous solution containing a buffer. Such pre-treatment can be performed on a small scale, i.e.
  • the reaction volume required for the pre-treatment is comparably small.
  • the reaction mixture in which the bioconversion of the nitrile compound to the amide compound is performed in general has a comparably large volume. Due to the low volume of the pre-treatment mixture compared to the volume of the reaction mixture, the buffer component is diluted in the reaction mixture when the pre- treatment mixture is transferred to the reactor for the bioconversion of the nitrile compound to the amide compound. Nevertheless, the beneficial effect of the buffer during the pre- treatment is preserved in the bioconversion.
  • the bioconversion of a nitrile compound to an amide compound using the biocatalyst exhibits a higher reaction rate if the same amount of biocatalyst is employed (Fig. 1 , 2 and 5-13). Further, the amount of biocatalyst can be reduced while achieving a reaction rate that is even higher than the reaction rate when using a non-reduced amount of un-pre-treated biocatalyst, i.e. a biocatalyst re-suspended in water after drying (Fig. 1 and 4).
  • buffers in particular neutral buffers, such as, for example, phosphate buffer, citrate buffer, Tris, TES, ACES, PIPES and others can be used to achieve the described effect of an increased NHase activity (Fig. 11 -13).
  • neutral buffers such as, for example, phosphate buffer, citrate buffer, Tris, TES, ACES, PIPES and others
  • the present inventors have dissolved the discrepancy that a buffer is not desired in the reaction mixture, i.e. that the amount of the buffer in the reaction mixture should be kept low in the reaction mixture, but that a buffer is desired for the pre-treatment of a dried biocatalyst prior to bioconversion of a nitrile compound to an amide compound.
  • a buffer is not desired in the reaction mixture, i.e. that the amount of the buffer in the reaction mixture should be kept low in the reaction mixture, but that a buffer is desired for the pre-treatment of a dried biocatalyst prior to bioconversion of a nitrile compound to an amide compound.
  • the present invention demonstrates that the amount of biocatalyst necessary for a full conversion of a nitrile compound to an amide compound can be strongly reduced by pre-treating the biocatalyst with a buffer, wherein the ratio of the molar concentration of the buffer in the pre- treatment mixture to the molar concentration of said buffer in the reaction mixture is about 2:1 or more.
  • WO 02/18612 does not give a hint that pre-treatment of a dried biocatalyst with a buffered aqueous solution will increase the NHase activity of the biocatalyst compared to re-suspending the dried biocatalyst in non-buffered aqueous solution.
  • the present invention relates to means and methods to improve the bioconversion of a nitrile compound to an amide compound by enhancing the NHase activity of a biocatalyst used in said bioconversion.
  • the present inventors suggest that the ratio of the molar concentration of the buffer used during pre- treatment of the biocatalyst, i.e. prior to the bioconversion, to the molar concentration of said buffer in the reaction mixture should be at least 2:1 or more.
  • the amount of buffer during pre-treatment of the biocatalyst is diluted in the reaction mixture, i.e. during the bioconversion of a nitrile compound to an amide compound.
  • the present invention relates to a method for producing an amide compound from a nitrile compound in aqueous mixture, the method comprising: (a) a pre-treatment step comprising mixing a dried biocatalyst with an aqueous solution to give a pre-treatment mixture, wherein the pre-treatment mixture comprises a buffer; and (b) converting the nitrile compound to the amide compound using the biocatalyst in a reaction mixture, wherein the reaction mixture comprises said buffer of step (a), and wherein the ratio of the molar concentration of the buffer in the pre-treatment mixture to the molar concentration of said buffer in the reaction mixture is about 2:1 or more.
  • the ratio of the molar concentration of the buffer in the pre-treatment mixture to the molar concentration of said buffer in the reaction mixture is about 2:1 or more before the end of the conversion. It is not required in any one of the methods disclosed herein that the ratio is maintained constant during the conversion. Rather the ratio may vary during the conversion, as long as the ratio is about 2:1 or more. For example, the ratio may increase during the conversion. This may be the case if reactants are added to the reaction mixture during the conversion which dilute the reaction mixture and thereby decrease the buffer concentration in the reaction mixture. For example, the nitrile compound and/or water may be fed as reactants to the reaction mixture during the conversion. This increases the volume of the reaction mixture, and, thus, decreases the molar concentration of the buffer in the reaction mixture.
  • the ratio of the molar concentration of the buffer in the pre-treatment mixture to the molar concentration of the buffer in the reaction mixture increases.
  • the molar ratio can vary over the course of conversion reaction.
  • the ratio of the molar concentration of the buffer in the pre-treatment mixture to the molar concentration of said buffer in the reaction mixture may be about 3:1 or more, preferably about 4:1 or more, more preferably about 5:1 or more, even more preferably about 7:1 or more, still more preferably about 10:1 or more, still more preferably about 20:1 or more, still more preferably about 50:1 or more, even more preferably about 75:1 or more, most preferably about 100:1 or more.
  • these ratios are present before the end of the conversion.
  • these concentrations are both indicated in mol/L (moles per liter).
  • both the molar concentration of the buffer in the pre-treatment mixture and the molar concentration of the buffer in the reaction mixture have to be taken in mol/L. It is also contemplated by the invention that the buffer of the pre-treatment mixture may be at least partially removed after the pre-treatment step and before the biocataiyst is contacted with a nitrile compound.
  • this can be done by centrifugation of the pre-treatment mixture followed by discarding the supernatant, optionally followed by contacting the biocataiyst with another aqueous solution, or, as another illustrative example, by filtration.
  • the biocataiyst (suspension) will typically still contain residual buffer when the biocataiyst is contacted with the nitrile compound. It is understood by the skilled artisan, that the less residual buffer is present in the biocataiyst, the higher the ratio of the molar concentration of the buffer in the pre-treatment mixture to the molar concentration of said buffer in the reaction mixture may typically be.
  • the pre-treatment may comprise the steps of: (i) contacting an aqueous solution with a buffer to give a buffered aqueous solution, and (ii) mixing the dried biocatalyst with the buffered aqueous solution to give a pre-treatment mixture. It is also envisaged that the pre-treatment comprises contacting a mixture of dried biocatalyst and buffer with an aqueous solution to give a pre-treatment mixture.
  • the biocatalyst and the buffer can be mixed prior to or during the drying step.
  • the dried biocatalyst may be mixed with buffer prior to contacting the mixture with an aqueous solution.
  • pre-treatment or "pre-treating” as used herein in the context of a dried biocatalyst in general refers to mixing the dried biocatalyst with an aqueous solution to give an aqueous mixture comprising the biocatalyst and a buffer. Said mixture is also referred herein as "pre- treatment mixture".
  • the pre- treatment mixture may be prepared by mixing a buffer with an aqueous solution to give a buffered aqueous solution and subsequently dissolving or suspending the dried biocatalyst in the buffered aqueous solution.
  • the pre-treatment mixture can also be prepared by mixing the dried biocatalyst with buffer components, in particular dry buffer components, and subsequently adding water to the mixture or adding the mixture to water, and dissolving the buffer components as well as dissolving or re-suspending the dried biocatalyst.
  • buffer components in particular dry buffer components
  • the present invention also relates to a method of pre- treating a dried biocatalyst for the production of an amide compound from a nitrile compound in aqueous mixture, comprising: (a) mixing a dried biocatalyst with an aqueous solution to give a pre-treatment mixture, wherein the pre-treatment mixture comprises a buffer.
  • the present invention provides for a method of pre-treating a dried biocatalyst for the production of an amide compound from a nitrile compound in aqueous mixture, comprising: (a) mixing a dried biocatalyst with an aqueous solution to give a pre-treatment mixture, wherein the pre-treatment mixture comprises a buffer, and (b) contacting the biocatalyst with an aqueous mixture and/or a nitrile compound to form a reaction mixture, wherein the reaction mixture comprises said buffer of step (a), and wherein the ratio of the molar concentration of the buffer in the pre-treatment mixture to the molar concentration of said buffer in the reaction mixture is about 2:1 or more.
  • the ratio of the molar concentration of the buffer in the pre-treatment mixture to the molar concentration of said buffer in the reaction mixture is about 2:1 or more before the end of the conversion.
  • the present invention relates to the use of an aqueous solution or mixture comprising a buffer for pre-treatment of a dried biocatalyst for the production of an amide compound from a nitrile compound in aqueous mixture, the pre-treatment comprising mixing the dried biocatalyst the aqueous solution or mixture to give a pre-treatment mixture, the use preferably further comprising contacting the pre-treated biocatalyst with an aqueous mixture and/or a nitrile compound to form a reaction mixture for the conversion of the nitrile compound to the amide compound, wherein the ratio of the molar concentration of the buffer in the pre-treatment mixture to the molar concentration of said buffer in the reaction mixture is about 2:1 or more.
  • the buffer can be added to a biocatalyst suspension or solution before the biocatalyst is subjected to a drying step to give a dried biocatalyst.
  • the biocatalyst may also be washed before the buffer is added.
  • the dried biocatalyst comprises the dried buffer components that have been added prior to the drying step.
  • the buffer components dissolve, which, together with the biocatalyst, gives a pre-treatment mixture.
  • the biocatalyst treated with buffer before the biocatalyst is subject of a drying step to give a dried biocatalyst can subsequently be re- suspended or dissolved in a buffer solution to give a pre-treatment mixture.
  • the buffer is added to the dried biocatalyst.
  • said pre-treatment does not require a long period of time.
  • said pre-treatment of the biocatalyst is carried out for about 1 minute or more, more preferably for about 5 minutes or more, even more preferably from about 10 minutes to about 10 hours, still more preferably from about 20 minutes to about 5 hours, most preferably from about 30 minutes to about 2 hours.
  • said pre-treatment mixture is typically directly used for the bioconversion, i.e. directly mixed with an aqueous solution and a nitrile compound to give the reaction mixture.
  • the dried biocatalyst can be subsequently stored for several months before bringing together said pre-treated biocatalyst with an aqueous solution to give a pre-treatment mixture and to further mix said pre-treatment mixture with an aqueous solution and a nitrile compound to give the reaction mixture.
  • said biocatalyst does not significantly lose activity during the storage period. This can be seen as a further advantage of said pre-treatment variants.
  • a pre-treatment step (a) which comprises mixing a dried biocatalyst with an aqueous solution to give a pre-treatment mixture, wherein the pre-treatment mixture comprises a buffer.
  • pre-treatment step (a) can be performed by mixing the buffer with the biocatalyst either prior to the drying step or after drying in order to effectively pretreat the biocatalyst.
  • the biocatalyst used for the bioconversion of a nitrile compound to an amide compound has a substantially increased NHase activity when pre-treated with buffer after fermentation but before the drying step, or when treated with a buffered solution after drying, but before bringing together the dried biocatalyst with an aqueous solution and a nitrile compound to give the reaction mixture.
  • the present invention also relates to a method for reducing the biocatalyst amount necessary for converting a nitrile compound to an amide compound in aqueous mixture, the method comprising: (a) a pre-treatment step comprising mixing a dried biocatalyst with an aqueous solution to give a pre-treatment mixture, wherein the pre-treatment mixture comprises a buffer, and (b) converting the nitrile compound to the amide compound using the biocatalyst in a reaction mixture, wherein the reaction mixture comprises said buffer of step (a), and wherein the ratio of the molar concentration of the buffer in the pre-treatment mixture to the molar concentration of said buffer in the reaction mixture is about 2:1 or more. In particular, the ratio of the molar concentration of the buffer in the pre-treatment mixture to the molar concentration of said buffer in the reaction mixture is about 2:1 or more.
  • an enhanced NHase activity of a biocatalyst used for the bioconversion of a nitrile compound to an amide compound can be conducted at a higher reaction rate if the same amount of biocatalyst is employed (Fig. 1 , 2 and 5-13).
  • the present invention also provides for a method for increasing the reaction rate of converting a nitrile compound to an amide compound using a biocatalyst in aqueous mixture, the method comprising: (a) a pre-treatment step comprising mixing a dried biocatalyst with an aqueous solution to give a pre-treatment mixture, wherein the pre-treatment mixture comprises a buffer, and (b) converting the nitrile compound to the amide compound using the biocatalyst in a reaction mixture, wherein the reaction mixture comprises said buffer of step (a), and wherein the ratio of the molar concentration of the buffer in the pre-treatment mixture to the molar concentration of said buffer in the reaction mixture is about 2:1 or more. In particular, the ratio of the molar concentration of the buffer in the pre-treatment mixture to the molar concentration of said buffer in the reaction mixture is about 2:1 or more before the end of the conversion.
  • a reaction mixture can be created by mixing the pre-treatment mixture with an aqueous solution and a nitrile compound.
  • the aqueous solution typically has a volume that is greater than the volume of the pre-treatment mixture.
  • the aqueous solution and a nitrile compound may first be mixed together in a reactor while the pre-treatment solution is added subsequently. This option is preferred.
  • the pre-treatment mixture may also be added to a reactor comprising the aqueous solution, while the nitrile compound is subsequently added.
  • the pre-treatment solution may be comprised in a reactor and a mixture comprising the aqueous solution and a nitrile compound is added to the pre-treatment mixture. It is also possible, that the pre-treatment mixture is comprised in a reactor and the aqueous solution is added to it, followed by adding the nitrile compound.
  • the reaction mixture is an aqueous mixture comprising a biocatalyst and a nitrile or amide compound.
  • the pre-treatment mixture is added to an aqueous solution or mixture comprising a nitrile compound to give the reaction mixture.
  • the pre-treatment mixture is added to an aqueous solution or mixture, wherein the nitrile compound is subsequently added to give the reaction mixture.
  • an aqueous solution or mixture comprising a nitrile compound is added to the pre-treatment mixture to give the reaction mixture.
  • an aqueous solution or mixture is added to the pre-treatment mixture, wherein the nitrile compound is subsequently added to give the reaction mixture.
  • reaction mixture refers to an aqueous mixture comprising a biocatalyst and a nitrile compound and/or an amide compound.
  • the reaction mixture according to any one of the methods disclosed herein is created by combining a biocatalyst that has undergone a pre-treatment step according to the invention, an aqueous solution and a nitrile compound.
  • the biocatalyst catalyzes the conversion of the nitrile compound to the amide compound in the reaction mixture.
  • reaction mixture typically refers to a mixture including water, a biocatalyst, and a nitrile and/or an amide compound, at any time of a conversion process, including at the beginning of the reaction, when in an aqueous solution a biocatalyst is first contacted to a nitrile compound, as well as after the conversion has been stopped or ended but when the aqueous solution, the biocatalyst and an amide or nitrile compound are still present in the mixture.
  • the term "before the end of the conversion” as used herein refers to any time while a conversion of nitrile to amide in the reaction mixture is still ongoing.
  • the ratio of the volume of the pre-treatment mixture to the volume of the reaction mixture is about 1 :2 or less, preferably about 1 :3 or less, more preferably about 1 :4 or less, even more preferably about 1 :5 or less, still more preferably from about 1 :5 to about 1 :1000, still more preferably from about 1 :10 to about 1 :500, still more preferably from about 1 :20 to about 1 :200, most preferably from about 1 :50 to about 1 :100.
  • these ratios are present before the end of the conversion.
  • volume of the pre-treatment mixture and the volume of the reaction mixture are both indicated in liters (L).
  • L liters
  • the pre-treatment mixture has a biocatalyst concentration of from about 0.1 to about 100 grams dry weight of the biocatalyst (gDw) per litre (L), preferably from about 0.2 to about 50 gDw L -1 , more preferably from about 0.5 to about 20 gDw L -1 , most preferably from about 1 to about 10 gDw L _1 . It is also envisaged that the pre-treatment of biocatalyst in the pre-treatment mixture is carried out for about 1 minute or more, preferably for about 5 minutes or more, more preferably from about 10 minutes to about 10 hours, even more preferably from about 20 minutes to about 5 hours, most preferably from about 30 minutes to about 2 hours.
  • dry weight or “dry cell weight” refer to weight as determined in the relative absence of water.
  • reference to a component as comprising a specified percentage by dry weight means that the percentage is calculated based on the weight of the biomass after substantially all water has been removed.
  • the reaction mixture may comprise more than about 10 w/w % of the amide compound, preferably more than about 15 w/w % of the amide compound, more preferably more than about 20 w/w % of the amide compound, even more preferably more than about 25 w/w % of the amide compound, still more preferably more than about 30 w/w % of the amide compound, still more preferably more than about 35 w/w % of the amide compound, still more preferably more than about 40 w/w % of the amide compound, still more preferably more than about 45 w/w % of the amide compound, still more preferably more than about 50 w/w % of the amide compound, still more preferably more than about 55 w/w % of the amide compound, most preferably more than about 60 w/w % of the amide compound, each based on 100 w/w % of the reaction mixture.
  • these contents of the amide compound are present before the end of
  • the buffer comprised in the pre- treatment mixture has a pKa in a range of from about 6 to about 9, preferably from about 6.5 to about 8.
  • the buffer may comprise a single component, or can be a mixture of more than one buffer component. It is also understood that one single component can have more than one pKa values.
  • a buffer has typically a pKa in a range from about 6 to about 9 if it comprises a buffer component that has a pKa in the range from about 6 to about 9.
  • phosphate has three pKa values, 2.1 , 7.2 and 12.7. Since one of the pKa values of phosphate is within the range of from about 6 to about 9, a buffer comprising phosphate may be understood as a buffer having a pKa in a range from about 6 to about 9.
  • the pre-treatment mixture has a pH value of from about 6.6 to about 9, preferably from about 6.6 to about 8.8, more preferably from about 6.7 to about 8.6, even more preferably from about 6.8 to about 8.4, still more preferably from about 6.9 to about 8.2, most preferably from about 7 to about 8.
  • the buffer may have a pKa in a range of from about 6 to about 9, preferably from about 6.5 to about 8.
  • the buffer comprises an inorganic buffer or an organic buffer. It is further envisaged that the buffer may comprise a non-sulfonic acid buffer or a carboxylic acid buffer.
  • Suitable buffers which may be used in the present invention may comprise a compound selected from the group consisting of phosphate, citrate, carbonate, 2-[(2-hydroxy-1 ,1 - bis(hydroxymethyl)ethyl)amino] ethanesulfonic acid (TES), 1 ,4-piperazinediethanesulfonic acid (PIPES), N-(2-acetamido)-2-aminoethanesulfonic acid (ACES), and tris(hydroxymethyl) aminomethane (TRIS), and any combination thereof.
  • the buffer comprises a phosphate buffer or a citrate buffer or a combination thereof.
  • the buffer is a phosphate buffer.
  • the buffer is in a concentration in the pre-treatment mixture of more than 50 mM, preferably more than 60 mM, more preferably more than 80 mM and most preferably more than 90 mM, such as more than 100 mM, more than 120 mM, more than 150 mM or more than 200 mM.
  • the buffer may be in a concentration in the pre-treatment mixture of about 50 mM to 1 M, preferably about 60 mM to 1 M, even more preferably about 70 mM to 1 M, still more preferably about 80 mM to 1 M, most preferably about 90 mM to about 1 M.
  • the buffer may be in a concentration in the pre-treatment mixture of about 50 mM to about 500 mM, preferably about 60 mM to about 500 mM, even more preferably about 70 mM to about 500 mM, still more preferably about 80 mM to about 500 mM, most preferably about 90 mM to about 500 mM.
  • the buffer may be in a concentration of about 10 mM to about 1 M, preferably about 20 mM to about 500 mM, more preferably about 50 mM to about 200 mM, even more preferably about 70 mM to about 130 mM, most preferably about 80 mM to about 120 mM, such as about 100 mM.
  • the buffer concentration in the reaction mixture is about 100 mM or less, preferably about 50 mM or less, more preferably about 20 mM or less, even more preferably about 10 mM or less, still more preferably from about 5 mM to about 1 pM, still more preferably from about 4 mM to about 1 pM, still more preferably from about 3 mM to about 1 pM, still more preferably from about 2 mM to about 1 pM, still more preferably from about 1 mM to about 1 pM, still more preferably from about 0.8 mM to about 1 pM, still more preferably from about 0.5 mM to about 1 pM, still more preferably from about 0.4 mM to about 1 pM, still more preferably from about 0.3 mM to about 1 pM, still more preferably from about 0.2 mM to about 1 pM, most preferably from about 0.1 mM to about 1 pM.
  • the temperature of the pre-treatment is in the range of from about 0 °C to about 50 °C, preferably from about 10° to about 40°C, more preferably from about 20°C to about 37°C.
  • the pH is not controlled during step (b), i.e. during the
  • the bioconversion of a nitrile compound to an amide compound By using the method of the invention it is not necessary to keep the pH within a certain range during the bioconversion, therefore the bioconversion can be simplified.
  • the term "the pH is not controlled" in the context of the present invention means that the pH is not adjusted to be kept within a certain range, in particular in response to the measured pH value in the solution. In a specific embodiment, this means that the pH is also not measured during step (b).
  • the amide compound is acrylamide, methacrylamide, acetamide or nicotinamide.
  • the amide compound is acrylamide.
  • the nitrile compound is acrylonitrile, methacrylonitrile, acetonitrile or 3-cyanopyridine.
  • the nitrile compound is acrylonitrile.
  • the biocatalyst used in any one of the methods disclosed herein is typically a microorganism, preferably a nitrile hydratase (NHase) producing microorganism.
  • a nitrile hydratase (NHase)
  • “Nitrile hydratase”("NHase”) refers to a microbial enzyme that catalyzes the hydration of nitriles to their corresponding amides (IUBMB Enzyme Nomenclature EC 4.2.1 .84).
  • the terms "Nitrile hydratase” and “NHase” as used herein also encompass modified or enhanced enzymes which are, e.g., capable of converting a nitrile compound (e.g.
  • amide compound e.g. acrylamide
  • an amide compound e.g. acrylamide
  • NHase producing microorganisms are used, or are for use, as a biocatalyst for converting a nitrile compound into the corresponding amide compound.
  • a "nitrile compound” is converted by a microorganism in the methods disclosed herein into an amide compound by the action of NHase.
  • a nitrile compound is any organic compound that has a -C ⁇ N functional group.
  • a preferred nitrile compound is acrylonitrile.
  • An example of an amide compound is acrylamide.
  • a "NHase producing microorganism” may be any microorganism which is able to produce the enzyme NHase. With this regard, it is not relevant whether the microorganism naturally encodes NHase or whether it has been genetically modified to encode said enzyme. Furthermore, the biocatalyst may be a microorganism which naturally encodes NHase and/or which is further genetically engineered, e.g., to increase production of NHase, or to increase stability and/or export of NHase or to decrease production of Amidase, or to increase stability and/or export of Amidase.
  • biocatalyst refers to any catalytic material of biological origin.
  • the biocatalyst can be homogeneous or heterogeneous, and can be an enzyme or a cellular biocatalyst, in particular microorganisms (e.g., bacteria or protozoic eukaryotes), for example, and comprises intact cell, such as a bacterial cells, a fungal cells or a yeast cells, or a cell fragment.
  • a biocatalyst referred to in the context of the methods disclosed herein comprises a nitrile hydratase (NHase) and is typically able to catalyze the conversion of a nitrile compound to an amide compound.
  • NHase nitrile hydratase
  • a given biocatalyst e.g., microorganism or enzyme
  • a nitrile compound e.g. acrylonitrile
  • an amide compound e.g. acrylamide
  • activity of a given biocatalyst to be capable of converting acrylonitrile to acrylamide in the methods disclosed herein may be determined as follows: First reacting 100 ⁇ of a cell suspension, cell lysate, dissolved enzyme powder or any other preparation containing the supposed biocatalyst with 875 ⁇ of an 50 mM potassium phosphate buffer and 25 ⁇ of acrylonitrile at 25 °C on an Eppendorf tube shaker at 1 ,000 rpm for 10 minutes. After 10 minutes of reaction time, samples may be drawn and immediately quenched by adding the same volume of 1.4% hydrochloric acid.
  • the concentration of acrylamide shall be between 0.25 and 1.25 mmol/l - if necessary, the sample has to be diluted accordingly and the conversion has to be repeated.
  • the activity may then be deduced from the concentration of acrylamide by dividing the acrylamide concentration derived from HPLC analysis by the reaction time, which has been 10 minutes and by multiplying this value with the dilution factor between HPLC sample and original sample.
  • Activities >5 U/mg dry cell weight, preferably >25 U/mg dry cell weight, more preferably >50 U/mg dry cell weight, most preferably >100 U/mg dry cell weight indicate the presence of a functional biocatalyst and are considered as biocatalyst capable of converting acrylonitrile to acrylamide in context with the methods disclosed herein.
  • conversion when used in the context of the methods disclosed herein refers to the total or partially reaction of the nitrile compound to an amide compound in aqueous solution and in the presence of a biocatalyst. More precisely, “conversion” or “converting” means, that the nitrile compound is allowed to undergo hydration reaction by the use of a biocatalyst in aqueous solution in order to obtain an amide reaction solution having a desired concentration. According to the present invention, this hydration reaction may be carried out in any conventional manner. The concentration of the nitrile compound is not specifically restricted provided that the amide reaction solution of a desired concentration is obtained.
  • the term "bioconversion” denotes a reaction, wherein methacrylonitrile is converted to acrylamide in aqueous solution and in the presence of a biocatalyst.
  • the acrylamide is dissolved in the water, such that by any one of the methods described and provided herein an aqueous acrylamide solution is formed.
  • the nitrile compound may be added to the reactor before the water is added, after water is added, or added together with water.
  • the nitrile compound may be added continuously or intermittently. Addition of nitrile compound may be at constant or variable feed rate or batch-wise.
  • the water may be added as such, be part of the pre-treatment mixture as described herein, be part of a nitrile solution as described herein, or otherwise be added. In case that the water is added as such, in general tap water or deionized water may be used.
  • the microbial catalyst may be used in any amount provided that the amide reaction solution of a desired concentration is obtained, and the amount thereof is properly determined according to the reaction conditions, the type of the catalyst and the form thereof.
  • the amount of the microbial catalyst is in the range of usually 10 to 50000 ppm by weight, preferably 50 to 30000 ppm by weight, in terms of weight of dry bacterial cell, based on the aqueous medium.
  • the reaction time of the conversion of the nitrile compound to the amide compound is not specifically restricted either provided that the amide reaction solution of a desired concentration is obtained.
  • the reaction time depends upon the amount of the catalyst used and the conditions such as temperature, it is specifically in the range of usually 1 to 80 hours, preferably 2 to 40 hours, based on one reactor.
  • the conversion of the nitrile compound to the amide compound is usually carried out at atmospheric pressure, it may be carried out under pressure in order to increase solubility of the nitrile compound in the aqueous medium.
  • the reaction temperature is not specifically restricted provided that it is not lower than the ice point of the aqueous medium.
  • the conversion of the nitrile compound to the amide compound may be carried out by any of a batch process and a continuous process, and the conversion may be carried out by selecting its reaction system from reaction systems such as suspended bed, a fixed bed, a fluidized bed and the like or by combining different reaction systems according to the form of the catalyst.
  • the biocatalyst capable of converting a nitrile compound to an amide compound may be a microorganism which encodes the enzyme nitrile hydratase.
  • the microorganism is naturally encoding nitrile hydratase, or whether it has been genetically modified to encode said enzyme, or whether a microorganism naturally encoding nitrile hydratase has been modified such as to be able to produce more and/or enhanced nitrile hydratase.
  • biocatalyst e.g., microorganism
  • encoding the enzyme
  • nitrile hydratase or the like generally means that such a microorganism is generally also able to produce and stably maintain nitrile hydratase. That is, as used herein and as readily understood by the skilled person, a biocatalyst (e.g., a microorganism) to be employed in accordance with the methods disclosed herein which (naturally or non-naturally) encodes nitrile hydratase is generally also capable of producing and stably maintaining nitrile hydratase.
  • microorganisms only produced nitrile hydratase during cultivation (or fermentation) of the microorganism - thus then containing nitrile hydratase - before being added to a reactor.
  • the microorganisms do not produce nitrile hydratase during the methods described and provided herein any more, but they act only via the nitrile hydratase units which they have produced before and which they still contain.
  • biocatalyst encompasses the enzyme nitrile hydratase per se, as long as it is able to convert acrylonitrile to acrylamide as described and exemplified herein.
  • biocatalyst it is also possible to directly employ nitrile hydratase as biocatalyst.
  • microorganisms naturally encoding nitrile hydratase which can be used as biocatalyst in any one of the methods described herein, is a bacterium. It is further envisaged that the microorganism is selected from the group consisting of Rhodococcus, Aspergillus, Acidovorax, Agrobacterium, Bacillus, Bradyrhizobium, Burkholderia, Escherichia, Geobacillus, Klebsiella, Mesorhizobium, Moraxella, Pantoea, Pseudomonas, Rhizobium, Rhodopseudomonas, Serratia, Amycolatopsis, Arthrobacter, Brevibacterium, Corynebacterium, Microbacterium, Micrococcus, Nocardia, Pseudonocardia, Trichoderma, Myrothecium, Aureobasidium, Candida, Cryptococcus, Debaryomyces, Geotrichum,
  • the microorganism is selected from the group consisting of Rhodococcus, Pseudomonas, Escherichia, and Geobacillus. It is further envisaged that the microorganism is selected from the group consisting of Rhodococcus rhodochrous, Rhodococcus pyridinovorans, Rhodococcus erythropolis, Rhodococcus equi, Rhodococcus ruber, Rhodococcus opacus, Aspergillus niger, Acidovorax avenae, Acidovorax facilis, Agrobacterium tumefaciens, Agrobacterium radiobacter, Bacillus subtilis, Bacillus pallidus, Bacillus smithii, Bacillus sp BR449, Bradyrhizobium oligotrophicum, Bradyrhizobium diazoefficiens, Bradyrhizobium japonicum, Burkholderia cenocepacia, Bur
  • RAPc8 Klebsiella oxytoca, Klebsiella pneumonia, Klebsiella variicola, Mesorhizobium ciceri, Mesorhizobium opportunistum, Mesorhizobium sp F28, Moraxella, Pantoea endophytica, Pantoea agglomerans, Pseudomonas chlororaphis, Pseudomonas putida, Rhizobium, Rhodopseudomonas palustris, Serratia liquefaciens, Serratia marcescens, Amycolatopsis, Arthrobacter, Brevibacterium sp CH1 , Brevibacterium sp CH2, Brevibacterium sp R312, Brevibacterium imperiale, Corynebacterium nitrilophilus, Corynebacterium pseudodiphteriticum, Corynebacterium glutamicum, Corynebacterium hoffmanii, Microbacter
  • microorganism is Rhodococcus rhodochrous or Rhodococcus pyridinovorans. It is further envisaged that the microorganism is Rhodococcus rhodochrous (NCIMB 41 164), Rhodococcus rhodochrous (FERM BP-1478), or Rhodococcus rhodochrous M33.
  • microorganisms can be cultured by any method that is appropriate for a given microbial species.
  • the microbial biocatalyst that is prepared from microorganisms refers to a culture solution obtained by culturing microorganisms, cells obtained by a harvesting process or the like, cell disrupted by ultrasonication or the like, or those prepared after cell disruption including a crude enzyme, a partially-purified enzyme or a purified enzyme.
  • a mode to use the microbial catalyst may be appropriately selected depending on enzyme stability, production scale and the like.
  • nitrile hydratase encoding microorganisms which are not naturally encoding nitrile hydratase may be genetically engineered microorganisms which naturally do not contain a gene encoding a nitrile hydratase but which have been manipulated such as to contain a polynucleotide encoding a nitrile hydratase (e.g., via transformation, transduction, transfection, conjugation, or other methods suitable to transfer or insert a polynucleotide into a cell as known in the art; cf.
  • additional polynucleotides which may be necessary to allow transcription and translation of the nitrile hydratase gene or mRNA, respectively.
  • additional polynucleotides may comprise, inter alia, promoter sequences, polyT- or polyU-tails, or replication origins or other plasmid-control sequences.
  • such genetically engineered microorganisms which naturally do not contain a gene encoding a nitrile hydratase but which have been manipulated such as to contain a polynucleotides encoding a nitrile hydratase may be prokaryotic or eukaryotic microorganisms.
  • prokaryotic microorganisms include, e.g., representatives of the species Escherichia coli.
  • examples for such eukaryotic microorganisms include, e.g., yeast (e.g., Saccharomyces cerevisiae).
  • nitrile hydratase (also referred to herein as NHase) generally means an enzyme which is capable of catalyzing the conversion (i.e. hydration) of acrylonitrile to acrylamide.
  • an enzyme may be, e.g., the enzyme registered under IUBMB nomenclature as of April 1 , 2014: EC 4.2.1.84; CAS-No. 2391 -37-5.
  • nitrile hydratase as used herein also encompasses modified or enhanced enzymes which are, e.g., capable of converting acrylonitrile to acrylamide more quickly, or which can be produced at a higher yield/time-ratio, or which are more stable, as long as they are capable to catalyze conversion (i.e. hydration) of acrylonitrile to acrylamide.
  • modified or enhanced enzymes which are, e.g., capable of converting acrylonitrile to acrylamide more quickly, or which can be produced at a higher yield/time-ratio, or which are more stable, as long as they are capable to catalyze conversion (i.e. hydration) of acrylonitrile to acrylamide.
  • activity of a given biocatalyst to act as a nitrile hydratase in the sense of the present disclosure may be determined as follows: First reacting 100 ⁇ of a cell suspension, cell lysate, dissolved enzyme powder or any other preparation containing the supposed nitrile hydratase with 875 ⁇ of an 50 mM potassium phosphate buffer and 25 ⁇ of acrylonitrile at 25 °C on an Eppendorf tube shaker at 1 ,000 rpm for 10 minutes. After 10 minutes of reaction time, samples may be drawn and immediately quenched by adding the same volume of 1 .4% hydrochloric acid.
  • the concentration of acrylamide shall be between 0.25 and 1.25 mmol/l - if necessary, the sample has to be diluted accordingly and the conversion has to be repeated.
  • the enzyme activity may then be deduced from the concentration of acrylamide by dividing the acrylamide concentration derived from HPLC analysis by the reaction time, which has been 10 minutes and by multiplying this value with the dilution factor between HPLC sample and original sample.
  • Activities >5 U/mg dry cell weight, preferably >25 U/mg dry cell weight, more preferably >50 U/mg dry cell weight, most preferably >100 U/mg dry cell weight indicate the presence of a functional biocatalyst and are considered as biocatalyst capable of converting acrylonitrile to acrylamide in context with the present disclosure.
  • the nitrile hydratase may be a polypeptide encoded by a polynucleotide which comprises or consists of a nucleotide sequence which is at least 70%, preferably at least 75%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 95%, more preferably at least 96%, more preferably at least 97%, more preferably at least 98%, more preferably at least 99%, more preferably at least 99,5%, and most preferably 100% identical to the nucleotide sequence of SEQ ID NO: 1 (alpha-subunit of nitrile hydratase of Rhodococcus rhodochrous: GTGAGCGAGCACGTCAATAAGTACACGGAGTACGAGGCACGTACCAAGGCGATCGAAA CCTTGCTGTACGAGCGAGGGCTCATCACGCCCGCCGCGGTCGACCGAGTCGTTTCGTA CTACGAGAACGATCGGCCCG
  • the nitrile hydratase may be a polypeptide which comprises or consists of an amino acid sequence which is at least 70%, preferably at least 75%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 95%, more preferably at least 96%, more preferably at least 97%, more preferably at least 98%, more preferably at least 99%, more preferably at least 99,5%, and most preferably 100% identical to the amino acid sequence of SEQ ID NO: 2 (alpha-subunit of nitrile hydratase of Rhodococcus rhodochrous: VSEHVN KYTE YEARTKAI ET LLYERGLITP AAVDRVVSYY EN EIGPMGGA KVVAKSWVDP EYRKWLEEDA TAAMASLGYA GEQAHQISAV FN DSQTH HVV
  • rhodochrous MDGIHDTGGM TGYGPVPYQK DEPFFHYEWE GRTLSILTWM HLKGISWWDK SRFFRESMGN ENYVNEIRNSY YTHWLSAAE RILVADKIIT EEERKHRVQE ILEGRYTDRK PSRKFDPAQI EKAIERLHEP HSLALPGAEP SFSLGDKIKV KSMNPLGHTR CPKYVRNKIG EIVAYHGCQI YPESSSAGLG DDPRPLYTVA FSAQELWGDD GNGKDVVCVD LWEPYLISA), provided that said polypeptide is capable of catalyzing hydration of acrylonitrile to acrylamide as described and exemplified herein.
  • sequences e.g., nucleic acid sequences or amino acid sequences
  • identity may refer to the shorter sequence and that part of the longer sequence that matches said shorter sequence.
  • the degree of identity may preferably either refer to the percentage of nucleotide residues in the shorter sequence which are identical to nucleotide residues in the longer sequence or to the percentage of nucleotides in the longer sequence which are identical to nucleotide sequence in the shorter sequence.
  • identity levels of nucleic acid sequences or amino acid sequences may refer to the entire length of the respective sequence and is preferably assessed pair-wise, wherein each gap is to be counted as one mismatch.
  • nucleic acid/amino acid sequences having the given identity levels to the herein-described particular nucleic acid/amino acid sequences may represent derivatives/variants of these sequences which, preferably, have the same biological function. They may be either naturally occurring variations, for instance sequences from other varieties, species, etc., or mutations, and said mutations may have formed naturally or may have been produced by deliberate mutagenesis. Furthermore, the variations may be synthetically produced sequences. The variants may be naturally occurring variants or synthetically produced variants or variants produced by recombinant DNA techniques.
  • Deviations from the above-described nucleic acid sequences may have been produced, e.g., by deletion, substitution, addition, insertion and/or recombination.
  • the term “addition” refers to adding at least one nucleic acid residue/amino acid to the end of the given sequence, whereas "insertion” refers to inserting at least one nucleic acid residue/amino acid within a given sequence.
  • the term “deletion” refers to deleting or removal of at least one nucleic acid residue or amino acid residue in a given sequence.
  • substitution refers to the replacement of at least one nucleic acid residue/amino acid residue in a given sequence.
  • nucleic acid molecules may comprise inter alia DNA molecules, RNA molecules, oligonucleotide thiophosphates, substituted ribo-oligonucleotides or PNA molecules.
  • nucleic acid molecule may refer to DNA or RNA or hybrids thereof or any modification thereof that is known in the art (see, e.g., US 552571 1 , US 471 1955, US 5792608 or EP 302175 for examples of modifications).
  • the polynucleotide sequence may be single- or double- stranded, linear or circular, natural or synthetic, and without any size limitation.
  • the polynucleotide sequence may be genomic DNA, cDNA, mitochondrial DNA, mRNA, antisense RNA, ribozymal RNA or a DNA encoding such RNAs or chimeroplasts (Gamper, Nucleic Acids Research, 2000, 28, 4332 - 4339).
  • Said polynucleotide sequence may be in the form of a vector, plasmid or of viral DNA or RNA.
  • nucleic acid molecules which are complementary to the nucleic acid molecules described above and nucleic acid molecules which are able to hybridize to nucleic acid molecules described herein.
  • a nucleic acid molecule described herein may also be a fragment of the nucleic acid molecules in context of the present disclosure. Particularly, such a fragment is a functional fragment. Examples for such functional fragments are nucleic acid molecules which can serve as primers.
  • a "reference microorganism" when referred to herein a dried biocatalyst (i.e. microorganism) not pre-treated with buffer after fermentation and prior to bioconversion may be used.
  • a reference microorganism is one which was dried after fermentation, but not pre-treated before or after drying with any kind of buffer, and which is then re-suspended in water before bioconversion.
  • the reference microorganism can be contacted with a nitrile compound in aqueous solution and converts the nitrile compound to an amide compound.
  • said reference microorganism has a lower NHase activity as compared with a microorganism pre-treated with buffer prior to bioconversion.
  • the use of said reference microorganism will be conducted at a lower reaction rate as compared to the reaction rate of a microorganism pre-treated with buffer, if the same amount of biocatalyst is employed during bioconversion.
  • the microorganism used to convert a nitrile compound to an amide compound is necessarily a dried microorganism.
  • the dried biocatalyst is a biocatalyst that has been subjected to a drying step before mixing the biocatalyst with an aqueous solution.
  • the drying can be mediated by spray drying, freeze-drying, heat drying, air drying, vacuum drying, fluidized-bed drying and/or spray granulation, wherein spray drying and freeze drying are preferred, wherein spray drying is most preferred.
  • the dried biocatalyst is in the form of a powder, granule, suspension, and/or matrix bound microorganism.
  • the biocatalyst may be dried using the drying methods described herein.
  • dried biocatalyst refers to a biocatalyst that has been subjected to a drying step.
  • a dried biocatalyst typically has a moisture content of less than about 20 w/w %, more preferably less than about 15 w/w %, even more preferably less than about 14 w/w %, most preferably from about 5 to about 10 w/w % based on the total weight of the biocatalyst sample.
  • Methods of determining the moisture content are familiar to the skilled person. For example, in the context of the present invention the moisture content of a sample of the dried biocatalyst may be determined via thermogravimetric analysis.
  • the initial weight of the sample is determined.
  • the sample is then heated and the moisture vaporizes. Heating is continued until the sample weight remains constant.
  • the difference between the constant weight at the end of the analysis and the initial weight represents the amount of water vaporized during the analysis, which allows for calculation of the moisture content of the sample.
  • the biocatalyst sample may be, for example, analyzed on a 'Mettler Toledo HB43-S Halogen moisture analyzer', operated at 130 °C until the sample weight remains constant for at least 30 seconds.
  • the aqueous acrylamide solution may be obtained along with the biocatalyst.
  • the biocatalyst may be separated from the obtained aqueous acrylamide solution.
  • a separation of the biocatalyst may be performed with regard to the desired applications, which may, for example, include the homopolymerization or copolymerization of the acrylamide.
  • Suitable methods for separation of the biocatalyst are known in the art and include, for example, centrifugation, sedimentation (e.g., with flocculation), membrane separation and filtration.
  • the separation of the biocatalyst is started after completion of the conversion of acrylonitrile to acrylamide using a biocatalyst.
  • the term "after completion" when used herein can be understood as the point of time when the desired amide concentration in the aqueous solution is achieved. The desired amide concentration is disclosed elsewhere herein.
  • the separation may be started immediately after completion of the conversion of acrylonitrile to acrylamide, or within a specific time interval. In a preferred embodiment of the present invention, the separation is started within 30 minutes after completion of the conversation of acrylonitrile to acrylamide. In a more preferred embodiment the separation is started within 20 minutes after completion of the conversation of acrylonitrile to acrylamide. In a most preferred embodiment the separation is started within 10 minutes after completion of the conversation of acrylonitrile to acrylamide.
  • the present invention further relates to an aqueous amide compound solution obtainable or being obtained by any one of the methods described and provided herein.
  • an aqueous amide compound solution in particular an aqueous amide compound solution obtainable or being obtained by any one of the methods described herein, may contain 20 to 65 w/w % of the amide compound, wherein indications of w/w % are each referred to the total weight of the solution.
  • the aqueous amide compound solution contains 25 to 60 w/w % of the amide compound, wherein indications of w/w % are each referred to the total weight of the solution.
  • the aqueous amide compound solution contains 30 to 58 w/w % of the amide compound, wherein indications of w/w % are each referred to the total weight of the solution.
  • the aqueous amide compound solution contains 35 to 55 w/w % of the amide compound, wherein indications of w/w % are each referred to the total weight of the solution.
  • the acrylamide content, the acrylonitrile and/or the acrylic acid concentration may be determined using HPLC.
  • HPLC Preferably, an HPLC method is used as set forth below under the Examples.
  • the present invention further relates to a composition comprising an amide compound and a biocatalyst, wherein the biocatalyst has been pre-treated by a method of pre-treating a dried biocatalyst for the production of an amide compound from a nitrile compound in aqueous mixture, comprising: (a) mixing a dried biocatalyst with an aqueous solution to give a pre- treatment mixture, wherein the pre-treatment mixture comprises a buffer, and (b) contacting the biocatalyst with an aqueous mixture and/or a nitrile compound to form a reaction mixture, wherein the reaction mixture comprises said buffer of step (a), and wherein the ratio of the molar concentration of the buffer in the pre-treatment mixture to the molar concentration of said buffer in the reaction mixture is about 2:1 or more.
  • the ratio of the molar concentration of the buffer in the pre-treatment mixture to the molar concentration of said buffer in the reaction mixture is about 2:1 or more before the end of the conversion.
  • the amide compound is acrylamide.
  • said composition preferably comprises acrylamide and a biocatalyst.
  • composition includes but is not limited to solutions and/or suspensions, dispersions, concentrations, ready mix, powders, and granules comprising an amide compound, preferably acrylamide and a biocatalyst.
  • the present invention also relates to the use of a composition comprising a biocatalyst pre- treated according to the method of pre-treating a dried biocatalyst for the production of an amide compound from a nitrile compound in aqueous mixture, comprising: (a) mixing a dried biocatalyst with an aqueous solution to give a pre-treatment mixture, wherein the pre- treatment mixture comprises a buffer, and (b) contacting the biocatalyst with an aqueous mixture and/or a nitrile compound to form a reaction mixture, wherein the reaction mixture comprises said buffer of step (a), and wherein the ratio of the molar concentration of the buffer in the pre-treatment mixture to the molar concentration of said buffer in the reaction mixture is about 2:1 or more for converting a nitrile compound to an amide compound, wherein the conversion is conducted in a reaction mixture, wherein the ratio of the molar concentration of the buffer in the pre-treatment mixture to the molar concentration of said
  • a third option refers to the applicability of the first and second elements together. Any one of these options is understood to fall within the meaning, and therefore satisfy the requirement of the term “and/or” as used herein. Concurrent applicability of more than one of the options is also understood to fall within the meaning, and therefore satisfy the requirement of the term "and/or" as used herein.
  • the word “about” as used herein refers to a value being within an acceptable error range for the particular value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, i.e., the limitations of the measurement system. For example, “about” can mean within 1 or more than 1 standard deviation, per the practice in the art. The term “about” is also used to indicate that the amount or value in question may be the value designated or some other value that is approximately the same. The phrase is intended to convey that similar values promote equivalent results or effects according to the invention. In this context "about” may refer to a range above and/or below of up to 10%.
  • the word “about” refers in some embodiments to a range above and below a certain value that is up to 5%, such as up to up to 2%, up to 1 %, or up to 0.5 % above or below that value. In one embodiment “about” refers to a range up to 0.1 % above and below a given value.
  • FIG. 1 Time course of acrylamide (ACM, depicted in dark grey) [%] and acrylonitrile (ACN, depicted in light grey) [%] concentrations in w/w % in a bioconversion of acrylonitrile to acrylamide applying spray dried Rhodococcus rhodochrous NCIMB 41 164 as biocatalyst.
  • the dried biocatalyst has been re-suspended in water.
  • a total amount of 3.36 g of the dried biocatalyst (batch Ch10) was employed, which had an NHase activity of 1 16 kU/g as measured before the beginning of the bioconversion.
  • FIG. 2 Time course of acrylamide (ACM, depicted in dark grey) [%] and acrylonitrile (ACN, depicted in light grey) [%] concentrations in w/w % in a bioconversion of acrylonitrile to acrylamide applying spray dried Rhodococcus rhodochrous NCIMB 41 164 as biocatalyst.
  • the dried biocatalyst has been re-suspended in 33 ml. of 100 mM phosphate buffer (pH 7.0), which corresponds to the pre-treatment step of the invention. Pre-treatment was conducted for 1 h.
  • a total amount of 3.36 g of the dried biocatalyst (batch Ch10) was employed, which had an NHase activity of 1 16 kU/g as measured before the beginning of the bioconversion.
  • L liter
  • re-suspended biocatalyst corresponding to 2.4 g dried biocatalyst was added to the reactor.
  • the acrylonitrile (ACN) concentration from O h to 1 h after beginning of the bioconversion was maintained at 2 w/w % by feeding acrylonitrile to the reactor.
  • FIG. 3 Time course of acrylamide (ACM, depicted in dark grey) [%] and acrylonitrile (ACN, depicted in light grey) [%] concentrations in w/w % in a bioconversion of acrylonitrile to acrylamide applying spray dried Rhodococcus rhodochrous NCIMB 41 164 as biocatalyst.
  • the dried biocatalyst has been re-suspended in water.
  • a total amount of 3.36 g of the dried biocatalyst (batch Ch10) was employed, which had an NHase activity of 1 16 kU/g as measured before the beginning of the bioconversion.
  • FIG. 4 Time course of acrylamide (ACM, depicted in dark grey) [%] and acrylonitrile (ACN, depicted in light grey) [%] concentrations in w/w % in a bioconversion of acrylonitrile to acrylamide applying spray dried Rhodococcus rhodochrous NCIMB 41 164 as biocatalyst.
  • the dried biocatalyst has been re-suspended in 30 ml. of 100 mM phosphate buffer (pH 7.0), which corresponds to the pre-treatment step of the invention. Pre-treatment was conducted for 0.5 h.
  • FIG. 5 Time course of acrylamide (ACM, depicted in dark grey) [%] and acrylonitrile (ACN, depicted in light grey) [%] concentrations in w/w % in a bioconversion of acrylonitrile to acrylamide applying spray dried Rhodococcus rhodochrous NCIMB 41 164 as biocatalyst.
  • the dried biocatalyst has been re-suspended in water.
  • a total amount of 1.73 g of the dried biocatalyst (batch Ch32) was employed, which had an NHase activity of 137 kU/g as measured before the beginning of the bioconversion.
  • FIG. 6 Time course of acrylamide (ACM, depicted in dark grey) [%] and acrylonitrile (ACN, depicted in light grey) [%] concentrations in w/w % in a bioconversion of acrylonitrile to acrylamide applying spray dried Rhodococcus rhodochrous NCIMB 41 164 as biocatalyst.
  • the dried biocatalyst has been re-suspended in 30 ml. of 100 mM phosphate buffer (pH 7.5), which corresponds to the pre-treatment step of the invention. Pre-treatment was conducted for 0.5 h.
  • a total amount of 1 .73 g of the dried biocatalyst (batch Ch32) was employed, which had an NHase activity of 137 kU/g as measured before the beginning of the bioconversion.
  • L liter
  • re-suspended biocatalyst corresponding to 1.24 g dried biocatalyst was added to the reactor.
  • the acrylonitrile (ACN) concentration from 0 h to 1 h after beginning of the bioconversion was maintained at 2 w/w % by feeding acrylonitrile to the reactor.
  • Figure 7 Time course of acrylamide (ACM, depicted in dark grey) [%] and acrylonitrile (ACN, depicted in light grey) [%] concentrations in w/w % in a bioconversion of acrylonitrile to acrylamide applying spray dried Rhodococcus rhodochrous NCIMB 41 164 as biocatalyst.
  • the dried biocatalyst has been re-suspended in water.
  • a total amount of 1 .29 g of the dried biocatalyst (batch Ch30) was employed, which had an NHase activity of 203 kU/g as measured before the beginning of the bioconversion.
  • L liter
  • re-suspended biocatalyst corresponding to 0.92 g dried biocatalyst was added to the reactor.
  • the acrylonitrile (ACN) concentration from 0 h to 1 h after beginning of the bioconversion was maintained at 2 w/w % by feeding acrylonitrile to the reactor.
  • ACN acrylonitrile
  • the acrylonitrile concentration was maintained at 0.8 w/w %, until a total amount of 1553 g acrylonitrile has been added to the reactor. No full conversion ( ⁇ 100 ppm residual acrylonitrile) was reached after 19 h.
  • Figure 8 Time course of acrylamide (ACM, depicted in dark grey) [%] and acrylonitrile (ACN, depicted in light grey) [%] concentrations in w/w % in a bioconversion of acrylonitrile to acrylamide applying spray dried Rhodococcus rhodochrous NCIMB 41 164 as biocatalyst.
  • the dried biocatalyst has been re-suspended in 30 ml. of 100 mM phosphate buffer (pH 7.5), which corresponds to the pre-treatment step of the invention. Pre-treatment was conducted for 0.5 h.
  • a total amount of 1.29 g of the dried biocatalyst (batch Ch30) was employed, which had an NHase activity of 203 kU/g as measured before the beginning of the bioconversion.
  • L liter
  • re-suspended biocatalyst corresponding to 0.92 g dried biocatalyst was added to the reactor.
  • the acrylonitrile (ACN) concentration from 0 h to 1 h after beginning of the bioconversion was maintained at 2 w/w % by feeding acrylonitrile to the reactor.
  • Figure 9 Time course of acrylamide (ACM, depicted in dark grey) [%] and acrylonitrile (ACN, depicted in light grey) [%] concentrations in w/w % in a bioconversion of acrylonitrile to acrylamide applying spray dried Rhodococcus rhodochrous NCIMB 41 164 as biocatalyst.
  • the dried biocatalyst has been re-suspended in water.
  • a total amount of 1.29 g of the dried biocatalyst (batch V3) was employed, which had an NHase activity of 172 kU/g as measured before the beginning of the bioconversion.
  • re-suspended biocatalyst corresponding to 0.92 g dried biocatalyst was added to the reactor.
  • the acrylonitrile (ACN) concentration from 0 h to 1 h after beginning of the bioconversion was maintained at 2 w/w % by feeding acrylonitrile to the reactor.
  • re-suspended biocatalyst corresponding to 0.37 g dried biocatalyst was added to the reactor.
  • the acrylonitrile concentration was maintained at 0.8 w/w %, until a total amount of 1553 g acrylonitrile has been added to the reactor. No full conversion ( ⁇ 100 ppm residual acrylonitrile) was reached after 20 h.
  • FIG. 10 Time course of acrylamide (ACM, depicted in dark grey) [%] and acrylonitrile (ACN, depicted in light grey) [%] concentrations in w/w % in a bioconversion of acrylonitrile to acrylamide applying spray dried Rhodococcus rhodochrous NCIMB 41 164 as biocatalyst.
  • the dried biocatalyst has been re-suspended in 30 ml. of 100 mM phosphate buffer (pH 8.0), which corresponds to the pre-treatment step of the invention. Pre-treatment was conducted for 0.5 h.
  • a total amount of 1.29 g of the dried biocatalyst (batch V3) was employed, which had an NHase activity of 172 kU/g as measured before the beginning of the bioconversion.
  • L liter
  • re-suspended biocatalyst corresponding to 0.92 g dried biocatalyst was added to the reactor.
  • the acrylonitrile (ACN) concentration from 0 h to 1 h after beginning of the bioconversion was maintained at 2 w/w % by feeding acrylonitrile to the reactor.
  • FIG 11 Time course of acrylamide (ACM, depicted in dark grey) [%] and acrylonitrile (ACN, depicted in light grey) [%] concentrations in w/w % in a bioconversion of acrylonitrile to acrylamide applying spray dried Rhodococcus rhodochrous NCIMB 41 164 as biocatalyst.
  • the dried biocatalyst has been re-suspended in 30 ml. of 100 mM citrate buffer (pH 7.0), which corresponds to the pre-treatment step of the invention. Pre-treatment was conducted for 0.5 h.
  • a total amount of 1.29 g of the dried biocatalyst (batch V3) was employed, which had an NHase activity of 172 kU/g as measured before the beginning of the bioconversion.
  • L liter
  • re-suspended biocatalyst corresponding to 0.92 g dried biocatalyst was added to the reactor.
  • the acrylonitrile (ACN) concentration from 0 h to 1 h after beginning of the bioconversion was maintained at 2 w/w % by feeding acrylonitrile to the reactor.
  • Figure 12 Time course of acrylamide (ACM, depicted in dark grey) [%] and acrylonitrile (ACN, depicted in light grey) [%] concentrations in w/w % in a bioconversion of acrylonitrile to acrylamide applying spray dried Rhodococcus rhodochrous NCIMB 41 164 as biocatalyst.
  • the dried biocatalyst has been re-suspended in water.
  • a total amount of 1.84 g of the dried biocatalyst (batch Ch08) was employed, which had an NHase activity of 136 kU/g as measured before the beginning of the bioconversion.
  • FIG. 13 Time course of acrylamide (ACM, depicted in dark grey) [%] and acrylonitrile (ACN, depicted in light grey) [%] concentrations in w/w % in a bioconversion of acrylonitrile to acrylamide applying spray dried Rhodococcus rhodochrous NCIMB 41 164 as biocatalyst.
  • the dried biocatalyst has been re-suspended in 30 ml. of 100 mM phosphate buffer (pH 7.0), which corresponds to the pre-treatment step of the invention. Pre-treatment was conducted for 0.5 h.
  • a total amount of 1 .84 g of the dried biocatalyst (batch Ch08) was employed, which had an NHase activity of 136 kU/g as measured before the beginning of the bioconversion.
  • L liter
  • re-suspended biocatalyst corresponding to 1.31 g dried biocatalyst was added to the reactor.
  • the acrylonitrile (ACN) concentration from 0 h to 1 h after beginning of the bioconversion was maintained at 2 w/w % by feeding acrylonitrile to the reactor.
  • Figure 14 Time course of acrylamide (ACM, depicted in dark grey) [%] and acrylonitrile (ACN, depicted in light grey) [%] concentrations in w/w % in a bioconversion of acrylonitrile to acrylamide applying spray dried Rhodococcus rhodochrous NCIMB 41 164 as biocatalyst.
  • the dried biocatalyst has been re-suspended in water.
  • a total amount of 1.94 g of the dried biocatalyst (batch Ch13-PP/200) was employed, which had an NHase activity of 129 kU/g as measured before the beginning of the bioconversion.
  • Batch Ch13-PP/200 of the biocatalyst Rhodococcus rhodochrous used in the experiments of Fig. 14 and 15 differs from batch Ch08 used in the experiments of Fig. 12 and 13 only in that Ch13-PP/200 has been spray dried together with phosphate buffer according to Example 2, while Ch08 has been spray dried without addition of buffer. Both batches Ch08 and Ch13-PP/200 have been obtained from the same concentrated cell suspension.
  • the acrylonitrile (ACN) concentration from 0 h to 1 h after beginning of the bioconversion was maintained at 2 w/w % by feeding acrylonitrile to the reactor.
  • ACN acrylonitrile
  • re-suspended biocatalyst corresponding to 0.55 g dried biocatalyst was added to the reactor.
  • the acrylonitrile concentration was maintained at 0.8 w/w %, until a total amount of 1553 g acrylonitrile has been added to the reactor.
  • Total reaction time until full conversion was 8.9 h.
  • Figure 15 Time course of acrylamide (ACM, depicted in dark grey) [%] and acrylonitrile (ACN, depicted in light grey) [%] concentrations in w/w % in a bioconversion of acrylonitrile to acrylamide applying spray dried Rhodococcus rhodochrous NCIMB 41 164 as biocatalyst.
  • ACM acrylamide
  • ACN acrylonitrile
  • the dried biocatalyst has been re-suspended in 30 ml. of 100 mM phosphate buffer (pH 7.0).
  • the acrylonitrile (ACN) concentration from 0 h to 1 h after beginning of the bioconversion was maintained at 2 w/w % by feeding acrylonitrile to the reactor.
  • ACN acrylonitrile
  • re-suspended biocatalyst corresponding to 0.55 g dried biocatalyst was added to the reactor.
  • the acrylonitrile concentration was maintained at 0.8 w/w %, until a total amount of 1553 g acrylonitrile has been added to the reactor.
  • Total reaction time until full conversion was 6.63 h.
  • Example 1 Pretreatment of a dried biocatalyst with buffer
  • Spray dried biocatalyst is weighed out in a centrifuge tube (Falcon®) and suspended in 30 ml. buffer for the pre-treatment step according to the invention. Unless indicated otherwise, said buffer was 100 mM phosphate buffer, pH 7.0. The biocatalyst is buffer-treated for 0.5 h at room temperature. Then the biomass (biocatalyst) suspension is transferred to the reactor and further incubated for 1 h. After addition of the biomass suspension to the reactor, the centrifuge tube is rinsed with water and the solvent is transferred as well to the reactor. This amount of water is considered for the water weighing into the reactor.
  • Example 2 Pre-treatment of a biocatalyst with buffer before spray drying
  • the cell suspension is concentrated by mechanical means, e.g. by centrifugation, filtration or membrane processes.
  • the concentrate has a molar phosphate concentration of about 10 mM.
  • the concentrate is the form of the biocatalyst prior to its drying step.
  • Concentrate means that the fermentation broth is concentrated by reducing liquid fermentation broth, e.g. by centrifugation and/or filtration.
  • the fermentation broth, the concentrate and the dried powder as used in this Example contain the same biocatalyst.
  • a concentrated buffer solution is added to the cell suspension, thereby increasing the phosphate amount up to 200 mM. Shortly afterwards the cell suspension is spray dried.
  • 2.4 L of water is filled in the reactor as well as the biocatalyst.
  • Biomass is added as spray dried cells of Rhodococcus rhodochrous, which has been previously suspended into water. As described herein, the spray dried cells can also be suspended in buffer as pre-treatment.
  • acrylonitrile is dosed into the stirred tank reactor employing a process control system.
  • a constant concentration of acrylonitrile of 0.5 to 5 w/w % is adjusted by the use of an online Fourier Transform Infrared (FTIR) analysis, which directly communicates with the process control unit (Labview).
  • FTIR Fourier Transform Infrared
  • the reaction temperature is constantly kept at 20 to 29°C.
  • the dosage of acrylonitrile is stopped after the addition of 1553 g acrylonitrile.
  • ACN residual acrylonitrile
  • concentrations of acrylamide and acrylonitrile are determined via HPLC using the method set forth in Example 4.
  • the acrylamide concentration determined via HPLC may slightly deviate from the acrylamide concentration shown in the Figures, which have been monitored via FTIR.
  • Example 4 Determination of the concentration of acrylic acid, acrylamide, acrylic acid and acrylonitrile in the obtained aqueous acrylamide solutions by HPLC
  • UV detector wavelength 210 nm
  • NCI MB buffer pH 7.0
  • NCIMB buffer pH 7.5
  • NCIMB buffer pH 7.5
  • Rhodococcus rhodochrous (NCIMB 41 164) of batch Ch30 with phosphate buffer leads to a dramatic reduction of total reaction time from an incomplete conversion after 19 h to a complete conversion after 4.32 h.
  • Biocatalyst powder with a specific nitrile hydratase activity of 90 kU/g powder was suspended in deionized water and several different buffers before being used in a bioconversion reaction. 70,7 mg biocatalyst powder was suspended in 10 g suspension medium (i.e. either deionized water or a buffer solution) and gently mixed at room
  • TRIS-HCI 2-Amino-2-(hydroxymethyl)-1 ,3-propanediol hydrochloride
  • ACES N-(2-Acetamido)-2-aminoethanesulfonic acid
  • Example 1 2410 g deionized water and 25 g ACN were placed in a reactor. 1 ,92 g biocatalyst powder containing spray dried cells of Rhodococcus rhodochrous NCIMB 41 164, with a specific nitrile hydratase activity of 153 kU/g dry powder and 1528 g additional ACN was then added to the reactor in the following manner:
  • Run #1 (reference, without buffer): 1 ,37 g biocatalyst powder was suspended in 20 ml deionized water at room temperature and added to the reactor, whereby the bioconversion reaction started.
  • the mixing tube with a total volume of 50 ml, was rinsed with 5 g deionized water, which were also added to the reactor.
  • an additional 0,55 g biocatalyst powder was suspended in 20 g deionized water at room temperature and added to the reactor.
  • the mixing tube was rinsed with 5 g deionized water, which were also added to the reactor. 1528 g ACN was added continuously to the reactor.
  • the ACN concentration was measured by on-line FTIR, and the rate of addition of ACN was adjusted so that the ACN concentration in the reaction mixture was kept constant at 1.0 ⁇ 0.1 % (w / w) until the entire ACN had been added to the reaction mixture. The reaction was stopped after ACN concentration had decreased to ⁇ 100 ppm due to conversion.
  • reaction time was controlled at 23 °C throughout the complete reaction time.
  • ACM concentration in every run was ⁇ 51 % (w / w), determined using HPLC according to the method provided below. The results are shown in the table below.

Landscapes

  • Organic Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Microbiology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Biotechnology (AREA)
  • Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

La présente invention concerne des procédés de production d'un composé amide à partir d'un composé nitrile à l'aide d'un biocatalyseur séché qui a été prétraité avec un tampon, le biocatalyseur séché et prétraité présentant des propriétés améliorées par comparaison avec un biocatalyseur séché qui n'a pas été prétraité avec un tampon. En particulier, la présente invention concerne un moyen et des procédés pour améliorer l'activité NHase d'un biocatalyseur séché destiné à être utilisé dans la production de composés amide à partir de composés nitrile dans des solutions aqueuses, ce qui permet d'améliorer le procédé de bioconversion.
PCT/EP2016/073372 2015-09-30 2016-09-29 Moyen et procédé de production d'un composé amide WO2017055518A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP15187778 2015-09-30
EP15187778.4 2015-09-30

Publications (1)

Publication Number Publication Date
WO2017055518A1 true WO2017055518A1 (fr) 2017-04-06

Family

ID=54251424

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2016/073372 WO2017055518A1 (fr) 2015-09-30 2016-09-29 Moyen et procédé de production d'un composé amide

Country Status (1)

Country Link
WO (1) WO2017055518A1 (fr)

Cited By (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019081004A1 (fr) 2017-10-25 2019-05-02 Basf Se Procédé de production de solutions aqueuses de polyacrylamide
WO2019081327A1 (fr) 2017-10-25 2019-05-02 Basf Se Procédé de production de solutions aqueuses de polyacrylamide
WO2019081008A1 (fr) 2017-10-25 2019-05-02 Basf Se Processus de production d'une solution aqueuse d'acrylamide
WO2019081319A1 (fr) 2017-10-25 2019-05-02 Basf Se Procédé de production de solutions aqueuses de polyacrylamide
WO2019081321A1 (fr) 2017-10-25 2019-05-02 Basf Se Procédé de production de solutions aqueuses de polyacrylamide
WO2019081330A1 (fr) 2017-10-25 2019-05-02 Basf Se Procédé de production de solutions aqueuses de polyacrylamide
WO2019081318A1 (fr) 2017-10-25 2019-05-02 Basf Se Procédé de production de solutions aqueuses de polyacrylamide
WO2019081323A1 (fr) 2017-10-25 2019-05-02 Basf Se Procédé de production de solutions aqueuses de polyacrylamide
CN111039861A (zh) * 2019-12-29 2020-04-21 安徽瑞邦生物科技有限公司 一种含低烟酸副产物的烟酰胺合成催化工艺
WO2020079124A1 (fr) 2018-10-18 2020-04-23 Basf Se Procédé de production de compositions de polyacrylamide aqueuses
WO2020079148A1 (fr) 2018-10-18 2020-04-23 Basf Se Procédé de fracturation de formations souterraines
WO2020079152A1 (fr) 2018-10-18 2020-04-23 Basf Se Procédé de production d'un concentrat de polyacrylamide aqueux
WO2020079119A1 (fr) 2018-10-18 2020-04-23 Basf Se Procédé de fourniture de concentrés de polyacrylamide aqueux
WO2023041515A2 (fr) 2021-09-15 2023-03-23 Basf Se Procédé de préparation d'une solution de (méth) acrylamide aqueuse

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005040373A1 (fr) * 2003-10-27 2005-05-06 Lonza Ag Immobilisation d'un biocatalyseur
WO2005054456A1 (fr) * 2003-12-02 2005-06-16 Ciba Specialty Chemicals Water Treatments Limited Souche de rhodococcus rhodochrous ncimb 41164 et son utilisation comme producteur de nitrile hydratase
EP1835033A1 (fr) * 2005-01-07 2007-09-19 Dia-Nitrix Co., Ltd. Procede de production d'un compose amide et d'un copolymere acrylamide
WO2016050819A1 (fr) * 2014-09-30 2016-04-07 Basf Se Procédé de préparation d'une solution d'acrylamide ayant une faible concentration d'acide acrylique
WO2016050816A2 (fr) * 2014-09-30 2016-04-07 Basf Se Moyens et procédés de production de composés amide avec moins d'acide acrylique

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005040373A1 (fr) * 2003-10-27 2005-05-06 Lonza Ag Immobilisation d'un biocatalyseur
WO2005054456A1 (fr) * 2003-12-02 2005-06-16 Ciba Specialty Chemicals Water Treatments Limited Souche de rhodococcus rhodochrous ncimb 41164 et son utilisation comme producteur de nitrile hydratase
EP1835033A1 (fr) * 2005-01-07 2007-09-19 Dia-Nitrix Co., Ltd. Procede de production d'un compose amide et d'un copolymere acrylamide
WO2016050819A1 (fr) * 2014-09-30 2016-04-07 Basf Se Procédé de préparation d'une solution d'acrylamide ayant une faible concentration d'acide acrylique
WO2016050816A2 (fr) * 2014-09-30 2016-04-07 Basf Se Moyens et procédés de production de composés amide avec moins d'acide acrylique

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
PRATUSH A ET AL: "Optimization of process parameters for conversion of 3-cyanopyridine to nicotinamide using resting cells of mutant 4D strain of Rhodococcus rhodochrous PA-34", INTERNATIONAL JOURNAL BIOAUTOMOTION 2011 INSTITUTE OF BIOPHYSICS AND BIOMEDICAL ENGINEERING BGR, vol. 15, no. 3, 2011, pages 151 - 158, XP002751832 *
SONG LIYA ET AL: "Purification and characterization of the enantioselective nitrile hydratase from Rhodococcus sp AJ270", BIOTECHNOLOGY JOURNAL, vol. 2, no. 6, June 2007 (2007-06-01), pages 717 - 724, XP002751831 *

Cited By (19)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019081330A1 (fr) 2017-10-25 2019-05-02 Basf Se Procédé de production de solutions aqueuses de polyacrylamide
WO2019081323A1 (fr) 2017-10-25 2019-05-02 Basf Se Procédé de production de solutions aqueuses de polyacrylamide
WO2019081004A1 (fr) 2017-10-25 2019-05-02 Basf Se Procédé de production de solutions aqueuses de polyacrylamide
WO2019081331A1 (fr) 2017-10-25 2019-05-02 Basf Se Procédé de production d'une solution aqueuse d'acrylamide
WO2019081319A1 (fr) 2017-10-25 2019-05-02 Basf Se Procédé de production de solutions aqueuses de polyacrylamide
WO2019081003A1 (fr) 2017-10-25 2019-05-02 Basf Se Procédé de production de solutions aqueuses de polyacrylamide
WO2019081321A1 (fr) 2017-10-25 2019-05-02 Basf Se Procédé de production de solutions aqueuses de polyacrylamide
WO2019081320A1 (fr) 2017-10-25 2019-05-02 Basf Se Procédé de production de solutions aqueuses de polyacrylamide
WO2019081008A1 (fr) 2017-10-25 2019-05-02 Basf Se Processus de production d'une solution aqueuse d'acrylamide
WO2019081327A1 (fr) 2017-10-25 2019-05-02 Basf Se Procédé de production de solutions aqueuses de polyacrylamide
WO2019081318A1 (fr) 2017-10-25 2019-05-02 Basf Se Procédé de production de solutions aqueuses de polyacrylamide
US11643491B2 (en) 2018-10-18 2023-05-09 Basf Se Process for producing an aqueous polyacrylamide concentrate
WO2020079124A1 (fr) 2018-10-18 2020-04-23 Basf Se Procédé de production de compositions de polyacrylamide aqueuses
WO2020079148A1 (fr) 2018-10-18 2020-04-23 Basf Se Procédé de fracturation de formations souterraines
WO2020079152A1 (fr) 2018-10-18 2020-04-23 Basf Se Procédé de production d'un concentrat de polyacrylamide aqueux
WO2020079119A1 (fr) 2018-10-18 2020-04-23 Basf Se Procédé de fourniture de concentrés de polyacrylamide aqueux
US11608468B2 (en) 2018-10-18 2023-03-21 Basf Se Process of fracturing subterranean formations
CN111039861A (zh) * 2019-12-29 2020-04-21 安徽瑞邦生物科技有限公司 一种含低烟酸副产物的烟酰胺合成催化工艺
WO2023041515A2 (fr) 2021-09-15 2023-03-23 Basf Se Procédé de préparation d'une solution de (méth) acrylamide aqueuse

Similar Documents

Publication Publication Date Title
AU2015326905B2 (en) Means and methods for producing amide compounds with less acrylic acid
WO2017055518A1 (fr) Moyen et procédé de production d'un composé amide
JP6716547B2 (ja) 低いアクリル酸濃度を有するアクリルアミド水溶液の製造方法
WO2016050819A1 (fr) Procédé de préparation d'une solution d'acrylamide ayant une faible concentration d'acide acrylique
CN107075457B (zh) 培养具有腈水合酶活性的微生物的方法
JP2017535249A5 (fr)
AU2017242461B2 (en) Process for producing a polyacrylamide solution with increased viscosity
KR20160057478A (ko) 정제 화학약품의 개선된 생산을 위한 재조합 미생물
EP3225694A1 (fr) Procédé de production d'acrylamide par addition définie du biocatalyseur
JP2016202046A (ja) 酵素の製造方法
US20220403426A1 (en) Method of storing a biocatalyst
EP3225693A1 (fr) Procédé de préparation de solutions d'acrylamide aqueuses
WO2023183785A2 (fr) Variants de nitrile hydratases, microbe les exprimant, et utilisation dans la synthèse d'amides

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16774946

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 16774946

Country of ref document: EP

Kind code of ref document: A1