WO2017024233A1 - Compositions and methods for identifying type i signal peptidase inhibitors - Google Patents

Abstract

Type I signal peptidase (SPase) is important for viability in wild type bacteria because its proteolytic activity to releases proteins from their membrane bound N-terminal leader sequences after translocation across the cytoplasmic membrane. Methods and compositions useful for identifying inhibitors of Type I SPase are provided. Methods and compositions useful for identifying compounds that are candidates for antibiotics and therapeutic treatments.

Description

COMPOSITIONS AND METHODS FOR IDENTIFYING TYPE I SIGNAL

PEPTIDASE INHIBITORS

INCORPORATION OF SEQUENCE LISTING

[0001] The sequence listing that is contained in the file named

"P34335US00_Sequence_listing_ST25.txt," which is 47.6 kilobytes (measured in operating system MS-Windows), recorded on August 5, 2015, is filed herewith and incorporated herein by reference.

GOVERNMENT LICENSE RIGHTS

[0002] This invention was made with government support under AI- 109809 awarded by National Institutes of Health. The government has certain rights in the invention.

FIELD OF THE INVENTION

[0003] The present disclosure relates to and includes methods and compositions useful for the identification of inhibitors of Type I Signal Peptidase (SPase) Inhibitors. Bacterial Type I SPase inhibitors are useful as antibiotics. BACKGROUND OF THE INVENTION

[0004] Secreted proteins in both prokaryotic and eukaryotic organisms are initially synthesized as precursors having an amino-terminal extension known as the signal peptide. Signal peptidase (SPase) I, localized in the cytoplasmic membrane in bacteria, cleaves the precursor leading to the release of secreted proteins from the outer surface of cytoplasmic membrane. SPase I and SPase II have been identified in bacteria that have different cleavage specificities. The majority of secreted proteins are processed by SPase I while SPase II has been identified as processing glyceride-modified lipoproteins.

[0005] Gene knockout and genetic experiments have demonstrated that SPase I is essential for bacterial viability and growth. SPase I is present in both Gram-positive and Gram- negative bacteria, as well as in Chlamydia. SPase I has been cloned and sequenced from different bacterial species, including many clinically relevant bacteria. Differences between the prokaryotic and eukaryotic SPases make them attractive candidates for development of antibiotics and therapeutic treatments. [0006] Type I signal peptidase (SPase) is important for viability in wild type bacteria because the terminal step of the bacterial general secretory pathway requires its proteolytic activity to release proteins from their membrane bound N-terminal leader sequences after translocation across the cytoplasmic membrane. We have identified a four gene operon (referred to as the AyrR operon or ayrR promoter) whose expression is repressed by the repressor protein AyrR. This operon is derepressed when Type I SPase is inhibited and the derepressed genes are then transcribed and their protein products help the bacteria to overcome negative effects of Type I SPase inhibition.

[0007] Current screening methods for SPase inhibitors rely on in vivo or in vitro assays that depend on the inhibition of SPase-mediated cleavage of a fluorogenic peptide substrate (inducing or reducing fluorescence). Prior methods require the addition of a peptide substrate and are laborious, costly, and prone to artifacts. In addition, in vitro assays often require SPase purification.

[0008] The detection of SPase inhibitors provides a starting point for the development of new antibiotics. The present disclosure provides techniques and compositions to detect novel SPase inhibitors, amenable to standard screening techniques including high throughput screening formats, by monitoring the increase in luminescence that results from derepression of the ayrR operon modified to encode luciferase. A transcriptional reporter of the ayrR promoter of the present disclosure has many advantages over the current screening method. Methods of the present disclosure includes those that use intact cells and surrogate peptide substrate needs to be added.

SUMMARY OF THE INVENTION

[0009] The present disclosure provides for, and includes, a method of screening for an inhibitor of a Type I signal peptidase (SPase) comprising contacting a bacterium with a compound, wherein the bacterium is transformed with a nucleic acid comprising a promoter capable of being repressed by an AyrR repressor protein, and a nucleic acid sequence encoding a reporter that is operably linked to the promoter, and detecting expression of the reporter.

[0010] The present disclosure further provides for, and includes, a recombinant nucleic acid comprising a promoter capable of being repressed by an AyrR repressor protein and a nucleic acid encoding a reporter. [0011] A method of screening for antibiotics comprising providing a microorganism having a bacterial Type I signal peptidase (SPase I) transformed with a recombinant nucleic acid comprising a promoter capable of being repressed by an AyrR repressor protein and a nucleic acid encoding a reporter, applying one or more compounds to the microorganism, and detecting a signal from the reporter.

BRIEF DESCRIPTION OF THE DRAWINGS

[0012] The present disclosure includes the accompanying drawings, wherein:

[0013] Figure 1 is a diagram illustrating the action of a method and nucleic acid construct of an aspect according to the present disclosure. Without being limited by theory, in the absence of Type I SPase inhibition, AyrR protein binds to the ayrRp operator and inhibits the transcription of luxCDABE (left). Upon Type I SPase inhibition, AyrR protein dissociates from the ayrRp operator and LuxAB and LuxCDE are produced, resulting in detectable luminescence (right).

[0014] Figure 2 is a graph showing increased luminescence in Staphylococcus aureus cells having a recombinant nucleic acid according to an aspect of the present disclosure.

Luminescence detected from S. aureus cells transformed with a recombinant nucleic acid according to an aspect of the present disclosure is shown before addition of the Type I SPase inhibitor (left) and after addition (right).

[0015] Figure 3 A presents the chemical structure of a Type I SPase inhibitor, arylomycin M131.

[0016] Figure 3B is a schematic representation of the genomic organization of the ayrRABC operon {ayrR, SA0337; ayrA, SA0338; ayrB, SA0339; ayrC, SA0340) and the region immediately upstream that includes SA0336. Below is the sequence of the putative promoter region in the DNA upstream of ayrR ending with its GTG translational start site (SEQ ID NO: 1). A 22-nt palindromic repeat (denoted by arrows under the sequence) is located 43-65 base pairs (bp) upstream of the start site (SEQ ID NO:2). A putative -35, -10 and ribosome binding site (RBS) are underlined in the coding strand. The transcriptional start site is marked as +1, corresponding to 18 nucleotides (nts) upstream from the translational start site.

[0017] Figure 3 C is an RT-PCR analysis of the ayrRABC operon and divergent genes

(SA0334-SA0336) according to an aspect of the present disclosure. The fold change in gene expression from ARCOOOl with respect to N315 is shown. gyrB is used as an external control and gene expression is normalized using gmk. See Table 7 for primer sequences.

[0018] Figure 3D is a gel shift analysis according to the present disclosure. Gel shifts are performed with 30 ng of each DNA probe and an increasing concentration of AyrR protein as indicated at the top. The region of DNA corresponding to each gel shift probe is shown above the gel data, with the ayrR binding site shown in red. Filled triangles denote free DNA probe and open triangles denote the indicated DNA- AyrR complexes. All DNA probes are amplified from wild type N315 genomic DNA with the exception of IRpal, which is created by annealing synthetic oligonucleotides. See Table 7 for primer sequences.

[0019] Figure 3E is an analysis of luminescence from the ayrR promoter (pARC l) in wild type N315 and N315ASA0336- ayrRABC (labeled AAyrR) according to an aspect of the present disclosure. Luminescence is expressed as counts per second per cell density

(cps/OD590).

[0020] Figure 3F is an analysis of luminescence from N315 harboring pARCl in the presence and absence of arylomycin M131 (0.5 xMIC) according to an aspect according to the present disclosure.

[0021] Figure 4 is an analysis of the extracellular proteomes of N315, ARCOOOl and ARCOOl AspsB according to an aspect of the present disclosure. Arrows denote bands where significant differences are observed in the extracellular proteomes of wild type N315 and ARCOOOlAspsB.

[0022] Corresponding reference characters indicate corresponding parts throughout the several views. The examples set out herein illustrate aspects of the present disclosure but should not be construed as limiting the scope of the present disclosure in any manner.

DETAILED DESCRIPTION

[0023] The present disclosure provides a S. aureus operon ayrRABC (SA0337-SA0340), and provides, without being limited by theory, that once released from repression by AyrR protein, protein products AyrABC together confer resistance to the Type I SPase inhibitor arylomycin M131 by providing an alternate method to release translocated proteins.

Derepression of ayrRABC allows cells to bypass the necessity for Type I SPase. Again not limited by theory it is disclosed that AyrABC functionally complements Type I SPase by mediating the processing of the normally secreted proteins, albeit in some cases with reduced efficiency and either without cleavage or via cleavage at a site N-terminal to the canonical Type I SPase cleavage site. The present disclosure provides that ctyrRABC encodes a secretion-stress inducible alternate terminal step of the general secretory pathway. Inducible expression of genes operably linked to the ayrR promoter when Type I SPase is inhibited provides for methods of screening for novel compounds, molecules, proteins, and nucleic acids that can act through inhibiting Type I SPase.

[0024] The present disclosure provides for, and includes, methods for screening for inhibitors of a Type I signal peptidase (Type I SPase). The present disclosure provides for methods for screening for inhibitors of Type I SPase obtainable from Gram-positive, Gram- negative bacteria, mycobacteria, archaea, fungi, chloroplasts, as well as other higher eukaryotes.

[0025] In an aspect according to the present disclosure, a method can be performed on small numbers of samples or can be performed using high throughput screening methods. Methods of the present disclosure include and provide for improved screening of SPase inhibitors in the absence of purification of SPase or the preparation of SPase cleavable substrates such as fluorogenic peptides.

[0026] In an aspect according to the present disclosure, a Type I SPase can be a Type I SPase from a Gram-positive bacteria. The term "gram-positive bacteria" or "gram-positive bacterium" as used herein refers to bacteria, which have been classified using the Gram stain as having a blue stain. Gram-positive bacteria have a thick cell membrane consisting of multiple layers of peptidoglycan and an outside layer of teichoic acid.

[0027] In other aspects, the Type I SPase can be from a Gram-negative bacteria. In yet other aspect, the Type I SPase can be obtained from mycobacteria, archaea, fungi, plants, as well as other higher eukaryotes. The present disclosure provides for, and includes, introducing a heterologous Type I SPase into a Gram-positive bacteria. In an aspect, a heterologous Type I SPase can be from a Gram-positive bacteria, from a Gram-negative bacteria, an archaea, a fungi, a plant, or a eukaryote including mammals. In an aspect, the heterologous Type I SPase is introduced into the Gram-positive bacteria, Staphylococcus aureus (S. aureus). The present method includes, and provides for, identifying inhibitors of Type I SPases from a variety of sources, including bacterial sources which do not have an endogenous ayrRABC operon and repressor system.

[0028] The present disclosure provides for, and includes methods for screening for inhibitors of Type I SPase obtained from multiple diverse sources. Type I SPase has been identified in Gram-positive and Gram-negative bacteria, archaea, the inner membrane of yeast mitochondria, the thylakoid membrane of chloroplasts, and the endoplasmic reticular (ER) membranes of yeast and higher eukaryotes. See Paetzel et al, "Signal peptidases," Chem. Rev 102(12):4549-4580 (2002). Type I signal peptidase is critical for viability in wild type bacteria because the terminal step of the bacterial general secretory pathway requires its proteolytic activity to release proteins from their membrane bound N-terminal leader sequences after translocation across the cytoplasmic membrane. Type I signal peptidases are ubiquitous and recognizable by those of skill in the art based on conservation of sequence. See van Roosmalen et al, "Type I signal peptidases of Gram-positive bacteria," Biochim Biophys Acta. 1694:279-297 (2004). In aspects according to the present disclosure the Type I SPase may be a heterologous or endogenous peptidase.

[0029] As used herein, a heterologous Type I SPase is a Type I SPase that has been introduced into a microorganism of a different species. In some aspects, a bacterium for screening of a heterologous Type I SPase may be engineered to express the heterologous Type I SPase by replacing the endogenous Type I SPase. In other aspects, the heterologous Type I SPase may be expressed in a heterologous bacterium in addition to the endogenous Type I SPase. In some aspects, the endogenous Type I SPase can be knocked out, be conditionally expressed, or mutated. In certain aspects, the heterologous Type I SPase may be inducible. In certain aspects, the endogenous Type I SPase may be inducible. In yet other aspects, the heterologous Type I SPase may be inducible in a bacterial host wherein the endogenous Type I SPase is repressible. In an aspect, the repressible endogenous Type I SPase may be a temperature sensitive mutant Type I SPase.

[0030] According to the present disclosure, a bacterium suitable for use in the screening methods may be a Gram-positive bacterium, a Gram-negative bacterium, or a

mycobacterium. The term "gram-negative bacteria" or "gram-negative bacterium" as used herein is defined as bacteria which have been classified by the Gram stain as having a red stain. Gram-negative bacteria have thin walled cell membranes consisting of a single layer of peptidoglycan and an outer layer of lipopolysaccharide, lipoprotein, and phospholipid.

[0031] Suitable Gram-positive bacterial host cells for use in the methods of the present disclosure include, but are not limited to Staphylococcus spp., Streptococcus spp.,

Propionibacterium spp. , Enter ococcus spp. , Bacillus spp. , Corynebacterium spp. , Nocardia spp., Clostridium spp. , Actinobacteria spp. , Listeria spp., Zymomonas spp., Geobacillis spp., Lactobacillis spp. , Lactococcus spp. , Oenococcus spp. , and Eubacterium spp. In certain aspects, the host bacterium is S. aureus. [0032] Suitable Gram-negative bacteria suitable for use in the present methods include, but are not limited to, Enter obacteriacea consisting of Escherichia, Shigella, Edwardsiella, Salmonella, Citrobacter, Klebsiella, Enterobacter , Hafnia, Serratia, Proteus, Morganella, Providencia, Yersinia, Erwinia, Buttlauxella, Cedecea, Ewingella, Kluyvera, Tatumella and Rahnella. Other exemplary gram-negative organisms suitable for use in the methods of the present disclosure but not in the family Enterobacteriacea include, but are not limited to, Pseudomonas aeruginosa, Stenotrophomonas maltophilia, Burkholderia, Cepacia,

Gardenerella, Vaginalis, and Acinetobacter species.

[0033] The present disclosure provides for methods for screening for inhibitors of Type I SPase obtainable from Gram-positive, Gram-negative bacteria, mycobacteria, archaea, fungi, chloroplasts, as well as other higher eukaryotes. Notably, a homologous ayrRABC operon and repressor system has not been identified to date in Gram-negative bacteria. In aspects according to the present disclosure, a Gram-negative bacteria may be an engineered Gram- negative bacteria wherein the ayrRABC operon and repressor system from a Gram-positive bacteria has been introduced. In certain aspects, an engineered Gram-negative bacteria may further include a heterologous Type I SPase for using the screening methods according to the present disclosure.

[0034] Suitable methods for preparing bacteria transformed with a nucleic acid of the present disclosure are known in the art. Standard techniques to introduce nucleic acids of the present disclosure include calcium chloride methods, rubidium chloride methods and electroporation. See e.g. , Hanahan (J. Mol. Biol. 166: 557-580 (1983); Liu et al ,

BioTechniques 8: 21-25 (1990); and U.S. Patent No. 6,709,854 issued March 23, 2004. Basic techniques used for transformation for bacteria include calcium phosphate transfection, DEAE-dextran mediated transfection, Polybrene, protoplast fusion, liposomes, direct microinjection into the nuclei, scrape loading, and electroporation. See Sambrook, Fritsch & Maniatis, 1989, "Molecular Cloning: A laboratory manual," 2nd edition Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. Other methods include, for example, biolistic devices {See, for example, Sanford, Trends In Biotech. (1988) 6: 299-302, U. S. Patent No. 4,945,050, issued July 31, 1990; electroporation (See Fromm et al , Proc. Nat'l. Acad. Sci. (USA) 82: 5824-5828 (1985); use of a laser beam, electroporation, microinjection or any other method capable of introducing DNA into a cell. Selection of transformed bacteria is accomplished using a suitable selectable marker. Suitable selectable markers are known in the art and include resistance genes to erythromycin (erm), ampicillin {bid), kanamycin (kan), chloramphenicol (cat), spectinomycin (ctadA), and tetracycline (tet). Suitable metabolic markers include genes that complement nutritional auxotrophies in minimal media, such as pur A (adenylosuccinate synthetase) or asd (aspartate semi-aldehyde dehydrogenase) in a bacterial strain that cannot synthesize adenine or diaminopimelic acid, respectively.

[0035] A vector or other recombinant nucleic acid molecule may include a nucleotide sequence encoding a reporter polypeptide. The term "vector" as used herein is used in its broadest sense and includes within its meaning any replicon capable of transferring recombinant DNA material from one cell to another. Suitable vectors are well known in the art and may be integration vectors and plasmids that include an origin of replication for extrachromosomal replication. Vectors of the present disclosure may further include transcription termination sequences, viral promoters, multiple cloning sites and other features that are known in the art.

[0036] The present disclosure provides for, and includes, nucleic acids encoding polypeptides suitable for use as a reporter. A reporter generally encodes a detectable polypeptide, for example, a fluorescent protein, a luminescent reporter or an enzymatic reporter. Suitable reporters of the present disclosure when contacted with an appropriate agent (a particular wavelength of light or luciferin, for example) generates a signal that can be detected by eye or using appropriate instrumentation (Giacomin et al , "Expression of a PALI promoter luciferase gene function in Arabidopsis thaliana in response to infection by phytopathogenic bacteria," Plant Sci. 116:59-72 (1996); Scikantha, et al, "The sea pansy Renilla reniformis luciferase serves as a sensitive bioluminescent reporter for differential gene expression in Candida albicans," J. Bacteriol. 178: 121 (1996); Gerdes et al, "Green fluorescent protein: applications in cell biology," FEBS Lett. 389:44-47 (1996); see also Jefferson et al , "GUS fusions: beta-glucuronidase as a sensitive and versatile gene fusion marker in higher plants," EMBO J. 6:3901-3907 (1997). In some aspects, the reporter can be detected based on its activity as a polypeptide. In other aspects, expression of the reporter can be detected as the transcribed ribonucleic acid (RNA).

[0037] In some aspects, the reporter may be a fluorescent reporter. Different fluorescent reporters are categorized by the fluorescence emission wavelength and include, but are not limited to Blue/UV (Table 1), Cyan (Table 2), Green (Table 3), Yellow (Table 4), Orange (Table 5), Red (Table 6). Additional reporter proteins suitable for the methods and recombinant nucleic acids of the present disclosure include Far-Red proteins, near-IR proteins, long stokes shift proteins, photoactivatible proteins, photoconvertible proteins, and photoswitchable proteins. Many fluorescent reporters are known in the art. For example as found on the internet at nic.ucsfedu/dokuwiki/doku.php?id=fluorescent_proteins.

Table 1: Blue/UV Reporter Proteins

Table 2: Cyan Reporter Proteins

Table 5: Orange Reporter Proteins

[0038] The present disclosure provides for, and includes, nucleic acids encoding a promoter capable of being repressed by an AyrR repressor protein operably linked to green fluorescent protein (GFP), derivatives of green fluorescent protein, dsRED, mRFP, derivatives of mRFP. See Shaner et al. , J Cell Sci. 120(Pt 24):4247-60 (2007). In an aspect, the reporter is GFP or derivatives thereof. In another aspect, the fluorescent reporter may encode uroporphyrinogen (UMT) (Feliciano et al, "Novel reporter gene in a fluorescent- based whole cell sensing system," Biotechnol Bioeng. 93(5): 989-97 (2006), or nitroreductase (nfsB) (Stein et al. , "Use of nfsB, encoding nitroreductase, as a reporter gene to determine the mutational spectrum of spontaneous mutations in Neisseria gonorrhoeae," BMC Microbiol. 9:239 (2009).

[0039] The present disclosure provides for, and includes, nucleic acids encoding a promoter capable of being repressed by an AyrR repressor protein operably linked to a luminescent reporter. In an aspect, the luminescent reporter is a nucleic acid sequence encoding the luxCDABE genes. The luxCDABE genes reporter includes the genes necessary to produce the luminescent substrate, decanal (n-decyl aldehyde). Thus, in certain aspects, methods of detecting the expression of the luxCDABE does not require the addition of a substrate. In another aspect, the luminescent reporter is a nucleic acid sequence encoding the luxAB genes wherein detection of expression is accomplished through the addition of the substrate, for example decanal (n-decyl aldehyde) or other suitable fatty acid aldehyde. See Meighen, "Molecular biology of bacterial bioluminescence," Microbiol Rev. 55(1): 123-42 (1991). Also included in certain aspects, is a reporter comprising a polynucleotide encoding firefly luciferase (Prax et al., "An update on the molecular genetics toolbox for

staphylococci " Microbiology. 159(Pt 3):421-35 (2013)). In an aspect, the luminescent reporter may be a nucleic acid encoding aequorin (Zeinoddini et al. , "Design and characterization of an aequorin-based bacterial biosensor for detection of toluene and related compounds," Photochem Photobiol. 86(5): 1071-5 (2010)).

[0040] The present disclosure provides for, and includes, nucleic acids encoding a promoter capable of being repressed by an AyrR repressor protein operably linked to an enzymatic reporter. Like some luminescent reporters, enzymatic reporters often require the addition of a suitable substrate for detection. In an aspect, the enzymatic reporter is catechol 2,3-dioxygenase (xylE) (See European Patent Publication No. EP0086139, published August 17, 1983). In an aspect the enzymatic reporter is lipase (lip). In another aspect, the enzymatic reporter is beta-lactamase (blaZ). In an aspect, the enzymatic reporter is beta- galactosidase (lacZ or bgaB). In an aspect, the enzymatic reporter is beta-glucuronidase (gusA) (See Myronovskyi et al , "Beta-glucuronidase as a sensitive and versatile reporter in actinomy cetes," Appl Environ Microbiol. 77(15):5370-83 (2011)). In yet another aspect, the enzymatic reporter is tyrosinase (jnelC) (See Paget et al. "Construction and application of streptomycete promoter probe vectors which employ the Streptomyces glaucescens tyrosinase-encoding gene as reporter," Gene 146(1): 105-10 (1994)), alpha-amylase (amy) (See Kili et al., "Streptococcal reporter gene-fusion vector for identification of in vivo expressed genes," Plasmid. 42(l):67-72 (1999)). Another suitable enzymatic reporter includes alkaline phosphatase (phoZ/phoA) (See Le Jeune et al. , "Construction of a new sensitive molecular tool for the study of gene expression in Enterococcus faecalis," Mol Microbiol Biotechnol. 19(3): 159-68 (2010)). In an aspect, the enzymatic reporter is chloramphenicol acetyltransferase (cat). In yet another aspect, the enzymatic reporter is neomycin phosphotransferase (neo) (See Roy et al , "A sensitive and simple paper chromatographic procedure for detecting neomycin phosphotransferase II (NPTII) gene expression," Plant Mol Biol. 14(5): 873-6. (1990)). In yet another aspect, the enzymatic reporter is ice nucleation (inaZ) (See Lindgren et al , "An ice nucleation reporter gene system: identification of inducible pathogenicity genes in Pseudomonas syringae pv.

Phaseolicola " EMBO J. 8(5): 1291 -301 (1989)). As provided by the present disclosure, suitable enzymatic reporters can be used in combination with each other (See Prax et al. , "An update on the molecular genetics toolbox for staphylococci," Microbiology. 159(Pt 3):421 -35 (2013)).

[0041] Vectors according the present disclosure can further include a selectable marker. The term "selectable marker" refers to a polynucleotide (or encoded polypeptide) that confers a detectable phenotype. A selectable marker generally is a molecule that, when present or expressed in a cell, provides a selective advantage (or disadvantage) to the cell containing the marker, for example, the ability to grow in the presence of an agent that otherwise would kill the cell. A selectable marker can provide a means to obtain prokaryotic cells or eukaryotic cells or both that express the marker and, therefore, can be useful as a component of a vector. Examples of selectable markers include, but are not limited to, neomycin phosphotransferase, which confers resistance to the aminoglycosides neomycin, kanamycin and paromycin (Herrera-Estrella, "Chimeric genes as dominant selectable markers in plant cells. " EMBO J. 2:987-995, (1983)), hygromycin B phosphotransferase (hph), which confers resistance to hygromycin (Marsh et al. , "The pIC plasmid and phage vectors with versatile cloning sites for recombinant selection by insertional inactivation," Gene 32:481-485 (1984)), trpB, which allows cells to utilize indole in place of tryptophan; hisD, which allows cells to utilize histinol in place of histidine (Hartman et al. , "Two dominant-acting selectable markers for gene transfer studies in mammalian cells," Proc. Natl. Acad. ScL, USA 85 : 8047 (1988)); mannose- 6-phosphate isomerase which allows cells to utilize mannose (WO 94/20627); ornithine decarboxylase, which confers resistance to the ornithine decarboxylase inhibitor, 2- (difluoromethyl)-DL-ornithine (DFMO; McConlogue, 1987, In: Current Communications in Molecular Biology, Cold Spring Harbor Laboratory ed.); and deaminase from Aspergillus terreus, which confers resistance to Blasticidin S (Tamura et al , "Blasticidin S deaminase gene (BSD): a new selection marker gene for transformation of Arabidopsis thaliana and Nicotiana tabacum " Biosci. Biotechnol. Biochem. 59:2336-2338 (1995)). Additional selectable markers include those that confer herbicide resistance, for example, phosphinothricin acetyltransferase gene, which confers resistance to phosphinothricin (White et al , "A cassette containing the bar gene of Streptomyces hygroscopicus: a selectable marker for plant transformation," Nucl. Acids Res. 18: 1062 (1990). Selectable markers include polynucleotides that confer dihydrofolate reductase (DHFR) or neomycin resistance for eukaryotic cells and tetracycline; ampicillin resistance for prokaryotes such as E. coli; and bleomycin, erythromycin, gentamycin, glyphosate, hygromycin, kanamycin, methotrexate, phleomycin, phosphinotricin, spectinomycin, streptomycin, sulfonamide and sulfonylurea. Suitable selectable markers are known in the art.

[0042] One or more codons of an encoding polynucleotide can be biased to reflect the preferred codon usage of the host cell, or an organelle thereof (e.g. chloroplasts). Most amino acids are encoded by two or more different (degenerate) codons, and it is well recognized that various organisms utilize certain codons in preference to others.

[0043] The term "biased," when used in reference to a codon, means that the sequence of a codon in a polynucleotide has been changed such that the codon is one that is used preferentially in the target which the bias is for, e.g. , alga cells, chloroplasts, bacteria or yeast. A polynucleotide that is biased for a particular codon usage can be synthesized de novo, or can be genetically modified using routine recombinant DNA techniques, for example, by a site directed mutagenesis method, to change one or more codons such that they are biased for chloroplast codon usage. Suitable codon tables for preparing biased polypeptide encoding nucleic acids are known in the art. See Hilterbrand et al , "CBDB: the codon bias database," BMC Bioinformatics 13:62 (2012).

[0044] As used herein, the term "operably linked" means that expression of the nucleic acid is dependent on the expression from the promoter. "Operably linked" generally, but not always, refers to a juxtaposition wherein the components are configured so as to perform their usual function. Thus, promoters operably linked to a coding sequence are capable of effecting the expression of the coding sequence. In certain aspects, a promoter that is operably linked to a coding sequence may include an operator that can regulate gene expression, typically, but not always through repression. An operator is a nucleic acid sequence (often referred to as a repressor binding site) that is capable of binding a transcription factor. Suitable positioning of the operator/repressor binding site results in the repression of transcription. In certain aspects, the repressor binding site is proximal to the promoter. In other aspects, the repressor binding site is overlapping with the promoter. In an aspect according to the present disclosure, a promoter can be physically or operably linked to the nucleic acid encoding a reporter. Thus, when transcription is initiated, the nucleic acid sequences downstream from said promoter are expressed as an RNA transcript that can then be detected directly, or can be detected following translation of the RNA message into the encoded reporter polypeptide. In an aspect, the operable linkage may be indirect wherein transcription from the promoter produces a protein product or RNA that activates expression of the reporter from a second promoter. A second promoter may be physically linked to the first promoter, or may be present on a second nucleic acid or distantly linked to the first promoter.

[0045] As used herein, "detecting expression" means measuring the amount of expression of the reporter that is operably linked to the promoter capable of being repressed by an AyrR repressor protein. In an aspect, detecting comprises detecting a change in luminescence, fluorescence, or enzymatic activity of the polypeptide encoded by the reporter. In an aspect according to the present disclosure, inhibition of a Type I SPase comprises an increase in luminescence, fluorescence, or enzymatic activity of the reporter polypeptide over the level of luminescence, fluorescence, or enzymatic activity of a microorganism having an identical nucleic acid construct that is not exposed to a compound.

[0046] In an aspect, detection means the measurement of the amount of RNA that encodes the reporter polypeptide. Suitable methods for detecting the amount of RNA are known in the art and include reverse transcriptase polymerase chain reaction (RT-PCR) based methods. RT-PCR assays includes real time PCR methods. In aspects according to the present disclosure, inhibition of a Type I SPase comprises an increase in the amount of RNA encoding the reporter polypeptide over the amount of RNA encoding the reporter polypeptide of a microorganism having an identical nucleic acid construct that is not exposed to a compound.

[0047] In an aspect, detection means detecting the amount of reporter protein. In an aspect, measuring the reporter itself provides the means for detection. For example, fluorescent reporters when expressed as a protein can be detected by measuring the amount of light at the emission wavelength when the fluorescent reporter protein is illuminated with light in the absorption wavelength. Suitable emission and absorption wavelengths are known in the art as provided above in Tables 1 to 6. Detecting includes measuring the amount of light emission or the amount of fluorescence of a translation product of the reporter gene as the amount of expression by utilizing an optical detection apparatus. [0048] Detection of the translation products of the luminescent reporters, enzymatic reporters and fluorescent reporters are detected by a suitable optical detection apparatus. For some luminescent reporters (e.g. , luciferase) a separate reagent may be required. Similarly, for enzymatic reporters, a color-developing substrate may be required. Suitable color- developing substrates and luminescent reporter substrates are known in the art.

[0049] For optical detection of luminescent reporter products, the luminescence intensity of the solution comprising the luciferase protein and substrate is measured by a luminometer. In the case when the reporter gene is a fluorescent protein gene, for example, the bacterium or microorganism can be irradiated with a laser having an appropriate wavelength determined by the proteins absorption wavelength. Irradiation at the appropriate absorption wavelength results in the emission of light at the emission wavelength. Intensity of the generated fluorescence is measured by a fluorophotometer. In an aspect, where the reporter is a enzymatic reporter, a substrate undergoes a color change that can either be detected as an absorption or through the generation of a fluorescent product. In an aspect, enzymatic reporters can cause a change in the fluorescent wavelength of a substrate, or cause fluorescence when none was previously present.

[0050] The methods of the present disclosure provides for, and includes, the detection of changes in expression of a reporter that results when a Type I SPase is inhibited by a compound. Thus, the present disclosure provides for a facile method for identifying new compounds that inhibit Type I SPase and are potential bactericidal or bacteriostatic compounds, and should be especially useful to detect lead compounds whose activity is insufficient to cause cell death. Similarly, in an aspect where the Type I SPase is obtained from a fungus, inhibition of Type I SPase provides for the identification of fungicides. In an aspect, the Type I SPase can be obtained from a higher eukaryote, for example a parasite, and provides for the identification of a compound suitable for treatment of parasitic infections.

[0051] Compounds suitable for use in the methods of the present disclosure includes small molecules, proteins, and nucleic acids. Also included and provided for in the present disclosure are compounds that are lipids, proteoglycans, saccharides and polysaccharides. Virtually any chemical or biological entity can be screened in the methods described herein. The term "small molecule" as used herein refers to any compound that can be analyzed by mass spectral analysis, NMR, or other spectroscopic method and having a molecular weight that is less than 4000 Da. [0052] Suitable compounds for the methods of the present disclosure can be obtained from libraries (e.g. , combinatorial or compound libraries, including those that contain synthetic and/or natural products, and custom analog libraries, which may contain compounds based on a common scaffold). Suitable libraries can include hundreds or thousands of distinct compounds or random pools thereof. Libraries suitable for screening can be obtained from a variety of sources, including the compound libraries from commercial sources, for example ChemBridge Corp. (San Diego, Calif). Another compound library is available from the consortium formed by the University of Kentucky, the University of Cincinnati Genome Research Institute and the Research Institute of the Children's Hospital of Cincinnati. The library is referred to as the UC/GRI Compound Library. Compound libraries may also be prepared by means known in the art, including, but not limited to, combinatorial chemistry techniques, fermentation methods, plant and cellular extraction procedures and the like. Methods for making combinatorial libraries are well-known in the art. See, for example, E. R. Felder Chimia 48:512-541 (1994); Gallop et al , "Applications of Combinatorial

Technologies to Drug Discovery. 1. Background and Peptide Combinatorial Libraries," J. Med. Chem. 37: 1233-1251 (1994); Houghten, "Peptide libraries: criteria and trends," Trends Genet. 9:235-239 (1993); Houghten et al, "Generation and use of synthetic peptide combinatorial libraries for basic research and drug discovery," Nature 354: 84-86 (1991); Lam et al , "A new type of synthetic peptide library for identifying ligand-binding activity," Nature 354:82-84 (1991); Carell et al. "New promise in combinatorial chemistry: synthesis, characterization, and screening of small-molecule libraries in solution," Chem. Biol. 3: 171- 183 (1995); Madden et al , "Synthetic combinatorial libraries: Views on techniques and their application," Perspectives in Drug Discovery and Design 2:269-282 (1995); Cwirla et al. "Peptides on phage: a vast library of peptides for identifying ligands," Proc. Natl. Acad. Sci. USA 87:6378-6382 (1990); Brenner et al. , "Encoded combinatorial chemistry," Proc. Natl. Acad. Sci. USA 89:5381-5383 (1992); Gordon et al. , "Applications of combinatorial technologies to drug discovery. 2. Combinatorial organic synthesis, library screening strategies, and future directions," J. Med. Chem. 37: 1385-1401 (1994); Lebl et al, "One- bead-one-structure combinatorial libraries," Biopolymers 37: 177-198 (1995); and references cited therein.

[0053] The term "library" as used herein refers to an archived collection containing many items all belonging to the same family of items. The term many means more than 2 or 3 and generally means as many as can be found and put into the library, therefore the size of the library is limited only upon the availability of the different components of the library. For example, a library of small molecules, a library of natural product extracts (including proteins, lipids, nucleic acids or subsets of each), a library of expressed proteins, for example expressed from a plurality of cDNAs, and libraries of nucleic acids (for example siRNAs). The components of a library may be characterized or may be a random collection. Screening of a library involves the repeated application of the methods of the current disclosure followed by separation using methods known in the art (for example by chromatography or dilution). Each round of selection results in a decrease in the complexity of the library. Methods of screening libraries are well known in the art including automated and high throughput methods.

[0054] The present disclosure provides for, and includes a promoter capable of being repressed by an AyrR repressor protein. A core promoter contains essential nucleotide sequences for promoter function, including the Pribnow box (TATAAT) and start of transcription. By this definition, a core promoter may or may not have detectable activity in the absence of specific sequences that enhance the activity or confer tissue specific activity. Promoters can be inducible (the rate of transcription changes in response to a specific agent), tissue specific (expressed only in some tissues), temporal specific (expressed only at certain times) or constitutive (expressed in all tissues and at a constant rate of transcription). As provided by the present disclosure, a promoter capable of being repressed by an AyrR repressor protein under normal conditions would be repressed and then induced when the Type I SPase has been inhibited.

[0055] The term "minimal promoter" is intended to describe a partial promoter sequence which defines the start site of transcription for the linked sequence to be transcribed but which by itself is not capable of initiating transcription efficiently, if at all. Thus, the activity of such a minimal promoter is dependent upon the binding of a transcriptional activator to an operatively linked regulatory sequence. Suitable minimal promoters are known in the art or can be identified by standard techniques. For example, a functional promoter which activates transcription of a contiguously linked reporter gene can be progressively deleted until it no longer activates expression of the reporter gene alone but rather requires the presence of an additional regulatory sequences, generally referred to as enhancer sequences. A minimal promoter can be a naturally occurring promoter that has been weakened so that it is not 100% active. [0056] Promoter-enhancer sequences are DNA sequences to which RNA polymerase binds and initiates transcription. The promoter determines the polarity of the transcript by specifying which strand will be transcribed. Bacterial promoters can consist of consensus sequences, -35 and -10 nucleotides relative to the transcriptional start, which are bound by a specific sigma factor and RNA polymerase. A promoter-enhancer configuration is generally a constitutive promoter. A constitutive promoter is one that is normally active and provides for initiation of transcription and transcription of the downstream (e.g. , 3 ') genes. A constitutive promoter can be converted into a regulatable promoter by the introduction of one or more repressor binding sites as described below. In an aspect according to the present disclosure, a promoter capable of being repressed by an AyrR repressor protein is a constitutive promoter having one or more binding sites for an AyrR repressor protein.

[0057] Examples of constitutive promoters include the int promoter of bacteriophage λ, the bla promoter of the β -lactamase gene sequence of pBR322, the cat promoter of the chloramphenicol acetyl transferase gene sequence of pPR325, and the like. Examples of inducible prokaryotic promoters include the major right and left promoters of bacteriophage (PL and PR), the tip, recA, lacZ, lad, araC and gal promoters of E. coli, the a-amylase (Ulmanen et al , "Transcription and translation of foreign genes in Bacillus subtilis by the aid of a secretion vector," J. Bacteriol. 162: 176-182 (1985)) and the sigma-28-specific promoters of B. subtilis (Gilman et al , "Isolation of sigma-28-specific promoters from Bacillus subtilis DNA," Gene 32: 11-20 (1984)), the promoters of the bacteriophages of Bacillus (Gryczan, In: The Molecular Biology of the Bacilli, Academic Press, Inc., NY (1982)), Streptomyces promoters (Ward et al , "Construction and characterization of a series of multi-copy promoter-probe plasmid vectors for Streptomyces using the aminoglycoside

phosphotransferase gene from Tn5 as indicator," Mol. Gen. Genet. 203 :468-478, (1986), and the like. Exemplary prokaryotic promoters are reviewed by Goldstein et al , "Prokaryotic promoters in biotechnology," Biotechnol Annu Rev. 1 : 105-28 (1995), Busby et al , "Promoter structure, promoter recognition, and transcription activation in prokaryotes," Cell 79(5): 743 -6 (1994), and Gottesman, "Bacterial regulation: global regulatory networks," Ann. Rev. Genet. 18:415-442 (1984).

[0058] In an aspect, the promoter may be the ayrR promoter (AyrRp) from S. aureus (SEQ ID NO: 1). The ayrR promoter, illustrated in Figure 3B consists of a 75 nucleotide sequence that includes a promoter element at -35 that is overlapped by an AyrR protein binding site. Binding of the AyrR protein results in suppression of transcription. Other suitable promoters can be prepared by including one or more AyrR protein binding sites having the sequence of SEQ ID NO:2.

[0059] As used herein, the term "repressor" and like terms refers to the polypeptide encoded by a nucleic acid sequence that binds to an operator sequence to block

transcriptional initiation. In certain aspects, the inhibition of transcription is incomplete, particularly in systems wherein the repressor is located downstream of the repressed promoters. In an aspect, for example where the repressor protein is provided in trans, nearly complete elimination of transcription can be accomplished. In the absence of an inducer or induction, a repressor binds to a nucleic acid operator present in a gene and inhibits transcription of the operably linked gene. Upon binding of a repressor to an inducer or other signal, a repressor disassociates from the operator to which it was bound thereby permitting transcription of the gene to occur.

[0060] In an aspect, a repressor comprises a protein encoded by the nucleic acid sequence of SEQ ID NO:70 from S. aureus. Multiple alleles of the AyrR protein are also suitable for the methods and compositions of the present disclosure (SEQ ID Nos:78 to 88). Homologs from Staphylococcus haemolyticus (SEQ ID NO: 89), Staphylococcus simiae (SEQ ID NO: 90), Staphylococcus pasteuri (SEQ ID NO: 91), Staphylococcus warneri (SEQ ID NO: 92), Staphylococcus xylosus (SEQ ID NO: 93), Staphylococcus hominis (SEQ ID NO: 94), Staphylococcus capitis (SEQ ID NO:95), and Staphylococcus epidermidis (SEQ ID NO:96) are further included and provided for by the present disclosure. Similarly, in certain aspects, homologs identified in Streptococci species including Streptococcus pneumonia (SEQ ID NO:97), Streptococcus pyogenes (SEQ ID NO:98), and Streptococcus agalactiae (SEQ ID NO:99) based on homology to ayrR and an adjacent homolog of ayrA with a DUF3169 domain are included and provided for by the present disclosure. It will be understood by a person of skill in the art, that homologous sequences encoding homologous proteins exist in other Gram-positive bacteria that can be readily isolated and incorporated into the methods and compositions of the present disclosure. Such sequences can be identified using bioinformatics methods, PCR amplification, cloning, screening and other methods well known to a person of skill in the art.

[0061] As used herein, an "operator" is a segment of DNA to which a transcription factor binds to regulate gene expression. Operator/repressor systems are well known in the art. The first operator/repressor system characterized was the lac repressor/operator inducer system in Escherichia coli. Jacob and Monod "Genetic regulatory mechanisms in the synthesis of proteins," JMol Biol. 3 (3): 318-56 (1961). The operator/repressor system has been applied to widely divergent organisms. See Hu et al, "The inducible lac operator-repressor system is functional in mammalian cells," Cell 48:555-566 (1987); Brown et al , "lac repressor can regulate expression from a hybrid SV40 early promoter containing a lac operator in animal cells," Cell 49:603-612 (1987); Figge et al , "Stringent regulation of stably integrated chloramphenicol acetyl transferase genes by E. coli lac repressor in monkey cells," Cell 52:713-722 (1988); Fuerst et al , "Transfer of the inducible lac repressor/operator system from Escherichia coli to a vaccinia virus expression vector," Proc. Natl. Acad. Sci. USA 86:2549-2553 (1989); Deutschle et al , "Regulated expression of foreign genes in mammalian cells under the control of coliphage T3 RNA polymerase and lac repressor," Proc. Natl.

Acad. Sci. USA 86:5400-5405 (1989). In an aspect, the operator/repressor system comprises at least one binding site for an AyrR repressor protein and the AyrR repressor protein. In certain aspects, an endogenous AyrR repressor protein is provided by the host bacteria. In other aspects, the AyrR repressor protein may be provided as a heterologous AyrR repressor protein.

[0062] It has been observed that multiple operators can be inserted into a gene construct to bind more than one repressor. The advantage of multiple operators is several fold. First, tighter blockage of RNA polymerase binding or translocation down the gene can be effected. Second, when spaced apart by at least about 70 nucleotides and typically no more than about 1000 nucleotides, and preferably spaced by about 200 to 500 nucleotides, a loop can be formed in the nucleic acid by the interaction between a repressor protein bound to the two operator sites. The loop structure formed provides strong inhibition of RNA polymerase interaction with the promoter, if the promoter is present in the loop, and provides inhibition of translocation of RNA polymerase down the transcriptional unit if the loop is located downstream from the promoter. Promoters configured with multiple operators exhibit lower levels of expression and are strongly inducible.

[0063] The present disclosure provides for, and includes, promoters capable of being repressed by an AyrR repressor protein operably linked to a nucleic acid sequence encoding a reporter as described above. In an aspect, the promoter may be the ayrR promoter obtained from S. aureus. In another aspect the promoter may be an ayrR promoter obtained from a bacterial species homologous to S. aureus. In other aspects, the ayrR promoter may be an ayrR promoter obtained from a Gram-positive bacteria. Those of skill in the art will recognize that the isolation of AyrR promoters from bacteria based on homology is routine in the art.

[0064] In certain aspects, a promoter capable of being repressed by an AyrR repressor protein operably linked to a nucleic acid sequence encoding a reporter can be prepared by modification of existing promoters. For example, a constitutive promoter incorporating one or more AyrR operator sites. In some aspects, a constitutive promoter can have two AyrR operator sites. In another aspect, a constitutive promoter can have three AyrR operator sites. In yet other aspects, a constitutive promoter can have four or more AyrR operator sites.

[0065] As discussed above the location and spacing of operator sites can be selected to optimize repression and de-repression of the promoter. In an aspect, a constitutive promoter can have two AyrR operator sites that are at least about 70 nucleotides apart. In an aspect, the distance between AyrR operator sites is between about 200 to 500 nucleotides. In certain aspects according to the present disclosure, a promoter capable of being repressed by an AyrR repressor protein is a promoter having at least one binding site that overlaps with the polymerase binding site, typically at about -35 nucleotides upstream (e.g. 5') of the transcriptional start site.

[0066] The present disclosure provides for, and includes, methods and compositions wherein the AyrR repressor protein is modified. As is understood by one of skill in the art, binding of a DNA binding protein to a nucleic acid sequence is not necessarily optimal. It is well understood that DNA binding is complex and dependent both on the sequence of the binding site and the polypeptide sequence. Binding affinity may be increased or decreased by mutating the DNA binding sequence, the DNA binding domain of a DNA binding protein, or both.

[0067] Mutations that alter the amino acid sequence of a protein show an enormous variety of effects ranging from no observable changes in structure or function to complete loss of function, protein destabilization, and degradation. Mutational studies of the DNA- binding proteins have shown that loss of function mutations include those mutations which have destabilizing effects on global protein structure or folding and those which affect protein function by specifically altering protein-protein (in the case of dimerization or activation) or protein-DNA (in the case of DNA-binding) interactions. Similarly, mutations can have stabilizing effects on global structure and enhance protein-DNA interactions. Similarly, mutations of the DNA binding site can both enhance or destabilize the protein-DNA interaction. Methods for modifying both the protein and the DNA binding site are well known in the art. See for example U.S. Patent No. 5,096,815, issued March 17, 1992, U.S Patent No. 5,223,409, issued June 29, 1993, U.S. Patent No. 5,955,358, issued September 21, 1999, U.S. Patent No. 9,023,594, issued May 5, 2015. Selection for improved or reduced nucleic acid binding can be accomplished both in vivo and in vitro and are known in the art.

[0068] The present disclosure provides for, and includes, modifying an ayrR repressor binding site to increase AyrR protein binding. Similarly, the present disclosure provides for, and includes, modifying an AyrR protein to increase binding to an ayrR repressor binding site. In an aspect, the ayrR binding site of SEQ ID NO: 2 can be modified to increase the affinity of the site by the AyrR protein from S. aureus. In aspect, the ayrR binding site of SEQ ID NO: 2 may be modified to prepare a perfect 22-nt palindrome. In an aspect, a nucleotide at positions 9 and 14 of SEQ ID NO:2 can be modified to prepare a perfect palindromic sequence. Also included and provided for by the present disclosure, are modifications to a binding site for an AyrR repressor protein to decrease AyrR protein binding. In certain aspects, an AyrR repressor protein can be mutated to decrease protein binding to an ayrR binding site. As provided here, one of skill in the art can modify the ayrR repressor/operator system to increase the sensitivity of the system to changes in Type I SPase inhibition.

[0069] In an aspect, additional mutations can be introduced an increase the affinity of an AyrR binding protein to SEQ ID NO: 2. In an aspect, two or more mutations can be introduced into a nucleic acid of SEQ ID NO:2. In an aspect, three or more mutations can be introduced into a nucleic acid of SEQ ID NO:2. In other aspects, four or more mutations can be introduced into a nucleic acid of SEQ ID NO: 2. One of ordinary skill in the art would recognize that random mutations in SEQ ID NO:2 can be generated and selected for increased affinity using methods well known in the art.

[0070] A person of ordinary skill would recognize, given the current disclosure, that a priori knowledge of the nucleotides that are important, or even critical, for AyrR protein binding are not necessary in order to identify and select nucleic acid sequences having high affinity. In aspects according to the present disclosure, nucleic acids that are optimized for AyrR binding may be selected from pools of random nucleic acids using selection procedures known in the art. For example, using a Systematic Evolution of Ligands by Exponential enrichment (SELEX) procedure described in U.S. Patent No. 5,475,096, issued December 12, 1995, and U.S. Patent No. 5,637,459, issued June 10, 1997. Additional methods for selection of high affinity nucleic acids are known in the art. [0071] Methods and compositions of the present disclosure are suitable for use for identifying Type I SPase inhibitors in diverse bacteria. One of ordinary skill in the art would recognize that differences in structure of Type I SPase proteins may result in differing affinities and inhibitory activity of different compounds. Thus, a compound identified that inhibits a Type I SPase from S. aureus may not be an optimal compound for inhibiting a Type I SPase from Staphylococcus epidermidis. As would be evident to a person of skill in the art, the more distant the evolutionary relationship between the Type I SPase proteins from different organisms, the more likely a difference in inhibitory activity of a given compound will be observed. In an aspect according to the present disclosure, bacteria from diverse sources may be screened.

[0072] Those of skill in the art would further recognize that broad spectrum inhibitors of Type I SPase are desirable. Accordingly, the present disclosure provides for, and includes methods for screening Type I SPase inhibitors active against Type I SPase proteins obtained from varied microorganisms.

[0073] In an aspect, the reporter based screening method provides for comparing the activity of Type I SPase proteins. In an aspect, the method can be applied to identify Type I SPase inhibitors active against various pathogens such as bacteria, fungi and parasites while having little or no activity against a mammalian Type I SPase homolog. Thus, inhibitors of Type I SPase proteins can be identified that can be used in the treatment of mammals, including humans.

[0074] In an aspect according to the present disclosure, a bacterium suitable for use in the methods and compositions of the present disclosure may be a Gram-positive cocci. In some aspects the Gram-positive cocci is a pathogenic Gram-positive cocci. In an aspect, the Gram- positive cocci is selected from the group consisting of Staphylococcus aureus,

Staphylococcus epidermidis, Staphylococcus saprophyticus, Streptococcus pyogenes, Streptococcus pneumonia, Streptococcus enter ococcus spp., Clostridium difficile,

Streptococcus agalactiae, and Streptococcus viridans. In an aspect, the Gram-positive cocci is Staphylococcus aureus. In another aspect, the Gram-positive cocci is Staphylococcus epidermidis. In other aspects, the Gram-positive cocci is Staphylococcus saprophyticus. In a further aspect, the Gram-positive cocci is Streptococcus pyogenes. In yet another aspect, the Gram-positive cocci is Streptococcus pneumonia. In some aspect, the Gram-positive cocci is a Streptococcus enterococcus spp. In another aspect, the Gram-positive cocci is Clostridium difficile. In yet another aspect, the Gram-positive cocci is Streptococcus agalactiae. In another aspect, the Gram-positive cocci is Streptococcus viridans.

[0075] The present disclosure provides for, and includes, methods for screening for potential antibiotics comprising contacting a microorganism having a bacterial Type I signal peptidase (SPase I) transformed with a recombinant nucleic acid comprising a promoter capable of being repressed by an AyrR repressor protein and a nucleic acid encoding a reporter, applying one or more compounds to said bacterium and detecting a signal from said reporter.

[0076] Suitable microorganisms for the methods of the present disclosure, include but are not limited to contacting a microorganism that is a Gram-positive bacterium, a Gram- negative bacterium, or is a mycobacterium. Among the non-limiting Gram-positive bacteria, the Gram-positive bacteria may be a Gram-positive cocci selected from the group consisting of Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus saprophyticus, Streptococcus pyogenes, Streptococcus pneumonia, Streptococcus enter ococcus spp. , Clostridium difficile, Streptococcus agalactiae, and Streptococcus viridans.

[0077] Suitable promoters and reports for use in methods for screening for antibiotics are described above. For example suitable promoters are described in detail at paragraphs [0054] to [0065]. Suitable reporters are described in detail in paragraphs [0035] to [0041].

[0078] Methods and compositions of the present disclosure include those that are suitable for use in high throughput screening methods. Prior approaches to identifying Type I SPase inhibitors are hampered by the requirement to purify a target Type I SPase or the requirement to prepare and provide a suitable substrate as discussed above. By providing for a reporter active in vivo in a transformed microorganism, compounds or potential antibiotics that inhibit Type I SPase can be identified by the detectable expression of a fluorescent, luminescent or enzymatic reporter protein. High throughput methods are known in the art and include, but are not limited to those disclosed in U.S. Publication No. 20060188941, published August 24, 2006, U.S. Publication No. US20030129634, published July 10, 2003, and International Patent Publication No. WO2001096597, published Dec 20, 2001. High throughput screening systems are commercially available (see, e.g. , Zymark Corp. , Hopkinton, MA; Air Technical Industries, Mentor, OH; Beckman Instruments, Inc. Fullerton, CA; Precision Systems, Inc. , Natick, MA, etc.). High throughput systems typically automate entire procedures including all sample and reagent pipetting, liquid dispensing, timed incubations, and final readings of the microplate in detector(s) appropriate for the assay. These configurable systems provide high throughput and rapid start up as well as a high degree of flexibility and customization. Manufacturers of such systems provide detailed protocols the various high throughput approaches.

[0079] The present disclosure provides for, and includes, recombinant nucleic acids comprising a promoter capable of being repressed by an AyrR repressor protein and a nucleic acid encoding a reporter. As provided above in detail, the recombinant nucleic acid constructs provide for a variety of promoter configurations and reporter configurations. The discussion of the methods employing the described recombinant nucleic acids apply to the recombinant nucleic acids themselves.

[0080] In aspects according to the present disclosure, the recombinant nucleic acids comprising a promoter capable of being repressed by an AyrR repressor protein and a nucleic acid encoding a reporter provide for binding of an AyrR repressor protein that results in repression of transcription in a bacterium transformed with the recombinant nucleic acid.

[0081] In aspects according to the present disclosure, a recombinant nucleic acids includes one or more repressor binding sites of SEQ ID NO:2. In other aspects, a repressor binding sites may be optimized for increased or decrease binding of an AyrR repressor protein as discussed above. Other appropriate repressor binding site sequences are readily identifiable as discussed above. The present disclosure further provides for recombinant nucleic acids that include more than one repressor binding site and further provides for optimizing the distance separating multiple binding sites to result in increased repression and increase post- induction expression. One of ordinary skill in the art would recognize that improved repression provides for recombinant nucleic acids that combine strong, high expression promoters.

[0082] The recombinant nucleic acids of the present disclosure having a nucleic acid encoding a reporter includes a reporter that is fluorescent reporter, a luminescent reporter, or an enzymatic reporter. Suitable reporters are described in detail in paragraphs [0035] to

[0041].

[0083] The recombinant nucleic acids of the present disclosure having a promoter capable of being repressed by an AyrR repressor protein includes promoters as described in detail above at paragraphs [0054] to [0065].

[0084] While the present disclosure has been described with reference to preferred embodiments, it will be understood by those skilled in the art that various changes may be made and equivalents may be substituted for elements thereof to adapt to particular situations without departing from the scope of the present disclosure. Therefore, it is intended that the present disclosure not be limited to the particular embodiments disclosed as the best mode contemplated for carrying out the present disclosure, but that the present disclosure will include all embodiments falling within the scope and spirit of the appended claims.

EXAMPLES

EXAMPLE 1

[0085] Identification and characterization of the ayrRABC operon in S. aureus

[0086] The ayrRABC operon (SEQ ID NO: 77) is cloned and analyzed. Four genes are identified: ayrR (SEQ ID Nos:69 and 70 for the nucleic acid and protein sequences respectively), ayrA (SEQ ID Nos:71 and 72 for the nucleic acid and protein sequences respectively), ayrB (SEQ ID Nos: 73 and 74 for the nucleic acid and protein sequences respectively), and ayrC (SEQ ID NOS: 75 and 76 for the nucleic acid and protein sequences respectively). The stop and start codons of ayrR and ayrA are overlapped, as are those of ayrB and ayrC, while the stop and start codons of ayrA and ayrB are separated by only 24 base pairs (Figure 3B), suggesting that they are all part of a co-transcriptionally regulated operon. Using RT-PCR, transcription of ayrRABC in the arylomycin-resistant strain

ARCOOOl, which harbors a nonsense mutation in ayrR and its parental wild type strain N315 is examined. Primers used for PCR are provided in Table 7. See Craney et al. , "A Putative Cro-Like Repressor Contributes to Arylomycin Resistance in Staphylococcus aureus " Antimicrob. Agents Chemother. 59:3066-3074 (2015) ("Craney et al , 2015"). No differences in transcript levels is observed for control genes (SA0334-SA0336 and gyrB), but transcript levels of ayrR, ayrA, ayrB, and ayrC in ARCOOOl are each increased ~8-fold compared to wild type (Figure 3C). Analysis of RNAseq data reveals overlapped sequence that aligns continuously across the entire ayrRABC locus, including the intergenic sequences (not shown). Collectively, these results demonstrate that ayrRABC is an operon and the mutation in ayrR that renders S. aureus resistant to Type I SPase inhibition results in operon derepression.

[0087] Multiple alleles of the AyrR protein are identified (SEQ ID Nos:78 to 88). The ayrR gene was identified in Staphylococcus haemolyticus (SEQ ID NO: 89), Staphylococcus simiae (SEQ ID NO:90), Staphylococcus pasteuri (SEQ ID NO:91), Staphylococcus warneri (SEQ ID NO: 92), Staphylococcus xylosus (SEQ ID NO: 93), Staphylococcus hominis (SEQ ID NO:94), Staphylococcus capitis (SEQ ID NO:95), and Staphylococcus epidermidis (SEQ ID NO: 96). Homologs are also identified in Streptococci species including Streptococcus pneumonia (SEQ ID NO: 97), Streptococcus pyogenes (SEQ ID NO: 98), and Streptococcus agalactiae (SEQ ID NO: 99) based on homology to ayrR and an adjacent homolog of ayrA with a DUF3169 domain.

Table 7: Gel Shift and RT PCR Primers

[0088] Identification and characterization of an ayrR binding site

[0089] The ayrR gene encodes a helix-tum-helix motif protein annotated as an XRE family transcriptional regulator with homology to the phage λ Cro repressor. Sequence analysis reveals an almost perfect 22-nt palindrome, TTTGACAAATATAGTTGTCAAA, upstream of ayrR and which overlaps the -35 promoter element (Figure 3B). Such palindromes commonly comprise the binding site of transcriptional regulators, and Cro regulates its own transcription by binding such a palindrome. See Huffman et al. ,

"Prokaryotic transcription regulators: more than just the helix-turn-helix motif," Curr. Opin. Struct. Biol. 12:98-106 (2002), Sarai et al , "Lambda repressor recognizes the approximately 2-fold symmetric half-operator sequences asymmetrically," Proc. Natl. Acad. Sci. USA 86:6513-6517 (1989), and Ptashne M. 1986. A Genetic Switch: Gene Control and Phage λ, Third Ed. ed. Cell Press & Blackwell Scientific Publications, Cambridge, MA. (1986). A gel shift assay is employed using various DNA fragments (Figure 3D) to demonstrate that AyrR selectively binds the palindrome.

[0090] AyrR binding results in suppression of the ayrRABC operon

[0091] A transcriptional reporter plasmid pARCl, which harbors the intergenic region between SA0336 and ayrR upstream of the genes encoding luciferase (luxCDABE) is prepared. See Mesak et al., "Improved lux reporters for use in Staphylococcus aureus," Plasmid 61 : 182-187 (2009). The intergenic region between SA0336 and ayrR (SEQ ID NO:68) is amplified using primers 3311uxF (SEQ ID NO: 100) and 3311uxR (SEQ ID NO: 101) which incorporate a BamHI site and Sail site, respectively, into the ayrR intergenic region PCR product. The ayrR intergenic region is cloned into pAMIlux between the BamHI and Sail sites creating the plasmid pARCl. The AyrR repressor is supplied in trans from the genome. Wild type N315 and a strain lacking the entire region from SA0336 to ayrC (N31 51ΔSA0336-ayrRABC) is transformed with either the empty luxCDABE vector or pARCl, and luminescence is assayed in actively growing cultures (Figure 3E). Only in the case of N31 51ΔSA0336-ayrRABC transformed with pARCl is high intensity luminescence observed. Luminescence is significantly lower for N315 harboring pARCl, consistent with repression by the genomically encoded AyrR protein. As an additional control, the ability of Type I SPase inhibition to release repression is tested by conducting the same experiment in the presence of a sub-inhibitory concentration of arylomycin M131 (0.5xMIC). Two hours after arylomycin addition, the luminescence signal in wild type N315 cells harboring pARCl is 7-fold higher than that observed in the absence of the arylomycin (Figure 3F). These results confirm that AyrR acts as a repressor of ayrRABC and that Type I SPase inhibition induces derepression. [0092] The ayrRABC operon is necessary for resistance to Type I SPase inhibition

[0093] The ayrA gene encodes a putative membrane protein, predicted to possess a DUF3169 domain of unknown function. Proteins in the DUF3169 family are found in both Staphylococcus and Streptococcus species, with one homolog present per genome in sequenced strains, and while they share only -30% sequence identity, six predicted transmembrane domains and a D-E(a/g)E motif located in the loop connecting the fourth and fifth predicted transmembrane segments are highly conserved. Interestingly, each ayrA homolog identified appears to be immediately downstream of a gene that is homologous to ayrR. The downstream genes ayrB and ayrC are predicted to encode the two domains of a type 2 family ABC transporter, with ayrC encoding the transporter domain and ayrB encoding the ATP -binding cassette domain (conserved domain cd03230).

[0094] The contribution of each gene to arylomycin resistance is assessed via gene deletion. Although ayrR can be deleted in an otherwise wild type strain (N315), we are unable to delete ayrA in ARCOOOl . Not to be limited by theory, this suggests that the derepression of ayrBC is toxic in the absence of ayrA. Thus, to test whether ayrA is required to tolerate Type I SPase inhibition, arylomycin resistance in N315 AayrA can be evolved. As a control, a strain lacking SA0336 is constructed and analyzed. Not to be limited by theory, it is predicted to encode a hypothetical protein and which is not part of the ayrRABC operon.

High level arylomycin M131 resistance (>16 μg/ml) is evolved in N315ASA0336 with frequencies indistinguishable from the wild type parental strain (2.0 x 10^"8) (Table 8).

[0095] Sequencing reveals that 8 out of 8 of the resistant strains contains mutations in ayrR, similar to the behavior observed with wild type cells. See id. In contrast, N315 ΔayrA develops high level resistance with a significantly reduced frequency (2.9 x 10^-10) (Table 8). Moreover, for the single, resistant clone isolated, sequencing revealed a wild type ayrR.

[0096] Deletion of ayrBC in ARC0001 (ARC0001 Δayr5 ) results in full re-sensitization to arylomycin M131, demonstrating that the ABC transporter is required to tolerate SPase inhibition (Table 8). Moreover, deletion of ctyrBC in N315 (N315 ayrBC) results in the evolution of resistance to arylomycin Ml 31 with the same reduced frequency observed with N3\5 AayrA (Table 8), and again, sequencing reveals wild type ayrR in a resistant mutant isolated. Collectively, these results demonstrate that each member of the ayrRABC operon is required to tolerate SPase inhibition.

EXAMPLE 2

[0097] Derepression of ayrRABC bypasses the requirement for SPase

[0098] Because derepression of ayrRABC confers S. aureus with high level resistance to SPase inhibition we speculate that it may render SPase nonessential. Using the same chromosomal integration approach, we attempt to delete the SPase gene spsB in ARCOOOl and its parental wild type N315. Not surprisingly, attempts to delete spsB in the wild type strain result in the recovery of the wild type sequence. In contrast, the ARCOOOl AspsB strain is viable. In addition to confirming the absence of spsB at its chromosomal loci via sequencing, we demonstrate that spsB is not present elsewhere in the genome of

ARC0001 AspsB via PCR and RT-PCR of genomic DNA and RNA, respectively, using primers internal to the spsB gene (Table 9).

Table 9: Amplification spsB from RNA and gDNA

Threshold

[0099] Deletion of spsB is also verified phenotypically via an examination of the susceptibility of N315 and ARCOOOlAspsB to gentamicin and the β-lactam antibiotics cefoxitin, oxacillin and penicillin G, known to be synergistic with that of the arylomycins. See Therien et al. , "Broadening the spectrum of beta-lactam antibiotics through inhibition of signal peptidase type I," Antimicrob. Agents Chemother. 56:4662-4670 (2012) and Smith et al. , "In vitro activities of arylomycin natural-product antibiotics against Staphylococcus epidermidis and other coagulase-negative staphylococci," Antimicrob. Agents Chemother. 55: 1130-1134 (2011). As controls, we susceptibilities to CCCP, vancomycin, daptomycin, erythromycin, trimethoprim and tetracycline are examine. For each control antibiotic tested, the observed susceptibilities of N315 are virtually identical to those observed for N315 and ARCOOOl. See Craney et al, 2015. However, the susceptibility of ARCOOOl AspsB to gentamicin and each β-lactam is 8- to 64-fold greater than that of N315 or ARCOOOl consistent with the absence of Type I SPase activity.

EXAMPLE 3

[00100] The activity of the ayrRABC complements SPase deletion.

[00101] Evaluation of protein secretion in N315, ARCOOOl and ARCOOOl AspsB using ID SDS-PAGE (Figure 4) reveals identical patterns of secretion for the wild type and ARCOOOl. Not to be limited by theory, this suggests that ARCOOOl still employs SPase even though the ayrRABC operon is derepressed. In contrast, a small but clearly significant alteration in the pattern of secretion is apparent for ARCOOOlAspsB. To confirm that this altered partem of secretion is the result of the loss of SPase activity, secretion is examined in the presence of arylomycin M131 (4xMIC). Wild type cells show drastically reduced levels of secretion in the presence of the arylomycin. However, treatment of ARCOOOl cells with the arylomycin does not reduce secretion and results in a secretion pattern indistinguishable from that of ARCOOOlAspsB, revealing that the altered pattern results from the absence of SPase activity. Moreover, the pattern and quantity of secreted proteins observed with ARCOOOl AspsB is unchanged by the addition of the arylomycin, confirming that secretion does not depend on SPase function.

[00102] The secreted proteome of ARCOOOl AspsB and N315 is compared in more detail by isolating proteins from the media, digesting with trypsin, using reductive dimethylation (ReDiMe) to heavy isotope label the wild type fragments and light isotope label the

ARCOOOl AspsB fragments. The combined samples are then analyzed via multidimensional mass spectrometry (MudPIT). See Washburn et al. , "Large-scale analysis of the yeast proteome by multidimensional protein identification technology," Nat. Biotechnol. 19:242- 247 (2001) and Inloes et al , "The hereditary spastic paraplegia-related enzyme DDHD2 is a principal brain triglyceride lipase," Proc. Natl. Acad. Sci. USA 111 : 14924-14929 (2014). In total, tryptic peptides corresponding to 38 proteins that are encoded with signal peptides are identified (Table 10), which is consistent with previous studies of the S. aureus secretome. See Schallenberger et al , "Type I signal peptidase and protein secretion in Staphylococcus aureus," J. Bacteriol. 194:2677-2686 (2012). [00103] The quantity of secreted proteins is then determined from the ratio of parent ion peak areas, which demonstrates that while tryptic peptides for the same proteins are detected from each strain, several are detected at different levels (Table 10). Sixteen of the 38 secreted proteins are detected in both strains at similar levels (within 2-fold), while 19 are detected at 2- to 8-fold reduced levels (for example, the proteases staphylokinase and SspP, the complement inhibitor Sak, and a hypothetical surface protein SA2285). Two proteins (SA0663 and SdrE) are detected at 6- to 8-fold elevated levels in the AspsB strain, while PrsA is detected at a 16-fold elevated level. PrsA is a peptidyl-prolyl isomerase involved in protein folding of secreted proteins in the extracellular environment; and is upregulated at the transcriptional level by SPase inhibition. See Hyyrylainen et al. , "Transcriptome analysis of the secretion stress response of Bacillus subtilis," Appl. Microbiol. Biotechnol. 67: 389-396 (2005). Examination of signal sequences does not reveal an obvious correlation with observed differences in secretion.

Table 10: Com arison of the Secreted Proteomes of Wild t e N315 and ARCOOOlAs si?

[00104] None of the tryptic peptides from wild type cells contained any part of the signal peptide, however, peptide fragments for eight of the proteins are found with N-termini that precisely matched the predicted SPase cleavage site (not shown). In contrast, with

ARC0001 ΔspsB, tryptic peptides corresponding to the N-terminal leader peptides of twelve of the 38 proteins are detected (Table 10). Not to be limited by theory, this suggests that AyrABC mediates secretion of the same proteins as does SPase but via either cleavage at a more N- terminal site or perhaps by extricating the entire intact preprotein from the cytoplasmic membrane.

Claims

CLAIMS:

1. A method of screening for an inhibitor of a Type I signal peptidase (SPase) comprising:

a. contacting a bacterium with a compound, wherein said bacterium is transformed with a nucleic acid comprising:

i. a promoter capable of being repressed by an AyrR repressor protein; and ii. a nucleic acid sequence encoding a reporter that is operably linked to said promoter;

b. detecting expression of said reporter.

2. The method of claim 1, wherein said compound is selected from the group consisting of a small molecule, a protein, or a nucleic acid.

3. The method of claim 1, wherein said promoter comprises at least one binding site for an AyrR repressor protein.

4. The method of claim 3, wherein said binding site overlaps said promoter and said promoter is repressed by binding of said AyrR repressor protein.

5. The method of claim 1, wherein said detecting comprises detecting a change in

luminescence, fluorescence, or enzymatic activity.

6. The method of claim 1, wherein said detecting comprises detecting a change in the amount of RNA transcribed from said nucleic acid sequence encoding said reporter.

7. The method of claim 1, wherein inhibition of said Type I signal peptidase comprises an increase in expression of said reporter.

8. The method of claim 1, wherein said reporter is selected from the group consisting of a fluorescent reporter, a luminescent reporter, and an enzymatic reporter.

9. The method of claim 8, wherein said fluorescent reporter is selected from the group

consisting of green fluorescent protein (GFP), derivatives of green fluorescent protein, dsRED, mRFP, derivatives of mRFP, uroporphyrinogen (UMT), nitroreductase.

10. The method of claim 8, wherein said luminescent reporter is selected from the group consisting of the luxCDABE genes, the luxAB genes, firefly luciferase, and aequorin.

11. The method of claim 8, wherein said enzymatic reporter is selected from the group

consisting of catechol 2,3-di oxygenase (xylE EP0086139); lipase (lip), beta-lactamase (blaZ), beta-galactosidase (lacZ or bgaB), beta- glucuronidase (gusA), tyrosinase (melC), alpha-amylase (amy), alkaline phosphatase (phoA/phoZ), chloramphenicol acetyltransferase (cat), neomycin phosphotransferase (neo), and combinations thereof.

12. The method of claim 1, wherein said promoter is an ayrR promoter from a Gram-positive or Gram-negative bacterium.

13. The method of claim 12, wherein said promoter is the ayrR promoter from Staphylococcus aureus (S. aureus).

14. The method of claim 12, wherein said promoter is an ayrR promoter from a Gram-positive bacterium.

15. The method of claim 1, wherein said binding site for an AyrR repressor protein is modified to increase AyrR protein binding.

16. The method of claim 1, wherein said binding site for an AyrR repressor protein is modified to decrease AyrR protein binding.

17. The method of claim 1, wherein the AyrR gene for said AyrR repressor protein in said bacterium is mutated to increase protein binding to said ayrR binding site.

18. The method of claim 1, wherein the ayrR gene for said AyrR repressor protein in said

bacterium is mutated to decrease protein binding to said AyrR binding site.

19. The method of claim 3 wherein said binding site for an AyrR repressor protein comprises a sequence of SEQ ID NO:2.

20. The method of claim 1, wherein said bacterium is selected from a Gram-positive or Gram- negative bacterium.

21. The method of claim 1, wherein said bacterium is a Gram-positive cocci selected from the group consisting of Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus saprophyticus, Streptococcus pyogenes, Streptococcus pneumonia, Streptococcus enter ococcus spp., Clostridium difficile, Streptococcus agalactiae, and Streptococcus viridans.

22. The method of claim 1, wherein said Type I signal peptidase (SPase) is a Type I SPase selected from the group consisting of a Gram -positive Type I SPase, Gram -positive Type I SPase, mycobacterial Type I SPase, archaea Type I SPase, and eukaryotic Type I SPase.

23. A recombinant nucleic acid comprising a promoter capable of being repressed by an AyrR repressor protein and a nucleic acid encoding a reporter.

24. The nucleic acid of claim 23, wherein binding of an AyrR repressor protein results in

repression of transcription in a bacterium transformed with said recombinant nucleic acid.

25. The nucleic acid of claim 23, wherein said promoter that is capable of being repressed by an AyrR repressor protein comprises a repressor binding site of SEQ ID NO: 2.

26. The nucleic acid of claim 23, wherein said reporter is selected from the group consisting of a fluorescent reporter, a luminescent reporter, and an enzymatic reporter.

27. The nucleic acid of claim 26, wherein said fluorescent reporter is selected from the group consisting of green fluorescent protein (GFP), derivatives of green fluorescent protein, dsRED, mRFP, derivatives of mRFP, uroporphyrinogen (UMT), nitroreductase, and combinations thereof.

28. The nucleic acid of claim 26, wherein said luminescent reporter is selected from the group consisting of the luxCDABE genes, the luxAB genes, firefly luciferase, and aequorin, and combinations thereof.

29. The nucleic acid of claim 26, wherein said enzymatic reporter is selected from the group consisting of catechol 2,3-di oxygenase (xylE EP0086139); lipase {lip), beta-lactamase (blaZ), beta-galactosidase (lacZ or bgaB), beta- glucuronidase (gusA), tyrosinase (melC), alpha-amylase (amy), alkaline phosphatase (phoA/phoZ), chloramphenicol acetyltransferase (cat), neomycin phosphotransferase (neo), and combinations thereof.

30. The nucleic acid of claim 26, wherein said promoter is an ayrR promoter from a Gram- positive or Gram-negative bacterium.

31. The nucleic acid of claim 26, wherein said promoter is the ayrR promoter from

Staphylococcus aureus (S. aureus).

32. The nucleic acid of claim 26, wherein said promoter is an ayrR promoter from a Gram- positive bacterium.

33. The nucleic acid of claim 26, wherein said promoter comprises one or more binding sites for an AyrR repressor protein.

34. The nucleic acid of claim 26, wherein said binding site for an AyrR repressor protein is modified to increase AyrR protein binding.

35. The nucleic acid of claim 26, wherein said binding site for an AyrR repressor protein is modified to decrease AyrR protein binding.

36. The nucleic acid of claim 26, wherein said binding site for an AyrR repressor protein

comprises a sequence of SEQ ID NO:2.

37. A method of screening for antibiotics comprising:

a. providing a microorganism having a bacterial Type I signal peptidase (SPase I) transformed with a recombinant nucleic acid comprising a promoter capable of being repressed by an AyrR repressor protein and a nucleic acid encoding a reporter;

b applying one or more compounds to said microorganism; and

c detecting a signal from said reporter.

The method of claim 37, wherein said microorganism is a Gram-positive bacterium, Gram-negative bacterium, or is a mycobacterium.

The method of claim 38, wherein said bacterium is a Gram-positive cocci selected from the group consisting of Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus saprophyticus, Streptococcus pyogenes, Streptococcus pneumonia, Streptococcus enter ococcus spp., Clostridium difficile, Streptococcus agalactiae, and Streptococcus viridans.

40. The method of claim 37, wherein said method is a high throughput screening format.

41. The method of claim 37, wherein said promoter that is capable of being repressed by an AyrR repressor protein comprises repressor binding site of SEQ ID NO: 2.

42. The method of claim 37, wherein said reporter is selected from the group consisting of a fluorescent reporter, a luminescent reporter, and an enzymatic reporter.

43. The method of claim 37, wherein said fluorescent reporter is selected from the group

consisting of green fluorescent protein (GFP), derivatives of green fluorescent protein, dsRED, mRFP, derivatives of mRFP, uroporphyrinogen (UMT), nitroreductase, and combinations thereof.

44. The method of claim 37, wherein said luminescent reporter is selected from the group consisting of the luxCDABE genes, the luxAB genes, firefly luciferase, and aequorin, and combinations thereof.

45. The method of claim 37, wherein said enzymatic reporter is selected from the group

consisting of catechol 2,3-dioxygenase (xylE); lipase (lip), beta-lactamase (blaZ), beta- galactosidase (lacZ or bgaB), beta- glucuronidase (gusA), tyrosinase (melC), alpha-amylase

(amy), alkaline phosphatase (phoAlphoZ), chloroamphenicol acetyltransferase (cat), neomycin phosphotransferase (neo), and combinations thereof.

46. The method of claim 37, wherein said promoter is an ayrR promoter from a Gram-positive or Gram-negative bacterium.

47. The method of claim 37, wherein said promoter is the ayrR promoter from Staphylococcus aureus (S. aureus).

48. The method of claim 37, wherein said promoter is an ayrR promoter from a Gram-positive bacterium.

49. The method of claim 37, wherein said promoter comprises one or more binding sites for an AyrR repressor protein.

50. The method of claim 37, wherein said binding site for an AyrR repressor protein is

modified to increase AyrR protein binding.

51. The method of claim 37, wherein said binding site for an AyrR repressor protein is

modified to decrease AyrR protein binding.

52. The method of claim 37, wherein said binding site for an AyrR repressor protein comprises a sequence of SEQ ID NO:2.