WO2017023337A1 - Animaux résistants à des agents pathogènes ayant des gènes cd163 modifiés - Google Patents

Animaux résistants à des agents pathogènes ayant des gènes cd163 modifiés Download PDF

Info

Publication number
WO2017023337A1
WO2017023337A1 PCT/US2015/044113 US2015044113W WO2017023337A1 WO 2017023337 A1 WO2017023337 A1 WO 2017023337A1 US 2015044113 W US2015044113 W US 2015044113W WO 2017023337 A1 WO2017023337 A1 WO 2017023337A1
Authority
WO
WIPO (PCT)
Prior art keywords
nucleotide
animal
cell
base pair
deletion
Prior art date
Application number
PCT/US2015/044113
Other languages
English (en)
Inventor
Randall S. Prather
Kevin D. Wells
Kristin M. Whitworth
Original Assignee
The Curators Of The University Of Missouri
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The Curators Of The University Of Missouri filed Critical The Curators Of The University Of Missouri
Priority to CA2993435A priority Critical patent/CA2993435A1/fr
Priority to KR1020187005189A priority patent/KR102495662B1/ko
Priority to KR1020247003232A priority patent/KR20240017121A/ko
Priority to KR1020237003410A priority patent/KR102631856B1/ko
Priority to PCT/US2015/044113 priority patent/WO2017023337A1/fr
Priority to AU2015404563A priority patent/AU2015404563B2/en
Publication of WO2017023337A1 publication Critical patent/WO2017023337A1/fr
Priority to AU2023200913A priority patent/AU2023200913A1/en

Links

Classifications

    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
    • A01K67/027—New or modified breeds of vertebrates
    • A01K67/0275—Genetically modified vertebrates, e.g. transgenic
    • A01K67/0276—Knock-out vertebrates
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
    • A01K67/027—New or modified breeds of vertebrates
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70596—Molecules with a "CD"-designation not provided for elsewhere
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1138—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/07—Animals genetically altered by homologous recombination
    • A01K2217/075—Animals genetically altered by homologous recombination inducing loss of function, i.e. knock out
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00—Animals characterised by species
    • A01K2227/10—Mammal
    • A01K2227/108—Swine
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00—Animals characterised by purpose
    • A01K2267/02—Animal zootechnically ameliorated
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1131—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against viruses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011—Details
    • C12N2770/10011—Arteriviridae

Definitions

  • the present invention relates to non-human animals and offspring thereof comprising at least one modified chromosomal sequence in a gene encoding a CD 163 protein.
  • the invention further relates to animal cells that contain such modified chromosomal sequences.
  • the animals and cells have increased resistance to pathogens, including porcine reproductive and respiratory syndrome virus (PRRSV).
  • PRRSV porcine reproductive and respiratory syndrome virus
  • the animals and offspring have chromosomal modifications of a CD 163 gene so that PRRSV entry and replication is inhibited and resultant animals display resistance to the disease and syndrome caused by the virus.
  • the invention further relates to methods of breeding to create pathogen-resistant animals and populations of animals made using such methods.
  • the invention also relates to methods for gene editing of CD 163 involving direct injection of embryos and the development of animals, founder animals and lines that are resistant to pathogens such as PRRSV.
  • Porcine reproductive and respiratory syndrome virus belongs to a group of mammalian arteriviruses, which also include murine lactate dehydrogenase-elevating virus, simian hemorrhagic fever virus and equine arteritis virus.
  • the arteriviruses share important properties related to viral pathogenesis, including a tropism for macrophages and the capacity to cause severe disease and persistent infection.
  • Clinical disease syndromes caused by infection with porcine reproductive and respiratory syndrome virus (PRRSV) were first reported in the United States in 1987 (Keffaber, 1989) and later in Europe in 1990 (Wensvoort et al., 1991).
  • PRRSV PRRSV-induced respiratory disease
  • respiratory disease including cough and fever, reproductive failure during late gestation, and reduced growth performance.
  • the virus also participates in a variety of polymicrobial disease syndrome interactions while maintaining a lifelong subclinical infection (Rowland et al, 2012).
  • PRRS has become the most important disease of commercial pigs in North America, Europe and Asia, with only the continents of Australia and Antarctica free from disease. In North America alone PRRSV-related losses are estimated to cost producers $664 M each year (Holtkamp et al, 2013). In 2006, a more severe form of the disease, known as highly pathogenic PRRS (HP -PRRS), decimated pig populations throughout China. Genetic diversity has limited the development of vaccines needed to effectively control and eliminate the disease. While genetic selection for natural resistance might be an option, the results have to date been limited (Boddicker et al, 2014).
  • SIGLECl CD 169
  • previous work by using SIGLECl 1' pigs showed no difference in virus replication compared to wild type pigs.
  • Non-human animals, offspring thereof, and animal cells that comprise at least one modified chromosomal sequence in a gene encoding a CD 163 protein are provided.
  • the method comprises genetically modifying an oocyte or a sperm cell to introduce a modified chromosomal sequence in a gene encoding a CD 163 protein into at least one of the oocyte and the sperm cell, and fertilizing the oocyte with the sperm cell to create a fertilized egg containing the modified chromosomal sequence in a gene encoding a CD 163 protein.
  • the method comprises genetically modifying a fertilized egg to introduce a modified chromosomal sequence in a gene encoding a CD 163 protein into the fertilized egg.
  • the method further comprises transferring the fertilized egg into a surrogate female animal, wherein gestation and term delivery produces a progeny animal, screening the progeny animal for susceptibility to the pathogen, and selecting progeny animals that have reduced susceptibility to the pathogen as compared to animals that do not comprise a modified chromosomal sequence in a gene encoding a CD 163 protein.
  • a method of increasing a livestock animal's resistance to infection with a pathogen comprises genetically editing at least one
  • chromosomal sequence from a gene encoding a CD 163 protein so that CD 163 protein production or activity is reduced, as compared to CD63 protein production or activity in a livestock animal that does not comprise an edited chromosomal sequence in a gene encoding a CD 163 protein.
  • modifications to the chromosomal sequence in a gene encoding a CD 163 protein reduce the susceptibility of the animal, offspring, cell, or population (e.g., a porcine animal, offspring, cell or population) to a pathogen (e.g., a virus such as porcine reproductive and respiratory syndrome virus (PRRSV)).
  • a pathogen e.g., a virus such as porcine reproductive and respiratory syndrome virus (PRRSV)
  • the modification of the chromosomal sequence in the gene encoding a CD 163 protein can comprise an 11 base pair deletion from nucleotide 3,137 to nucleotide 3, 147 as compared to reference sequence SEQ ID NO: 47; a 2 base pair insertion between nucleotides 3, 149 and 3, 150 as compared to reference sequence SEQ ID NO: 47, with a 377 base pair deletion from nucleotide 2,573 to nucleotide 2,949 as compared to reference sequence SEQ ID NO: 47 on the same allele; a 124 base pair deletion from nucleotide 3,024 to nucleotide 3, 147 as compared to reference sequence SEQ ID NO: 47; a 123 base pair deletion from nucleotide 3,024 to nucleotide 3,146 as compared to reference sequence SEQ ID NO: 47; a 1 base pair insertion between nucleotides 3, 147 and 3, 148 as
  • isolated nucleic acids comprise a nucleotide sequence selected from the group consisting of: (a) a nucleotide sequence comprising SEQ ID NO: 47; (b) a nucleotide sequence having at least 80% sequence identity to the sequence of SEQ ID NO: 47, wherein said nucleotide sequence contains at least one substitution, insertion, or deletion relative to SEQ ID NO: 47; and (c) a cDNA sequence of (a) or (b).
  • the isolated nucleic acid comprises SEQ ID NO: 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 11 1, 1 12, 113, or 114.
  • FIG. 1 Targeting vectors and CRISPRs used to modify CD 163.
  • Panel A depicts wild type exons 7, 8 and 9 of the CD 163 gene that was targeted for modification using
  • Panel B shows the targeting vector designed to replace pig exon 7 (pig domain was used in transfections with drug selection by G418. PCR primers for the long range, left arm and right arm assay are labelled with arrows for 1230, 3752, 8791, 7765 and 7775.
  • Panel C depicts a targeting vector identical to the one shown in panel B, but wherein the Neo cassette was removed. This targeting vector was used to target CD 163 in cells that were already neomycin resistant. Primers used in small deletions assays are illustrated with arrows and labeled GCD 163F and GCD163R. Panel D emphasizes the exons targeted by CRISPRs.
  • CRISPRs 10, 131, 256 and 282 are represented by the downward facing arrows on exon 7.
  • the CRISPR numbers represent the number of base pairs from the intron-exon junction of intron 6 and exon 7.
  • FIG. 2 Targeting vector and CRISPRs used to modify CDID.
  • Panel A depicts wild type exons 3, 4, 5, 6 and 7 of the CDID gene that was targeted for modification by CRISPRs.
  • Panel B shows the targeting vector designed to replace exon 3 with the selectable marker Neo. This targeting vector was used in combination with CRISPRs to modify CDID.
  • PCR primers for the long range, left arm and right arm assay are labeled with arrows for 3991, 4363, 7373 and 12806.
  • Panel C depicts the exons targeted by CRISPRs. Locations of CRISPRs 4800, 5350, 5620 and 5626 are represented by the downward facing arrows on exon 3. Primers used in small deletions assays are illustrated with arrows and labelled GCD 1DF and GCD1DR. The CRISPR numbers represent the number of base pairs from the intron-exon junction of intron 6 and exon 7.
  • FIG. 3. Generation of CD163 and CDID knockout pigs by CRISPR/Cas9 and SCNT.
  • a wild-type (WT) genotype results in a 6545 base pair (bp) band.
  • Lanes 1-6 represent six different colonies from a single transfection with CRISPR 10 with Cas9 and donor DNA containing Neo.
  • Lanes 1, 4, and 5 show a large homozygous deletion of 1500-2000 bp.
  • Lane 2 represents a smaller homozygous deletion.
  • Lanes 3 and 6 represent either a WT allele and a small deletion or a biallelic modification of both alleles.
  • E) Genotype of two SCNT litters containing the 1506 bp deletion of CD163. Lanes 1-3 (litter 63) and lanes 1-4 (litter 64) represent the genotype for each piglet from each litter. Sow indicates the recipient female of the SCNT embryos, and WT represents a WT control. NTC no template control.
  • FIG. 4 Effect of CRISPR/Cas9 system in porcine embryos.
  • FIG. 5 Effect of CRISPR/Cas9 system in targeting CD163 in porcine embryos.
  • FIG. 6 Effect of CRISPR/Cas9 system when introduced with two types of CRISPRs.
  • A) PCR amplification of CD 163 in blastocysts injected with CRISPR/ Cas9 as zygotes. Lanes 1, 3, 6, and 12 show the designed deletion between two different CRISPRs.
  • CD ID had a lower frequency of deletion as determined by gel electrophoresis when compared to CD 163 (3/23); lanes 1, 8, and 15 show obvious deletions in CD1D.
  • CD 163 WT (SEQ ID NO:24), CD163 #1 (SEQ ID NO:25), CD163 #2 (SEQ ID NO:26), CD163 #3 (SEQ ID NO:27), eGFP WT (SEQ ID NO:28), eGFP #1-1 (SEQ ID NO:29), eGFP #1-2 (SEQ ID NO: 30), eGFP #2 (SEQ ID NO:31), and eGFP #3 (SEQ ID NO:32).
  • CD 163 knockout pigs generated by CRISPR/Cas9 system injected into zygotes.
  • the other two animals (from litters 67-2 and 67-4) are carrying a biallelic modification of CD163: #67-2 Al (SEQ ID NO:35), #67-2 A2 (SEQ ID NO:36), #67-4 Al (SEQ ID NO:38), and #67-4 a2 (SEQ ID NO:39).
  • the deletion was caused by introducing two different CRISPRs with Cas9 system. No animals from the zygote injection for CD 163 showed a mosaic genotype.
  • FIG. 8 CD ID knockout pigs generated by CRISPR/Cas9 system injected into zygotes.
  • WT FF wild-type fetal fibroblasts.
  • FIG. 10 Lung histopathology during acute PRRSV infection. Representative photomicrographs of H and E stained tissues from wild-type and knockout pigs. The left panel shows edema and infiltration of mononuclear cells. The right panel from a knockout pig shows lung architecture of a normal lung.
  • FIG. 1 Viremia in the various genotypes. Note that the CD163-/- piglet data lies along the X axis.
  • FIG. 12 Antibody production in null, wild type and uncharacterized allele pigs.
  • FIG. 13 Cell surface expression of CD 163 in individual pigs. Lines appearing towards the right in the uncharacterized A, uncharacterized B, and CD 163 +/+ panels represent the CD 163 antibody while the lines appearing towards the left-hand sides of these panels are the no antibody controls (background). Note that in the CD163-/- animals the CD163 staining overlaps with the background control, and that the CD 163 staining in the Uncharacterized alleles is roughly halfway between the WT level and the background (also note that this is a log scale, thus less than -10%).
  • FIG. 14 Level of CD 169 on alveolar macrophages from three representative pigs and the no antibody control (FITC labelled anti-CD 169).
  • FIG. 15. Viremia in the various genotypes. Note that the ⁇ 43 amino acid piglet data lies along the X-axis.
  • FIG. 16 Genomic Sequence of wild type CD163 exons 7-10 used as a reference sequence (SEQ ID NO:47). The sequence includes 3000 bp upstream of exon 7 to the last base of exon 10. The underlined regions show the locations of exons 7, 8, 9, and 10, respectively.
  • animals and methods for producing gene edited animals that have modifications of the CD 163 gene and which are resistant to PRRSV and other related respiratory virus infections.
  • the animals have chromosomal modifications (insertions or deletions) that inactivate or otherwise modulate CD 163 gene activity.
  • CD 163 is required for PRRSV entry into cell and for virus replication.
  • the null CD 163 animals display resistance to PRRSV infection when challenged.
  • Also provided herein are methods for of making a porcine animal comprising introducing to a porcine animal cell or porcine embryo an agent that specifically binds to a chromosomal target site of the cell and causes a double-stranded DNA break or otherwise inactivates or reduces activity of a CD 163 gene or protein therein using gene editing methods such as the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) /Cas system, Transcription Activator-Like Effector Nucleases (TALENs), Zinc Finger Nucleases (ZFN), recombinase fusion proteins, or meganucleases.
  • CRISPR Clustered Regularly Interspaced Short Palindromic Repeats
  • TALENs Transcription Activator-Like Effector Nucleases
  • ZFN Zinc Finger Nucleases
  • recombinase fusion proteins or meganucleases.
  • CD 163 loci in tandem with a polypeptide capable of effecting cleavage and/or integration of specific nucleic acid sequences within the CD 163 loci.
  • Examples of the use of CD 163 loci in tandem with a polypeptide or RNA capable of effecting cleavage and/or integration of the CD 163 loci include a polypeptide selected from the group consisting of zinc finger proteins, meganucleases, TAL domains, TALENs, RNA-guided CRISPR/Cas recombinases, leucine zippers, and others known to those in the art.
  • a chimeric (“fusion") protein comprising a site- specific DNA binding domain polypeptide and cleavage domain polypeptide (e.g., a nuclease), such as a ZFN protein comprising a zinc-finger polypeptide and a Fokl nuclease polypeptide.
  • cleavage domain polypeptide e.g., a nuclease
  • ZFN protein comprising a zinc-finger polypeptide and a Fokl nuclease polypeptide
  • Described herein are polypeptides comprising a DNA-binding domain that specifically binds to a CD 163 gene.
  • Such a polypeptide can also comprise a nuclease (cleavage) domain or half- domain (e.g., a homing endonuclease, including a homing endonuclease with a modified DNA- binding domain), and/or a ligase domain, such that the polypeptide may induce a targeted double-stranded break, and/or facilitate recombination of a nucleic acid of interest at the site of the break.
  • a DNA-binding domain that targets a CD 163 locus can be a DNA-cleaving functional domain.
  • the foregoing polypeptides can be used to introduce an exogenous nucleic acid into the genome of a host organism (e.g., an animal species) at one or more CD163 loci.
  • the DNA- binding domains can comprise a zinc finger protein with one or more zinc fingers (e.g., 2, 3, 4, 5, 6, 7, 8, 9 or more zinc fingers), which is engineered (non-naturally occurring) to bind to any sequence within a CD 163 gene.
  • Any of the zinc finger proteins described herein may bind to a target site within the coding sequence of the target gene or within adjacent sequences (e.g., promoter or other expression elements).
  • the zinc finger protein can bind to a target site in a CD 163 gene.
  • ranges recited herein also encompass any and all possible sub-ranges and combinations of sub-ranges thereof, as well as the individual values making up the range, particularly integer values.
  • a recited range includes each specific value, integer, decimal, or identity within the range. Any listed range can be easily recognized as sufficiently describing and enabling the same range being broken down into at least equal halves, thirds, quarters, fifths, or tenths. As a non-limiting example, each range discussed herein can be readily broken down into a lower third, middle third and upper third, etc.
  • a "binding protein” is a protein that is able to bind to another molecule.
  • a binding protein can bind to, for example, a DNA molecule (a DNA-binding protein), an RNA molecule (an RNA-binding protein) and/or a protein molecule (a protein-binding protein).
  • a DNA-binding protein a DNA-binding protein
  • an RNA-binding protein an RNA-binding protein
  • a protein-binding protein In the case of a protein-binding protein, it can bind to itself (to form homodimers, homotrimers, etc.) and/or it can bind to one or more molecules of a different protein or proteins.
  • a binding protein can have more than one type of binding activity. For example, zinc finger proteins have DNA- binding, RNA-binding and protein-binding activity.
  • nucleic acid sequences refers to those nucleic acids which encode identical or conservatively modified variants of the amino acid sequences. Because of the degeneracy of the genetic code, a large number of functionally identical nucleic acids encode any given protein. For instance, the codons GCA, GCC, GCG and GCU all encode the amino acid alanine. Thus, at every position where an alanine is specified by a codon, the codon can be altered to any of the corresponding codons described without altering the encoded polypeptide. Such nucleic acid variations are "silent variations" and represent one species of conservatively modified variation. Every nucleic acid sequence herein that encodes a polypeptide also, by reference to the genetic code, describes every possible silent variation of the nucleic acid.
  • each codon in a nucleic acid can be modified to yield a functionally identical molecule. Accordingly, each silent variation of a nucleic acid which encodes a polypeptide of the present invention is implicit in each described polypeptide sequence and is within the scope of the present invention.
  • amino acid sequences one of skill will recognize that individual substitutions, deletions or additions to a nucleic acid, peptide, polypeptide, or protein sequence which alters, adds or deletes a single amino acid or a small percentage of amino acids in the encoded sequence is a "conservatively modified variant" where the alteration results in the substitution of an amino acid with a chemically similar amino acid.
  • any number of amino acid residues selected from the group of integers consisting of from 1 to 15 can be so altered.
  • 1, 2, 3, 4, 5, 7, or 10 alterations can be made.
  • Conservatively modified variants typically provide similar biological activity as the unmodified polypeptide sequence from which they are derived.
  • substrate specificity, enzyme activity, or ligand/receptor binding is generally at least 30%, 40%, 50%, 60%, 70%, 80%, or 90% of the native protein for its native substrate.
  • Conservative substitution tables providing functionally similar amino acids are well known in the art.
  • CRISPR stands for "clustered regularly interspaced short palindromic repeats.”
  • Cas9 refers to "CRISPR associated protein 9.”
  • CRISPR/Cas9 or CRISPR/Cas9 system refer to a programmable nuclease system for genetic engineering that includes a Cas9 protein, or derivative thereof, and one or more non-coding RNAs that can provide the function of a CRISPR RNA (crRNA) and trans-activating RNA (tracrRNA) for the Cas9.
  • the crRNA and tracrRNA can be used individually or can be combined to produce a "guide RNA” (gRNA).
  • the crRNA or gRNA provide sequence that is complementary to the genomic target. CRISPR/Cas9 systems are described further hereinbelow.
  • references herein to a deletions in a nucleotide sequence from nucleotide x to nucleotide y mean that all of the nucleotides in the range have been deleted, including x and y.
  • the phrase "an 1 1 base pair deletion from nucleotide 3,137 to nucleotide 3, 147 as compared to SEQ ID NO: 47" means that each of nucleotides 3,317 through 3, 147 have been deleted, including nucleotides 3,317 and 3,147.
  • Disease resistance is a characteristic of an animal, wherein the animal avoids the disease symptoms that are the outcome of animal-pathogen interactions, such as interactions between a porcine animal and PRRSV. That is, pathogens are prevented from causing animal diseases and the associated disease symptoms, or alternatively, a reduction of the incidence and/or severity of clinical signs or reduction of clinical symptoms.
  • compositions and methods disclosed herein can be used with other compositions and methods available in the art for protecting animals from pathogen attack.
  • nucleic acid encoding a protein comprising the information for translation into the specified protein.
  • a nucleic acid encoding a protein may comprise intervening sequences (e.g., introns) within translated regions of the nucleic acid, or may lack such intervening non-translated sequences (e.g., as in cDNA).
  • the information by which a protein is encoded is specified by the use of codons.
  • the amino acid sequence is encoded by the nucleic acid using the "universal" genetic code.
  • nucleases create specific double-stranded chromosomal breaks (DSBs) at desired locations in the genome, which in some cases harnesses the cell's endogenous mechanisms to repair the induced break by natural processes of homologous recombination (HR) and/or nonhomologous end-joining (NHEJ).
  • HR homologous recombination
  • NHEJ nonhomologous end-joining
  • Gene editing effectors include Zinc Finger Nucleases (ZFNs), Transcription Activator-Like Effector Nucleases (TALENs), the Clustered Regularly Interspaced Short Palindromic Repeats/CAS9 (CRISPR/Cas9) system, and meganucleases (e.g., meganucleases re-engineered as homing endonucleases).
  • ZFNs Zinc Finger Nucleases
  • TALENs Transcription Activator-Like Effector Nucleases
  • CRISPR/Cas9 Clustered Regularly Interspaced Short Palindromic Repeats/CAS9
  • meganucleases e.g., meganucleases re-engineered as homing endonucleases.
  • the terms also include the use of transgenic procedures and techniques, including, for example, where the change is a deletion or relatively small insertion (typically less than 20nt) and/or does not introduce DNA from a foreign species.
  • heterologous in reference to a nucleic acid is a nucleic acid that originates from a foreign species, or, if from the same species, is substantially modified from its native form in composition and/or genomic locus by deliberate human intervention.
  • a promoter operably linked to a heterologous structural gene is from a species different from that from which the structural gene was derived, or, if from the same species, one or both are substantially modified from their original form.
  • a heterologous protein may originate from a foreign species or, if from the same species, is substantially modified from its original form by deliberate human intervention.
  • homoing DNA technology covers any mechanisms that allow a specified molecule to be targeted to a specified DNA sequence including Zinc Finger (ZF) proteins, Transcription Activator-Like Effectors (TALEs) meganucleases, and the CRISPR/Cas9 system.
  • ZF Zinc Finger
  • TALE Transcription Activator-Like Effectors
  • increased resistance and “reduced susceptibility” herein mean, but are not limited to, a statistically significant reduction of the incidence and/or severity of clinical signs or clinical symptoms which are associated with infection by pathogen.
  • increased resistance or “reduced susceptibility can refer to a statistically significant reduction of the incidence and/or severity of clinical signs or clinical symptoms which are associated with infection by PRRSV in an animal comprising at least one modified chromosomal sequence in a gene encoding a CD 163 protein as compared to a control animal having an unmodified chromosomal sequence.
  • statically significant reduction of clinical symptoms means, but is not limited to, the frequency in the incidence of at least one clinical symptom in the edited group of subjects is at least 10%, preferably at least 20%, more preferably at least 30%, even more preferably at least 50%, and even more preferably at least 70% lower than in the non-edited control group after the challenge the infectious agent.
  • knock-in means replacement of an endogenous gene with a transgene or with same endogenous gene with some structural modification/s, but retaining the transcriptional control of the endogenous gene.
  • Knock-out means disruption of the structure or regulatory mechanism of a gene. Knock-outs may be generated through homologous recombination of targeting vectors, replacement vectors or hit-and-run vectors or random insertion of a gene trap vector resulting into complete, partial or conditional loss of gene function.
  • animal includes any non-human animal, for example a domestic animal (e.g. a livestock animal).
  • livestock animal includes any animals traditionally raised in livestock farming, for example a porcine animal, a bovine animal (e.g., beef of dairy cattle), an ovine animal, a caprine animal, an equine animal (e.g., horses or donkeys), buffalo, camels, or an avian animal (e.g., chickens, turkeys, ducks, geese, guinea fowl, or squabs).
  • This term "livestock animal” does not include rats, mice, or other rodents.
  • mutation includes alterations in the nucleotide sequence of a polynucleotide, such as for example a gene or coding DNA sequence (CDS), compared to the wild-type sequence.
  • CDS coding DNA sequence
  • the term includes, without limitation, substitutions, insertions, frameshifts, deletions, inversions, translocations, duplications, splice-donor site mutations, point-mutations and the like.
  • operably linked includes reference to a functional linkage between two nucleic acid sequences, e.g., a promoter sequence and a second sequence, wherein the promoter sequence initiates and mediates transcription of the DNA sequence corresponding to the second sequence.
  • operably linked means that the nucleic acid sequences being linked are contiguous and, where necessary join two protein coding regions, contiguously and in the same reading frame.
  • polynucleotide includes reference to a
  • deoxyribopolynucleotide, ribopolynucleotide, or conservatively modified variants may also refer to analogs thereof that have the essential nature of a natural ribonucleotide in that they hybridize, under stringent hybridization conditions, to substantially the same nucleotide sequence as naturally occurring nucleotides and/or allow translation into the same amino acid(s) as the naturally occurring nucleotide(s).
  • a polynucleotide can be full-length or a subsequence of a native or heterologous structural or regulatory gene. Unless otherwise indicated, the term includes reference to the specified sequence as well as the complementary sequence thereof. Thus, DNAs or RNAs with backbones modified for stability or for other reasons are
  • DNAs or RNAs comprising unusual bases, such as inosine, or modified bases, such as tritylated bases, to name just two examples, are polynucleotides as the term is used herein. It will be appreciated that a great variety of modifications have been made to DNA and RNA that serve many useful purposes known to those of skill in the art.
  • polynucleotide as it is employed herein embraces such chemically, enzymatically or metabolically modified forms of polynucleotides, as well as the chemical forms of DNA and RNA characteristic of viruses and cells, including among other things, simple and complex cells.
  • polypeptide polypeptide
  • peptide protein
  • protein protein
  • amino acid residues polymer of amino acid residues
  • the terms also may apply to conservatively modified variants and to amino acid polymers in which one or more amino acid residue is an artificial chemical analogue of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers.
  • the essential nature of such analogues of naturally occurring amino acids is that, when incorporated into a protein, the protein is specifically reactive to antibodies elicited to the same protein but consisting entirely of naturally occurring amino acids.
  • polypeptide is also inclusive of modifications including, but not limited to, glycosylation, lipid attachment, sulfation, gamma- carboxylation of glutamic acid residues, hydroxylation and ADP-ribosylation. It will be appreciated, as is well known and as noted above, that polypeptides are not always entirely linear. For instance, polypeptides may be branched as a result of ubiquitination, and they may be circular, with or without branching, generally as a result of post-translation events, including natural processing event and events brought about by human manipulation which do not occur naturally.
  • Circular, branched and branched circular polypeptides may be synthesized by non- translation natural process and by entirely synthetic methods, as well. Further, this invention contemplates the use of both the methionine-containing and the methionine-less amino terminal variants of the protein of the invention.
  • “reduction of the incidence and/or severity of clinical signs” or “reduction of clinical symptoms” means, but is not limited to, reducing the number of infected subjects in a group, reducing or eliminating the number of subjects exhibiting clinical signs of infection, or reducing the severity of any clinical signs that are present in one or more subjects, in comparison to wild-type infection.
  • these terms encompass any clinical signs of infection, lung pathology, viremia antibody production, reduction of pathogen load, pathogen shedding, reduction in pathogen transmission, or reduction of any clinical sign symptomatic of PRRSV.
  • these clinical signs are reduced in one or more animals of the invention by at least 10% in comparison to subjects not having a modification in the CD 163 gene and that become infected. More preferably clinical signs are reduced in subjects of the invention by at least 20%, preferably by at least 30%, more preferably by at least 40%, and even more preferably by at least 50%.
  • amino acid residue or “amino acid residue” or “amino acid” are used interchangeably herein to refer to an amino acid that is incorporated into a protein, polypeptide, or peptide (collectively “protein”).
  • the amino acid may be a naturally occurring amino acid and, unless otherwise limited, may encompass non-natural analogs of natural amino acids that can function in a similar manner as naturally occurring amino acids.
  • the term "selectively hybridizes" includes reference to hybridization, under stringent hybridization conditions, of a nucleic acid sequence to another nucleic acid sequence or other biologies.
  • a nucleic acid probe is chosen that is complementary to a reference nucleic acid sequence, and then by selection of appropriate conditions the probe and the reference sequence selectively hybridize, or bind, to each other to form a duplex molecule.
  • stringent conditions or “stringent hybridization conditions” includes reference to conditions under which a probe will hybridize to its target sequence to a detectably greater degree than to other sequences (e.g., at least 2-fold over background). Stringent conditions are sequence-dependent and will be different in different circumstances. By controlling the stringency of the hybridization and/or washing conditions, target sequences can be identified which are 100% complementary to the probe (homologous probing).
  • stringency conditions can be adjusted to allow some mismatching in sequences so that lower degrees of similarity are detected (heterologous probing).
  • a probe is less than about 1000 nucleotides in length, optionally less than 500 nucleotides in length.
  • stringent conditions will be those in which the salt concentration is less than about 1.5 M Na ion, typically about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30° C for short probes (e. g., 10 to 50 nucleotides) and at least about 60° C for long probes (e.g., greater than 50 nucleotides).
  • Tm thermal melting point
  • Tm [°C] 81.5 + 16.6 (log M) + 0.41(% GQ-0.61 (% form)-500/L; where M is the molarity of monovalent cations, % GC is the percentage of guanosine and cytosine nucleotides in the DNA, % form is the percentage of formamide in the hybridization solution, and L is the length of the hybrid in base pairs.
  • the T m is the temperature (under defined ionic strength and pH) at which 50% of a complementary target sequence hybridizes to a perfectly matched probe.
  • Tm is reduced by about 1° C for each 1% of mismatching; thus, Tm, hybridization and/or wash conditions can be adjusted to hybridize to sequences of the desired identity. For example, if sequences with > 90% identity are sought, the Tm can be decreased 10° C.
  • stringent conditions are selected to be about 5° C lower than the Tm for the specific sequence and its complement at a defined ionic strength and pH.
  • severely stringent conditions can utilize a hybridization and/or wash at 1 to 4° C lower than the Tm; moderately stringent conditions can utilize a hybridization and/or wash at 6 to 10° C lower than the Tm; low stringency conditions can utilize a hybridization and/or wash at 1 1 to 20° C lower than the Tm.
  • a "TALE DNA binding domain” or “TALE” is a polypeptide comprising one or more TALE repeat domains/units. The repeat domains are involved in binding of the TALE to its cognate target DNA sequence.
  • a single “repeat unit” (also referred to as a “repeat”) is typically 33-35 amino acids in length and exhibits at least some sequence homology with other TALE repeat sequences within a naturally occurring TALE protein.
  • Zinc finger and TALE binding domains can be "engineered” to bind to a predetermined nucleotide sequence, for example via engineering (altering one or more amino acids) of the recognition helix region of naturally occurring zinc finger or TALE proteins.
  • engineered DNA binding proteins are proteins that are non-naturally occurring.
  • methods for engineering DNA-binding proteins are design and selection.
  • a designed DNA binding protein is a protein not occurring in nature whose design/composition results principally from rational criteria. Rational criteria for design include application of substitution rules and computerized algorithms for processing information in a database storing information of existing ZFP and/or TALE designs and binding data. See, for example, U.S. Pat. Nos. 6, 140,081;
  • vector includes reference to a nucleic acid used in transfection of a host cell and into which can be inserted a polynucleotide. Vectors are often replicons. Expression vectors permit transcription of a nucleic acid inserted therein.
  • Wild type means those animals and blastocysts, embryos or cells derived therefrom, which have not been genetically edited or otherwise genetically modified and are usually inbred and outbred strains developed from naturally occurring strains.
  • a "zinc finger DNA binding protein” (or binding domain) is a protein, or a domain within a larger protein, that binds DNA in a sequence-specific manner through one or more zinc fingers, which are regions of amino acid sequence within the binding domain whose structure is stabilized through coordination of a zinc ion.
  • the term zinc finger DNA binding protein is often abbreviated as zinc finger protein or ZFP.
  • a "selected" zinc finger protein or TALE is a protein not found in nature whose production results primarily from an empirical process such as phage display, interaction trap or hybrid selection. See e.g., U.S. Pat. No. 5,789,538; U.S. Pat. No. 5,925,523; U.S. Pat. No.
  • polynucleotide/polypeptide (a)"reference sequence", (b)”comparison window", (c) "sequence identity”, and (d) "percentage of sequence identity”.
  • reference sequence is a defined sequence used as a basis for sequence comparison with a polynucleotide/polypeptide of the present invention.
  • a reference sequence may be a subset or the entirety of a specified sequence; for example, as a segment of a full-length cDNA or gene sequence, or the complete cDNA or gene sequence.
  • comparison window includes reference to a contiguous and specified segment of a polynucleotide/polypeptide sequence, wherein the
  • polynucleotide/polypeptide sequence may be compared to a reference sequence and wherein the portion of the polynucleotide/polypeptide sequence in the comparison window may comprise additions or deletions (i.e., gaps) compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences.
  • the comparison window is at least 20 contiguous nucleotides/amino acids residues in length, and optionally can be 30, 40, 50, 100, or longer.
  • CLUSTAL program is well described by Higgins and Sharp, Gene 73 : 237-244 (1988); Higgins and Sharp, CABIOS 5: 151-153 (1989); Corpet, et al, Nucleic Acids Research 16: 10881-90 (1988); Huang, et al, Computer Applications in the Biosciences 8 : 155-65 (1992), and Pearson, et al, Methods in Molecular Biology 24: 307-331 (1994).
  • the BLAST family of programs that can be used for database similarity searches includes: BLASTN for nucleotide query sequences against nucleotide database sequences; BLASTX for nucleotide query sequences against protein database sequences; BLASTP for protein query sequences against protein database sequences; TBLASTN for protein query sequences against nucleotide database sequences; and TBLASTX for nucleotide query sequences against nucleotide database sequences.
  • the BLAST algorithm In addition to calculating percent sequence identity, the BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin & Altschul, Proc. Nat'l. Acad. Sci. USA 90: 5873-5877 (1993)).
  • a number of low-complexity filter programs can be employed to reduce such low-complexity alignments.
  • the SEG Wioten and Federhen, Comput. Chem., 17: 149-163 (1993)
  • XNU Caverie and States, Comput. Chem., 17: 191-201 (1993)
  • nucleotide and protein identity/similarity values provided herein are calculated using GAP (GCG Version 10) under default values.
  • GAP Global Alignment Program
  • GAP uses the algorithm of Needleman and Wunsch (J. Mol. Biol. 48: 443-453, 1970) to find the alignment of two complete sequences that maximizes the number of matches and minimizes the number of gaps.
  • GAP represents one member of the family of best alignments. There may be many members of this family, but no other member has a better quality.
  • GAP displays four figures of merit for alignments: Quality, Ratio, Identity, and Similarity.
  • the Quality is the metric maximized in order to align the sequences. Ratio is the quality divided by the number of bases in the shorter segment. Percent Identity is the percent of the symbols that actually match. Percent Similarity is the percent of the symbols that are similar. Symbols that are across from gaps are ignored. A similarity is scored when the scoring matrix value for a pair of symbols is greater than or equal to 0.50, the similarity threshold.
  • the scoring matrix used in Version 10 of the Wisconsin Genetics Software Package is BLOSUM62 (see Henikoff & Henikoff (1989) Proc. Natl. Acad. Sci. USA 89: 10915).
  • sequence identity in the context of two nucleic acid or polypeptide sequences includes reference to the residues in the two sequences which are the same when aligned for maximum correspondence over a specified comparison window.
  • sequence identity or “identity” in the context of two nucleic acid or polypeptide sequences includes reference to the residues in the two sequences which are the same when aligned for maximum correspondence over a specified comparison window.
  • Sequences which differ by such conservative substitutions are said to have "sequence similarity" or "similarity". Means for making this adjustment are well-known to those of skill in the art. Typically this involves scoring a conservative substitution as a partial rather than a full mismatch, thereby increasing the percentage sequence identity. Thus, for example, where an identical amino acid is given a score of 1 and a non-conservative substitution is given a score of zero, a conservative substitution is given a score between zero and 1.
  • the scoring of conservative substitutions may be calculated according to the algorithm of Meyers and Miller, Computer Applic. Biol. Sci., 4: 11-17 (1988), for example as implemented in the program PC/GENE (Intelligenetics, Mountain View, California, USA).
  • percentage of sequence identity means the value determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide sequence in the comparison window may comprise additions or deletions (i.e., gaps) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the identical nucleic acid base or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison and multiplying the result by 100 to yield the percentage of sequence identity.
  • CD 163 has 17 exons and the protein is composed of an extracellular region with 9 scavenger receptor cysteine-rich (SRCR) domains, a transmembrane segment, and a short cytoplasmic tail.
  • SRCR scavenger receptor cysteine-rich
  • CD 163 has a number of important functions, including acting as a haptoglobin- hemoglobin scavenger receptor. Elimination of free hemoglobin in the blood is an important function of CD 163 as the heme group can be very toxic (Kristiansen et al. 2001). CD 163 has a cytoplasmic tail that facilitates endocytosis. Mutation of this tail results in decreased haptoglobin-hemoglobin complex uptake (Nielsen et al. 2006).
  • CI 63 erythroblast adhesion
  • SRCR2 erythroblast adhesion
  • SRCRl-4 & 6-9 TWEAK receptor
  • SRCR5 bacterial receptor
  • SRCR5 African Swine Virus receptor
  • Van Gorp et al. 2010a a potential role as an immune-modulator
  • CD 163 is a member of the scavenger receptor cysteine-rich (SRCR) superfamily and consists of an intracellular domain and 9 extracellular SRCR domains.
  • SRCR scavenger receptor cysteine-rich
  • CD163 also serves as a receptor for tumor necrosis factor-like weak inducer of apoptosis (TWEAK: SRCR1- 4 & 6-9), a pathogen receptor (African Swine Fever Virus; bacteria: SRCR2), and erythroblast binding (SRCR2).
  • TWEAK tumor necrosis factor-like weak inducer of apoptosis
  • SRCR1- 4 & 6-9 a tumor necrosis factor-like weak inducer of apoptosis
  • pathogen receptor Africann Swine Fever Virus
  • bacteria SRCR2
  • SRCR2 erythroblast binding
  • CD 163 plays a role in infection by many different pathogens and therefore invention is not limited animals having reduced susceptibility to PRRSV infection, but also includes animals having reduced susceptibility to any pathogen which relies on CD 163 either for infection into a cell or for later replication and/or persistence in the cell.
  • the infection process of the PRRSV begins with initial binding to heparan sulfate on the surface of the alveolar macrophage. Prior to 2013 it was thought that secure binding then occurs to sialoadhesin (SIGLECl, also referred to as CD 169 or SN). The virus is then internalized via clatherin- mediated endocytosis. Another molecule, CD163, then facilitates the uncoating of the virus in the endosome (Van Breedam et al. 2010a). The viral genome is released and the cell infected.
  • SIGLECl sialoadhesin
  • Described herein are animals and offspring thereof and cells comprising at least one modified chromosomal sequence in a gene encoding a CD163 protein, e.g., an insertion or a deletion (“INDEL”), which confer improved or complete resistance to infection by a pathogen (e.g., PRRSV) upon the animal.
  • INDEL insertion or a deletion
  • Applicants have demonstrated that CD 163 is the critical gene in PRRSV infection and have created founder resistant animals and lines.
  • the present disclosure provides genetically modified animals, offspring thereof, or animal cells comprising at least one modified chromosomal sequence in a gene encoding a CD 163 protein.
  • This invention does not include inactivation or editing of the SIGLECl (CD 169) gene, which had previously been postulated as critical for PRRSV resistance.
  • the edited chromosomal sequence may be (1) inactivated, (2) modified, or (3) comprise an integrated sequence resulting in a null mutation.
  • An inactivated chromosomal sequence is altered such that a CD 163 protein function as it relates to PRRSV infection is impaired, reduced or eliminated.
  • a genetically edited animal comprising an inactivated chromosomal sequence may be termed a "knock out” or a "conditional knock out.”
  • a genetically edited animal comprising an integrated sequence may be termed a "knock in” or a "conditional knock in.”
  • a genetically edited animal comprising a modified chromosomal sequence may comprise a targeted point mutation(s) or other modification such that an altered protein product is produced.
  • the process can comprise introducing into an embryo or cell at least one RNA molecule encoding a targeted zinc finger nuclease and, optionally, at least one accessory polynucleotide.
  • the method further comprises incubating the embryo or cell to allow expression of the zinc finger nuclease, wherein a double-stranded break introduced into the targeted chromosomal sequence by the zinc finger nuclease is repaired by an error-prone non-homologous end-joining DNA repair process or a homology-directed DNA repair process.
  • the method of editing chromosomal sequences encoding a protein associated with germline development using targeted zinc finger nuclease technology is rapid, precise, and highly efficient.
  • the process can comprise using a CRISPR/Cas9 system to modify the genomic sequence
  • the protein can be delivered directly to a cell, an mRNA that encodes Cas9 can be delivery to a cell, or a gene that provide for expression of an mRNA that encodes Cas9 can be delivered to a cell.
  • target specific crRNA and a tracrRNA can be delivered directly to a cell or target specific gRNA(s) can be to a cell (these RNAs can alternatively be produced by a gene constructed to express these RNAs). Selection of target sites and designed of crRNA/gRNA are well known in the art. Construction and cloning of gRNAs can be found at http://www.genome- engineering.org/crispr/wp-content/uploads/2014/2017CRISPR-Reagent-Description- Rev20140509.pdf.
  • At least one CD 163 locus can be used as a target site for the site-specific editing.
  • the site-specific editing can include insertion of an exogenous nucleic acid (e.g., a nucleic acid comprising a nucleotide sequence encoding a polypeptide of interest) or deletions of nucleic acids from the locus.
  • an exogenous nucleic acid e.g., a nucleic acid comprising a nucleotide sequence encoding a polypeptide of interest
  • deletions of nucleic acids from the locus e.g., integration of the exogenous nucleic acid and/or deletion of part of the genomic nucleic acid can modify the locus so as to produce a disrupted (i.e., reduced activity of CD 163 protein) CD 163 gene.
  • non-human animals offspring of said animals, and animal cells comprising at least one modified chromosomal sequence in a gene encoding a CD 163 protein.
  • the modification in the chromosomal sequence in the gene encoding the CD 163 protein reduces the susceptibility of the animal, offspring, or cell to infection by a pathogen (e.g., a virus such as PRRSV), as compared to the susceptibility of an animal, offspring, or cell that does not comprise a modified chromosomal sequence in a gene encoding a CD 163 protein to infection by the pathogen.
  • a pathogen e.g., a virus such as PRRSV
  • the animal or offspring can be an embryo, a juvenile, or an adult.
  • the cell can comprise an embryonic cell, a cell derived from a juvenile animal, or a cell derived from an adult animal.
  • the animal or offspring can comprise a domesticated animal.
  • the cell can comprise a cell derived from a domesticated animal.
  • the domesticated animal can comprise a livestock animal, for example a porcine animal, a bovine animal (e.g., beef cattle or dairy cattle), an ovine animal, a caprine animal, an equine animal (e.g., a horse or a donkey), buffalo, camels, or an avian animal (e.g., a chicken, a turkey, a duck, a goose, a guinea fowl, or a squab).
  • the livestock animal is preferably a bovine or porcine animal, and most preferably is a porcine animal.
  • the animal or offspring can comprise a genetically edited animal.
  • the cell can comprise a genetically edited cell.
  • the animal or cell can be genetically edited using a homing endonuclease.
  • the homing endonuclease can be a naturally occurring endonuclease but is preferably a rationally designed, non-naturally occurring homing endonuclease that has a DNA recognition sequence that has been designed so that the endonuclease targets a chromosomal sequence in gene encoding a CD 163 protein.
  • the homing endonuclease can be a designed homing endonuclease.
  • the homing endonuclease can comprise, for example, a Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) /Cas9 system, a Transcription Activator-Like Effector Nuclease (TALEN), a Zinc Finger Nuclease (ZFN), a recombinase fusion protein, a meganuclease, or a combination thereof).
  • CRISPR Clustered Regularly Interspaced Short Palindromic Repeats
  • TALEN Transcription Activator-Like Effector Nuclease
  • ZFN Zinc Finger Nuclease
  • the animal or cell is preferably an animal or cell that has been genetically edited using a CRISPR/Cas9 system.
  • the genetically edited animal, offspring thereof, or the genetically edited cell preferably displays increased resistance to a pathogen (e.g., a virus such as PRRSV) as compared to a non-edited animal.
  • a pathogen e.g., a virus such as PRRSV
  • the animal, offspring, or cell can be heterozygous for the modified chromosomal sequence.
  • the animal, offspring, or cell can be homozygous for the modified chromosomal sequence.
  • the modified chromosomal sequence can comprise an insertion in the gene encoding the CD 163 protein, a deletion in the gene encoding the CD 163 protein, or a combination thereof.
  • the modified chromosomal sequence can comprise a deletion in the gene encoding the CD 163 protein (e.g., an in-frame deletion).
  • the modified chromosomal sequence can comprise an insertion in the gene encoding the CD 163 protein.
  • the insertion or deletion can cause CD 163 protein production or activity to be reduced, as compared to CD 163 protein production or activity in an animal, offspring, or cell that lacks the insertion or deletion.
  • the insertion or deletion can result in production of substantially no functional CD 163 protein by the animal, offspring, or cell.
  • substantially no functional CD 163 protein it is meant that the level of CD 163 protein in the animal, offspring, or cell is undetectable, or if detectable, is at least about 90% lower than the level observed in an animal, offspring, or cell that does not comprise the insertion or deletion.
  • the modified chromosomal sequence can comprise a modification in exon 7 of the gene encoding the CD 163 protein, exon 8 of the gene encoding the CD 163 protein, an intron that is contiguous with exon 7 or exon 8 of the gene encoding the CD 163 protein, or a combination thereof.
  • the modified chromosomal sequence suitably comprises a modification in exon 7 of the gene encoding the CD 163 protein.
  • the modification in exon 7 of the gene encoding the CD 163 protein can comprise a deletion (e.g., an in-frame deletion in exon 7).
  • the modification in exon 7 of the gene encoding the CD 163 protein can comprise an insertion.
  • the modification can comprise an 11 base pair deletion from nucleotide 3,137 to nucleotide 3, 147 as compared to reference sequence SEQ ID NO: 47; a 2 base pair insertion between nucleotides 3, 149 and 3, 150 as compared to reference sequence SEQ ID NO: 47, with a 377 base pair deletion from nucleotide 2,573 to nucleotide 2,949 as compared to reference sequence SEQ ID NO: 47 on the same allele; a 124 base pair deletion from nucleotide 3,024 to nucleotide 3, 147 as compared to reference sequence SEQ ID NO: 47; a 123 base pair deletion from nucleotide 3,024 to nucleotide 3, 146 as compared to reference sequence SEQ ID NO: 47; a 1 base pair insertion between nucleotides
  • nucleotide 3, 149 as compared to reference sequence SEQ ID NO: 47; a 1280 base pair deletion from nucleotide 2,818 to nucleotide 4,097 as compared to reference sequence SEQ ID NO: 47; a 1373 base pair deletion from nucleotide 2,724 to nucleotide 4,096 as compared to reference sequence SEQ ID NO: 47; a 1467 base pair deletion from nucleotide 2,431 to nucleotide 3,897 as compared to reference sequence SEQ ID NO: 47; a 1930 base pair deletion from nucleotide 488 to nucleotide 2,417 as compared to reference sequence SEQ ID NO: 47, wherein the deleted sequence is replaced with a 12 base pair insertion beginning at nucleotide 488, and wherein there is a further 129 base pair deletion in exon 7 from nucleotide 3,044 to nucleotide 3, 172 as compared to reference sequence SEQ ID NO: 47; a 28 base pair deletion from nucleo
  • SEQ ID NO: 47 provides the nucleotide sequence for the region beginning 3000 base pairs (bp) upstream of exon 7 of the wild-type porcine CD 163 gene to the last base of exon 10 of this gene. SEQ ID NO: 47 is used as a reference sequence herein and is shown in Figure 16.
  • the porcine animal or cell comprises the 2 base pair insertion between nucleotides 3, 149 and 3, 150 as compared to reference sequence SEQ ID NO: 47
  • the 2 base pair insertion can comprise insertion of the dinucleotide AG.
  • the porcine animal or cell comprises the 1 base pair insertion between nucleotides 3, 147 and 3, 148 as compared to reference sequence SEQ ID NO: 47
  • the 1 base pair insertion can comprise insertion of a single adenine residue.
  • the 7 base pair insertion can comprise insertion of the sequence TACTACT (SEQ ID NO: 1 15).
  • the porcine animal or cell comprises the 1930 base pair deletion from nucleotide 488 to nucleotide 2,417 as compared to reference sequence SEQ ID NO: 47, wherein the deleted sequence is replaced with a 12 base pair insertion beginning at nucleotide 488, and wherein there is a further 129 base pair deletion in exon 7 from nucleotide 3,044 to nucleotide 3, 172 as compared to reference sequence SEQ ID NO: 47
  • the 12 base pair insertion can comprise insertion of the sequence TGTGGAGAATTC (SEQ ID NO: 116).
  • the porcine animal or cell comprises the 1382 base pair deletion from nucleotide 3, 113 to nucleotide 4,494 as compared to reference sequence SEQ ID NO: 47, wherein the deleted sequence is replaced with an 1 1 base pair insertion beginning at nucleotide 3, 113, the 1 1 base pair insertion can comprise insertion of the sequence AGCCAGCGTGC (SEQ ID NO: 117).
  • the deletion preferably comprises an in- frame deletion.
  • In- frame deletions are deletions that do not cause a shift in the triplet reading frame, and thus result a protein product that has an internal deletion of one or more amino acids, but that is not truncated. Deletions of three base pairs or multiples of three base pairs within an exon can result in an in-frame mutation, assuming that splicing occurs correctly.
  • INDELs described herein for porcine animals and cells are expected to result in in- frame deletions, since the deletions within exon 7 of the porcine CD 163 gene is a multiple of three: the 1506 base pair deletion from nucleotide 1,525 to nucleotide 3,030 as compared to reference sequence SEQ ID NO: 47; the 1930 base pair deletion from nucleotide 488 to nucleotide 2,417 as compared to reference sequence SEQ ID NO: 47, wherein the deleted sequence is replaced with a 12 base pair insertion beginning at nucleotide 488, and wherein there is a further 129 base pair deletion in exon 7 from nucleotide 3,044 to nucleotide 3,172 as compared to reference sequence SEQ ID NO: 47; the 1373 base pair deletion from nucleotide 2,724 to nucleotide 4,096 as compared to reference sequence SEQ ID NO: 47; the 123 base pair deletion from nucleotide 3,024 to nucleotide 3,
  • the insertion or deletion in the gene encoding the CD 163 protein can comprise an in-frame deletion in exon 7 selected from the group consisting of the 1506 base pair deletion from nucleotide 1,525 to nucleotide 3,030 as compared to reference sequence SEQ ID NO: 47; the 1930 base pair deletion from nucleotide 488 to nucleotide 2,417 as compared to reference sequence SEQ ID NO: 47, wherein the deleted sequence is replaced with a 12 base pair insertion beginning at nucleotide 488, and wherein there is a further 129 base pair deletion in exon 7 from nucleotide 3,044 to nucleotide 3,172 as compared to reference sequence SEQ ID NO: 47; the 1373 base pair deletion from nucleotide 2,724 to nucleotide 4,096 as compared to reference sequence SEQ ID NO: 47; the 123 base pair deletion from nucleotide 3,024 to nucleotide 3, 146 as
  • the porcine animal or cell can comprise an insertion or deletion selected from the group consisting of: the 2 base pair insertion between nucleotides 3, 149 and 3, 150 as compared to reference sequence SEQ ID NO: 47, with the 377 base pair deletion from nucleotide 2,573 to nucleotide 2,949 as compared to reference sequence SEQ ID NO: 47 on the same allele; the 28 base pair deletion from nucleotide 3, 145 to nucleotide 3, 172 as compared to reference sequence SEQ ID NO: 47; and a combination thereof.
  • the animal or cell can comprise the 2 base pair insertion between nucleotides 3, 149 and 3, 150 as compared to reference sequence SEQ ID NO: 47, with the 377 base pair deletion from nucleotide 2,573 to nucleotide 2,949 as compared to reference sequence SEQ ID NO: 47 on the same allele.
  • the animal or cell can comprise the 28 base pair deletion from nucleotide 3, 145 to nucleotide 3, 172 as compared to reference sequence SEQ ID NO: 47.
  • the porcine animal or cell can comprise the 7 base pair insertion between nucleotide 3, 148 and nucleotide 3,149 as compared to reference sequence SEQ ID NO: 47 and the 11 base pair deletion from nucleotide 3, 137 to nucleotide 3, 147 as compared to reference sequence SEQ ID NO: 47.
  • the porcine animals or cells that comprise any of the insertions or deletions described above can comprise a chromosomal sequence having at a high degree of sequence identity to SEQ ID NO: 47 outside of the insertion or deletion.
  • the porcine animal or cell can comprise a chromosomal sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, at least 99.9%, or 100% sequence identity to SEQ ID NO: 47 in the regions of the chromosomal sequence outside of the insertion or deletion.
  • the porcine animal or cell can comprise a chromosomal sequence comprising SEQ ID NO: 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 11 1, 112, 113, or 114.
  • SEQ ID NOs. 98-114 provide nucleotide sequences for a region corresponding to the region of wild-type porcine CD 163 provided in SEQ ID NO:47, and include the insertions or deletions in the porcine CD 163 chromosomal sequence that are described herein.
  • the porcine animal or cell can comprise a chromosomal sequence comprising SEQ ID NO: 98, 101, 105, 109, 1 10, 1 12, 113, or 114.
  • SEQ ID NOs: 98, 101, 105, 109, 110, 112, 113, or 1 14 provide the nucleotide sequences for in-frame deletions in exon 7 of the porcine CD 163 chromosomal sequence.
  • the porcine animal or cell can comprise a chromosomal sequence comprising SEQ ID NO: 103 or 1 11.
  • the porcine animal or cell can comprise the 11 base pair deletion in one allele of the gene encoding the CD163 protein and the 2 base pair insertion with the 377 base pair deletion in the other allele of the gene encoding the CD 163 protein.
  • the porcine animal or cell can comprise the 124 base pair deletion in one allele of the gene encoding the CD 163 protein and the 123 base pair deletion in the other allele of the gene encoding the CD 163 protein.
  • the porcine animal or cell can comprise the 1 base pair insertion.
  • the porcine animal or cell can comprise the 130 base pair deletion in one allele of the gene encoding the CD 163 protein and the 132 base pair deletion in the other allele of the gene encoding the CD 163 protein.
  • the porcine animal or cell can comprise the 1506 base pair deletion.
  • the porcine animal or cell can comprise the 7 base pair insertion.
  • the porcine animal or cell can comprise the 1280 base pair deletion in one allele of the gene encoding the CD 163 protein and the 1373 base pair deletion in the other allele of the gene encoding the CD 163 protein.
  • the porcine animal or cell can comprise the 1467 base pair deletion.
  • the porcine animal or cell can comprise the 1930 base pair intron 6 deletion from nucleotide 488 to nucleotide 2,417, with a 12 base pair addition at nucleotide 4,488 and an additional 129 base pair deletion in exon 7.
  • the porcine animal or cell can comprise the 28 base pair deletion in one allele of the gene encoding the CD 163 protein and the 1387 base pair deletion in the other allele of the gene encoding the CD 163 protein.
  • the porcine animal or cell can comprise the 1382 base pair deletion with the 1 1 base pair insertion in one allele of the gene encoding the CD 163 protein and the 1720 base pair deletion in the other allele of the gene encoding the CD 163 protein.
  • any of the cells comprising the at least one modified chromosomal sequence in a gene encoding a CD 163 protein can comprise a sperm cell.
  • any of these cells can comprise an egg cell (e.g., a fertilized egg).
  • any of the cells comprising the at least one modified chromosomal sequence in a gene encoding a CD 163 protein can comprise a somatic cell.
  • any of the cells can comprise a fibroblast (e.g., a fetal fibroblast).
  • Site-specific integration of an exogenous nucleic acid at a CD 163 locus may be accomplished by any technique known to those of skill in the art.
  • integration of an exogenous nucleic acid at a CD 163 locus can comprise contacting a cell (e.g., an isolated cell or a cell in a tissue or organism) with a nucleic acid molecule comprising the exogenous nucleic acid.
  • a nucleic acid molecule can comprise nucleotide sequences flanking the exogenous nucleic acid that facilitate homologous recombination between the nucleic acid molecule and at least one CD 163 locus.
  • nucleotide sequences flanking the exogenous nucleic acid that facilitate homologous recombination can be complementary to endogenous nucleotides of the CD 163 locus.
  • nucleotide sequences flanking the exogenous nucleic acid that facilitate homologous recombination can be complementary to previously integrated exogenous nucleotides.
  • a plurality of exogenous nucleic acids can be integrated at one CD 163 locus, such as in gene stacking.
  • Integration of a nucleic acid at a CD 163 locus can be facilitated (e.g., catalysed) by endogenous cellular machinery of a host cell, such as, for example and without limitation, endogenous DNA and endogenous recombinase enzymes.
  • endogenous cellular machinery of a host cell such as, for example and without limitation, endogenous DNA and endogenous recombinase enzymes.
  • integration of a nucleic acid at a CD163 locus can be facilitated by one or more factors (e.g., polypeptides) that are provided to a host cell.
  • nuclease(s), recombinase(s), and/or ligase polypeptides may be provided (either independently or as part of a chimeric polypeptide) by contacting the polypeptides with the host cell, or by expressing the polypeptides within the host cell.
  • a nucleic acid comprising a nucleotide sequence encoding at least one nuclease, recombinase, and/or ligase polypeptide may be introduced into the host cell, either concurrently or sequentially with a nucleic acid to be integrated site-specifically at a CD 163 locus, wherein the at least one nuclease, recombinase, and/or ligase polypeptide is expressed from the nucleotide sequence in the host cell.
  • Site-specific integration can be accomplished by utilizing factors that are capable of recognizing and binding to particular nucleotide sequences, for example, in the genome of a host organism. For instance, many proteins comprise polypeptide domains that are capable of recognizing and binding to DNA in a site-specific manner.
  • a DNA sequence that is recognized by a DNA-binding polypeptide may be referred to as a "target" sequence.
  • Polypeptide domains that are capable of recognizing and binding to DNA in a site-specific manner generally fold correctly and function independently to bind DNA in a site-specific manner, even when expressed in a polypeptide other than the protein from which the domain was originally isolated.
  • target sequences for recognition and binding by DNA-binding polypeptides are generally able to be recognized and bound by such polypeptides, even when present in large DNA structures (e.g., a chromosome), particularly when the site where the target sequence is located is one known to be accessible to soluble cellular proteins (e.g., a gene).
  • DNA-binding polypeptides identified from proteins that exist in nature typically bind to a discrete nucleotide sequence or motif (e.g., a consensus recognition sequence), methods exist and are known in the art for modifying many such DNA-binding polypeptides to recognize a different nucleotide sequence or motif.
  • DNA-binding polypeptides include, for example and without limitation: zinc finger DNA-binding domains; leucine zippers; UPA DNA-binding domains; GAL4; TAL; LexA; Tet repressors; Lacl; and steroid hormone receptors.
  • the DNA-binding polypeptide can be a zinc finger.
  • Individual zinc finger motifs can be designed to target and bind specifically to any of a large range of DNA sites.
  • Canonical Cys 2 His 2 (as well as non-canonical CyssHis) zinc finger polypeptides bind DNA by inserting an a-helix into the major groove of the target DNA double helix.
  • Recognition of DNA by a zinc finger is modular; each finger contacts primarily three consecutive base pairs in the target, and a few key residues in the polypeptide mediate recognition.
  • the DNA-binding specificity of the targeting endonuclease may be further increased (and hence the specificity of any gene regulatory effects conferred thereby may also be increased). See, e.g., Urnov et al. (2005) Nature 435:646-51.
  • one or more zinc finger DNA-binding polypeptides may be engineered and utilized such that a targeting endonuclease introduced into a host cell interacts with a DNA sequence that is unique within the genome of the host cell.
  • the zinc finger protein is non-naturally occurring in that it is engineered to bind to a target site of choice. See, for example, Beerli et al. (2002) Nature Biotechnol. 20: 135-141 ; Pabo et al. (2001) Ann. Rev. Biochem. 70:313-340; Isalan et al. (2001) Nature Biotechnol. 19:656-660; Segal et al. (2001) Curr. Opin. Biotechnol. 12:632-637; Choo et al. (2000) Curr. Opin. Struct. Biol. 10:41 1-416; U.S. Pat. Nos.
  • An engineered zinc finger binding domain can have a novel binding specificity, compared to a naturally-occurring zinc finger protein.
  • Engineering methods include, but are not limited to, rational design and various types of selection. Rational design includes, for example, using databases comprising triplet (or quadruplet) nucleotide sequences and individual zinc finger amino acid sequences, in which each triplet or quadruplet nucleotide sequence is associated with one or more amino acid sequences of zinc fingers which bind the particular triplet or quadruplet sequence. See, for example, U.S. Pat. Nos. 6,453,242 and 6,534,261.
  • Exemplary selection methods including phage display and two-hybrid systems, are disclosed in U.S. Pat. Nos. 5,789,538; 5,925,523; 6,007,988; 6,013,453; 6,410,248;
  • zinc finger domains and/or multi-fingered zinc finger proteins may be linked together using any suitable linker sequences, including for example, linkers of 5 or more amino acids in length. See, also, U.S. Pat. Nos. 6,479,626; 6,903, 185; and 7,153,949 for exemplary linker sequences 6 or more amino acids in length.
  • the proteins described herein may include any combination of suitable linkers between the individual zinc fingers of the protein.
  • zinc finger domains and/or multi-fingered zinc finger proteins may be linked together using any suitable linker sequences, including for example, linkers of 5 or more amino acids in length. See, also, U.S. Pat. Nos. 6,479,626; 6,903, 185; and 7,153,949 for exemplary linker sequences 6 or more amino acids in length.
  • the proteins described herein may include any combination of suitable linkers between the individual zinc fingers of the protein.
  • the DNA-binding polypeptide is a DNA-binding domain from GAL4.
  • GAL4 is a modular trans activator in Saccharomyces cerevisiae, but it also operates as a transactivator in many other organisms. See, e.g., Sadowski et al. (1988) Nature 335:563-4.
  • the expression of genes encoding enzymes of the galactose metabolic pathway in S. cerevisiae is stringently regulated by the available carbon source. Johnston (1987) Microbiol. Rev. 51 :458-76. Transcriptional control of these metabolic enzymes is mediated by the interaction between the positive regulatory protein, GAL4, and a 17 bp symmetrical DNA sequence to which GAL4 specifically binds (the upstream activation sequence (UAS)).
  • UAS upstream activation sequence
  • Native GAL4 consists of 881 amino acid residues, with a molecular weight of 99 kDa. GAL4 comprises functionally autonomous domains, the combined activities of which account for activity of GAL4 in vivo. Ma and Ptashne (1987) Cell 48:847-53); Brent and Ptashne (1985) Cell 43(3 Pt 2):729-36. The N-terminal 65 amino acids of GAL4 comprise the GAL4 DNA-binding domain. Keegan et al. (1986) Science 231 :699-704; Johnston (1987) Nature 328:353-5. Sequence-specific binding requires the presence of a divalent cation coordinated by 6 Cys residues present in the DNA binding domain.
  • the coordinated cation- containing domain interacts with and recognizes a conserved CCG triplet at each end of the 17 bp UAS via direct contacts with the major groove of the DNA helix.
  • the DNA-binding function of the protein positions C-terminal
  • transcriptional activating domains in the vicinity of the promoter, such that the activating domains can direct transcription.
  • Additional DNA-binding polypeptides that can be used include, for example and without limitation, a binding sequence from a AVRBS3 -inducible gene; a consensus binding sequence from a AVRBS3 -inducible gene or synthetic binding sequence engineered therefrom (e.g., UPA DNA-binding domain); TAL; LexA (see, e.g., Brent & Ptashne (1985), supra); LacR (see, e.g., Labow et al. (1990) Mol. Cell. Biol. 10:3343-56; Bairn et al. (1991) Proc. Natl. Acad. Sci.
  • the DNA-binding domain of one or more of the nucleases used in the methods and compositions described herein can comprise a naturally occurring or engineered (non- naturally occurring) TAL effector DNA binding domain. See, e.g., U.S. Patent Publication No. 201 1/0301073.
  • the nuclease can comprise a CRISPR Cas system.
  • CRISPR Cas system Such systems include a CRISPR (clustered regularly interspaced short palindromic repeats) locus, which encodes RNA components of the system, and a Cas (CRISPR-associated) locus, which encodes proteins (Jansen et al, 2002. Mol. Microbiol. 43 : 1565-1575; Makarova et al, 2002. Nucleic Acids Res. 30: 482-496; Makarova et al, 2006. Biol. Direct 1 : 7; Haft et al, 2005. PLoS Comput. Biol. 1 : e60).
  • CRISPR loci in microbial hosts contain a combination of Cas genes as well as non-coding RNA elements capable of programming the specificity of the CRISPR- mediated nucleic acid cleavage.
  • the Type II CRISPR is one of the most well characterized systems and carries out targeted DNA double-strand break in nature in four sequential steps.
  • the mature crRNA:tracrRNA complex directs Cas9 to the target DNA via Wastson-Crick base-pairing between the spacer on the crRNA and the protospacer on the target DNA next to the protospacer adjacent motif (PAM), an additional requirement for target recognition.
  • Cas9 mediates cleavage of target DNA to create a double-stranded break within the protospacer.
  • the two non-coding RNAs can be replaced by a single RNA referred to as a guide RNA (gRNA).
  • Activity of the CRISPR Cas system comprises of three steps: (i) insertion of exogenous DNA sequences into the CRISPR array to prevent future attacks, in a process called "adaptation,” (ii) expression of the relevant proteins, as well as expression and processing of the array, followed by (iii) RNA-mediated interference with the foreign nucleic acid.
  • a process called "adaptation” insertion of exogenous DNA sequences into the CRISPR array to prevent future attacks, in a process called "adaptation,"
  • expression of the relevant proteins as well as expression and processing of the array, followed by (iii) RNA-mediated interference with the foreign nucleic acid.
  • RNA-mediated interference with the foreign nucleic acid In the bacterial cell, several Cas proteins are involved with the natural function of the CRISPR/Cas system and serve roles in functions such as insertion of the foreign DNA etc.
  • the Cas protein can be a "functional derivative” of a naturally occurring Cas protein.
  • a “functional derivative” of a native sequence polypeptide is a compound having a qualitative biological property in common with a native sequence polypeptide.
  • “Functional derivatives” include, but are not limited to, fragments of a native sequence and derivatives of a native sequence polypeptide and its fragments, provided that they have a biological activity in common with a corresponding native sequence polypeptide.
  • a biological activity contemplated herein is the ability of the functional derivative to hydro lyze a DNA substrate into fragments.
  • the term “derivative” encompasses both amino acid sequence variants of polypeptide, covalent modifications, and fusions thereof.
  • Suitable derivatives of a Cas polypeptide or a fragment thereof include but are not limited to mutants, fusions, covalent modifications of Cas protein or a fragment thereof.
  • Cas protein which includes Cas protein or a fragment thereof, as well as derivatives of Cas protein or a fragment thereof, may be obtainable from a cell or synthesized chemically or by a combination of these two procedures.
  • the cell may be a cell that naturally produces Cas protein, or a cell that naturally produces Cas protein and is genetically engineered to produce the endogenous Cas protein at a higher expression level or to produce a Cas protein from an exogenously introduced nucleic acid, which nucleic acid encodes a Cas that is same or different from the endogenous Cas.
  • the cell does not naturally produce Cas protein and is genetically engineered to produce a Cas protein.
  • a DNA-binding polypeptide can specifically recognize and bind to a target nucleotide sequence comprised within a genomic nucleic acid of a host organism. Any number of discrete instances of the target nucleotide sequence may be found in the host genome in some examples.
  • the target nucleotide sequence may be rare within the genome of the organism (e.g., fewer than about 10, about 9, about 8, about 7, about 6, about 5, about 4, about 3, about 2, or about 1 copy(ies) of the target sequence may exist in the genome).
  • the target nucleotide sequence may be located at a unique site within the genome of the organism.
  • Target nucleotide sequences may be, for example and without limitation, randomly dispersed throughout the genome with respect to one another; located in different linkage groups in the genome; located in the same linkage group; located on different chromosomes; located on the same chromosome; located in the genome at sites that are expressed under similar conditions in the organism (e.g., under the control of the same, or substantially functionally identical, regulatory factors); and located closely to one another in the genome (e.g., target sequences may be comprised within nucleic acids integrated as concatemers at genomic loci).
  • a DNA-binding polypeptide that specifically recognizes and binds to a target nucleotide sequence can be comprised within a chimeric polypeptide, so as to confer specific binding to the target sequence upon the chimeric polypeptide.
  • a chimeric polypeptide may comprise, for example and without limitation, nuclease, recombinase, and/or ligase polypeptides, as these polypeptides are described above.
  • Chimeric polypeptides comprising a DNA-binding polypeptide and a nuclease, recombinase, and/or ligase polypeptide may also comprise other functional polypeptide motifs and/or domains, such as for example and without limitation: a spacer sequence positioned between the functional polypeptides in the chimeric protein; a leader peptide; a peptide that targets the fusion protein to an organelle (e.g., the nucleus); polypeptides that are cleaved by a cellular enzyme; peptide tags (e.g., Myc, His, etc.); and other amino acid sequences that do not interfere with the function of the chimeric polypeptide.
  • a spacer sequence positioned between the functional polypeptides in the chimeric protein
  • a leader peptide e that targets the fusion protein to an organelle (e.g., the nucleus)
  • polypeptides that are cleaved by a cellular enzyme
  • Functional polypeptides in a chimeric polypeptide may be operatively linked.
  • Functional polypeptides of a chimeric polypeptide can be operatively linked by their expression from a single polynucleotide encoding at least the functional polypeptides ligated to each other in-frame, so as to create a chimeric gene encoding a chimeric protein.
  • the functional polypeptides of a chimeric polypeptide can be operatively linked by other means, such as by cross-linkage of independently expressed polypeptides.
  • a DNA-binding polypeptide, or guide RNA that specifically recognizes and binds to a target nucleotide sequence can be comprised within a natural isolated protein (or mutant thereof), wherein the natural isolated protein or mutant thereof also comprises a nuclease polypeptide (and may also comprise a recombinase and/or ligase polypeptide).
  • isolated proteins include TALENs, recombinases (e.g., Cre, Hin, Tre, and FLP recombinase), RNA-guided CRISPR/Cas9, and meganucleases.
  • targeting endonuclease refers to natural or engineered isolated proteins and mutants thereof that comprise a DNA-binding polypeptide or guide RNA and a nuclease polypeptide, as well as to chimeric polypeptides comprising a DNA- binding polypeptide or guide RNA and a nuclease.
  • Any targeting endonuclease comprising a DNA-binding polypeptide or guide RNA that specifically recognizes and binds to a target nucleotide sequence comprised within a CD 163 locus (e.g., either because the target sequence is comprised within the native sequence at the locus, or because the target sequence has been introduced into the locus, for example, by recombination) can be used.
  • chimeric polypeptides include, without limitation, combinations of the following polypeptides: zinc finger DNA-binding polypeptides; a Fokl nuclease polypeptide; TALE domains; leucine zippers; transcription factor DNA-binding motifs; and DNA recognition and/or cleavage domains isolated from, for example and without limitation, a TALEN, a recombinase (e.g., Cre, Hin, RecA, Tre, and FLP recombinases), RNA- guided CRISPR/Cas9, a meganuclease; and others known to those in the art.
  • TALEN a recombinase
  • Cre Cre, Hin, RecA, Tre, and FLP recombinases
  • CRISPR/Cas9 RNA- guided CRISPR/Cas9
  • meganuclease a meganuclease
  • Chimeric polypeptides may be engineered by methods known to those of skill in the art to alter the recognition sequence of a DNA-binding polypeptide comprised within the chimeric polypeptide, so as to target the chimeric polypeptide to a particular nucleotide sequence of interest.
  • the chimeric polypeptide can comprise a DNA-binding domain (e.g., zinc finger, TAL-effector domain, etc.) and a nuclease (cleavage) domain.
  • the cleavage domain may be heterologous to the DNA-binding domain, for example a zinc finger DNA-binding domain and a cleavage domain from a nuclease or a TALEN DNA-binding domain and a cleavage domain, or meganuclease DNA-binding domain and cleavage domain from a different nuclease.
  • Heterologous cleavage domains can be obtained from any endonuclease or exonuclease.
  • Exemplary endonucleases from which a cleavage domain can be derived include, but are not limited to, restriction endonucleases and homing endonucleases. See, for example, 2002-2003 Catalogue, New England Biolabs, Beverly, Mass.; and Belfort et al. (1997) Nucleic Acids Res. 25:3379-3388. Additional enzymes which cleave DNA are known (e.g., 51 Nuclease; mung bean nuclease; pancreatic DNase I; micrococcal nuclease; yeast HO endonuclease; see also Linn et al. (eds.) Nucleases, Cold Spring Harbor Laboratory Press, 1993). One or more of these enzymes (or functional fragments thereof) can be used as a source of cleavage domains and cleavage half-domains.
  • a cleavage half-domain can be derived from any nuclease or portion thereof, as set forth above, that requires dimerization for cleavage activity.
  • two fusion proteins are required for cleavage if the fusion proteins comprise cleavage half-domains.
  • a single protein comprising two cleavage half-domains can be used.
  • the two cleavage half-domains can be derived from the same endonuclease (or functional fragments thereof), or each cleavage half-domain can be derived from a different endonuclease (or functional fragments thereof).
  • the target sites for the two fusion proteins are preferably disposed, with respect to each other, such that binding of the two fusion proteins to their respective target sites places the cleavage half-domains in a spatial orientation to each other that allows the cleavage half-domains to form a functional cleavage domain, e.g., by dimerizing.
  • the near edges of the target sites can be separated by 5-8 nucleotides or by 15-18 nucleotides.
  • any integral number of nucleotides, or nucleotide pairs can intervene between two target sites (e.g., from 2 to 50 nucleotide pairs or more).
  • the site of cleavage lies between the target sites.
  • Restriction endonucleases are present in many species and are capable of sequence-specific binding to DNA (at a recognition site), and cleaving DNA at or near the site of binding, for example, such that one or more exogenous sequences
  • Type IIS restriction enzymes
  • Fok I catalyses double-stranded cleavage of DNA, at 9 nucleotides from its recognition site on one strand and 13 nucleotides from its recognition site on the other. See, for example, U.S. Pat. Nos. 5,356,802; 5,436, 150 and 5,487,994; as well as Li et al. (1992) Proc. Natl. Acad. Sci. USA 89:4275-4279; Li et al.
  • fusion proteins can comprise the cleavage domain (or cleavage half-domain) from at least one Type IIS restriction enzyme and one or more zinc finger binding domains, which may or may not be engineered.
  • An exemplary Type IIS restriction enzyme whose cleavage domain is separable from the binding domain, is Fok I. This particular enzyme is active as a dimer.
  • the portion of the Fok I enzyme used in the disclosed fusion proteins is considered a cleavage half-domain.
  • two fusion proteins, each comprising a Fokl cleavage half-domain can be used to reconstitute a catalytically active cleavage domain.
  • a single polypeptide molecule containing a DNA binding domain and two Fok I cleavage half-domains can also be used.
  • a cleavage domain or cleavage half-domain can be any portion of a protein that retains cleavage activity, or that retains the ability to multimerize (e.g., dimerize) to form a functional cleavage domain.
  • Additional restriction enzymes also contain separable binding and cleavage domains, and these are contemplated by the present disclosure. See, for example, Roberts et al. (2003) Nucleic Acids Res. 31 :418-420.
  • the cleavage domain can comprise one or more engineered cleavage half- domain (also referred to as dimerization domain mutants) that minimize or prevent
  • nucleases may be assembled in vivo at the nucleic acid target site using so-called "split-enzyme” technology (see e.g. U.S. Patent Publication No. 20090068164).
  • split-enzyme e.g. U.S. Patent Publication No. 20090068164.
  • Components of such split enzymes may be expressed either on separate expression constructs, or can be linked in one open reading frame where the individual components are separated, for example, by a self-cleaving 2A peptide or IRES sequence.
  • Components may be individual zinc finger binding domains or domains of a meganuclease nucleic acid binding domain.
  • a chimeric polypeptide can comprise a custom-designed zinc finger nuclease (ZFN) that may be designed to deliver a targeted site-specific double-strand DNA break into which an exogenous nucleic acid, or donor DNA, may be integrated (see US Patent publication 2010/0257638).
  • ZFNs are chimeric polypeptides containing a non-specific cleavage domain from a restriction endonuclease (for example, Fokl) and a zinc finger DNA-binding domain polypeptide. See, e.g., Huang et al. (1996) J. Protein Chem. 15:481-9; Kim et al. (1997a) Proc. Natl. Acad. Sci.
  • the ZFNs can comprise non-canonical zinc finger DNA binding domains (see US Patent publication 2008/0182332).
  • the Fokl restriction endonuclease must dimerize via the nuclease domain in order to cleave DNA and introduce a double-strand break. Consequently, ZFNs containing a nuclease domain from such an endonuclease also require dimerization of the nuclease domain in order to cleave target DNA.
  • Dimerization of the ZFN can be facilitated by two adjacent, oppositely oriented DNA-binding sites. Id.
  • a method for the site-specific integration of an exogenous nucleic acid into at least one CD 163 locus of a host can comprise introducing into a cell of the host a ZFN, wherein the ZFN recognizes and binds to a target nucleotide sequence, wherein the target nucleotide sequence is comprised within at least one CD 163 locus of the host.
  • the target nucleotide sequence is not comprised within the genome of the host at any other position than the at least one CD 163 locus.
  • a DNA-binding polypeptide of the ZFN may be engineered to recognize and bind to a target nucleotide sequence identified within the at least one CD 163 locus (e.g., by sequencing the CD163 locus).
  • a method for the site-specific integration of an exogenous nucleic acid into at least one CD 163 performance locus of a host that comprises introducing into a cell of the host a ZFN may also comprise introducing into the cell an exogenous nucleic acid, wherein recombination of the exogenous nucleic acid into a nucleic acid of the host comprising the at least one CD 163 locus is facilitated by site-specific recognition and binding of the ZFN to the target sequence (and subsequent cleavage of the nucleic acid comprising the CD 163 locus).
  • Exogenous nucleic acids for integration at a CD 163 locus include: an exogenous nucleic acid for site-specific integration in at least one CD 163 locus, for example and without limitation, an ORF; a nucleic acid comprising a nucleotide sequence encoding a targeting endonuclease; and a vector comprising at least one of either or both of the foregoing.
  • particular nucleic acids include nucleotide sequences encoding a polypeptide, structural nucleotide sequences, and/or DNA-binding polypeptide recognition and binding sites.
  • donor sequence also called a "donor sequence” or “donor” or “transgene”
  • insertion of an exogenous sequence is provided, for example for expression of a polypeptide, correction of a mutant gene or for increased expression of a wild-type gene.
  • the donor sequence is typically not identical to the genomic sequence where it is placed.
  • a donor sequence can contain a non-homologous sequence flanked by two regions of homology to allow for efficient homology-directed repair (HDR) at the location of interest.
  • donor sequences can comprise a vector molecule containing sequences that are not homologous to the region of interest in cellular chromatin.
  • a donor molecule can contain several, discontinuous regions of homology to cellular chromatin. For example, for targeted insertion of sequences not normally present in a region of interest, said sequences can be present in a donor nucleic acid molecule and flanked by regions of homology to sequence in the region of interest.
  • the donor polynucleotide can be DNA or RNA, single-stranded or double- stranded and can be introduced into a cell in linear or circular form. See e.g., U.S. Patent Publication Nos. 2010/0047805, 201 1/0281361, 201 1/0207221, and 2013/0326645. If introduced in linear form, the ends of the donor sequence can be protected (e.g. from
  • exonucleolytic degradation by methods known to those of skill in the art.
  • one or more dideoxynucleotide residues are added to the 3' terminus of a linear molecule and/or self- complementary oligonucleotides are ligated to one or both ends. See, for example, Chang et al. (1987) Proc. Natl. Acad. Sci. USA 84:4959-4963; Nehls et al. (1996) Science 272:886-889.
  • Additional methods for protecting exogenous polynucleotides from degradation include, but are not limited to, addition of terminal amino group(s) and the use of modified internucleotide linkages such as, for example, phosphorothioates, phosphoramidates, and O-methyl ribose or deoxyribose residues.
  • a polynucleotide can be introduced into a cell as part of a vector molecule having additional sequences such as, for example, replication origins, promoters and genes encoding antibiotic resistance.
  • donor polynucleotides can be introduced as naked nucleic acid, as nucleic acid complexed with an agent such as a liposome or poloxamer, or can be delivered by viruses (e.g., adenovirus, AAV, herpesvirus, retrovirus, lentivirus and integrase defective lentivirus (IDLV)).
  • viruses e.g., adenovirus, AAV, herpesvirus, retrovirus, lentivirus and integrase defective lentivirus (IDLV)
  • the donor is generally integrated so that its expression is driven by the endogenous promoter at the integration site, namely the promoter that drives expression of the endogenous gene into which the donor is integrated (e.g., CD 163).
  • the donor may comprise a promoter and/or enhancer, for example a constitutive promoter or an inducible or tissue specific promoter.
  • exogenous sequences may also include transcriptional or translational regulatory sequences, for example, promoters, enhancers, insulators, internal ribosome entry sites, sequences encoding 2 A peptides and/or polyadenylation signals.
  • Exogenous nucleic acids that may be integrated in a site-specific manner into at least one CD 163 locus, so as to modify the CD 163 locus include, for example and without limitation, nucleic acids comprising a nucleotide sequence encoding a polypeptide of interest; nucleic acids comprising an agronomic gene; nucleic acids comprising a nucleotide sequence encoding an RNAi molecule; or nucleic acids that disrupt the CD 163 gene.
  • An exogenous nucleic acid can be integrated at a CD 163 locus, so as to modify the CD 163 locus, wherein the nucleic acid comprises a nucleotide sequence encoding a polypeptide of interest, such that the nucleotide sequence is expressed in the host from the CD 163 locus.
  • the polypeptide of interest e.g., a foreign protein
  • the polypeptide of interest may be extracted from the host cell, tissue, or biomass.
  • a nucleotide sequence encoding a targeting endonuclease can be engineered by manipulation (e.g., ligation) of native nucleotide sequences encoding polypeptides comprised within the targeting endonuclease.
  • the nucleotide sequence of a gene encoding a protein comprising a DNA-binding polypeptide may be inspected to identify the nucleotide sequence of the gene that corresponds to the DNA-binding polypeptide, and that nucleotide sequence may be used as an element of a nucleotide sequence encoding a targeting endonuclease comprising the DNA-binding polypeptide.
  • the amino acid sequence of a targeting endonuclease may be used to deduce a nucleotide sequence encoding the targeting
  • endonuclease for example, according to the degeneracy of the genetic code.
  • nucleic acid molecules comprising a nucleotide sequence encoding a targeting endonuclease
  • the last codon of a first polynucleotide sequence encoding a nuclease polypeptide, and the first codon of a second polynucleotide sequence encoding a DNA- binding polypeptide may be separated by any number of nucleotide triplets, e.g., without coding for an intron or a "STOP.”
  • the last codon of a nucleotide sequence encoding a first polynucleotide sequence encoding a DNA-binding polypeptide, and the first codon of a second polynucleotide sequence encoding a nuclease polypeptide may be separated by any number of nucleotide triplets.
  • the last codon (i.e., most 3' in the nucleic acid sequence) of a first polynucleotide sequence encoding a nuclease polypeptide, and a second polynucleotide sequence encoding a DNA-binding polypeptide can be fused in phase-register with the first codon of a further polynucleotide coding sequence directly contiguous thereto, or separated therefrom by no more than a short peptide sequence, such as that encoded by a synthetic nucleotide linker (e.g., a nucleotide linker that may have been used to achieve the fusion).
  • a synthetic nucleotide linker e.g., a nucleotide linker that may have been used to achieve the fusion.
  • polynucleotide sequences include, for example and without limitation, tags, targeting peptides, and enzymatic cleavage sites.
  • first codon of the most 5' (in the nucleic acid sequence) of the first and second polynucleotide sequences may be fused in phase-register with the last codon of a further polynucleotide coding sequence directly contiguous thereto, or separated therefrom by no more than a short peptide sequence.
  • a sequence separating polynucleotide sequences encoding functional polypeptides in a targeting endonuclease may, for example, consist of any sequence, such that the amino acid sequence encoded is not likely to significantly alter the translation of the targeting endonuclease. Due to the autonomous nature of known nuclease polypeptides and known DNA-binding polypeptides, intervening sequences will not interfere with the respective functions of these structures.
  • somatic cells such as cumulus or mammary cells, or adult, fetal, or embryonic stem cells, followed by nuclear transplantation (Wilmut et al. (1997) Nature 385, 810-813; and Wakayama et al. (1998) Nature 394, 369-374).
  • Pronuclear microinjection, sperm mediated gene transfer, and somatic cell nuclear transfer are particularly useful techniques.
  • An animal that is genomically modified is an animal wherein all of its cells have the genetic modification, including its germ line cells. When methods are used that produce an animal that is mosaic in its genetic modification, the animals may be inbred and progeny that are genomically modified may be selected.
  • Cloning may be used to make a mosaic animal if its cells are modified at the blastocyst state, or genomic modification can take place when a single-cell is modified. Animals that are modified so they do not sexually mature can be homozygous or heterozygous for the modification, depending on the specific approach that is used. If a particular gene is inactivated by a knock out modification, homozygosity would normally be required. If a particular gene is inactivated by an RNA interference or dominant negative strategy, then heterozygosity is often adequate.
  • a nucleic acid construct or mRNA is introduced into a fertilized egg; 1 or 2 cell fertilized eggs are used as the nuclear structure containing the genetic material from the sperm head and the egg are visible within the protoplasm.
  • Pronuclear staged fertilized eggs can be obtained in vitro or in vivo (i.e., surgically recovered from the oviduct of donor animals).
  • In vitro fertilized eggs can be produced as follows. For example, swine ovaries can be collected at an abattoir, and maintained at 22-28° C. during transport.
  • Ovaries can be washed and isolated for follicular aspiration, and follicles ranging from 4-8 mm can be aspirated into 50 mL conical centrifuge tubes using 18 gauge needles and under vacuum. Follicular fluid and aspirated oocytes can be rinsed through pre- filters with commercial TL-HEPES (Minitube, Verona, Wis.).
  • Oocytes surrounded by a compact cumulus mass can be selected and placed into TCM-199 OOCYTE MATURATION MEDIUM (Minitube, Verona, Wis.) supplemented with 0.1 mg/mL cysteine, 10 ng/mL epidermal growth factor, 10% porcine follicular fluid, 50 ⁇ 2-mercaptoethanol, 0.5 mg/ml cAMP, 10 IU/mL each of pregnant mare serum gonadotropin (PMSG) and human chorionic gonadotropin (hCG) for approximately 22 hours in humidified air at 38.7° C. and 5% CO 2 .
  • PMSG pregnant mare serum gonadotropin
  • hCG human chorionic gonadotropin
  • the oocytes can be moved to fresh TCM-199 maturation medium, which will not contain cAMP, PMSG or hCG and incubated for an additional 22 hours. Matured oocytes can be stripped of their cumulus cells by vortexing in 0.1% hyaluronidase for 1 minute.
  • mature oocytes can be fertilized in 500 ⁇ Minitube PORCPRO IVF MEDIUM SYSTEM (Minitube, Verona, Wis.) in Minitube 5-well fertilization dishes.
  • IVF in vitro fertilization
  • freshly -collected or frozen boar semen can be washed and resuspended in PORCPRO IVF Medium to 400,000 sperm.
  • Sperm concentrations can be analyzed by computer assisted semen analysis (SPERMVISION, Minitube, Verona, Wis.).
  • Final in vitro insemination can be performed in a 10 ⁇ volume at a final concentration of approximately 40 motile sperm/oocyte, depending on boar.
  • Linearized nucleic acid constructs or mRNA can be injected into one of the pronuclei or into the cytoplasm. Then the injected eggs can be transferred to a recipient female (e.g., into the oviducts of a recipient female) and allowed to develop in the recipient female to produce the transgenic or gene edited animals.
  • a recipient female e.g., into the oviducts of a recipient female
  • in vitro fertilized embryos can be centrifuged at 15,000 x g for 5 minutes to sediment lipids allowing visualization of the pronucleus.
  • the embryos can be injected with using an Eppendorf FEMTO JET injector and can be cultured until blastocyst formation. Rates of embryo cleavage and blastocyst formation and quality can be recorded.
  • Embryos can be surgically transferred into uteri of asynchronous recipients. Typically, 100-200 (e.g., 150-200) embryos can be deposited into the ampulla-isthmus junction of the oviduct using a 5.5-inch TOMCAT® catheter. After surgery, real-time ultrasound examination of pregnancy can be performed.
  • a transgenic or gene edited cell such as an embryonic blastomere, fetal fibroblast, adult ear fibroblast, or granulosa cell that includes a nucleic acid construct described above, can be introduced into an enucleated oocyte to establish a combined cell.
  • Oocytes can be enucleated by partial zona dissection near the polar body and then pressing out cytoplasm at the dissection area.
  • an injection pipette with a sharp bevelled tip is used to inject the transgenic or gene edited cell into an enucleated oocyte arrested at meiosis 2.
  • oocytes arrested at meiosis-2 are termed eggs.
  • the embryo After producing a porcine or bovine embryo (e.g., by fusing and activating the oocyte), the embryo is transferred to the oviducts of a recipient female, about 20 to 24 hours after activation. See, for example, Cibelli et al. (1998) Science 280, 1256-1258 and U.S. Pat. Nos. 6,548,741, 7,547,816, 7,989,657, or 6,21 1,429. For pigs, recipient females can be checked for pregnancy
  • Standard breeding techniques can be used to create animals that are homozygous for the inactivated gene from the initial heterozygous founder animals.
  • Gene edited pigs described herein can be bred with other pigs of interest.
  • inactivation of an endogenous nucleic acid can be assessed using standard techniques. Initial screening can be accomplished by Southern blot analysis to determine whether or not inactivation has taken place. For a description of Southern analysis, see sections 9.37-9.52 of Sambrook et al, 1989, Molecular Cloning, A Laboratory Manual, second edition, Cold Spring Harbor Press, Plainview; N.Y. Polymerase chain reaction (PCR) techniques also can be used in the initial screening PCR refers to a procedure or technique in which target nucleic acids are amplified. Generally, sequence information from the ends of the region of interest or beyond is employed to design
  • oligonucleotide primers that are identical or similar in sequence to opposite strands of the template to be amplified.
  • PCR can be used to amplify specific sequences from DNA as well as RNA, including sequences from total genomic DNA or total cellular RNA.
  • Primers typically are 14 to 40 nucleotides in length, but can range from 10 nucleotides to hundreds of nucleotides in length. PCR is described in, for example PCR Primer: A Laboratory Manual, ed. Dieffenbach and Dveksler, Cold Spring Harbor Laboratory Press, 1995.
  • Nucleic acids also can be amplified by ligase chain reaction, strand displacement amplification, self-sustained sequence replication, or nucleic acid sequence-based amplified.
  • RNAi interfering RNA
  • dsRNA double-stranded RNA
  • RISC RNA- induced silencing complex
  • RISC metabolizes dsRNA to small 21-23 -nucleotide small interfering RNAs (siRNAs).
  • RISC contains a double stranded RNAse (dsRNase, e.g., Dicer) and ssRNase (e.g., Argonaut 2 or Ago2).
  • RISC utilizes antisense strand as a guide to find a cleavable target.
  • siRNAs and microRNAs miRNAs
  • a method of inactivating a gene in a genetically edited animal comprises inducing RNA interference against a target gene and/or nucleic acid such that expression of the target gene and/or nucleic acid is reduced.
  • the exogenous nucleic acid sequence can induce RNA interference against a nucleic acid encoding a polypeptide.
  • double-stranded small interfering RNA (siRNA) or small hairpin RNA (shRNA) homologous to a target DNA can be used to reduce expression of that DNA.
  • Constructs for siRNA can be produced as described, for example, in Fire et al. (1998) Nature 391 :806; Romano and Masino (1992) Mol. Microbiol. 6:3343; Cogoni et al. (1996) EMBO J. 15:3153; Cogoni and Masino (1999) Nature 399: 166; Misquitta and Paterson (1999) Proc. Natl.
  • shRNAs are transcribed as a single- stranded RNA molecule containing complementary regions, which can anneal and form short hairpins.
  • the probability of finding a single, individual functional siRNA or miRNA directed to a specific gene is high.
  • the predictability of a specific sequence of siRNA, for instance, is about 50% but a number of interfering RNAs may be made with good confidence that at least one of them will be effective.
  • RNAi may be, for instance, selected from the group consisting of siRNA, shRNA, dsRNA, RISC and miRNA.
  • An inducible system may be used to inactivate a CD 163 gene.
  • Various inducible systems are known that allow spatial and temporal control of inactivation of a gene.
  • Several have been proven to be functional in vivo in porcine animals.
  • an inducible system is the tetracycline (tet)-on promoter system, which can be used to regulate transcription of the nucleic acid.
  • tet tetracycline
  • a mutated Tet repressor (TetR) is fused to the activation domain of herpes simplex virus VP 16 trans-activator protein to create a tetracycline-controlled transcriptional activator (tTA), which is regulated by tet or doxycycline (dox).
  • tTA tetracycline-controlled transcriptional activator
  • dox tetracycline-controlled transcriptional activator
  • Alternative inducible systems include the ecdysone or rapamycin systems.
  • Ecdysone is an insect molting hormone whose production is controlled by a heterodimer of the ecdysone receptor and the product of the ultraspiracle gene (USP). Expression is induced by treatment with ecdysone or an analog of ecdysone such as muristerone A.
  • the agent that is administered to the animal to trigger the inducible system is referred to as an induction agent.
  • the tetracycline-inducible system and the Cre/loxP recombinase system are among the more commonly used inducible systems.
  • the tetracycline-inducible system involves a tetracycline-controlled transactivator (tTA)/reverse tTA (rtTA).
  • tTA tetracycline-controlled transactivator
  • rtTA reverse tTA
  • a method to use these systems in vivo involves generating two lines of genetically edited animals.
  • One animal line expresses the activator (tTA, rtTA, or Cre recombinase) under the control of a selected promoter.
  • Another line of animals expresses the acceptor, in which the expression of the gene of interest (or the gene to be modified) is under the control of the target sequence for the tTA/rtTA transactivators (or is flanked by loxP sequences). Mating the two of animals provides control of gene expression.
  • tetracycline-dependent regulatory systems rely on two components, i.e., a tetracycline-controlled transactivator (tTA or rtTA) and a tTA/rtTA- dependent promoter that controls expression of a downstream cDNA, in a tetracycline- dependent manner.
  • tTA tetracycline-controlled transactivator
  • tTA/rtTA- dependent promoter that controls expression of a downstream cDNA
  • tet-OFF The tet system that uses tTA is termed tet-OFF, because tetracycline or doxycycline allows transcriptional down-regulation. Administration of tetracycline or its derivatives allows temporal control of trans gene expression in vivo.
  • rtTA is a variant of tTA that is not functional in the absence of doxycycline but requires the presence of the ligand for trans activation. This tet system is therefore termed tet-ON.
  • the tet systems have been used in vivo for the inducible expression of several transgenes, encoding, e.g., reporter genes, oncogenes, or proteins involved in a signaling cascade.
  • the Cre/lox system uses the Cre recombinase, which catalyzes site-specific recombination by crossover between two distant Cre recognition sequences, i.e., loxP sites.
  • a DNA sequence introduced between the two loxP sequences (termed floxed DNA) is excised by Cre-mediated recombination.
  • Control of Cre expression in a transgenic and/or gene edited animal using either spatial control (with a tissue- or cell-specific promoter), or temporal control (with an inducible system), results in control of DNA excision between the two loxP sites.
  • One application is for conditional gene inactivation (conditional knockout).
  • Another approach is for protein over-expression, wherein a floxed stop codon is inserted between the promoter sequence and the DNA of interest. Genetically edited animals do not express the transgene until Cre is expressed, leading to excision of the floxed stop codon.
  • This system has been applied to tissue- specific oncogenesis and controlled antigene receptor expression in B lymphocytes.
  • Inducible Cre recombinases have also been developed. The inducible Cre recombinase is activated only by administration of an exogenous ligand. The inducible Cre recombinases are fusion proteins containing the original Cre recombinase and a specific ligand-binding domain. The functional activity of the Cre recombinase is dependent on an external ligand that is able to bind to this specific domain in the fusion protein.
  • in vitro cells in vivo cells, or a genetically edited animal such as a livestock animal that comprises a CD 163 gene under control of an inducible system
  • the genetic modification of an animal may be genomic or mosaic.
  • the inducible system may be, for instance, selected from the group consisting of Tet-On, Tet-Off, Cre-lox, and Hif 1 alpha.
  • nucleic acids may be introduced into cells for knockout purposes, for inactivation of a gene, to obtain expression of a gene, or for other purposes.
  • nucleic acid includes DNA, RNA, and nucleic acid analogs, and nucleic acids that are double-stranded or single-stranded (i.e., a sense or an antisense single strand).
  • Nucleic acid analogs can be modified at the base moiety, sugar moiety, or phosphate backbone to improve, for example, stability, hybridization, or solubility of the nucleic acid.
  • Modifications at the base moiety include deoxyuridine for deoxythymidine, and 5-methyl-2'-deoxycytidine and 5-bromo- 2'-doxycytidine for deoxycytidine.
  • Modifications of the sugar moiety include modification of the 2' hydroxyl of the ribose sugar to form 2'-0-methyl or 2'-0-allyl sugars.
  • the deoxyribose phosphate backbone can be modified to produce morpholino nucleic acids, in which each base moiety is linked to a six membered, morpholino ring, or peptide nucleic acids, in which the deoxyphosphate backbone is replaced by a pseudopeptide backbone and the four bases are retained.
  • deoxyphosphate backbone can be replaced with, for example, a phosphorothioate or phosphorodithioate backbone, a phosphoroamidite, or an alkyl phosphotriester backbone.
  • the target nucleic acid sequence can be operably linked to a regulatory region such as a promoter. Regulatory regions can be porcine regulatory regions or can be from other species. As used herein, operably linked refers to positioning of a regulatory region relative to a nucleic acid sequence in such a way as to permit or facilitate transcription of the target nucleic acid.
  • Any type of promoter can be operably linked to a target nucleic acid sequence. Examples of promoters include, without limitation, tissue-specific promoters, constitutive promoters, inducible promoters, and promoters responsive or unresponsive to a particular stimulus.
  • tissue specific promoters can result in preferential expression of a nucleic acid transcript in beta cells and include, for example, the human insulin promoter.
  • Other tissue specific promoters can result in preferential expression in, for example, hepatocytes or heart tissue and can include the albumin or alpha-myosin heavy chain promoters, respectively.
  • a promoter that facilitates the expression of a nucleic acid molecule without significant tissue or temporal-specificity can be used (i.e., a constitutive promoter).
  • a beta-actin promoter such as the chicken beta-actin gene promoter, ubiquitin promoter, miniCAGs promoter, glyceraldehyde-3 -phosphate dehydrogenase (GAPDH) promoter, or 3- phosphoglycerate kinase (PGK) promoter can be used, as well as viral promoters such as the herpes simplex virus thymidine kinase (HSV-TK) promoter, the SV40 promoter, or a cytomegalovirus (CMV) promoter.
  • HSV-TK herpes simplex virus thymidine kinase
  • CMV cytomegalovirus
  • a fusion of the chicken beta actin gene promoter and the CMV enhancer can be used as a promoter. See, for example, Xu et al. (2001) Hum. Gene Ther. 12:563; and Kiwaki et al. (1996) Hum. Gene Ther. 7:821.
  • Additional regulatory regions that may be useful in nucleic acid constructs, include, but are not limited to, polyadenylation sequences, translation control sequences (e.g., an internal ribosome entry segment, IRES), enhancers, inducible elements, or introns. Such regulatory regions may not be necessary, although they may increase expression by affecting transcription, stability of the mRNA, translational efficiency, or the like. Such regulatory regions can be included in a nucleic acid construct as desired to obtain optimal expression of the nucleic acids in the cell(s). Sufficient expression, however, can sometimes be obtained without such additional elements.
  • a nucleic acid construct may be used that encodes signal peptides or selectable markers.
  • Signal peptides can be used such that an encoded polypeptide is directed to a particular cellular location (e.g., the cell surface).
  • selectable markers include puromycin, ganciclovir, adenosine deaminase (ADA), aminoglycoside phosphotransferase (neo, G418, APH), dihydrofolate reductase (DHFR), hygromycin-B-phosphtransferase, thymidine kinase (TK), and xanthin-guanine phosphoribosyltransferase (XGPRT).
  • puromycin ganciclovir
  • ADA adenosine deaminase
  • DHFR dihydrofolate reductase
  • TK thymidine kinase
  • XGPRT xanthin-guanine
  • selectable markers include fluorescent polypeptides, such as green fluorescent protein or yellow fluorescent protein.
  • a sequence encoding a selectable marker can be flanked by recognition sequences for a recombinase such as, e.g., Cre or Flp.
  • the selectable marker can be flanked by loxP recognition sites (34-bp recognition sites recognized by the Cre recombinase) or FRT recognition sites such that the selectable marker can be excised from the construct. See, Orban, et al, Proc. Natl. Acad. Sci. (1992) 89:6861, for a review of Cre/lox technology, and Brand and Dymecki, Dev.
  • a transposon containing a Cre- or Flp-activatable transgene interrupted by a selectable marker gene also can be used to obtain animals with conditional expression of a transgene.
  • a promoter driving expression of the marker/transgene can be either ubiquitous or tissue-specific, which would result in the ubiquitous or tissue-specific expression of the marker in F0 animals (e.g., pigs).
  • Tissue specific activation of the transgene can be accomplished, for example, by crossing a pig that ubiquitously expresses a marker-interrupted transgene to a pig expressing Cre or Flp in a tissue-specific manner, or by crossing a pig that expresses a marker-interrupted transgene in a tissue-specific manner to a pig that ubiquitously expresses Cre or Flp recombinase. Controlled expression of the transgene or controlled excision of the marker allows expression of the transgene.
  • the exogenous nucleic acid can encode a polypeptide.
  • a nucleic acid sequence encoding a polypeptide can include a tag sequence that encodes a "tag" designed to facilitate subsequent manipulation of the encoded polypeptide (e.g., to facilitate localization or detection).
  • Tag sequences can be inserted in the nucleic acid sequence encoding the polypeptide such that the encoded tag is located at either the carboxyl or amino terminus of the polypeptide.
  • Non- limiting examples of encoded tags include glutathione S-transferase (GST) and FLAGTMtag (Kodak, New Haven, Conn.).
  • Nucleic acid constructs can be methylated using an Sssl CpG methylase (New England Biolabs, Ipswich, Mass.).
  • the nucleic acid construct can be incubated with S-adenosylmethionine and Sssl CpG-methylase in buffer at 37°C. Hypermethylation can be confirmed by incubating the construct with one unit of HinPlI endonuclease for 1 hour at 37° C. and assaying by agarose gel electrophoresis.
  • Nucleic acid constructs can be introduced into embryonic, fetal, or adult animal cells of any type, including, for example, germ cells such as an oocyte or an egg, a progenitor cell, an adult or embryonic stem cell, a primordial germ cell, a kidney cell such as a PK-15 cell, an islet cell, a beta cell, a liver cell, or a fibroblast such as a dermal fibroblast, using a variety of techniques.
  • Non-limiting examples of techniques include the use of transposon systems, recombinant viruses that can infect cells, or liposomes or other non-viral methods such as electroporation, microinjection, or calcium phosphate precipitation, that are capable of delivering nucleic acids to cells.
  • transposon systems the transcriptional unit of a nucleic acid construct, i.e., the regulatory region operably linked to an exogenous nucleic acid sequence, is flanked by an inverted repeat of a transposon.
  • transposon systems including, for example, Sleeping Beauty (see, U.S. Pat. No. 6,613,752 and U.S. Publication No. 2005/0003542); Frog Prince (Miskey et al. (2003) Nucleic Acids Res. 31 :6873); Tol2 (Kawakami (2007) Genome Biology 8(Suppl. l):S7; Minos (Pavlopoulos et al. (2007) Genome Biology 8(Suppl.
  • a transposase can be delivered as a protein, encoded on the same nucleic acid construct as the exogenous nucleic acid, can be introduced on a separate nucleic acid construct, or provided as an mRNA (e.g., an in /ro-transcribed and capped mRNA).
  • Insulator elements also can be included in a nucleic acid construct to maintain expression of the exogenous nucleic acid and to inhibit the unwanted transcription of host genes. See, for example, U.S. Publication No. 2004/0203158. Typically, an insulator element flanks each side of the transcriptional unit and is internal to the inverted repeat of the transposon. Non- limiting examples of insulator elements include the matrix attachment region-(MAR) type insulator elements and border-type insulator elements. See, for example, U.S. Pat. Nos.
  • Nucleic acids can be incorporated into vectors.
  • a vector is a broad term that includes any specific DNA segment that is designed to move from a carrier into a target DNA.
  • a vector may be referred to as an expression vector, or a vector system, which is a set of components needed to bring about DNA insertion into a genome or other targeted DNA sequence such as an episome, plasmid, or even virus/phage DNA segment.
  • Vector systems such as viral vectors (e.g., retroviruses, adeno-associated virus and integrating phage viruses), and non-viral vectors (e.g., transposons) used for gene delivery in animals have two basic components: 1) a vector comprised of DNA (or RNA that is reverse transcribed into a cDNA) and 2) a transposase, recombinase, or other integrase enzyme that recognizes both the vector and a DNA target sequence and inserts the vector into the target DNA sequence.
  • Vectors most often contain one or more expression cassettes that comprise one or more expression control sequences, wherein an expression control sequence is a DNA sequence that controls and regulates the transcription and/or translation of another DNA sequence or mRNA, respectively.
  • Plasmids and viral vectors are known.
  • Mammalian expression plasmids typically have an origin of replication, a suitable promoter and optional enhancer, necessary ribosome binding sites, a polyadenylation site, splice donor and acceptor sites, transcriptional termination sequences, and 5' flanking non-transcribed sequences.
  • vectors include: plasmids (which may also be a carrier of another type of vector), adenovirus, adeno-associated virus (AAV), lentivirus (e.g., modified HIV-1, SIV or FIV), retrovirus (e.g., ASV, ALV or MoMLV), and transposons (e.g., Sleeping Beauty, P-elements, Tol-2, Frog Prince, piggyBac).
  • plasmids which may also be a carrier of another type of vector
  • adenovirus e.g., adeno-associated virus (AAV)
  • lentivirus e.g., modified HIV-1, SIV or FIV
  • retrovirus e.g., ASV, ALV or MoMLV
  • transposons e.g., Sleeping Beauty, P-elements, Tol-2, Frog Prince, piggyBac.
  • nucleic acid refers to both RNA and DNA, including, for example, cDNA, genomic DNA, synthetic (e.g., chemically synthesized) DNA, as well as naturally occurring and chemically modified nucleic acids, e.g., synthetic bases or alternative backbones.
  • a nucleic acid molecule can be double-stranded or single-stranded (i.e., a sense or an antisense single strand).
  • Founder animals may be produced by cloning and other methods described herein.
  • the founders can be homozygous for a genetic modification, as in the case where a zygote or a primary cell undergoes a homozygous modification.
  • founders can also be made that are heterozygous.
  • the animals comprising at least one modified chromosomal sequence in a gene encoding a CD 163 protein, the founders are preferably heterozygous.
  • the founders may be genomically modified, meaning that all of the cells in their genome have undergone modification.
  • Founders can be mosaic for a modification, as may happen when vectors are introduced into one of a plurality of cells in an embryo, typically at a blastocyst stage.
  • Progeny of mosaic animals may be tested to identify progeny that are genomically modified.
  • An animal line is established when a pool of animals has been created that can be reproduced sexually or by assisted reproductive techniques, with heterogeneous or homozygous progeny consistently expressing the modification.
  • An animal line may include a trait chosen from a trait in the group consisting of a production trait, a type trait, a workability trait, a fertility trait, a mothering trait, and a disease resistance trait. Further traits include expression of a recombinant gene product.
  • Animals with a desired trait or traits may be modified to prevent their sexual maturation. Since the animals are sterile until matured, it is possible to regulate sexual maturity as a means of controlling dissemination of the animals. Animals that have been bred or modified to have one or more traits can thus be provided to recipients with a reduced risk that the recipients will breed the animals and appropriate the value of the traits to themselves.
  • the genome of an animal can be genetically modified, wherein the modification comprises inactivation of a sexual maturation gene, wherein the sexual maturation gene in a wild type animal expresses a factor selective for sexual maturation.
  • the animal can be treated by administering a compound to remedy a deficiency caused by the loss of expression of the gene to induce sexual maturation in the animal.
  • breeding of animals that require administration of a compound to induce sexual maturity may advantageously be accomplished at a treatment facility.
  • the treatment facility can implement standardized protocols on well-controlled stock to efficiently produce consistent animals.
  • the animal progeny may be distributed to a plurality of locations to be raised. Farms and farmers (a term including a ranch and ranchers) may thus order a desired number of progeny with a specified range of ages and/or weights and/or traits and have them delivered at a desired time and/or location.
  • the recipients e.g., farmers, may then raise the animals and deliver them to market as they desire.
  • a genetically modified livestock animal having an inactivated sexual maturation gene can be delivered (e.g., to one or more locations, to a plurality of farms).
  • the animals can have an age of between about 1 day and about 180 days.
  • the animal can have one or more traits (for example one that expresses a desired trait or a high-value trait or a novel trait or a recombinant trait).
  • the method comprises genetically modifying an oocyte or a sperm cell to introduce a modified chromosomal sequence in a gene encoding a
  • the method comprises genetically modifying a fertilized egg to introduce a modified chromosomal sequence in a gene encoding a CD 163 protein into the fertilized egg.
  • the method further comprises transferring the fertilized egg into a surrogate female animal, wherein gestation and term delivery produces a progeny animal;
  • progeny animal for susceptibility to the pathogen; and selecting progeny animals that have reduced susceptibility to the pathogen as compared to animals that do not comprise a modified chromosomal sequence in a gene encoding a CD 163 protein.
  • the pathogen preferably comprises a virus, e.g., PRRSV.
  • the animal or offspring can be an embryo, a juvenile, or an adult.
  • the animal or offspring can comprise a domesticated animal.
  • the domesticated animal can comprise a livestock animal, for example a porcine animal, a bovine animal (e.g., beef cattle or dairy cattle), an ovine animal, a caprine animal, an equine animal (e.g., a horse or a donkey), buffalo, camels, or an avian animal (e.g., a chicken, a turkey, a duck, a goose, a guinea fowl, or a squab).
  • the livestock animal is preferably a bovine or porcine animal, and most preferably is a porcine animal.
  • the step of genetically modifying the oocyte, sperm cell, or fertilized egg can comprise genetic editing of the oocyte, sperm cell, or fertilized egg.
  • the genetic editing can comprise use of a homing endonuclease.
  • the homing endonuclease can be a naturally occurring endonuclease but is preferably a rationally designed, non-naturally occurring homing endonuclease that has a DNA recognition sequence that has been designed so that the endonuclease targets a chromosomal sequence in gene encoding a CD 163 protein.
  • the homing endonuclease can be a designed homing endonuclease.
  • the homing endonuclease can comprise, for example, a Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) /Cas9 system, a Transcription Activator-Like Effector Nuclease (TALEN), a Zinc Finger Nuclease (ZFN), a recombinase fusion protein, a meganuclease, or a combination thereof).
  • CRISPR Clustered Regularly Interspaced Short Palindromic Repeats
  • TALEN Transcription Activator-Like Effector Nuclease
  • ZFN Zinc Finger Nuclease
  • the genetic editing preferably comprises use of a CRISPR/Cas9 system.
  • the oocyte, sperm cell, or fertilized egg can be heterozygous for the modified chromosomal sequence.
  • the oocyte, sperm cell, or fertilized egg can be homozygous for the modified chromosomal sequence.
  • the modified chromosomal sequence can comprise an insertion in the gene encoding the CD 163 protein, a deletion in the gene encoding the CD 163 protein, or a combination thereof.
  • the modified chromosomal sequence comprises a deletion in the gene encoding the CD 163 protein (e.g., an in- frame deletion).
  • the modified chromosomal sequence can comprise an insertion in the gene encoding the CD 163 protein.
  • the insertion or deletion can cause CD 163 protein production or activity to be reduced, as compared to CD 163 protein production or activity in an animal that lacks the insertion or deletion.
  • the insertion or deletion can result in production of substantially no functional CD 163 protein by the animal.
  • substantially no functional CD 163 protein it is meant that the level of CD 163 protein in the animal, offspring, or cell is undetectable, or if detectable, is at least about 90% lower than the level observed in an animal, offspring, or cell that does not comprise the insertion or deletion.
  • the modified chromosomal sequence can comprise a modification in exon 7 of the gene encoding the CD 163 protein, exon 8 of the gene encoding the CD 163 protein, an intron that is contiguous with exon 7 or exon 8 of the gene encoding the CD 163 protein, or a combination thereof.
  • the modified chromosomal sequence suitably comprises a modification in exon 7 of the gene encoding the CD 163 protein.
  • the modification in exon 7 of the gene encoding the CD 163 protein can comprise a deletion (e.g., an in-frame deletion in exon 7).
  • the modification in exon 7 of the gene encoding the CD 163 protein can comprise an insertion.
  • the modification can comprise an 1 1 base pair deletion from nucleotide 3, 137 to nucleotide 3, 147 as compared to reference sequence SEQ ID NO: 47; a 2 base pair insertion between nucleotides 3, 149 and 3,150 as compared to reference sequence SEQ ID NO: 47, with a 377 base pair deletion from nucleotide 2,573 to nucleotide 2,949 as compared to reference sequence SEQ ID NO: 47 on the same allele; a 124 base pair deletion from nucleotide 3,024 to nucleotide 3, 147 as compared to reference sequence SEQ ID NO: 47; a 123 base pair deletion from nucleotide 3,024 to nucleotide 3, 146 as compared to reference sequence SEQ ID NO: 47; a 1 base pair insertion between nucleotides 3,147 and 3, 148 as compared to reference sequence SEQ ID NO: 47; a 130 base pair deletion from nucleotide 3,030
  • the porcine animal comprises the 2 base pair insertion between nucleotides 3, 149 and 3, 150 as compared to reference sequence SEQ ID NO: 47
  • the 2 base pair insertion can comprise insertion of the dinucleotide AG.
  • the porcine animal comprises the 1 base pair insertion between nucleotides 3, 147 and 3, 148 as compared to reference sequence SEQ ID NO: 47
  • the 1 base pair insertion can comprise insertion of a single adenine residue.
  • the 7 base pair insertion can comprise insertion of the sequence TACTACT (SEQ ID NO: 1 15).
  • the porcine animal comprises the 1930 base pair deletion from nucleotide 488 to nucleotide 2,417 as compared to reference sequence SEQ ID NO: 47, wherein the deleted sequence is replaced with a 12 base pair insertion beginning at nucleotide 488, and wherein there is a further 129 base pair deletion in exon 7 from nucleotide 3,044 to nucleotide 3,172 as compared to reference sequence SEQ ID NO: 47
  • the 12 base pair insertion can comprise insertion of the sequence TGTGGAGAATTC (SEQ ID NO: 116).
  • the porcine animal comprises the 1382 base pair deletion from nucleotide 3, 113 to nucleotide 4,494 as compared to reference sequence SEQ ID NO: 47, wherein the deleted sequence is replaced with an 11 base pair insertion beginning at nucleotide 3, 113, the 11 base pair insertion can comprise insertion of the sequence AGCCAGCGTGC (SEQ ID NO: 117).
  • the modified chromosomal sequence in the gene encoding the CD 163 protein comprises a deletion
  • the deletion preferably comprises an in-frame deletion
  • the insertion or deletion in the gene encoding the CD 163 protein can comprise an in-frame deletion in exon 7 selected from the group consisting of the 1506 base pair deletion from nucleotide 1,525 to nucleotide 3,030 as compared to reference sequence SEQ ID NO: 47; the 1930 base pair deletion from nucleotide 488 to nucleotide 2,417 as compared to reference sequence SEQ ID NO: 47, wherein the deleted sequence is replaced with a 12 base pair insertion beginning at nucleotide 488, and wherein there is a further 129 base pair deletion in exon 7 from nucleotide 3,044 to nucleotide 3,172 as compared to reference sequence SEQ ID NO: 47; the 1373 base pair deletion from nucleotide 2,724 to nucleotide 4,096 as compared to reference sequence SEQ ID NO: 47; the 123 base pair deletion from nucleotide 3,024 to nucleotide 3, 146 as compared to
  • the insertion or deletion can be selected from the group consisting of: the 2 base pair insertion between nucleotides 3, 149 and 3, 150 as compared to reference sequence SEQ ID NO: 47, with the 377 base pair deletion from nucleotide 2,573 to nucleotide 2,949 as compared to reference sequence SEQ ID NO: 47 on the same allele; the 28 base pair deletion from nucleotide 3, 145 to nucleotide 3, 172 as compared to reference sequence SEQ ID NO: 47; and a combination thereof.
  • the oocyte, sperm cell, or fertilized egg can comprise the 2 base pair insertion between nucleotides 3, 149 and 3, 150 as compared to reference sequence SEQ ID NO: 47, with the 377 base pair deletion from nucleotide 2,573 to nucleotide 2,949 as compared to reference sequence SEQ ID NO: 47 on the same allele.
  • the oocyte, sperm cell, or fertilized egg can comprise the 28 base pair deletion from nucleotide 3, 145 to nucleotide 3, 172 as compared to reference sequence SEQ ID NO: 47.
  • the oocyte, sperm cell, or fertilized egg can comprise the 7 base pair insertion between nucleotide 3, 148 and nucleotide 3, 149 as compared to reference sequence SEQ ID NO: 47 and the 1 1 base pair deletion from nucleotide 3, 137 to nucleotide 3, 147 as compared to reference sequence SEQ ID NO: 47.
  • the oocytes, sperm cells, or fertilized eggs that comprise any of the insertions or deletions described above can comprise a chromosomal sequence having at a high degree of sequence identity to SEQ ID NO: 47 outside of the insertion or deletion.
  • the oocyte, sperm cell, or fertilized egg can comprise a chromosomal sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, at least 99.9%, or 100% sequence identity to SEQ ID NO: 47 in the regions of the chromosomal sequence outside of the insertion or deletion.
  • the oocyte, sperm cell, or fertilized egg can comprise a chromosomal sequence comprising SEQ ID NO: 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 11 1, 112, 113, or 114.
  • SEQ ID NOs. 98-114 provide nucleotide sequences for a region corresponding to the region of wild-type porcine CD 163 provided in SEQ ID NO:47, and include the insertions or deletions in the porcine CD 163 chromosomal sequence that are described herein.
  • the oocyte, sperm cell, or fertilized egg can comprise comprises a chromosomal sequence comprising SEQ ID NO: 98, 101, 105, 109, 110, 112, 113, or 1 14.
  • SEQ ID NOs: 98, 101, 105, 109, 1 10, 112, 113, or 114 provide the nucleotide sequences for in-frame deletions in exon 7 of the porcine CD 163 chromosomal sequence.
  • the oocyte, sperm cell, or fertilized egg can comprise a chromosomal sequence comprising SEQ ID NO: 103 or 11 1.
  • the oocyte, sperm cell, or fertilized egg can comprise the 11 base pair deletion in one allele of the gene encoding the CD 163 protein and the 2 base pair insertion with the 377 base pair deletion in the other allele of the gene encoding the CD 163 protein.
  • the oocyte, sperm cell, or fertilized egg can comprise the 124 base pair deletion in one allele of the gene encoding the CD163 protein and the 123 base pair deletion in the other allele of the gene encoding the CD 163 protein.
  • the oocyte, sperm cell, or fertilized egg can comprise the 1 base pair insertion.
  • the oocyte, sperm cell, or fertilized egg can comprise the 130 base pair deletion in one allele of the gene encoding the CD 163 protein and the 132 base pair deletion in the other allele of the gene encoding the CD 163 protein. [00245] The oocyte, sperm cell, or fertilized egg can comprise the 1506 base pair deletion.
  • the oocyte, sperm cell, or fertilized egg can comprise the 7 base pair insertion.
  • the oocyte, sperm cell, or fertilized egg can comprise the 1280 base pair deletion in one allele of the gene encoding the CD 163 protein and the 1373 base pair deletion in the other allele of the gene encoding the CD 163 protein.
  • the oocyte, sperm cell, or fertilized egg can comprise the 1467 base pair deletion.
  • the oocyte, sperm cell, or fertilized egg can comprise the 1930 base pair intron 6 deletion from nucleotide 488 to nucleotide 2,417, with a 12 base pair addition at nucleotide 4,488 and an additional 129 base pair deletion in exon 7.
  • the oocyte, sperm cell, or fertilized egg can comprise the 28 base pair deletion in one allele of the gene encoding the CD 163 protein and the 1387 base pair deletion in the other allele of the gene encoding the CD 163 protein.
  • the oocyte, sperm cell, or fertilized egg can comprise the 1382 base pair deletion with the 1 1 base pair insertion in one allele of the gene encoding the CD 163 protein and the 1720 base pair deletion in the other allele of the gene encoding the CD 163 protein.
  • the selected animal can be used as a founder animal.
  • the fertilizing can comprise artificial insemination.
  • a population of animals made by any of the methods of breeding is also provided.
  • the population of animals is preferably resistant to infection by a pathogen, for example a virus such as PRRSV.
  • a method for increasing a livestock animal's resistance to infection with a pathogen comprises genetically editing at least one chromosomal sequence from a gene encoding a CD 163 protein so that CD 163 protein production or activity is reduced, as compared to CD63 protein production or activity in a livestock animal that does not comprise an edited chromosomal sequence in a gene encoding a CD 163 protein.
  • the pathogen preferably comprises a virus (e.g., PRRSV).
  • isolated nucleic acids are provided.
  • the isolated nucleic acid molecule can comprise a nucleotide sequence selected from the group consisting of: (a) a nucleotide sequence comprising SEQ ID NO: 47; (b) a nucleotide sequence having at least 80% sequence identity to the sequence of SEQ ID NO: 47, wherein said nucleotide sequence contains at least one substitution, insertion, or deletion relative to SEQ ID NO: 47; and (c) a cDNA sequence of (a) or (b).
  • the isolated nucleic acid can comprise a nucleotide sequence comprising SEQ ID NO: 47.
  • the isolated nucleic acid can comprise a nucleotide sequence having at least 80% sequence identity to the sequence of SEQ ID NO: 47, wherein said nucleotide sequence contains at least one substitution, insertion, or deletion relative to SEQ ID NO: 47.
  • the isolated nucleic acid can comprise a nucleotide sequence having at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or at least 99.9%, sequence identity to the sequence of SEQ ID NO: 47, wherein said nucleotide sequence contains at least one
  • substitution, insertion, or deletion preferably reduces or eliminates CD 163 protein production or activity, as compared to a nucleic acid that does not comprise the substitution, insertion, or deletion.
  • the isolated nucleic acid can comprise SEQ ID NO: 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 1 10, 1 11, 1 12, 1 13, or 114.
  • the isolated nucleic acid can comprise SEQ ID NO: 98, 101, 105,
  • the isolated nucleic acid can comprise SEQ ID NO: 103 or 1 11.
  • the isolated nucleic acid can comprise the cDNA.
  • the isolated nucleic acid can comprise SEQ ID NO: 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 1 10, 1 11, 1 12, 113, or 114.
  • the isolated nucleic acid can comprise SEQ ID NO: 98, 101, 105, 109,
  • the isolated nucleic acid can comprise SEQ ID NO: 103 or 11 1.
  • Example 1 Use of the CRISPR/Cas9 System to Produce Genetically Engineered Pigs from In E3 ⁇ 4ro-Derived Oocytes and Embryos
  • homing endonucleases such as zinc- finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and components in the clustered regularly interspaced short palindromic repeat (CRISPR)/ CRISPR-associated (Cas9) system suggest that genetic engineering (GE) in pigs might now be more efficient.
  • ZFNs zinc- finger nucleases
  • TALENs transcription activator-like effector nucleases
  • Cas9 CRISPR-associated plasmic acid sequence
  • GE genetic engineering
  • HEJ nonhomologous end joining
  • HR homologous recombination
  • homing endonucleases are a useful tool in generating GE pigs.
  • the CRISPR/Cas9 system adapted from prokaryotes where it is used as a defense mechanism, appears to be an effective approach.
  • RNA ⁇ 20 bases
  • crRNA cis- repressed RNA
  • tracrRNA trans -activating crRNA
  • Cas9 the enzymatic protein component in this complex.
  • a single guide RNA (gRNA) can be constructed to serve the roles of the base- paired crRNA and tracrRNA.
  • the gRNA/protein complex can scan the genome and catalyze a DSB at regions that are complementary to the crRNA/gRNA.
  • a short oligomer needs to be designed to construct the reagents required to target a gene of interest whereas a series of cloning steps are required to assemble ZFNs and TALENs.
  • the present example describes an efficient approach to use the CRISPR/ Cas9 system in generating GE pigs via both injection of in vitro derived zygotes and modification of somatic cells followed by SCNT.
  • Two endogenous genes CD 163 and CD ID
  • eGFP transgene
  • CD 163 appears to be required for productive infection by porcine reproductive and respiratory syndrome virus, a virus known to cause a significant economic loss to swine industry.
  • CD1D is considered a nonclassical major histocompatibility complex protein and is involved in presentation of lipid antigens to invariant natural killer T cells. Pigs deficient in these genes were designed to be models for agriculture and biomedicine.
  • the eGFP transgene was used as a target for preliminary proof-of-concept experiments and optimizations of methods.
  • RNAs were designed to regions within exon 7 of CD163 that were unique to the wild type CD 163 and not present in the domain swap targeting vector (described below), so that the CRISPR would result in DSB within wild type CD 163 but not in the domain swap targeting vector. There were only four locations in which the targeting vector would introduce a single nucleotide polymorphism (SNP) that would alter an S. pyogenes (Spy) protospacer adjacent motif (P AM). All four targets were selected including:
  • the PAM can be identified by the bold font in each gRNA.
  • CRISPR targets were arbitrarily limited to the coding strand within the first 1000 bp of the primary transcript.
  • RepeatMasker [26] (“Pig" repeat library) identified a repetitive element beginning at base 943 of the primary transcript.
  • the search for CRISPR targets was then limited to the first 942 bp of the primary transcript.
  • the search was further limited to the first 873 bp of the primary transcript since the last Spy PAM is located at base 873.
  • the first target (CRISPR 4800) was selected because it overlapped with the start codon located at base 42 in primary transcript
  • CRISPRs 5620 and 5626 were selected because they were the most distal to the first selection within our arbitrarily selected region (CTTTCATTTATCTGAACTCAgGG (SEQ ID NO:6) and
  • eGFPl and eGFP2 gRNA were on the antisense strand and eGFPl directly targeted the start codon.
  • the eGFPl gRNA sequence was CTCCTCGCCCTTGCTCACCAtGG (SEQ ID NO:9) and the eGFPl gRNA sequence was GACCAGGATGGGCACCACCCcGG (SEQ ID NO: 10).
  • Both porcine CD 163 and CD ID were amplified by PCR from DNA isolated from the fetal fibroblasts that would be used for later transfections to ensure an isogenic match between the targeting vector and the transfected cell line. Briefly, LA taq (Clontech) using the forward primer CTCTCCCTCACTCTAACCTACTT (SEQ ID NO: 1 1), and the reverse primer TATTTCTCTCACATGGCCAGTC (SEQ ID NO: 12) were used to amplify a 9538 bp fragment of CD 163. The fragment was DNA sequence validated and used to build the domain-swap targeting vector (Fig. 1).
  • This vector included 33 point mutations within exon 7 so that it would encode the same amino acid sequence as human CD163L from exon 11.
  • the replacement exon was 315 bp.
  • the subsequent intron was replaced with a modified myostatin intron B that housed a selectable marker gene that could be removed with Cre-recombinase (Cre) and had previously demonstrated normal splicing when harboring the retained loxP site (Wells, unpublished results).
  • the long arm of the construct was 3469 bp and included the domain swap DS exon.
  • the short arm was 1578 bp and included exons 7 and 8 (Fig. IB).
  • This plasmid was used to attempt to replace the coding region of exon 7 in the first transfection experiments and allowed for selection of targeting events via the selectable marker (G418). If targeting were to occur, the marker could be deleted by Cre-recombinase.
  • the CD 163 DS- targeting vector was then modified for use with cell lines that already contained a SIGLECl gene disrupted with Neo that could not be Cre deleted. In this targeting vector, the Neo cassette, loxP and myostatin intron B, were removed, and only the DS exon remained with the WT long and short arm (Fig. 1C).
  • the genomic sequence for porcine CD ID was amplified with LA taq using the forward primer CTCTCCCTCACTCTAACCTACTT(SEQ ID NO: 13) and reverse primer GACTGGCCATGTGAGAGAAATA (SEQ ID NO: 14), resulting in an 8729 bp fragment.
  • the fragment was DNA sequenced and used to build the targeting vector shown in Figure 2.
  • the Neo cassette is under the control of a phosphoglycerol kinase (PGK) promoter and flanked with loxP sequences, which were introduced for selection.
  • the long arm of the construct was 4832 bp and the short arm was 3563 bp, and included exons 6 and 7. If successful HR occurred, exons 3, 4, and 5 would be removed and replaced with the Neo cassette. If NHEJ repair occurred incorrectly, then exon 3 would be disrupted.
  • PGK phosphoglycerol kinase
  • Porcine fetal tissue was collected on Day 35 of gestation to create cell lines.
  • Two wild-type (WT) male and female fetal fibroblast cell lines were established from a large white domestic cross.
  • Male and female fetal fibroblasts that had previously been modified to contain a Neo cassette (SIGLECl-/- genetics) were also used in these studies.
  • Fetal fibroblasts were collected as described with minor modifications; minced tissue from each fetus was digested in 20 ml of digestion media (Dulbecco-modified Eagle medium [DMEM] containing L-glutamine and 1 g/L D-glucose [Cellgro] supplemented with 200 units/ml collagenase and 25 Kunitz units/ml DNasel) for 5 h at 38.5°C. After digestion, fetal fibroblast cells were washed and cultured with DMEM, 15% fetal bovine serum (FBS), and 40 ⁇ g/ml gentamicin. After overnight culture, the cells were typsinized and frozen at -80°C in aliquots in FBS with 10% dimethyl sulfoxide and stored in liquid nitrogen.
  • DMEM Dulbecco-modified Eagle medium
  • FBS fetal bovine serum
  • Fetal fibroblast cell lines of similar passage number were cultured for 2 days and grown to 75%-85% confluency in DMEM containing L-glutamine and 1 g/L D-glucose (Cellgro) supplemented with 15% FBS, 2.5 ng/ml basic fibroblast growth factor, and 10 mg/ml gentamicin. Fibroblast cells were washed with phosphate-buffered saline (PBS) (Life
  • a part (1/3) of the resuspended colony was transferred to a 96-well PCR plate, and the remaining (2/3) cells were cultured in a well of a 24-well plate.
  • the cell pellets were resuspended in 6 ⁇ of lysis buffer (40 mM Tris, pH 8.9, 0.9% Triton X-100, 0.4 mg/ml proteinase K [NEB]), incubated at 65°C for 30 min for cell lysis, followed by 85°C for 10 min to inactivate the proteinase K.
  • lysis buffer 40 mM Tris, pH 8.9, 0.9% Triton X-100, 0.4 mg/ml proteinase K [NEB]
  • CRISPR/Cas9 system The size of the amplicons was 435 bp and 1244 bp for CD163 and CD ID, respectively.
  • Lysates from both embryos and fetal fibroblasts were PCR amplified with LA taq. PCR conditions of the assays were an initial denaturation of 95°C for 2 min followed by 33 cycles of 30 sec at 94°C, 30 sec at 56°C, and 1 min at 72°C.
  • INDELs insertions and deletions
  • the resulting PCR products were subsequently DNA sequenced to identify small deletions using forward primers used in the PCR. Primer information is shown in Table 3. Table 3. Primers used to identify mutations through NHEJ on CD 163 and CD ID
  • sow-derived oocytes ART, Inc.
  • gilt- derived oocytes from a local slaughter house were used.
  • the sow-derived oocytes were shipped overnight in maturation medium (TCM-199 with 2.9 mM Hepes, 5 ⁇ g/ml insulin, 10 ng/ml epidermal growth factor [EGF], 0.5 ⁇ g/ml porcine follicle-stimulating hormone [p-FSH], 0.91 mM pyruvate, 0.5 mM cysteine, 10% porcine follicular fluid, and 25 ng/ml gentamicin) and transferred into fresh medium after 24 h.
  • TCM-199 maturation medium
  • EGF epidermal growth factor
  • p-FSH porcine follicle-stimulating hormone
  • oocytes were placed in the manipulation medium (TCM-199 [Life Technologies] with 0.6 mM NaHC0 3 , 2.9 mM Hepes, 30 mM NaCl, 10 ng/ml gentamicin, and 3 mg/ml BSA, with osmolarity of 305 mOsm) supplemented with 7.0 ⁇ g/ml cytochalasin B.
  • TCM-199 [Life Technologies] with 0.6 mM NaHC0 3 , 2.9 mM Hepes, 30 mM NaCl, 10 ng/ml gentamicin, and 3 mg/ml BSA, with osmolarity of 305 mOsm
  • the reconstructed embryos were then fused in a fusion medium (0.3 M mannitol, 0.1 mM CaCi 2 , 0.1 mM MgCi2, and 0.5 mM Hepes) with two DC pulses (1-sec interval) at 1.2 kV/cm for 30 lsec using a BTX Electro Cell Manipulator (Harvard Apparatus).
  • fused embryos were fully activated with 200 ⁇ thimerosal for 10 min in the dark and 8 mM dithiothreitol for 30 min. Embryos were then incubated in modified porcine zygote medium PZM3-MU1 with 0.5 ⁇ Scriptaid (S7817; Sigma-Aldrich), a histone deacetylase inhibitor, for 14- 16 h, as described previously.
  • modified porcine zygote medium PZM3-MU1 with 0.5 ⁇ Scriptaid (S7817; Sigma-Aldrich), a histone deacetylase inhibitor, for 14- 16 h, as described previously.
  • Immature oocytes were aspirated from medium size (3- 6 mm) follicles using an 18-gauge hypodermic needle attached to a 10 ml syringe. Oocytes with evenly dark cytoplasm and intact surrounding cumulus cells were then selected for maturation.
  • TCM- 199 (Invitrogen) with 3.05 mM glucose, 0.91 mM sodium pyruvate, 0.57 mM cysteine, 10 ng/ml EGF, 0.5 ⁇ g/ml luteinizing hormone (LH), 0.5 ⁇ g/ml FSH, 10 ng/ml gentamicin (APP Pharm), and 0.1% polyvinyl alcohol for 42- 44 h at 38.5°C, 5% C0 2 , in humidified air.
  • IVF medium modified Tris-buffered medium containing 1 13.1 mM NaCl, 3 mM KC1, 7.5 mM CaC12, 1 1 mM glucose, 20 mM Tris, 2 mM caffeine, 5 mM sodium pyruvate, and 2 mg/ml bovine serum albumin [BSA]
  • BSA bovine serum albumin
  • Embryos generated to produce GE CD 163 or CD ID pigs were transferred into surrogates either on Day 1 (SCNT) or 6 (zygote injected) after first standing estrus. For Day 6 transfer, zygotes were cultured for five additional days in PZM3-MU1 in the presence of 10 ng/ml ps48 (Stemgent, Inc.). The embryos were surgically transferred into the ampullary-isthmic junction of the oviduct of the surrogate.
  • RNA coding for Cas9 and gRNA was injected into the cytoplasm of fertilized oocytes at 14 h postfertilization (presumptive zygotes) using a FemtoJet microinjector (Eppendorf). Microinjection was performed in manipulation medium on the heated stage of a Nikon inverted microscope (Nikon Corporation; Tokyo, Japan). Injected zygotes were then transferred into the PZM3-MU1 with 10 ng/ml ps48 until further use.
  • CRISPR 10 and a mix of all four CRISPRs resulted in a higher number of colonies with a modified genome than CRISPR 256 and 282 (Table 5, P ⁇ 0.002).
  • Transfection with CRISPR 10 and a plasmid containing Neo but no homology to CD 163 resulted in no colonies presenting the large deletion.
  • one monoallelic deletion was also detected when the donor DNA was introduced without any CRISPR. This assay likely represents an underestimation of the mutation rate because any potential small deletions by sequencing which could not be detected on an agarose gel in the transfected somatic cells were not screened for.
  • the one colony with HR represents a partial HR event.
  • CRISPR/Cas9-induced mutations without drug selection was tested; the fetal fibroblast cell line used in this study already had an integration of the Neo resistant cassette and a knockout of SIGLEC 1.
  • CRISPR 131 was selected for this trial because in the previous experiment, it resulted in a high number of total colonies and an increased percentage of colonies possessing a modified genome.
  • Increasing amounts of CRISPR 131 DNA from 3 : 1 to 20: 1 did not have a significant effect on fetal fibroblast survivability.
  • CD163 and CDID knockout pigs The cells presenting modification of CD 163 or CDID were used for SCNT to produce CD163 and CDID knockout pigs (Fig. 3). Seven embryo transfers (CD163 Table 8), six embryo transfers (CD 163 -No Neo), and five embryo transfers (CDID) into recipient gilts were performed with SCNT embryos from male and female fetal fibroblasts transfected with
  • the male piglet had a biallelic modification of CD163 with a 28 bp deletion in exon 7 on one allele and a 1387 bp deletion on the other allele that included a partial deletion of exon 7 and complete deletion of exon 8 and the proceeding intron, thus removing the intron exon junction.
  • the female piglets had a biallelic mutation of CD 163, including a 1382 bp deletion with a 1 1 bp insertion on one allele and a 1720 bp deletion of CD 163 on the other allele.
  • a summary of the CD 163 modifications and the predicted translations can be found in Table 10.
  • a summary of the CDID modifications and predicted translations by CRISPR modification can be found in Table 11.
  • CD163 CRISPR NT line represents embryos created by NT with a fetal fibroblast line modified by transfection.
  • CRISPR injected embryos were IVF embryos injected at the 1 cell stage with CD163 guide RNA with CAS9 RNA.
  • CD163 CRISPR T-no Neo fetal line represents embryos created by NT with a previously modified fetal fibroblast that was already Neo resistant line modified by transfection without the use of a selectable marker.
  • ⁇ MU refers to gilt oocytes that were aspirated and matured at the University of Missouri as described in the IVF se4ction of the Materials and Methods.
  • ART refers to sow oocytes that were purchased and matured as described in the SCNT section of the Materials and Methods.
  • CD ID CRISPR NT line represents embryos created by NT with a fetal fibroblast line modified by transfection.
  • CRISPR injected embryos were IVF embryos injected at the 1 cell stage with CD1D guide RNA with CAS9 RNA.
  • ⁇ MU refers to gilt oocytes that were aspirated and matured at the University of Missouri as described in the IVF se4ction of the Materials and Methods.
  • ART refers to sow oocytes that were purchased and matured as described in the SCNT section of the Materials and Methods.
  • SEQ ID NOs. in this column refer to the SEQ ID NOs. for the sequences that show the INDELs in relation to SEQ ID NO: 47. a The inserted sequence was TACTACT (SEQ ID NO: 1 15)
  • the inserted sequence was a single adenine (A) residue.
  • the inserted sequence was TGTGGAGAATTC (SEQ ID NO: 116).
  • the inserted sequence was AGCCAGCGTGC (SEQ ID NO: 117).
  • CD ID with two CRISPRs was also effective because all the embryos (23/23) showed a modification of CD ID. However, we could only find the designed deletion of CD ID in two embryos (2/23) (Fig. 6B). We also found 5/23 embryos possessing mosaic genotypes, but the rest of embryos had either homozygous or biallelic modification of CD ID. Finally, we tested whether multiple genes can be targeted by the CRISPR/Cas9 system within the same embryo. For this purpose, targeting both CD 163 and eGFP was performed in the zygotes that were fertilized with heterozygous eGFP semen.
  • CD ID For CD ID, one pregnancy also produced four piglets (litter 166 from recipient sow identification no. 0165): one female and three males (Table 9).
  • One piglet (166-1) did carry a mosaic mutation of CD1D, including a 362 bp deletion that completely removed exon 3 that contains the start codon (Fig. 8).
  • One piglet contained a 6 bp insertion with a 2 bp mismatch on one allele with a large deletion on the other allele.
  • Two additional piglets had a biallelic single bp insertion. There were no mosaic mutations detected for CD 163.
  • CRISPR CRISPR/Cas9 endonucleases. Higher concentrations of CRISPRs might improve targeting efficiency in somatic cells although no statistical difference was found in these experimental results. This may suggest that CRISPR is a limiting factor in CRISPR/Cas9 system, but further validation is needed. Targeted cells were successfully used to produce GE pigs through SCNT, indicating the application of CRISPR/Cas9 does not affect the ability of the cells to be cloned. A few piglets were euthanized because of health issues; however, this is not uncommon in SCNT-derived piglets.
  • CD ID CRISPRs were designed across a greater area in the genome than CD 163; there was a 124 bp distance between CD 163 CRISPR 10 and 131 while there was a distance of 550 bp between CRISPR 4800 and 5350 for CD ID.
  • the longer distance between CRISPRs was not very effective in generating a deletion as shown in the study.
  • further study is need to verify the relationship between the distance between CRISPRs and probability of causing intended deletions.
  • the CRISPR/Cas9 system was also effective in targeting two genes simultaneously within the same embryo with the only extra step being the introduction of one additional CRISPR with crRNA. This illustrates the ease of disrupting multiples genes compared to other homing endonucleases. These results suggest that this technology may be used to target gene clusters or gene families that may have a compensatory effect, thus proving difficult to determine the role of individual genes unless all the genes are disrupted. Our results demonstrate that CRISPR/Cas9 technology can be applied in generating GE pigs by increasing the efficiency of gene targeting in somatic cells and by direct zygote injection.
  • Hai T Teng F, Guo R, Li W, Zhou Q.
  • Hai T Teng F, Guo R, Li W, Zhou Q.
  • Example 2 Increased resistance to PRRSV in swine having a modified chromosomal sequence in a gene encoding a CD163 protein
  • PRRSV Porcine Reproductive and Respiratory Syndrome Virus
  • Genotyping Genotyping was based on both DNA sequencing and mRNA sequencing.
  • the sire's genotype had an 1 1 bp deletion in one allele that when translated predicted 45 amino acids into domain 5, resulting in a premature stop codon at amino acid 64.
  • One sow had a 7 bp addition in one allele that when translated predicted the first 48 amino acids of domain 5, resulting in a premature stop codon at amino acid 70.
  • the other allele was uncharacterized (A), as there was no band from exon 7 by either PCR or long range 6.3 kb PCR.
  • the other 3 sows were clones and had a 129 bp deletion in exon 7 that is predicted to result in a deletion of 43 amino acids from domain 5.
  • the other allele was uncharacterized (B).
  • PRRSV Growth of PRRSV in culture and production of virus inoculum for the infection of pigs are covered under approved IBC application 973.
  • a type strain of PRRSV, isolate NVSL 97-7895 (GenBank # AF325691 2001-02-11), was grown as described in approved IBC protocol 973. This laboratory isolate has been used in experimental studies for about 20 years (Ladinig et al., 2015). A second isolate was used for the 2 nd trial, KS06-72109 as described previously (Prather et al, 2013).
  • PRRSV is present in body fluids during infection; therefore, blood samples were collected and stored at -80°C until measured to determine the amount or degree of viremia in each pig.
  • pigs were weighed and humanely euthanized, and tissues collected and fixed in 10% buffered formalin, embedded in paraffin, and processed for histopathology by a board-certified pathologist,
  • Phenotype Scoring of the Challenged pigs The phenotype of the pigs was blindly scored daily as follows: What is the attitude of the pig? Attitude Score: 0: BAR, 1 : QAR, 2: Slightly depressed, 3 : Depressed, 4: Moribund. What is the body condition of the pig? Body Condition Score: 1 : Emaciated, 2: Thin, 3 : Ideal, 4: Fat, 5: Overfat/Obese. What is the rectal temperature of the pig? Normal Body Temperature 101.6-103.6 (Fever considered > 104). Is there any lameness (grade)? What limb? Evaluate limbs for joint swelling and hoof lesions (check bottom and sides of hoof).
  • Lameness Score 1 : No lameness, 2: Slightly uneven when walking, appears stiff in some joints but no lameness, 3: Mild lameness, slight limp while walking, 4: Moderate lameness, obvious limp including toe touching lame, 5: Severe lameness, non-weight bearing on limb, needs encouragement to stand/walk. Is there any respiratory difficulty (grade)? Is there open mouth breathing? Is there any nasal discharge (discharge color, discharge amount: mild/moderate/severe)? Have you noticed the animal coughing? Is there any ocular discharge?
  • Respiratory Score 0: Normal, 1 : mild dyspnea and/or tachypnea when stressed (when handled), 2: mild dyspnea and/or tachypnea when at rest, 3 : moderate dyspnea and/or tachypnea when stressed (when handled), 4: moderate dyspnea and/or tachypnea when at rest, 5: severe dyspnea and/or tachypnea when stressed (when handled), 6: severe dyspnea and/or tachypnea when at rest. Is there evidence of diarrhea (grade) or vomiting? Is there any blood or mucus?
  • Diarrhea Score 0: no feces noted, 1 : normal stool, 2: soft stool but formed (soft serve yogurt consistency, creates cow patty), 3: liquid diarrhea of brown/tan coloration with particulate fecal material, 4: liquid diarrhea of brown/tan coloration without particulate fecal material, 5: liquid diarrhea appearing similar to water.
  • This scoring system was developed by Dr. Megan Niederwerder at KSU and is based on the following publications (Halbur et al, 1995; Merck; Miao et al, 2009; Patience and Thacker, 1989; Winckler and Willen, 2001). Scores and temperatures were analyzed by using ANOVA separated based on genotypes as treatments.
  • Viremia was determined via two approaches. Vims titration was performed by adding serial 1 : 10 dilutions of serum to confluent MARC- 145 cells in a 96 well-plate. Serum was diluted in Eagle's minimum essential medium supplemented with 8% fetal bovine serum, penicillin, streptomycin, and amphotericin B as previously described (Prather et al., 2013). The cells were examined after 4 days of incubation for the presence of a cytopathic effect by using microscope. The highest dilution showing a cytopathic effect was scored as the titration endpoint.
  • RNA was isolated from serum by using the Life Technologies MagMAX-96 viral RNA isolation kit for measuring viral nucleic acid.
  • the reverse transcription polymerase chain reaction was performed by using the EZ-PRRSV MPX 4.0 kit from Tetracore on a CFX-96 real-time PCR system (Bio-Rad) according to the manufacturer's instructions. Each reaction (25 ⁇ ) contained RNA from 5.8 ⁇ of serum.
  • the standard curve was constmcted by preparing serial dilutions of an RN A control supplied in the kit (Tetracore). The number of templates per PCR are reported.
  • PAMs Porcine alveolar macrophages
  • the plates were washed 30 min later and microspheres were resuspended in 100 ⁇ of phosphate buffered saline containing 10% goat serum an analyzed by using the MAGPIX and the Luminex xPONENT 4.2 software. Mean fluorescence intensity (MFI) is reported.
  • the wild-type Wild Type (CD163+/+) pigs showed early signs of PRRSV infection, which peaked at between days 5 and 14 and persisted in the group during the remainder of the study. The percentage of febrile pigs peaked on about day 10.
  • Null (CD163-I-) piglets showed no evidence of clinical signs over the entire study period. The respiratory signs during acute PRRSV infection are reflected in significant histopathological changes in the lung (Table 9). The infection of the wild type pigs showed histopathology consistent with PRRS including interstitial edema with the infiltration of mononuclear cells (Fig. 10). In contrast there was no evidence for pulmonary changes in the Null (CD163-I-) pigs.
  • Peak clinical signs correlated with the levels of PRRSV in the blood The measurement of viral nucleic acid was performed by isolation of total RNA from serum followed by amplification of PRRSV RNA by using a commercial reverse transcriptase realtime PRRSV PCR test (Tetracore, Rockville, MD). A standard curve was generated by preparing serial dilutions of a PRRSV RNA control, supplied in the RT-PCR kit and results were standardized as the number templates per 50 ⁇ PCR reaction. The PRRSV isolate followed the course for PRRSV viremia in the wild type CD163+/+ pigs (Fig. 11). Viremia was apparent at day four, reached a peak at day 11 and declined until the end of the study.
  • porcine alveolar macrophages were removed by lung lavage and stained for surface expression of SIGLECl (CD 169, clone 3B1 1/1 1) and CD163 (clone 2A10/1 1), as described previously (Prather et al, 2013). Relatively high levels of CD163 expression were detected on CD163+/+ wild type animals (Fig. 13). In contrast, CD163-I- pigs showed only background levels of anti-CD 163 staining, thus confirming the knockout phenotype. Expression levels for another macrophage marker CD 169 were similar for both wild type and knockout pigs (Fig. 14). Other macrophage surface markers, including MHC II and CD 172 were the same for both genotypes (data not shown).
  • PRRS The most clinically relevant disease to the swine industry is PRRS. While vaccination programs have been successful to prevent or ameliorate most swine pathogens, the PRRSV has proven to be more of a challenge. Here CD 163 is identified as an entry mediator for this viral strain.
  • the founder boar was created by injection of CRISPR/Cas9 into zygotes (Whitworth et al, 2014) and thus there is no transgene. Additionally one of the alleles from the sow (also created by using CRISPR/Cas9) does not contain a transgene. Thus piglet #40 carries a 7 bp addition in one allele and a 1 1 bp deletion in the other allele, but no transgene.
  • virus-resistance alleles of CD 163 represent minor genome edits considering that the swine genome is about 2.8 billion bp (Groenen et al, 2012). If similarly created animals were introduced into the food supply, significant economic losses could be prevented.
  • CD163 is the macrophage scavenger receptor for native and chemically modified hemoglobins in the absence of haptoglobin. Blood 107, 373-380.
  • Hemophagocytic macrophages constitute a major compartment of heme oxygenase expression in sepsis. European journal of haematology 77, 432-436.
  • SEQ ID NO:2 nucleotide CRISPR 131
  • SEQ ID NO: 3 nucleotide CRISPR 256
  • SEQ ID NO: 1 nucleotide forward primer 9538 fragment
  • SEQ ID NO: 13 nucleotide forward primer 8729 fragment
  • SEQ ID NO: 14 nucleotide forward primer 8729 fragment
  • SEQ ID NO: 110 nucleotide Allele with 1930 bp deletion in exon 6, 129 bp deletion in exon and 12 bp insertion

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Environmental Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Animal Husbandry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Biodiversity & Conservation Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Veterinary Medicine (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Toxicology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Cell Biology (AREA)
  • Immunology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Virology (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)

Abstract

La présente invention concerne des animaux non humains et leur descendance, comprenant au moins une séquence chromosomique modifiée dans un gène codant pour une protéine CD163. Des cellules animales qui contiennent de telles séquences chromosomiques modifiées sont également décrites. Les animaux et les cellules présentent une résistance accrue à des agents pathogènes, y compris le virus du syndrome reproducteur et respiratoire porcin (PRRSV). Les animaux et leur descendance présentent des modifications chromosomiques d'un gène CD163. L'invention concerne en outre des procédés d'amélioration génétique permettant de créer des animaux et des populations d'animaux résistants à des agents pathogènes produits au moyen de tels procédés.
PCT/US2015/044113 2015-08-06 2015-08-06 Animaux résistants à des agents pathogènes ayant des gènes cd163 modifiés WO2017023337A1 (fr)

Priority Applications (7)

Application Number Priority Date Filing Date Title
CA2993435A CA2993435A1 (fr) 2015-08-06 2015-08-06 Animaux resistants a des agents pathogenes ayant des genes cd163 modifies
KR1020187005189A KR102495662B1 (ko) 2015-08-06 2015-08-06 변형된 cd163 유전자를 갖는 병원균-내성 동물
KR1020247003232A KR20240017121A (ko) 2015-08-06 2015-08-06 변형된 cd163 유전자를 갖는 병원균-내성 동물
KR1020237003410A KR102631856B1 (ko) 2015-08-06 2015-08-06 변형된 cd163 유전자를 갖는 병원균-내성 동물
PCT/US2015/044113 WO2017023337A1 (fr) 2015-08-06 2015-08-06 Animaux résistants à des agents pathogènes ayant des gènes cd163 modifiés
AU2015404563A AU2015404563B2 (en) 2015-08-06 2015-08-06 Pathogen-resistant animals having modified CD163 genes
AU2023200913A AU2023200913A1 (en) 2015-08-06 2023-02-16 Pathogen-resistant animals having modified cd163 genes

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/US2015/044113 WO2017023337A1 (fr) 2015-08-06 2015-08-06 Animaux résistants à des agents pathogènes ayant des gènes cd163 modifiés

Publications (1)

Publication Number Publication Date
WO2017023337A1 true WO2017023337A1 (fr) 2017-02-09

Family

ID=57943379

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2015/044113 WO2017023337A1 (fr) 2015-08-06 2015-08-06 Animaux résistants à des agents pathogènes ayant des gènes cd163 modifiés

Country Status (4)

Country Link
KR (3) KR102495662B1 (fr)
AU (2) AU2015404563B2 (fr)
CA (1) CA2993435A1 (fr)
WO (1) WO2017023337A1 (fr)

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018073237A1 (fr) * 2016-10-17 2018-04-26 The University Court Of The University Of Edinburgh Porcs comprenant le gène cd163 modifié et procédés associés
CN108753832A (zh) * 2018-04-20 2018-11-06 中山大学 一种利用CRISPR/Cas9编辑大白猪CD163基因的方法
CN108823248A (zh) * 2018-04-20 2018-11-16 中山大学 一种利用CRISPR/Cas9编辑陆川猪CD163基因的方法
EP3331355A4 (fr) * 2015-08-06 2019-04-03 The Curators of the University of Missouri Animaux résistant aux pathogènes ayant des gènes cd163 modifiés
WO2019090237A1 (fr) * 2017-11-03 2019-05-09 Genus Plc Éditions d'adn sélectivement ciblées chez le bétail
CN112313330A (zh) * 2018-04-27 2021-02-02 密苏里大学管理者 具有经修饰氨肽酶n(anpep)基因的抗病原体动物
US11160260B2 (en) 2018-04-17 2021-11-02 The Curators Of The University Of Missouri Methods for protecting porcine fetuses from infection with porcine reproductive and respiratory syndrome virus (PRRSV)
US11208659B2 (en) 2020-05-05 2021-12-28 Genus Plc Pig with a genetically modified CD163 gene resistant to PRRSv

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030237106A1 (en) * 2002-04-03 2003-12-25 Gorczynski Reginald M. Transgenic animal containing CD200 and uses therefor
US20110016546A1 (en) * 2008-12-04 2011-01-20 Sigma-Aldrich Co. Porcine genome editing with zinc finger nucleases
US20130309263A1 (en) * 2012-05-17 2013-11-21 Zoetis Llc Effective vaccination against porcine reproductive and respiratory syndrome (prrs) virus prior to weaning

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102627319B1 (ko) * 2011-05-16 2024-01-23 더 큐레이터스 오브 더 유니버시티 오브 미주리 돼지 생식기 호흡기 증후군 바이러스 내성 동물
GB201313235D0 (en) * 2013-07-24 2013-09-04 Univ Edinburgh Antiviral Compositions Methods and Animals

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030237106A1 (en) * 2002-04-03 2003-12-25 Gorczynski Reginald M. Transgenic animal containing CD200 and uses therefor
US20110016546A1 (en) * 2008-12-04 2011-01-20 Sigma-Aldrich Co. Porcine genome editing with zinc finger nucleases
US20130309263A1 (en) * 2012-05-17 2013-11-21 Zoetis Llc Effective vaccination against porcine reproductive and respiratory syndrome (prrs) virus prior to weaning

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3331355A4 (fr) * 2015-08-06 2019-04-03 The Curators of the University of Missouri Animaux résistant aux pathogènes ayant des gènes cd163 modifiés
US10827730B2 (en) 2015-08-06 2020-11-10 The Curators Of The University Of Missouri Pathogen-resistant animals having modified CD163 genes
WO2018073237A1 (fr) * 2016-10-17 2018-04-26 The University Court Of The University Of Edinburgh Porcs comprenant le gène cd163 modifié et procédés associés
WO2019090237A1 (fr) * 2017-11-03 2019-05-09 Genus Plc Éditions d'adn sélectivement ciblées chez le bétail
US11160260B2 (en) 2018-04-17 2021-11-02 The Curators Of The University Of Missouri Methods for protecting porcine fetuses from infection with porcine reproductive and respiratory syndrome virus (PRRSV)
CN108753832A (zh) * 2018-04-20 2018-11-06 中山大学 一种利用CRISPR/Cas9编辑大白猪CD163基因的方法
CN108823248A (zh) * 2018-04-20 2018-11-16 中山大学 一种利用CRISPR/Cas9编辑陆川猪CD163基因的方法
CN112313330A (zh) * 2018-04-27 2021-02-02 密苏里大学管理者 具有经修饰氨肽酶n(anpep)基因的抗病原体动物
US11208659B2 (en) 2020-05-05 2021-12-28 Genus Plc Pig with a genetically modified CD163 gene resistant to PRRSv
US11535850B2 (en) 2020-05-05 2022-12-27 Genus Plc Methods for improving the health of porcine species by targeted inactivation of CD163
CN117487855A (zh) * 2020-05-05 2024-02-02 吉纳斯公司 通过对cd163靶向灭活来改善猪类健康的方法

Also Published As

Publication number Publication date
AU2023200913A1 (en) 2023-04-27
KR102495662B1 (ko) 2023-02-06
KR20180033548A (ko) 2018-04-03
KR20240017121A (ko) 2024-02-06
KR102631856B1 (ko) 2024-02-01
KR20230021174A (ko) 2023-02-13
AU2015404563A1 (en) 2018-02-15
CA2993435A1 (fr) 2017-02-09
AU2015404563B2 (en) 2022-11-17

Similar Documents

Publication Publication Date Title
US20240122164A1 (en) Pathogen-resistant animals having modified cd163 genes
AU2015404563B2 (en) Pathogen-resistant animals having modified CD163 genes
US11160260B2 (en) Methods for protecting porcine fetuses from infection with porcine reproductive and respiratory syndrome virus (PRRSV)
AU2020267283B2 (en) Nanos knock-out that ablates germline cells
US20200236914A1 (en) Pathogen-resistant animals having modified aminopeptidase n (anpep) genes
JP2023098940A (ja) ウイルス感染からブタ胎児を保護するための方法

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 15900596

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2993435

Country of ref document: CA

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2015404563

Country of ref document: AU

Date of ref document: 20150806

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 20187005189

Country of ref document: KR

Kind code of ref document: A

122 Ep: pct application non-entry in european phase

Ref document number: 15900596

Country of ref document: EP

Kind code of ref document: A1