WO2017024233A1 - Compositions et procédés d'identification d'inhibiteurs de la signal peptidase de type i - Google Patents

Compositions et procédés d'identification d'inhibiteurs de la signal peptidase de type i Download PDF

Info

Publication number
WO2017024233A1
WO2017024233A1 PCT/US2016/045796 US2016045796W WO2017024233A1 WO 2017024233 A1 WO2017024233 A1 WO 2017024233A1 US 2016045796 W US2016045796 W US 2016045796W WO 2017024233 A1 WO2017024233 A1 WO 2017024233A1
Authority
WO
WIPO (PCT)
Prior art keywords
ayrr
promoter
reporter
protein
nucleic acid
Prior art date
Application number
PCT/US2016/045796
Other languages
English (en)
Inventor
Floyd Romesberg
Arryn CRANEY
Original Assignee
The Scripps Research Institute
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The Scripps Research Institute filed Critical The Scripps Research Institute
Publication of WO2017024233A1 publication Critical patent/WO2017024233A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
    • C12Q1/18—Testing for antimicrobial activity of a material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6897—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids involving reporter genes operably linked to promoters

Definitions

  • the present disclosure relates to and includes methods and compositions useful for the identification of inhibitors of Type I Signal Peptidase (SPase) Inhibitors.
  • SPase Signal Peptidase
  • Bacterial Type I SPase inhibitors are useful as antibiotics. BACKGROUND OF THE INVENTION
  • Signal peptidase I Signal peptidase I
  • SPase II Signal peptidase II
  • SPase I and SPase II have been identified in bacteria that have different cleavage specificities. The majority of secreted proteins are processed by SPase I while SPase II has been identified as processing glyceride-modified lipoproteins.
  • SPase I is essential for bacterial viability and growth.
  • SPase I is present in both Gram-positive and Gram- negative bacteria, as well as in Chlamydia.
  • SPase I has been cloned and sequenced from different bacterial species, including many clinically relevant bacteria. Differences between the prokaryotic and eukaryotic SPases make them attractive candidates for development of antibiotics and therapeutic treatments.
  • Type I signal peptidase (SPase) is important for viability in wild type bacteria because the terminal step of the bacterial general secretory pathway requires its proteolytic activity to release proteins from their membrane bound N-terminal leader sequences after translocation across the cytoplasmic membrane.
  • AyrR operon a four gene operon whose expression is repressed by the repressor protein AyrR. This operon is derepressed when Type I SPase is inhibited and the derepressed genes are then transcribed and their protein products help the bacteria to overcome negative effects of Type I SPase inhibition.
  • the detection of SPase inhibitors provides a starting point for the development of new antibiotics.
  • the present disclosure provides techniques and compositions to detect novel SPase inhibitors, amenable to standard screening techniques including high throughput screening formats, by monitoring the increase in luminescence that results from derepression of the ayrR operon modified to encode luciferase.
  • a transcriptional reporter of the ayrR promoter of the present disclosure has many advantages over the current screening method. Methods of the present disclosure includes those that use intact cells and surrogate peptide substrate needs to be added.
  • the present disclosure provides for, and includes, a method of screening for an inhibitor of a Type I signal peptidase (SPase) comprising contacting a bacterium with a compound, wherein the bacterium is transformed with a nucleic acid comprising a promoter capable of being repressed by an AyrR repressor protein, and a nucleic acid sequence encoding a reporter that is operably linked to the promoter, and detecting expression of the reporter.
  • SPase Type I signal peptidase
  • the present disclosure further provides for, and includes, a recombinant nucleic acid comprising a promoter capable of being repressed by an AyrR repressor protein and a nucleic acid encoding a reporter.
  • a method of screening for antibiotics comprising providing a microorganism having a bacterial Type I signal peptidase (SPase I) transformed with a recombinant nucleic acid comprising a promoter capable of being repressed by an AyrR repressor protein and a nucleic acid encoding a reporter, applying one or more compounds to the microorganism, and detecting a signal from the reporter.
  • SPase I bacterial Type I signal peptidase
  • Figure 1 is a diagram illustrating the action of a method and nucleic acid construct of an aspect according to the present disclosure.
  • AyrR protein binds to the ayrRp operator and inhibits the transcription of luxCDABE (left).
  • AyrR protein dissociates from the ayrRp operator and LuxAB and LuxCDE are produced, resulting in detectable luminescence (right).
  • Figure 2 is a graph showing increased luminescence in Staphylococcus aureus cells having a recombinant nucleic acid according to an aspect of the present disclosure.
  • Luminescence detected from S. aureus cells transformed with a recombinant nucleic acid according to an aspect of the present disclosure is shown before addition of the Type I SPase inhibitor (left) and after addition (right).
  • Figure 3 A presents the chemical structure of a Type I SPase inhibitor, arylomycin M131.
  • Figure 3B is a schematic representation of the genomic organization of the ayrRABC operon ⁇ ayrR, SA0337; ayrA, SA0338; ayrB, SA0339; ayrC, SA0340) and the region immediately upstream that includes SA0336.
  • ayrR sequence of the putative promoter region in the DNA upstream of ayrR ending with its GTG translational start site (SEQ ID NO: 1).
  • a 22-nt palindromic repeat (denoted by arrows under the sequence) is located 43-65 base pairs (bp) upstream of the start site (SEQ ID NO:2).
  • a putative -35, -10 and ribosome binding site (RBS) are underlined in the coding strand.
  • the transcriptional start site is marked as +1, corresponding to 18 nucleotides (nts) upstream from the translational start site.
  • Figure 3 C is an RT-PCR analysis of the ayrRABC operon and divergent genes
  • SA0334-SA0336 The fold change in gene expression from ARCOOOl with respect to N315 is shown.
  • gyrB is used as an external control and gene expression is normalized using gmk. See Table 7 for primer sequences.
  • Figure 3D is a gel shift analysis according to the present disclosure. Gel shifts are performed with 30 ng of each DNA probe and an increasing concentration of AyrR protein as indicated at the top. The region of DNA corresponding to each gel shift probe is shown above the gel data, with the ayrR binding site shown in red. Filled triangles denote free DNA probe and open triangles denote the indicated DNA- AyrR complexes. All DNA probes are amplified from wild type N315 genomic DNA with the exception of IRpal, which is created by annealing synthetic oligonucleotides. See Table 7 for primer sequences.
  • Figure 3E is an analysis of luminescence from the ayrR promoter (pARC l) in wild type N315 and N315ASA0336- ayrRABC (labeled AAyrR) according to an aspect of the present disclosure. Luminescence is expressed as counts per second per cell density
  • Figure 3F is an analysis of luminescence from N315 harboring pARCl in the presence and absence of arylomycin M131 (0.5 xMIC) according to an aspect according to the present disclosure.
  • Figure 4 is an analysis of the extracellular proteomes of N315, ARCOOOl and ARCOOl AspsB according to an aspect of the present disclosure. Arrows denote bands where significant differences are observed in the extracellular proteomes of wild type N315 and ARCOOOlAspsB.
  • the present disclosure provides a S. aureus operon ayrRABC (SA0337-SA0340), and provides, without being limited by theory, that once released from repression by AyrR protein, protein products AyrABC together confer resistance to the Type I SPase inhibitor arylomycin M131 by providing an alternate method to release translocated proteins.
  • Derepression of ayrRABC allows cells to bypass the necessity for Type I SPase.
  • AyrABC functionally complements Type I SPase by mediating the processing of the normally secreted proteins, albeit in some cases with reduced efficiency and either without cleavage or via cleavage at a site N-terminal to the canonical Type I SPase cleavage site.
  • the present disclosure provides that ctyrRABC encodes a secretion-stress inducible alternate terminal step of the general secretory pathway. Inducible expression of genes operably linked to the ayrR promoter when Type I SPase is inhibited provides for methods of screening for novel compounds, molecules, proteins, and nucleic acids that can act through inhibiting Type I SPase.
  • the present disclosure provides for, and includes, methods for screening for inhibitors of a Type I signal peptidase (Type I SPase).
  • Type I SPase a Type I signal peptidase
  • the present disclosure provides for methods for screening for inhibitors of Type I SPase obtainable from Gram-positive, Gram- negative bacteria, mycobacteria, archaea, fungi, chloroplasts, as well as other higher eukaryotes.
  • a method can be performed on small numbers of samples or can be performed using high throughput screening methods.
  • Methods of the present disclosure include and provide for improved screening of SPase inhibitors in the absence of purification of SPase or the preparation of SPase cleavable substrates such as fluorogenic peptides.
  • a Type I SPase can be a Type I SPase from a Gram-positive bacteria.
  • Gram-positive bacteria or "gram-positive bacterium” as used herein refers to bacteria, which have been classified using the Gram stain as having a blue stain. Gram-positive bacteria have a thick cell membrane consisting of multiple layers of peptidoglycan and an outside layer of teichoic acid.
  • the Type I SPase can be from a Gram-negative bacteria.
  • the Type I SPase can be obtained from mycobacteria, archaea, fungi, plants, as well as other higher eukaryotes.
  • the present disclosure provides for, and includes, introducing a heterologous Type I SPase into a Gram-positive bacteria.
  • a heterologous Type I SPase can be from a Gram-positive bacteria, from a Gram-negative bacteria, an archaea, a fungi, a plant, or a eukaryote including mammals.
  • the heterologous Type I SPase is introduced into the Gram-positive bacteria, Staphylococcus aureus (S. aureus).
  • the present method includes, and provides for, identifying inhibitors of Type I SPases from a variety of sources, including bacterial sources which do not have an endogenous ayrRABC operon and repressor system.
  • the present disclosure provides for, and includes methods for screening for inhibitors of Type I SPase obtained from multiple diverse sources.
  • Type I SPase has been identified in Gram-positive and Gram-negative bacteria, archaea, the inner membrane of yeast mitochondria, the thylakoid membrane of chloroplasts, and the endoplasmic reticular (ER) membranes of yeast and higher eukaryotes. See Paetzel et al, "Signal peptidases," Chem. Rev 102(12):4549-4580 (2002).
  • Type I signal peptidase is critical for viability in wild type bacteria because the terminal step of the bacterial general secretory pathway requires its proteolytic activity to release proteins from their membrane bound N-terminal leader sequences after translocation across the cytoplasmic membrane.
  • Type I signal peptidases are ubiquitous and recognizable by those of skill in the art based on conservation of sequence. See van Roosmalen et al, "Type I signal peptidases of Gram-positive bacteria," Biochim Biophys Acta. 1694:279-297 (2004).
  • the Type I SPase may be a heterologous or endogenous peptidase.
  • a heterologous Type I SPase is a Type I SPase that has been introduced into a microorganism of a different species.
  • a bacterium for screening of a heterologous Type I SPase may be engineered to express the heterologous Type I SPase by replacing the endogenous Type I SPase.
  • the heterologous Type I SPase may be expressed in a heterologous bacterium in addition to the endogenous Type I SPase.
  • the endogenous Type I SPase can be knocked out, be conditionally expressed, or mutated.
  • the heterologous Type I SPase may be inducible.
  • the endogenous Type I SPase may be inducible.
  • the heterologous Type I SPase may be inducible in a bacterial host wherein the endogenous Type I SPase is repressible.
  • the repressible endogenous Type I SPase may be a temperature sensitive mutant Type I SPase.
  • a bacterium suitable for use in the screening methods may be a Gram-positive bacterium, a Gram-negative bacterium, or a
  • Gram-negative bacteria or "gram-negative bacterium” as used herein is defined as bacteria which have been classified by the Gram stain as having a red stain. Gram-negative bacteria have thin walled cell membranes consisting of a single layer of peptidoglycan and an outer layer of lipopolysaccharide, lipoprotein, and phospholipid.
  • Suitable Gram-positive bacterial host cells for use in the methods of the present disclosure include, but are not limited to Staphylococcus spp., Streptococcus spp.,
  • Propionibacterium spp. Enter ococcus spp. , Bacillus spp. , Corynebacterium spp. , Nocardia spp., Clostridium spp. , Actinobacteria spp. , Listeria spp., Zymomonas spp., Geobacillis spp., Lactobacillis spp. , Lactococcus spp. , Oenococcus spp. , and Eubacterium spp.
  • the host bacterium is S. aureus.
  • Suitable Gram-negative bacteria suitable for use in the present methods include, but are not limited to, Enter obacteriacea consisting of Escherichia, Shigella, Edwardsiella, Salmonella, Citrobacter, Klebsiella, Enterobacter , Hafnia, Serratia, Proteus, Morganella, Providencia, Yersinia, Erwinia, Buttlauxella, Cedecea, Ewingella, Kluyvera, Tatumella and Rahnella.
  • exemplary gram-negative organisms suitable for use in the methods of the present disclosure but not in the family Enterobacteriacea include, but are not limited to, Pseudomonas aeruginosa, Stenotrophomonas maltophilia, Burkholderia, Cepacia,
  • the present disclosure provides for methods for screening for inhibitors of Type I SPase obtainable from Gram-positive, Gram-negative bacteria, mycobacteria, archaea, fungi, chloroplasts, as well as other higher eukaryotes.
  • a homologous ayrRABC operon and repressor system has not been identified to date in Gram-negative bacteria.
  • a Gram-negative bacteria may be an engineered Gram- negative bacteria wherein the ayrRABC operon and repressor system from a Gram-positive bacteria has been introduced.
  • an engineered Gram-negative bacteria may further include a heterologous Type I SPase for using the screening methods according to the present disclosure.
  • Suitable methods for preparing bacteria transformed with a nucleic acid of the present disclosure are known in the art. Standard techniques to introduce nucleic acids of the present disclosure include calcium chloride methods, rubidium chloride methods and electroporation. See e.g. , Hanahan (J. Mol. Biol. 166: 557-580 (1983); Liu et al ,
  • Suitable selectable markers include resistance genes to erythromycin (erm), ampicillin ⁇ bid), kanamycin (kan), chloramphenicol (cat), spectinomycin (ctadA), and tetracycline (tet).
  • Suitable metabolic markers include genes that complement nutritional auxotrophies in minimal media, such as pur A (adenylosuccinate synthetase) or asd (aspartate semi-aldehyde dehydrogenase) in a bacterial strain that cannot synthesize adenine or diaminopimelic acid, respectively.
  • a vector or other recombinant nucleic acid molecule may include a nucleotide sequence encoding a reporter polypeptide.
  • the term "vector” as used herein is used in its broadest sense and includes within its meaning any replicon capable of transferring recombinant DNA material from one cell to another. Suitable vectors are well known in the art and may be integration vectors and plasmids that include an origin of replication for extrachromosomal replication. Vectors of the present disclosure may further include transcription termination sequences, viral promoters, multiple cloning sites and other features that are known in the art.
  • the present disclosure provides for, and includes, nucleic acids encoding polypeptides suitable for use as a reporter.
  • a reporter generally encodes a detectable polypeptide, for example, a fluorescent protein, a luminescent reporter or an enzymatic reporter.
  • Suitable reporters of the present disclosure when contacted with an appropriate agent (a particular wavelength of light or luciferin, for example) generates a signal that can be detected by eye or using appropriate instrumentation (Giacomin et al , "Expression of a PALI promoter luciferase gene function in Arabidopsis thaliana in response to infection by phytopathogenic bacteria," Plant Sci.
  • the reporter can be detected based on its activity as a polypeptide.
  • expression of the reporter can be detected as the transcribed ribonucleic acid (RNA).
  • the reporter may be a fluorescent reporter.
  • fluorescent reporters are categorized by the fluorescence emission wavelength and include, but are not limited to Blue/UV (Table 1), Cyan (Table 2), Green (Table 3), Yellow (Table 4), Orange (Table 5), Red (Table 6).
  • Additional reporter proteins suitable for the methods and recombinant nucleic acids of the present disclosure include Far-Red proteins, near-IR proteins, long stokes shift proteins, photoactivatible proteins, photoconvertible proteins, and photoswitchable proteins.
  • the present disclosure provides for, and includes, nucleic acids encoding a promoter capable of being repressed by an AyrR repressor protein operably linked to green fluorescent protein (GFP), derivatives of green fluorescent protein, dsRED, mRFP, derivatives of mRFP.
  • GFP green fluorescent protein
  • the reporter is GFP or derivatives thereof.
  • the fluorescent reporter may encode uroporphyrinogen (UMT) (Feliciano et al, "Novel reporter gene in a fluorescent- based whole cell sensing system," Biotechnol Bioeng.
  • nfsB nitroreductase
  • the present disclosure provides for, and includes, nucleic acids encoding a promoter capable of being repressed by an AyrR repressor protein operably linked to a luminescent reporter.
  • the luminescent reporter is a nucleic acid sequence encoding the luxCDABE genes.
  • the luxCDABE genes reporter includes the genes necessary to produce the luminescent substrate, decanal (n-decyl aldehyde).
  • methods of detecting the expression of the luxCDABE does not require the addition of a substrate.
  • the luminescent reporter is a nucleic acid sequence encoding the luxAB genes wherein detection of expression is accomplished through the addition of the substrate, for example decanal (n-decyl aldehyde) or other suitable fatty acid aldehyde. See Meighen, "Molecular biology of bacterial bioluminescence," Microbiol Rev. 55(1): 123-42 (1991). Also included in certain aspects, is a reporter comprising a polynucleotide encoding firefly luciferase (Prax et al., "An update on the molecular genetics toolbox for
  • the luminescent reporter may be a nucleic acid encoding aequorin (Zeinoddini et al. , "Design and characterization of an aequorin-based bacterial biosensor for detection of toluene and related compounds," Photochem Photobiol. 86(5): 1071-5 (2010)).
  • the present disclosure provides for, and includes, nucleic acids encoding a promoter capable of being repressed by an AyrR repressor protein operably linked to an enzymatic reporter.
  • enzymatic reporters often require the addition of a suitable substrate for detection.
  • the enzymatic reporter is catechol 2,3-dioxygenase (xylE) (See European Patent Publication No. EP0086139, published August 17, 1983).
  • the enzymatic reporter is lipase (lip).
  • the enzymatic reporter is beta-lactamase (blaZ).
  • the enzymatic reporter is beta- galactosidase (lacZ or bgaB).
  • the enzymatic reporter is beta-glucuronidase (gusA) (See Myronovskyi et al , "Beta-glucuronidase as a sensitive and versatile reporter in actinomy cetes," Appl Environ Microbiol. 77(15):5370-83 (2011)).
  • the enzymatic reporter is tyrosinase (jnelC) (See Paget et al.
  • the enzymatic reporter is chloramphenicol acetyltransferase (cat).
  • the enzymatic reporter is neomycin phosphotransferase (neo) (See Roy et al , "A sensitive and simple paper chromatographic procedure for detecting neomycin phosphotransferase II (NPTII) gene expression," Plant Mol Biol. 14(5): 873-6. (1990)).
  • the enzymatic reporter is ice nucleation (inaZ) (See Lindgren et al , "An ice nucleation reporter gene system: identification of inducible pathogenicity genes in Pseudomonas syringae pv.
  • suitable enzymatic reporters can be used in combination with each other (See Prax et al. , "An update on the molecular genetics toolbox for staphylococci,” Microbiology. 159(Pt 3):421 -35 (2013)).
  • Vectors according the present disclosure can further include a selectable marker.
  • selectable marker refers to a polynucleotide (or encoded polypeptide) that confers a detectable phenotype.
  • a selectable marker generally is a molecule that, when present or expressed in a cell, provides a selective advantage (or disadvantage) to the cell containing the marker, for example, the ability to grow in the presence of an agent that otherwise would kill the cell.
  • a selectable marker can provide a means to obtain prokaryotic cells or eukaryotic cells or both that express the marker and, therefore, can be useful as a component of a vector.
  • selectable markers include, but are not limited to, neomycin phosphotransferase, which confers resistance to the aminoglycosides neomycin, kanamycin and paromycin (Herrera-Estrella, "Chimeric genes as dominant selectable markers in plant cells. " EMBO J. 2:987-995, (1983)), hygromycin B phosphotransferase (hph), which confers resistance to hygromycin (Marsh et al.
  • Additional selectable markers include those that confer herbicide resistance, for example, phosphinothricin acetyltransferase gene, which confers resistance to phosphinothricin (White et al , "A cassette containing the bar gene of Streptomyces hygroscopicus: a selectable marker for plant transformation," Nucl. Acids Res. 18: 1062 (1990).
  • Selectable markers include polynucleotides that confer dihydrofolate reductase (DHFR) or neomycin resistance for eukaryotic cells and tetracycline; ampicillin resistance for prokaryotes such as E.
  • DHFR dihydrofolate reductase
  • neomycin resistance for eukaryotic cells and tetracycline
  • ampicillin resistance for prokaryotes such as E.
  • coli coli
  • bleomycin erythromycin, gentamycin, glyphosate, hygromycin, kanamycin, methotrexate, phleomycin, phosphinotricin, spectinomycin, streptomycin, sulfonamide and sulfonylurea.
  • Suitable selectable markers are known in the art.
  • One or more codons of an encoding polynucleotide can be biased to reflect the preferred codon usage of the host cell, or an organelle thereof (e.g. chloroplasts). Most amino acids are encoded by two or more different (degenerate) codons, and it is well recognized that various organisms utilize certain codons in preference to others.
  • bias when used in reference to a codon, means that the sequence of a codon in a polynucleotide has been changed such that the codon is one that is used preferentially in the target which the bias is for, e.g. , alga cells, chloroplasts, bacteria or yeast.
  • a polynucleotide that is biased for a particular codon usage can be synthesized de novo, or can be genetically modified using routine recombinant DNA techniques, for example, by a site directed mutagenesis method, to change one or more codons such that they are biased for chloroplast codon usage.
  • Suitable codon tables for preparing biased polypeptide encoding nucleic acids are known in the art. See Hilterbrand et al , "CBDB: the codon bias database,” BMC Bioinformatics 13:62 (2012).
  • operably linked means that expression of the nucleic acid is dependent on the expression from the promoter.
  • “Operably linked” generally, but not always, refers to a juxtaposition wherein the components are configured so as to perform their usual function.
  • promoters operably linked to a coding sequence are capable of effecting the expression of the coding sequence.
  • a promoter that is operably linked to a coding sequence may include an operator that can regulate gene expression, typically, but not always through repression.
  • An operator is a nucleic acid sequence (often referred to as a repressor binding site) that is capable of binding a transcription factor. Suitable positioning of the operator/repressor binding site results in the repression of transcription.
  • the repressor binding site is proximal to the promoter. In other aspects, the repressor binding site is overlapping with the promoter.
  • a promoter can be physically or operably linked to the nucleic acid encoding a reporter. Thus, when transcription is initiated, the nucleic acid sequences downstream from said promoter are expressed as an RNA transcript that can then be detected directly, or can be detected following translation of the RNA message into the encoded reporter polypeptide.
  • the operable linkage may be indirect wherein transcription from the promoter produces a protein product or RNA that activates expression of the reporter from a second promoter.
  • a second promoter may be physically linked to the first promoter, or may be present on a second nucleic acid or distantly linked to the first promoter.
  • detecting expression means measuring the amount of expression of the reporter that is operably linked to the promoter capable of being repressed by an AyrR repressor protein.
  • detecting comprises detecting a change in luminescence, fluorescence, or enzymatic activity of the polypeptide encoded by the reporter.
  • inhibition of a Type I SPase comprises an increase in luminescence, fluorescence, or enzymatic activity of the reporter polypeptide over the level of luminescence, fluorescence, or enzymatic activity of a microorganism having an identical nucleic acid construct that is not exposed to a compound.
  • detection means the measurement of the amount of RNA that encodes the reporter polypeptide.
  • Suitable methods for detecting the amount of RNA are known in the art and include reverse transcriptase polymerase chain reaction (RT-PCR) based methods.
  • RT-PCR assays includes real time PCR methods.
  • inhibition of a Type I SPase comprises an increase in the amount of RNA encoding the reporter polypeptide over the amount of RNA encoding the reporter polypeptide of a microorganism having an identical nucleic acid construct that is not exposed to a compound.
  • detection means detecting the amount of reporter protein.
  • measuring the reporter itself provides the means for detection.
  • fluorescent reporters when expressed as a protein can be detected by measuring the amount of light at the emission wavelength when the fluorescent reporter protein is illuminated with light in the absorption wavelength. Suitable emission and absorption wavelengths are known in the art as provided above in Tables 1 to 6. Detecting includes measuring the amount of light emission or the amount of fluorescence of a translation product of the reporter gene as the amount of expression by utilizing an optical detection apparatus.
  • Detection of the translation products of the luminescent reporters, enzymatic reporters and fluorescent reporters are detected by a suitable optical detection apparatus. For some luminescent reporters (e.g. , luciferase) a separate reagent may be required. Similarly, for enzymatic reporters, a color-developing substrate may be required. Suitable color- developing substrates and luminescent reporter substrates are known in the art.
  • the luminescence intensity of the solution comprising the luciferase protein and substrate is measured by a luminometer.
  • the reporter gene is a fluorescent protein gene
  • the bacterium or microorganism can be irradiated with a laser having an appropriate wavelength determined by the proteins absorption wavelength. Irradiation at the appropriate absorption wavelength results in the emission of light at the emission wavelength. Intensity of the generated fluorescence is measured by a fluorophotometer.
  • the reporter is a enzymatic reporter
  • a substrate undergoes a color change that can either be detected as an absorption or through the generation of a fluorescent product.
  • enzymatic reporters can cause a change in the fluorescent wavelength of a substrate, or cause fluorescence when none was previously present.
  • the methods of the present disclosure provides for, and includes, the detection of changes in expression of a reporter that results when a Type I SPase is inhibited by a compound.
  • the present disclosure provides for a facile method for identifying new compounds that inhibit Type I SPase and are potential bactericidal or bacteriostatic compounds, and should be especially useful to detect lead compounds whose activity is insufficient to cause cell death.
  • the Type I SPase is obtained from a fungus
  • inhibition of Type I SPase provides for the identification of fungicides.
  • the Type I SPase can be obtained from a higher eukaryote, for example a parasite, and provides for the identification of a compound suitable for treatment of parasitic infections.
  • Compounds suitable for use in the methods of the present disclosure includes small molecules, proteins, and nucleic acids. Also included and provided for in the present disclosure are compounds that are lipids, proteoglycans, saccharides and polysaccharides. Virtually any chemical or biological entity can be screened in the methods described herein.
  • the term "small molecule” as used herein refers to any compound that can be analyzed by mass spectral analysis, NMR, or other spectroscopic method and having a molecular weight that is less than 4000 Da.
  • Suitable compounds for the methods of the present disclosure can be obtained from libraries (e.g.
  • combinatorial or compound libraries including those that contain synthetic and/or natural products, and custom analog libraries, which may contain compounds based on a common scaffold).
  • Suitable libraries can include hundreds or thousands of distinct compounds or random pools thereof.
  • Libraries suitable for screening can be obtained from a variety of sources, including the compound libraries from commercial sources, for example ChemBridge Corp. (San Diego, Calif). Another compound library is available from the consortium formed by the University of Kentucky, the University of Cincinnati Genome Research Institute and the Research Institute of the Children's Hospital of Cincinnati. The library is referred to as the UC/GRI Compound Library.
  • Compound libraries may also be prepared by means known in the art, including, but not limited to, combinatorial chemistry techniques, fermentation methods, plant and cellular extraction procedures and the like. Methods for making combinatorial libraries are well-known in the art. See, for example, E. R. Felder Chimia 48:512-541 (1994); Gallop et al , "Applications of Combinatorial
  • library refers to an archived collection containing many items all belonging to the same family of items.
  • the term many means more than 2 or 3 and generally means as many as can be found and put into the library, therefore the size of the library is limited only upon the availability of the different components of the library.
  • a library of small molecules a library of natural product extracts (including proteins, lipids, nucleic acids or subsets of each), a library of expressed proteins, for example expressed from a plurality of cDNAs, and libraries of nucleic acids (for example siRNAs).
  • the components of a library may be characterized or may be a random collection.
  • Screening of a library involves the repeated application of the methods of the current disclosure followed by separation using methods known in the art (for example by chromatography or dilution). Each round of selection results in a decrease in the complexity of the library. Methods of screening libraries are well known in the art including automated and high throughput methods.
  • the present disclosure provides for, and includes a promoter capable of being repressed by an AyrR repressor protein.
  • a core promoter contains essential nucleotide sequences for promoter function, including the Pribnow box (TATAAT) and start of transcription.
  • TATAAT Pribnow box
  • a core promoter may or may not have detectable activity in the absence of specific sequences that enhance the activity or confer tissue specific activity. Promoters can be inducible (the rate of transcription changes in response to a specific agent), tissue specific (expressed only in some tissues), temporal specific (expressed only at certain times) or constitutive (expressed in all tissues and at a constant rate of transcription).
  • a promoter capable of being repressed by an AyrR repressor protein under normal conditions would be repressed and then induced when the Type I SPase has been inhibited.
  • minimal promoter is intended to describe a partial promoter sequence which defines the start site of transcription for the linked sequence to be transcribed but which by itself is not capable of initiating transcription efficiently, if at all. Thus, the activity of such a minimal promoter is dependent upon the binding of a transcriptional activator to an operatively linked regulatory sequence. Suitable minimal promoters are known in the art or can be identified by standard techniques. For example, a functional promoter which activates transcription of a contiguously linked reporter gene can be progressively deleted until it no longer activates expression of the reporter gene alone but rather requires the presence of an additional regulatory sequences, generally referred to as enhancer sequences.
  • a minimal promoter can be a naturally occurring promoter that has been weakened so that it is not 100% active.
  • Promoter-enhancer sequences are DNA sequences to which RNA polymerase binds and initiates transcription. The promoter determines the polarity of the transcript by specifying which strand will be transcribed.
  • Bacterial promoters can consist of consensus sequences, -35 and -10 nucleotides relative to the transcriptional start, which are bound by a specific sigma factor and RNA polymerase.
  • a promoter-enhancer configuration is generally a constitutive promoter.
  • a constitutive promoter is one that is normally active and provides for initiation of transcription and transcription of the downstream (e.g. , 3 ') genes.
  • a constitutive promoter can be converted into a regulatable promoter by the introduction of one or more repressor binding sites as described below.
  • a promoter capable of being repressed by an AyrR repressor protein is a constitutive promoter having one or more binding sites for an AyrR repressor protein.
  • Examples of constitutive promoters include the int promoter of bacteriophage ⁇ , the bla promoter of the ⁇ -lactamase gene sequence of pBR322, the cat promoter of the chloramphenicol acetyl transferase gene sequence of pPR325, and the like.
  • Examples of inducible prokaryotic promoters include the major right and left promoters of bacteriophage (PL and PR), the tip, recA, lacZ, lad, araC and gal promoters of E. coli, the a-amylase (Ulmanen et al , "Transcription and translation of foreign genes in Bacillus subtilis by the aid of a secretion vector," J. Bacteriol.
  • prokaryotic promoters are reviewed by Goldstein et al , "Prokaryotic promoters in biotechnology," Biotechnol Annu Rev. 1 : 105-28 (1995), Busby et al , "Promoter structure, promoter recognition, and transcription activation in prokaryotes,” Cell 79(5): 743 -6 (1994), and Gottesman, "Bacterial regulation: global regulatory networks,” Ann. Rev. Genet. 18:415-442 (1984).
  • the promoter may be the ayrR promoter (AyrRp) from S. aureus (SEQ ID NO: 1).
  • the ayrR promoter, illustrated in Figure 3B consists of a 75 nucleotide sequence that includes a promoter element at -35 that is overlapped by an AyrR protein binding site. Binding of the AyrR protein results in suppression of transcription.
  • Other suitable promoters can be prepared by including one or more AyrR protein binding sites having the sequence of SEQ ID NO:2.
  • repressor and like terms refers to the polypeptide encoded by a nucleic acid sequence that binds to an operator sequence to block
  • transcriptional initiation In certain aspects, the inhibition of transcription is incomplete, particularly in systems wherein the repressor is located downstream of the repressed promoters. In an aspect, for example where the repressor protein is provided in trans, nearly complete elimination of transcription can be accomplished.
  • a repressor In the absence of an inducer or induction, a repressor binds to a nucleic acid operator present in a gene and inhibits transcription of the operably linked gene. Upon binding of a repressor to an inducer or other signal, a repressor disassociates from the operator to which it was bound thereby permitting transcription of the gene to occur.
  • a repressor comprises a protein encoded by the nucleic acid sequence of SEQ ID NO:70 from S. aureus. Multiple alleles of the AyrR protein are also suitable for the methods and compositions of the present disclosure (SEQ ID Nos:78 to 88).
  • Staphylococcus haemolyticus SEQ ID NO: 89
  • Staphylococcus simiae SEQ ID NO: 90
  • Staphylococcus pasteuri SEQ ID NO: 91
  • Staphylococcus warneri SEQ ID NO: 92
  • Staphylococcus xylosus SEQ ID NO: 93
  • Staphylococcus hominis SEQ ID NO: 94
  • Staphylococcus capitis SEQ ID NO:95
  • Staphylococcus epidermidis SEQ ID NO:96
  • homologs identified in Streptococci species including Streptococcus pneumonia (SEQ ID NO:97), Streptococcus pyogenes (SEQ ID NO:98), and Streptococcus agalactiae (SEQ ID NO:99) based on homology to ayrR and an adjacent homolog of ayrA with a DUF3169 domain are included and provided for by the present disclosure.
  • Streptococci species including Streptococcus pneumonia (SEQ ID NO:97), Streptococcus pyogenes (SEQ ID NO:98), and Streptococcus agalactiae (SEQ ID NO:99) based on homology to ayrR and an adjacent homolog of ayrA with a DUF3169 domain are included and provided for by the present disclosure.
  • homologous sequences encoding homologous proteins exist in other Gram-positive bacteria that can be readily isolated and incorporated into the methods and compositions of the present disclosure
  • an "operator” is a segment of DNA to which a transcription factor binds to regulate gene expression.
  • Operator/repressor systems are well known in the art. The first operator/repressor system characterized was the lac repressor/operator inducer system in Escherichia coli. Jacob and Monod "Genetic regulatory mechanisms in the synthesis of proteins," JMol Biol. 3 (3): 318-56 (1961). The operator/repressor system has been applied to widely divergent organisms.
  • the operator/repressor system comprises at least one binding site for an AyrR repressor protein and the AyrR repressor protein.
  • an endogenous AyrR repressor protein is provided by the host bacteria.
  • the AyrR repressor protein may be provided as a heterologous AyrR repressor protein.
  • the loop structure formed provides strong inhibition of RNA polymerase interaction with the promoter, if the promoter is present in the loop, and provides inhibition of translocation of RNA polymerase down the transcriptional unit if the loop is located downstream from the promoter. Promoters configured with multiple operators exhibit lower levels of expression and are strongly inducible.
  • the present disclosure provides for, and includes, promoters capable of being repressed by an AyrR repressor protein operably linked to a nucleic acid sequence encoding a reporter as described above.
  • the promoter may be the ayrR promoter obtained from S. aureus.
  • the promoter may be an ayrR promoter obtained from a bacterial species homologous to S. aureus.
  • the ayrR promoter may be an ayrR promoter obtained from a Gram-positive bacteria.
  • a promoter capable of being repressed by an AyrR repressor protein operably linked to a nucleic acid sequence encoding a reporter can be prepared by modification of existing promoters.
  • a constitutive promoter incorporating one or more AyrR operator sites can have two AyrR operator sites.
  • a constitutive promoter can have three AyrR operator sites.
  • a constitutive promoter can have four or more AyrR operator sites.
  • a constitutive promoter can have two AyrR operator sites that are at least about 70 nucleotides apart. In an aspect, the distance between AyrR operator sites is between about 200 to 500 nucleotides.
  • a promoter capable of being repressed by an AyrR repressor protein is a promoter having at least one binding site that overlaps with the polymerase binding site, typically at about -35 nucleotides upstream (e.g. 5') of the transcriptional start site.
  • the present disclosure provides for, and includes, methods and compositions wherein the AyrR repressor protein is modified.
  • binding of a DNA binding protein to a nucleic acid sequence is not necessarily optimal. It is well understood that DNA binding is complex and dependent both on the sequence of the binding site and the polypeptide sequence. Binding affinity may be increased or decreased by mutating the DNA binding sequence, the DNA binding domain of a DNA binding protein, or both.
  • Mutations that alter the amino acid sequence of a protein show an enormous variety of effects ranging from no observable changes in structure or function to complete loss of function, protein destabilization, and degradation.
  • Mutational studies of the DNA- binding proteins have shown that loss of function mutations include those mutations which have destabilizing effects on global protein structure or folding and those which affect protein function by specifically altering protein-protein (in the case of dimerization or activation) or protein-DNA (in the case of DNA-binding) interactions.
  • mutations can have stabilizing effects on global structure and enhance protein-DNA interactions.
  • mutations of the DNA binding site can both enhance or destabilize the protein-DNA interaction. Methods for modifying both the protein and the DNA binding site are well known in the art.
  • the present disclosure provides for, and includes, modifying an ayrR repressor binding site to increase AyrR protein binding. Similarly, the present disclosure provides for, and includes, modifying an AyrR protein to increase binding to an ayrR repressor binding site.
  • the ayrR binding site of SEQ ID NO: 2 can be modified to increase the affinity of the site by the AyrR protein from S. aureus.
  • the ayrR binding site of SEQ ID NO: 2 may be modified to prepare a perfect 22-nt palindrome.
  • a nucleotide at positions 9 and 14 of SEQ ID NO:2 can be modified to prepare a perfect palindromic sequence.
  • an AyrR repressor protein can be mutated to decrease protein binding to an ayrR binding site.
  • one of skill in the art can modify the ayrR repressor/operator system to increase the sensitivity of the system to changes in Type I SPase inhibition.
  • additional mutations can be introduced an increase the affinity of an AyrR binding protein to SEQ ID NO: 2.
  • two or more mutations can be introduced into a nucleic acid of SEQ ID NO:2.
  • three or more mutations can be introduced into a nucleic acid of SEQ ID NO:2.
  • four or more mutations can be introduced into a nucleic acid of SEQ ID NO: 2.
  • random mutations in SEQ ID NO:2 can be generated and selected for increased affinity using methods well known in the art.
  • nucleic acids that are optimized for AyrR binding may be selected from pools of random nucleic acids using selection procedures known in the art. For example, using a Systematic Evolution of Ligands by Exponential enrichment (SELEX) procedure described in U.S. Patent No. 5,475,096, issued December 12, 1995, and U.S. Patent No. 5,637,459, issued June 10, 1997. Additional methods for selection of high affinity nucleic acids are known in the art.
  • SELEX Systematic Evolution of Ligands by Exponential enrichment
  • Methods and compositions of the present disclosure are suitable for use for identifying Type I SPase inhibitors in diverse bacteria.
  • One of ordinary skill in the art would recognize that differences in structure of Type I SPase proteins may result in differing affinities and inhibitory activity of different compounds.
  • a compound identified that inhibits a Type I SPase from S. aureus may not be an optimal compound for inhibiting a Type I SPase from Staphylococcus epidermidis.
  • bacteria from diverse sources may be screened.
  • Type I SPase inhibitors active against Type I SPase proteins obtained from varied microorganisms.
  • the reporter based screening method provides for comparing the activity of Type I SPase proteins.
  • the method can be applied to identify Type I SPase inhibitors active against various pathogens such as bacteria, fungi and parasites while having little or no activity against a mammalian Type I SPase homolog.
  • inhibitors of Type I SPase proteins can be identified that can be used in the treatment of mammals, including humans.
  • a bacterium suitable for use in the methods and compositions of the present disclosure may be a Gram-positive cocci.
  • the Gram-positive cocci is a pathogenic Gram-positive cocci.
  • the Gram- positive cocci is selected from the group consisting of Staphylococcus aureus,
  • Staphylococcus epidermidis Staphylococcus saprophyticus
  • Streptococcus pyogenes Streptococcus pneumonia
  • Streptococcus enter ococcus spp. Clostridium difficile
  • the Gram-positive cocci is Staphylococcus aureus. In another aspect, the Gram-positive cocci is Staphylococcus epidermidis. In other aspects, the Gram-positive cocci is Staphylococcus saprophyticus. In a further aspect, the Gram-positive cocci is Streptococcus pyogenes. In yet another aspect, the Gram-positive cocci is Streptococcus pneumonia. In some aspect, the Gram-positive cocci is a Streptococcus enterococcus spp. In another aspect, the Gram-positive cocci is Clostridium difficile. In yet another aspect, the Gram-positive cocci is Streptococcus agalactiae. In another aspect, the Gram-positive cocci is Streptococcus viridans.
  • the present disclosure provides for, and includes, methods for screening for potential antibiotics comprising contacting a microorganism having a bacterial Type I signal peptidase (SPase I) transformed with a recombinant nucleic acid comprising a promoter capable of being repressed by an AyrR repressor protein and a nucleic acid encoding a reporter, applying one or more compounds to said bacterium and detecting a signal from said reporter.
  • SPase I bacterial Type I signal peptidase
  • Suitable microorganisms for the methods of the present disclosure include but are not limited to contacting a microorganism that is a Gram-positive bacterium, a Gram- negative bacterium, or is a mycobacterium.
  • the Gram-positive bacteria may be a Gram-positive cocci selected from the group consisting of Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus saprophyticus, Streptococcus pyogenes, Streptococcus pneumonia, Streptococcus enter ococcus spp. , Clostridium difficile, Streptococcus agalactiae, and Streptococcus viridans.
  • Suitable promoters and reports for use in methods for screening for antibiotics are described above.
  • suitable promoters are described in detail at paragraphs [0054] to [0065].
  • Suitable reporters are described in detail in paragraphs [0035] to [0041].
  • Methods and compositions of the present disclosure include those that are suitable for use in high throughput screening methods.
  • Prior approaches to identifying Type I SPase inhibitors are hampered by the requirement to purify a target Type I SPase or the requirement to prepare and provide a suitable substrate as discussed above.
  • a reporter active in vivo in a transformed microorganism compounds or potential antibiotics that inhibit Type I SPase can be identified by the detectable expression of a fluorescent, luminescent or enzymatic reporter protein.
  • High throughput methods are known in the art and include, but are not limited to those disclosed in U.S. Publication No. 20060188941, published August 24, 2006, U.S. Publication No.
  • High throughput screening systems are commercially available (see, e.g. , Zymark Corp. , Hopkinton, MA; Air Technical Industries, Mentor, OH; Beckman Instruments, Inc. Fullerton, CA; Precision Systems, Inc. , Natick, MA, etc.). High throughput systems typically automate entire procedures including all sample and reagent pipetting, liquid dispensing, timed incubations, and final readings of the microplate in detector(s) appropriate for the assay. These configurable systems provide high throughput and rapid start up as well as a high degree of flexibility and customization. Manufacturers of such systems provide detailed protocols the various high throughput approaches.
  • the present disclosure provides for, and includes, recombinant nucleic acids comprising a promoter capable of being repressed by an AyrR repressor protein and a nucleic acid encoding a reporter.
  • recombinant nucleic acid constructs provide for a variety of promoter configurations and reporter configurations. The discussion of the methods employing the described recombinant nucleic acids apply to the recombinant nucleic acids themselves.
  • the recombinant nucleic acids comprising a promoter capable of being repressed by an AyrR repressor protein and a nucleic acid encoding a reporter provide for binding of an AyrR repressor protein that results in repression of transcription in a bacterium transformed with the recombinant nucleic acid.
  • a recombinant nucleic acids includes one or more repressor binding sites of SEQ ID NO:2.
  • a repressor binding sites may be optimized for increased or decrease binding of an AyrR repressor protein as discussed above.
  • Other appropriate repressor binding site sequences are readily identifiable as discussed above.
  • the present disclosure further provides for recombinant nucleic acids that include more than one repressor binding site and further provides for optimizing the distance separating multiple binding sites to result in increased repression and increase post- induction expression.
  • improved repression provides for recombinant nucleic acids that combine strong, high expression promoters.
  • the recombinant nucleic acids of the present disclosure having a nucleic acid encoding a reporter includes a reporter that is fluorescent reporter, a luminescent reporter, or an enzymatic reporter. Suitable reporters are described in detail in paragraphs [0035] to
  • the recombinant nucleic acids of the present disclosure having a promoter capable of being repressed by an AyrR repressor protein includes promoters as described in detail above at paragraphs [0054] to [0065].
  • the ayrRABC operon (SEQ ID NO: 77) is cloned and analyzed. Four genes are identified: ayrR (SEQ ID Nos:69 and 70 for the nucleic acid and protein sequences respectively), ayrA (SEQ ID Nos:71 and 72 for the nucleic acid and protein sequences respectively), ayrB (SEQ ID Nos: 73 and 74 for the nucleic acid and protein sequences respectively), and ayrC (SEQ ID NOS: 75 and 76 for the nucleic acid and protein sequences respectively).
  • ayrR SEQ ID Nos:69 and 70 for the nucleic acid and protein sequences respectively
  • ayrA SEQ ID Nos:71 and 72 for the nucleic acid and protein sequences respectively
  • ayrB SEQ ID Nos: 73 and 74 for the nucleic acid and protein sequences respectively
  • ayrC SEQ ID NOS: 75 and 76 for the nucleic acid and protein sequence
  • ARCOOOl which harbors a nonsense mutation in ayrR and its parental wild type strain N315 is examined.
  • Primers used for PCR are provided in Table 7. See Craney et al. , "A Putative Cro-Like Repressor Contributes to Arylomycin Resistance in Staphylococcus aureus " Antimicrob. Agents Chemother. 59:3066-3074 (2015) (“Craney et al , 2015”).
  • No differences in transcript levels is observed for control genes (SA0334-SA0336 and gyrB), but transcript levels of ayrR, ayrA, ayrB, and ayrC in ARCOOOl are each increased ⁇ 8-fold compared to wild type ( Figure 3C).
  • RNAseq data reveals overlapped sequence that aligns continuously across the entire ayrRABC locus, including the intergenic sequences (not shown).
  • AyrR protein Multiple alleles of the AyrR protein are identified (SEQ ID Nos:78 to 88).
  • the ayrR gene was identified in Staphylococcus haemolyticus (SEQ ID NO: 89), Staphylococcus simiae (SEQ ID NO:90), Staphylococcus pasteuri (SEQ ID NO:91), Staphylococcus warneri (SEQ ID NO: 92), Staphylococcus xylosus (SEQ ID NO: 93), Staphylococcus hominis (SEQ ID NO:94), Staphylococcus capitis (SEQ ID NO:95), and Staphylococcus epidermidis (SEQ ID NO: 96).
  • Homologs are also identified in Streptococci species including Streptococcus pneumonia (SEQ ID NO: 97), Streptococcus pyogenes (SEQ ID NO: 98), and Streptococcus agalactiae (SEQ ID NO: 99) based on homology to ayrR and an adjacent homolog of ayrA with a DUF3169 domain.
  • the ayrR gene encodes a helix-tum-helix motif protein annotated as an XRE family transcriptional regulator with homology to the phage ⁇ Cro repressor. Sequence analysis reveals an almost perfect 22-nt palindrome, TTTGACAAATATAGTTGTCAAA, upstream of ayrR and which overlaps the -35 promoter element (Figure 3B).
  • palindromes commonly comprise the binding site of transcriptional regulators, and Cro regulates its own transcription by binding such a palindrome. See Huffman et al. ,
  • AyrR binding results in suppression of the ayrRABC operon
  • a transcriptional reporter plasmid pARCl which harbors the intergenic region between SA0336 and ayrR upstream of the genes encoding luciferase (luxCDABE) is prepared. See Mesak et al., "Improved lux reporters for use in Staphylococcus aureus," Plasmid 61 : 182-187 (2009).
  • the intergenic region between SA0336 and ayrR (SEQ ID NO:68) is amplified using primers 3311uxF (SEQ ID NO: 100) and 3311uxR (SEQ ID NO: 101) which incorporate a BamHI site and Sail site, respectively, into the ayrR intergenic region PCR product.
  • the ayrR intergenic region is cloned into pAMIlux between the BamHI and Sail sites creating the plasmid pARCl.
  • the AyrR repressor is supplied in trans from the genome. Wild type N315 and a strain lacking the entire region from SA0336 to ayrC (N31 51 ⁇ SA0336-ayrRABC) is transformed with either the empty luxCDABE vector or pARCl, and luminescence is assayed in actively growing cultures (Figure 3E). Only in the case of N31 51 ⁇ SA0336-ayrRABC transformed with pARCl is high intensity luminescence observed.
  • Luminescence is significantly lower for N315 harboring pARCl, consistent with repression by the genomically encoded AyrR protein.
  • the ability of Type I SPase inhibition to release repression is tested by conducting the same experiment in the presence of a sub-inhibitory concentration of arylomycin M131 (0.5xMIC). Two hours after arylomycin addition, the luminescence signal in wild type N315 cells harboring pARCl is 7-fold higher than that observed in the absence of the arylomycin ( Figure 3F).
  • the ayrA gene encodes a putative membrane protein, predicted to possess a DUF3169 domain of unknown function. Proteins in the DUF3169 family are found in both Staphylococcus and Streptococcus species, with one homolog present per genome in sequenced strains, and while they share only -30% sequence identity, six predicted transmembrane domains and a D-E(a/g)E motif located in the loop connecting the fourth and fifth predicted transmembrane segments are highly conserved. Interestingly, each ayrA homolog identified appears to be immediately downstream of a gene that is homologous to ayrR.
  • the downstream genes ayrB and ayrC are predicted to encode the two domains of a type 2 family ABC transporter, with ayrC encoding the transporter domain and ayrB encoding the ATP -binding cassette domain (conserved domain cd03230).
  • ARC0001 AspsB via PCR and RT-PCR of genomic DNA and RNA, respectively, using primers internal to the spsB gene (Table 9).
  • spsB Deletion of spsB is also verified phenotypically via an examination of the susceptibility of N315 and ARCOOOlAspsB to gentamicin and the ⁇ -lactam antibiotics cefoxitin, oxacillin and penicillin G, known to be synergistic with that of the arylomycins. See Therien et al. , "Broadening the spectrum of beta-lactam antibiotics through inhibition of signal peptidase type I," Antimicrob. Agents Chemother. 56:4662-4670 (2012) and Smith et al.
  • the secreted proteome of ARCOOOl AspsB and N315 is compared in more detail by isolating proteins from the media, digesting with trypsin, using reductive dimethylation (ReDiMe) to heavy isotope label the wild type fragments and light isotope label the
  • ReDiMe reductive dimethylation
  • aureus secretome See Schallenberger et al , "Type I signal peptidase and protein secretion in Staphylococcus aureus," J. Bacteriol. 194:2677-2686 (2012).
  • the quantity of secreted proteins is then determined from the ratio of parent ion peak areas, which demonstrates that while tryptic peptides for the same proteins are detected from each strain, several are detected at different levels (Table 10). Sixteen of the 38 secreted proteins are detected in both strains at similar levels (within 2-fold), while 19 are detected at 2- to 8-fold reduced levels (for example, the proteases staphylokinase and SspP, the complement inhibitor Sak, and a hypothetical surface protein SA2285).
  • PrsA is a peptidyl-prolyl isomerase involved in protein folding of secreted proteins in the extracellular environment; and is upregulated at the transcriptional level by SPase inhibition. See Hyyrylainen et al. , “Transcriptome analysis of the secretion stress response of Bacillus subtilis,” Appl. Microbiol. Biotechnol. 67: 389-396 (2005). Examination of signal sequences does not reveal an obvious correlation with observed differences in secretion.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Toxicology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

La présente invention concerne la signal peptidase de type I (SPase) qui est importante pour la viabilité des bactéries de type sauvage, en raison de son activité protéolytique pour libérer des protéines de leurs séquences de tête N-terminales liées à la membrane après la translocation à travers la membrane cytoplasmique. L'invention concerne des procédés et des compositions utiles pour identifier les inhibiteurs de la SPase de type I. L'invention concerne également des procédés et des compositions utiles pour identifier des composés qui sont des candidats pour des antibiotiques et des traitements thérapeutiques.
PCT/US2016/045796 2015-08-06 2016-08-05 Compositions et procédés d'identification d'inhibiteurs de la signal peptidase de type i WO2017024233A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201562201989P 2015-08-06 2015-08-06
US62/201,989 2015-08-06

Publications (1)

Publication Number Publication Date
WO2017024233A1 true WO2017024233A1 (fr) 2017-02-09

Family

ID=56694252

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2016/045796 WO2017024233A1 (fr) 2015-08-06 2016-08-05 Compositions et procédés d'identification d'inhibiteurs de la signal peptidase de type i

Country Status (1)

Country Link
WO (1) WO2017024233A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112255208A (zh) * 2020-10-09 2021-01-22 安阳工学院 一种检测酪氨酸酶的化合物及其应用

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20120135092A1 (en) * 2005-03-07 2012-05-31 Scott Fain Singleton INHIBITORS OF RecA ACTIVITIES FOR CONTROL OF ANTIBIOTIC-RESISTANT BACTERIAL PATHOGENS
US20130244929A1 (en) * 2010-03-09 2013-09-19 Michel Gallant Bridged lipoglycopeptides that potentiate the activity of beta-lactam antibacterials

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20120135092A1 (en) * 2005-03-07 2012-05-31 Scott Fain Singleton INHIBITORS OF RecA ACTIVITIES FOR CONTROL OF ANTIBIOTIC-RESISTANT BACTERIAL PATHOGENS
US20130244929A1 (en) * 2010-03-09 2013-09-19 Michel Gallant Bridged lipoglycopeptides that potentiate the activity of beta-lactam antibacterials

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
ARRYN CRANEY ET AL: "A Putative Cro-Like Repressor Contributes to Arylomycin Resistance in Staphylococcus aureus", ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, vol. 59, no. 6, 9 March 2015 (2015-03-09), US, pages 3066 - 3074, XP055310128, ISSN: 0066-4804, DOI: 10.1128/AAC.04597-14 *
ARRYN CRANEY ET AL: "The inhibition of type I bacterial signal peptidase: Biological consequences and therapeutic potential", BIOORGANIC & MEDICINAL CHEMISTRY LETTERS, vol. 25, no. 21, 26 July 2015 (2015-07-26), AMSTERDAM, NL, pages 4761 - 4766, XP055310122, ISSN: 0960-894X, DOI: 10.1016/j.bmcl.2015.07.072 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112255208A (zh) * 2020-10-09 2021-01-22 安阳工学院 一种检测酪氨酸酶的化合物及其应用
CN112255208B (zh) * 2020-10-09 2023-01-10 安阳工学院 一种检测酪氨酸酶的化合物及其应用

Similar Documents

Publication Publication Date Title
US11130970B2 (en) Nucleic acid-guided nucleases
US11408012B2 (en) Nucleic acid-guided nucleases
Modell et al. A DNA damage-induced, SOS-independent checkpoint regulates cell division in Caulobacter crescentus
AU2001244091B2 (en) Signal sequence trapping
Slagowski et al. A functional genomic yeast screen to identify pathogenic bacterial proteins
US20020142296A1 (en) Screening and use of reagents which block or activate intein splicing utilizing natural or homologous exteins
Adam et al. Development of a positive genetic selection system for inhibition of protein splicing using mycobacterial inteins in Escherichia coli DNA gyrase subunit A
Yin et al. PBP1a/LpoA but not PBP1b/LpoB are involved in regulation of the major β-lactamase gene blaA in Shewanella oneidensis
Nordgren et al. A bidirectional fluorescent two-hybrid system for monitoring protein–protein interactions
Park et al. Functional analysis of the signal recognition particle in Escherichia coli by characterization of a temperature-sensitive ffh mutant
Chevance et al. Coupling of flagellar gene expression with assembly in Salmonella enterica
WO2017024233A1 (fr) Compositions et procédés d'identification d'inhibiteurs de la signal peptidase de type i
US20100029509A1 (en) Novel methods
Zhang et al. CerR, a single-domain regulatory protein of the LuxR family, promotes cerecidin production and immunity in Bacillus cereus
Ariosa et al. Fingerloop activates cargo delivery and unloading during cotranslational protein targeting
US20020076706A1 (en) Signal sequence trapping
M Brauer et al. Twin-arginine translocation (Tat) mutants in Salmonella enterica serovar Typhimurium have increased susceptibility to cell wall targeting antibiotics
Barbosa et al. Regulated expression of the Escherichia coli lepB gene as a tool for cellular testing of antimicrobial compounds that inhibit signal peptidase I in vitro
US20060014197A1 (en) In vivo screening methods for identifying inhibitors of RNA polymerases
Fan et al. Genome-Wide Mapping Reveals Complex Regulatory Activities of BfmR in Pseudomonas aeruginosa. Microorganisms 2021, 9, 485
JP2004215624A (ja) 相互作用インヒビターの検出方法、相互作用インヒビターライブラリーおよびインヒビター検出キット
Leibman Modulation of promoter escape by σ-core interactions of the bacterial RNA polymerase holoenzyme
Hundley Characterization of the conserved function of ribosome-associated molecular chaperones
Cresti et al. Use of the Morganella morganii phoC Gene as Reporter in Bacterial and Yeast Hosts
ZA200206216B (en) Signal sequence trapping.

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16753536

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 16753536

Country of ref document: EP

Kind code of ref document: A1