WO2017010805A1 - Microorganism prototyping genetic circuit-based system for searching for novel microorganism resources - Google Patents

Abstract

The present invention relates to: a genetic circuit comprising a gene encoding a transcriptional regulatory factor expressed by sensing phenol, and a downstream reporter gene operated by the transcriptional regulatory factor; a sensor cell comprising the genetic circuit; and a method for sensing and searching for, directly from natural specimens, novel microorganism strains or genetic resources having target enzyme activity, by using the sensor cell and a phenol-tag substrate. The genetic circuit and the sensor cell comprising the same, of the present invention, comprise, as reporter genes, a fluorescent protein together with an auxotrophy-related enzyme for controlling the survival of the sensor cell, thereby enabling easy identification, by a simple method of co-culturing the sensor cell and an unknown microorganism strain having a desired target enzyme activity and measuring the fluorescence thereof, of novel microorganism strains or genetic resources having the corresponding target enzyme activity. Additionally, by introducing the dual reporter system, visible and clearer confirmation, of whether the target enzyme is activated, is enabled. Moreover, when searching for useful resources directly from nature, the possibility of target enzyme gene expression and the simplicity of experimentation can be maximized since the process of DNA separation and library construction is not performed and the use of antibiotics is limited, and the GMO/LMO problems caused by recombinant microorganisms can be minimized by directly using natural microorganisms having high activity.

Description

New microbial resource search system based on microbial prototyping gene circuit

The present invention is a substrate containing a "phenolic compound" that can be used to detect intracellular enzyme activity, a gene encoding a transcriptional regulator that is expressed by detecting a phenolic compound and a lower reporter gene operated by the transcriptional regulator Gene circuit comprising, sensor cell comprising the gene circuit, and new microbial strains having the activity of the target enzyme using the sensor cell co-cultured with the sensor cell to directly detect and search for the activity It is about how to.

Recently, researches applying directed evolution to secure new gene sources from microbial genomes or metagenomes, or to improve the activity of existing genes and develop them into highly useful biocatalysts have been conducted. As an important strategy, the development of new high-sensitivity detection technology that detects trace amounts of enzyme activity at high speed is required.

As a method of acquiring new enzyme genes from various gene sources such as microbial genomes and environmental DNA (metagenome), sequence-based search technology is performed to identify DNA sequences, perform PCR reactions, and obtain amplified genes. screening). As the genomic information is rapidly increasing, its utility is increasing day by day, and there is an advantage that only the desired gene can be specifically selected, but it can be used only when the exact information of the target gene is known. There is a drawback that the applicable subject is limited to a part of the genetic source.

In contrast, activity-based screening techniques for selecting genes based on gene function, ie, enzyme activity, are also widely used. In order to explore the enzymatic activity by this method, the method of separating microorganisms directly from environmental samples such as soil, river, factory wastewater, seawater and forest has been mainly used. Less than 1%, only a very small amount. In recent years, a strategy has been actively attempted to construct genetic resources in the form of metagenome libraries by separating DNA directly from environmental samples without culturing microorganisms. Accordingly, there is also a great interest in the development of screening techniques to directly detect industrially useful enzyme activity in the metagenome library.

High-speed assay techniques for enzymatic activity include (1) automated multi-analysis techniques using well-plates, (2) observing color or halo in solid media, and (3) deficient microorganisms. The selective separation method used is mainly used. These methods have the advantage of clearly selecting the genes of the desired function because they are based on the actual activity of the enzyme, but there is a limitation in the versatility of the technology because it requires one detection technology to match the individual enzyme activity. In addition, the effect is further reduced when there is a problem such as low transcription, translation, or expression of foreign genes in the host cell or protein folding, secretion. Indeed, new enzymes derived from gene sources of high genetic diversity such as novel microorganisms and metagenomes and whose genetic characteristics are unknown, have very low expression levels in recombinant microorganisms, making it difficult to apply such high-speed assays. Accordingly, there has been a continuous demand for the development of a new high-speed search technology that can detect even very small amounts of enzyme activity with high sensitivity.

On the other hand, research on a technique for detecting a phenolic compound is known (Korean Patent Publication No. 10-0464068), and also some research on applying to the search for a variety of enzyme activity using it (In Korean) Publication No. 10-2010-0131955), foreign cell culture and gene expression due to the use of antibiotics, DNA isolation, library construction, etc., and thus the detection of a novel microbial strain that retains the activity of the target enzyme And how it can be searched is unknown.

Accordingly, the present inventors have developed a gene circuit composed of a transcriptional regulator in which its expression is induced by phenol and a lower reporter gene actuated by the transcriptional regulator and a sensor cell comprising the same. Instead of separating the DNA of the microorganism to search for the target enzyme and constructing a library, simply cultivating the sensor cell and the microorganism or the natural environmental sample itself without antibiotics to easily identify and isolate the microorganism resource holding the enzyme. The present invention has been completed by revealing that it can be achieved.

The present invention provides a substrate comprising a "phenolic compound" that can be used to detect intracellular enzymatic activity, a gene encoding a transcriptional regulator that is expressed by detecting a phenolic compound, and a lower reporter gene operated by the transcriptional regulator. A method for detecting and detecting the activity of a novel microbial strain possessing the activity of a target enzyme using a gene circuit comprising, a sensor cell comprising the gene circuit, and a substrate comprising the sensor cell and the phenolic compound. The purpose is to provide.

In order to achieve the above object, the present invention is (1) the gene expression control region, the first promoter whose activity is regulated by the gene expression control region, and the expression is regulated by the activation of the first promoter, fluorescent protein A first gene construct comprising; a reporter gene comprising a gene encoding a gene and a gene encoding an enzyme involved in nutritional requirements (auxotrophic); And (2) a gene of a transcriptional regulator that regulates expression by the second promoter and the second promoter and binds to the gene expression control site only in the presence of a phenolic compound to activate the second promoter. It provides a genetic circuit for detecting the presence of a phenolic compound, including; a second gene construct.

The present invention also provides a sensor cell comprising the gene circuit.

In addition, the present invention provides a method for detecting and searching for a novel microbial strain retaining the activity of the target enzyme using a substrate comprising the "phenolic compound" that can be used for detecting the sensor cell and intracellular enzyme activity. do.

Hereinafter, the present invention will be described in detail.

The present invention

(1) gene expression control site, a first promoter whose activity is regulated by the gene expression control site, and genes whose expression is regulated by activation of the first promoter, and enzymes involved in nutritional and nutritional components A reporter gene comprising a gene encoding a; a first gene construct comprising; And

(2) a second promoter and a gene of a transcriptional regulator that regulates expression by the second promoter and binds to the gene expression control site only in an environment where a phenolic compound is present to activate the second promoter Including a second gene construct;

Genetic circuits for detecting the presence of phenolic compounds are provided.

In this specification, unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In general, the nomenclature used herein and the experimental methods described below are well known and commonly used in the art.

The present invention relates to a technology (MP-GESS: Microbe prototyping based genetic enzyme screening system) to easily identify and isolate a novel microbial resource retaining the target enzyme activity in nature using a genetic circuit.

In the present invention, "phenolic compound" is a substrate that can be used to detect the enzyme activity in the cell, phenol, 2-chlorophenol, 2-iodine phenol, 2-fluorophenol, o-cresol, 2-ethylphenol, m-cresol, 2-nitrophenol, catechol, 2-methoxyphenol, 2-aminophenol, 2,3-dichlorophenol, 3-chlorophenol, 2,3-dimethylphenol, 3-nitrophenol, 4-chloro Phenol, p-cresol, 2,5-dichlorophenol, 2,5-dimethylphenol and the like. Substrates containing such "phenolic compounds" are also referred to as "phenol-tag substrates."

In the present invention, the reporter gene and the first promoter for regulating the expression of the reporter gene are operably linked.

In the present invention, the site where the transcriptional regulator binds to induce the expression of the downstream reporter gene activates the first promoter of the reporter gene such that the transcriptional regulator binds to express the downstream reporter gene. It is done.

In the present invention, a gene encoding a transcriptional regulator that recognizes the phenolic compound and induces expression of a downstream reporter protein and a second promoter that regulates the expression of the transcriptional regulator are operably linked. It features.

In the present invention, the "transcription regulator" is a protein that preferably regulates the expression of the degradation enzyme of the substrate including the phenolic compound, and operates a promoter that controls the expression of the phenolic compound degradation enzyme by detecting phenol. And a protein inducing expression of a reporter linked to such a promoter. In relation to the "transcription regulator", genes that show the degradation activity of aromatic organic compounds such as phenol, xylene, toluene, and benzene are mainly found in the genus Pseudomonas and Acinetobacter, and these genes are multifunctional with multigene expression. It is composed of operon and expressed by σ ⁵⁴ dependent transcriptional regulation. Representative transcriptional regulators include DmpR, DmpR variant, XylR, MopR, PhhR, PhlR, TbuT, etc. Among them, DmpR, which is involved in phenol degradation metabolism in Pseudomonas putida, and XylR, which is involved in metabolism of toluene and xylene, are the most It is well known. In particular, the use of DmpR or XylR to detect toluene, xylene or phenol contaminated with the natural environment has been studied in the concept of microbial biosensor. This NtrC family expression regulator is a combination of a domain that recognizes activators such as phenol and xylene (A domain), a domain that has ATPase activity (C domain), and a domain that binds to DNA (D domain). It is composed. Therefore, in the absence of a phenol molecule, the A domain inhibits transcription. However, when the phenol molecule binds to inhibit the A domain, the transcriptional activation function of the C and D domains appears. Recently, studies on improving specificity through research using genetics and genetic engineering methods using specificity of A domain have been known.

Accordingly, the transcriptional regulator preferably used in the present invention may be dmpR, or a variant thereof, which is a regulatory protein of P. putida-derived phenol-degrading operon. dmpR is the σ ⁵⁴ -dependent transcriptional activity regulatory portion of the dmp operon gene, which shows the degradation activity of aromatic organic compounds such as phenol, xylene, toluene and benzene. The dmp operon derived from P. putida consists of 15 genes, among which dmpKLMNOP codes for the enzymes required for phenol hydroxylation, and dmpQBCDEFGHI codes for the metalytic pathway that degrades catechol intermediates. dmpKLMNOP of operon expression is σ54-dependent transcription factor in dmpR is activated by binding to the operator of the dmp dmpK top, transcription factors for dmpR itself is known as σ ⁷⁰ dependent. In addition, the variant of dmpR is, for example, E135K, where the 135th E of the dmpR amino acid sequence is K-mutated, in addition to E172K, D135N, D135N and E172K, F65L, L184I, F42Y, R109C, L113V, D116N, F122L, K6E And one or more of F42S, Q10R and K117M, Q10R, D116G and K117R, D116V may be a variant in which amino acid residues are mutated, but is not limited thereto, and the variant may have a high affinity for a phenolic compound, thus Various variants, including single or multiple mutations at the periphery, as well as variants of various dmpRs may be included within the scope of the present invention.

In the present invention, the "gene expression control site" is a site that controls the entire gene circuit. In the absence of a phenolic molecule, the transcriptional regulator inhibits transcription, but when the phenolic molecule binds to inhibit the A domain, transcriptional activation function by C and D domains appears to bind to the OpR (Operator for Reporter) site. Which is modulated by σ ⁵⁴ dependency.

In the present invention, "promoter" means a promoter that regulates the expression of a transcriptional regulator or a promoter that controls the expression of a reporter protein. For example, a promoter of dmpR or dmp operon of Pseudomonas or a promoter for general protein expression may be High expression promoters, including trc, T7, lac and ara promoters, may be used for high expression of foreign proteins. In particular, Phce, which is a high expression vector that does not require an inducer, may be used. For example, σ ⁵⁴ -dependent promoter (PECO) of E. coli may be used as a promoter for regulating the expression of the reporter protein. In addition to this, it will be apparent to those skilled in the art to apply to Pseudomonas putida (PPPU), yeast (PYST) and the like depending on the host of MP-GESS.

In the present invention, the gene circuit may include not only the promoter, but preferably, a ribosome binding site (RBS) and / or a transcription terminator that facilitates expression of the reporter protein. That is, as a site for controlling the expression of the regulatory protein, in addition to the promoter may include RBS and / or transcription terminator.

In general, protein expression starts with AUG (methionine) or GUG (valine), which is an initiation codon in mRNA, and the distinction between AUG or GUG where the ribosome is located at a residue inside the protein and AUG and GUG as protein initiation codon is the purine base of DNA. Is determined by a rich RBS (or Shine-Dalgarno (SD) sequence), which is known to differ in sequence from species to species. According to a preferred embodiment of the present invention, the gene circuit constructed in the present invention uses a transcriptional regulator of Pseudomonas, which is different from E. coli, which is a host of the gene circuit, in the case of σ ⁵⁴ dependent gene expression. Since σ ⁵⁴ binding sites and σ ⁵⁴ factors themselves are very different from E. coli, they are used in combination with Pseudomonas RBS (RBSPPU), or E. coli RBS (RBSε), or all strains to facilitate the expression of reporter proteins in host E. coli. Possible RBS (RBSx) can be used.

In the present invention, the transcription terminator may preferably be rrnBT1T2 or tL3, and in addition to this, the transcription terminator may be used to construct the present invention using any transcription terminator commonly used in the art.

In the present invention, the reporter protein is composed of a fluorescent protein and an enzyme involved in trophic composition. As the fluorescent protein, preferably, GFP, GFP _UV , or RFP can be used, but as long as the object of the present invention can be achieved, the fluorescent protein that can be used in the present invention is not limited to these examples. In addition, the enzymes involved in the nutritional constituents lose the ability of microorganisms to synthesize certain amino acids, nucleotide groups, vitamins, etc., due to mutations, and thus cannot grow in the medium, and thus, the components that cannot be synthesized as nutrients necessary for growth. The required auxotroph represents an enzyme that allows the synthesis of the deficient substance. There are a number of such mutants, but not limited thereto, including arginine requirement, methionine requirement, thymine requirement, and the like. In addition, even with the same arginine requirement, various kinds of growth may occur, depending on the stage of inhibition of the arginine biosynthesis pathway: ① grown only with arginine, ② grown with citrulline instead of arginine, ③ grown with arginine, citrulline, ornithine. Can be. According to a preferred embodiment of the present invention, enzymes involved in nutrient composition include but not limited to DAAT (D-amino acid aminotransferase) enzyme, which allows the glutamic acid nutrient component microorganism to survive in an environment deficient in glutamic acid. It doesn't happen.

According to a preferred embodiment of the invention, the reporter may be a dual reporter (dual reporter) consisting of both fluorescent proteins and enzymes involved in nutrition, and multiple reporters consisting of two or more reporters. In accordance with the present invention, any known method may be used for the sequential transformation of metagenome libraries and phenol sensing redesign gene circuits into suitable microbial hosts. In order to increase the efficiency of transformation, electroporation may be preferably used.

The present invention also provides a sensor cell comprising the gene circuit.

In the present invention, the genetic circuit may be provided in the form of a vector or a microorganism containing the vector.

In the present invention, the cell is preferably, but is not limited to any bacteria, such as E. coli, fungi, such as yeast, plant cells, animal cells and the like.

The Escherichia coli may be a trophyotrophic host cell, and preferably, glutamic acid trophyotrophic host cell, but is not limited thereto.

The present invention also provides a method for detecting and searching for a novel microbial strain retaining the activity of the target enzyme using the sensor cell.

The method is

(1) designing a phenol-tag substrate in which a phenolic compound can be produced by the activity of a desired enzyme;

(2) treating the phenol-tag substrate with a natural microorganism strain or an environmental sample including the same, which is expected to possess the target enzyme, and culturing the same with a sensor cell under an environment deficient in specific nutrients;

(3) identifying and selecting those in which the reporter protein is expressed among the cultured sensor cells; And

(4) separating the microbial strain adjacent to the selected sensor cell.

Step (2) may be co-cultured with the natural microbial strain or the environmental sample comprising the same is expected to have the target enzyme and mixed with the phenol-tag substrate and the sensor cell.

Or step (2) comprises: forming a colony by culturing in an environment in which the phenol-tag substrate is treated in a natural microorganism or an environmental sample comprising the same, which is expected to possess the target enzyme; And co-culturing the formed colonies and the sensor cells together. The sensor cells can be co-cultured by spraying the sensor cell culture onto colonies formed from natural microorganisms or environmental samples comprising the same.

The sensor cells can be used immediately after thawing without storage after storage at low temperature.

In one embodiment of the present invention, when incubated with the substrate tyrosine and the sensor cells E. coli, Citrobacter Prepundi cells or TPL, by the activity of the enzymes present in the Citrobacter Preundi or TPL expressing E. coli Phenolic compounds produced from tyrosine were found to fluoresce in the sensor cells around the Citrobacter Preundy or TPL expressing E. coli (FIG. 6C).

Similarly, in another embodiment of the present invention, after forming a colony by forming a colony on a culture medium containing tyrosine as a substrate, E. coli or Citrobacter prepundi or TPL, the colony sensor cells are sprayed and cultured, the sheet Fluorescence expressed by sensor cells in the vicinity of Lobacter Freundy or TPL producing E. coli was confirmed (FIG. 6D).

In the present invention, the nutrient may be glutamic acid, but is not limited thereto.

According to one embodiment of the invention, the phenol-tag substrate is designed according to the activity of the target enzyme in step (1). For example, the phenol-tag substrate includes a binding site that can be degraded by the activity of the enzyme of interest and phenol bound through the binding site. As described above, by specifically designing the phenol-tag substrate to be suitable for the activity of the target enzyme, that is, by designing the binding site or functional group or the like in accordance with the activity of the enzyme to be searched, the microorganism which simply produces a phenolic compound. In addition, it is possible to search for a microorganism having a target enzyme having various activities.

In addition, the sensor comprising the gene circuit in an environment in which a specific nutrient is deficient by treating the phenol-tag substrate to a natural microbial strain or an environmental sample including the same, which is expected to have a target enzyme in step (2). Incubate with cells. Since the genetic circuit introduced into the sensor cell contains the DAAT gene, even if the sensor cell is placed in an environment that is a trophogenic strain and lacks nutritional substances, the DAAT gene is expressed in the introduced genetic circuit. If you can, you can survive.

In addition, in step (3), the sensor cell in which the expression of the reporter protein is induced by the phenolic compound produced by the activity of the target enzyme is identified and selected. If the target enzyme is present in a natural microorganism strain or an environmental sample containing the same, a phenolic compound will be produced by the activity of the target enzyme when the phenol-tag substrate designed as described above is treated, and the phenolic compound thus produced. Since the compound will induce the expression of the reporter protein in the sensor cell in the vicinity of the natural microorganism strain or the environmental sample containing the same, it is possible to search for a novel strain having the target enzyme by confirming the expression of the reporter protein as described above. .

In addition, in step (4), the microbial strain adjacent to the sensor cell from which the expression of the reporter protein selected as described above is induced is isolated. The microbial strain isolated as described above has a target enzyme. In addition, the isolated microbial strain can be verified once again whether there is actually the activity of the target enzyme, 16s rRNA analysis can be identified which bacteria to the isolated microbial strain.

In addition, the timing of substrate addition can be controlled to separate the activation stages of the cell growth-redesigned genetic circuit in order to optimize the enzymatic reaction. Compounds capable of producing phenolic compounds by enzymatic reactions, ie, phenol-tag substrates, include esters (-, -OOC-) and ethers (ether, -OC-) modified with phenolic hydroxyl groups (hydroxy, -OH). , Glycoside (-O-Glc), phospho-ester (-O-PO3), ortho-, meta-, para- position alkyl (-CH ₃ ), hydroxyl (-OH), car Compound (-COOH), amino (-NH ₂ ), thiol (-SH), amide (amide, -NH-CO- or -CO-NH-), sulfide (-S-SH), halogen group (- Phenol derivatives or benzene ring compounds in which Cl, -Br, and -F) are introduced, but are not limited thereto.

For example, various phenol derivatives covalently linked to the phenol group may be used as the phenol-tag substrate according to the present invention. For example, ester compound (ester, -OOC-), ether compound (ether, -OC-), glycoside compound (glycoside, -O) prepared by modifying hydroxyl group (hydroxy, -OH) of phenol -Glc), phospho-ester (-O-PO ₃ ) as a substrate, esterase, lipase, glycosidase, phosphatase, pita It can be used for the purpose of detecting phytase activity.

In addition, the phenol-tag substrate is a new methyl group (-CH ₃ ), hydroxyl group (-OH), carboxyl (-COOH), amino group (-NH ₂ ), hydrogen sulfide in one position of ortho-, meta-, para- It may be a material prepared by introducing (-SH). When a substance having an amide bond (-NH-CO- or -CO-NH-) or a sulfide bond (-S-SH) at this position is used as a substrate, the phenolic compound linked through the amide group is amidase, pep It can be used for the purpose of detecting peptidase activity, and by using a phenol compound linked through a sulfide group, it can be used for the purpose of detecting intracellular redox levels. In addition, when a phenol compound linked to a new carbon bond, ie, Ph-C- (R), is used as the phenol-tag substrate, phenol-lyase activity that breaks down the carbon bond to produce phenol may be detected. . Benzene ring material may be used as the phenol-tag substrate, and in this case, oxidase activity such as monooxygenase and dioxygenase, which are involved in the oxidation of aromatic compounds, may be detected. Phenolic compounds bound to halogen, such as chlorine (Cl), bromine (Br) and fluorine (F), may also be used as the substrate. In this case, enzymatic activity of dehalogenation or isomerization that changes the position of halogen by acting on the above halogenated phenolic compound can be detected according to the present invention.

In the aforementioned various phenolic compounds, the activity of transferases that transfer covalent bonds to other organic molecules or syntheses that generate new covalent bonds can also be detected by the present invention. Therefore, using the various phenol-tag substrates presented in the present invention, specific hydrolase, oxido-reductase, isomerase, lyase, transfer Enzymes can be detected. In the present invention, the substrate used for detecting the enzyme activity in the cell is a phenol-tag substrate, and represents various synthetic substrates including phenol, o / p-nitrophenol, o / p-chlorophenol and the like. When appropriate enzymes act on these phenol-tag substrates, the phenolic material is produced from the original phenol-tag substrate. For example, when E. coli β-galactosidase (lacZ) acts on phenyl-β-glucoside, a phenol component is produced according to the enzyme activity.

According to an embodiment of the present invention, when an enzyme gene is introduced into a sensor cell containing a gene circuit for detecting a phenolic compound, and a phenol-tag substrate is treated to a microbial strain retaining the activity of a target enzyme, The concentration of the phenolic compound changes depending on the function and activity of the intracellular enzyme gene. Therefore, it is possible to easily identify microbial strains possessing the desired activity of the desired enzyme through the degree of reaction to fluorescence and nutrient composition by the expression-inducing function of the phenolic compound.

In addition, the fluorescent protein used as a reporter in the present invention and enzymes involved in nutritional urine composition can be applied not only to a high sensitivity measurement method, but also expressed in the cells because they are limited to specific cells without passing through the cell membrane. Individual characteristics of the foreign genes will be exercised. Therefore, since individual single cells serve as independent reactors and analyzers, a large amount of millions to tens of millions as a means of detecting the activity of expression-induced reporters by detecting phenolic compounds produced by enzymatic reactions. Samples may also be measured using a fluorescence flow cytometer (FACS), microcolony fluorescence image analysis, fluorescence spectrum analysis, mass screening using nutritional selection media.

Since the gene circuit of the present invention and the sensor cell including the same include a fluorescent protein as a reporter gene together with related enzymes in nutritional components for controlling the survival of the sensor cell, the novel sensor having the activity of the sensor cell and the desired target enzyme By simply measuring the fluorescence of colonies formed by culturing microbial resources or natural environmental samples together, it is easy to identify novel microbial strains having the activity of the target enzyme, and by introducing such a dual reporter system, The presence or absence of the activity of the target enzyme can be visually confirmed more clearly. In addition, when searching for useful resources directly in nature, co-culture with sensor cells without DNA isolation, library construction, and antibiotic use maximizes the expression potential of the target enzyme, facilitates experimentation, It is a useful technique that can avoid the GMO / LMO problem caused by recombinant microorganisms by directly using highly active microorganisms.

Figure 1 is a schematic diagram showing the main configuration of the microbial prototyping-based enzyme gene screening system (MP-GESS) of the present invention.

2 is a schematic diagram showing an operation of the MP-GESS construct of the present invention.

Figure 3 is a graph showing the growth and fluorescence by phenol of the trophyotrophic host comprising the MP-GESS construct of the present invention.

4A shows a system in which a phenolic compound inducing dmpR activation operates a GFP-coding gene or an antibiotic resistance gene, and FIG. 4A (B) shows that a target enzyme in a cell produces phenol from a substrate molecule, DmpR is activated by phenol and indicates the expression of downstream GFP coding genes. 4B is a diagram illustrating the introduction of a D-AAT coding gene at the N-terminus of EGFP and transformation of this system with WM335, a D-glutamate trophic host, and FIG. 4B (B). Screening system based on cell-cell communication. Phenolic molecules are used not only as enzyme activity markers but also as signal transmitters, and phenol activates the transcription factor (dmpR) to induce the expression of D-AAT and GFP-coding genes.

5 is a graph showing the extent of proliferation of transformants when antibiotic resistance genes or trophyotrophic genes are introduced into the phenotypic reporter.

Figure 6a shows a chemical reaction that shows the production of phenol, pyruvate and ammonia by the degradation of L-tyrosine by tyrosine-phenol lyase (TPL) enzyme.

Figure 6b shows two methods for detecting microorganisms with target enzyme activity using the sensor cells of the present invention.

6c is a result of verifying activity of sensor cells confirmed based on a one-step protocol.

6D is a result of verifying activity of sensor cells confirmed based on a two-step protocol.

Figure 7a shows a chemical reaction showing the production of p-nitrophenol and cellobiose by the degradation of pNPG2 by fibrinolytic enzymes, Figure 7b shows the process of searching for microorganisms having fibrinolytic activity in soil samples .

FIG. 8 is a photograph showing fluorescence images of four colonies isolated from soil from metagenome samples.

9 is a graph showing fibrinolytic activity on various substrates of the seven candidate microorganisms selected.

10 shows the distribution of the new strain sequence based open reading frame (ORF) function through RAST site analysis.

Figure 11 shows the results of sequence similarity analysis with other strains by comparison of the whole strain of the ORF sequence.

FIG. 12 is a comparison of the functions of Pseudomonas fluorescence Pf0-1 strains found to be the most similar strains by sequence comparison analysis with new strains. It is a graph showing the top ten functions of the function (left) only in the strain (left) and the function (right) only in the Pseudomonas fluorescein Pf0-1 strain.

13A and 13B are photographs showing images of Pseudomonas genus # 46-2 strains using a scanning electron microscope and a transmission electron microscope, respectively.

FIG. 14A shows the reaction of phenylphosphate to phenol and phosphate by phosphatase, FIG. 14B shows seven candidate microorganisms selected as sensor cells, and FIG. 14C shows sensor cells as negative control. Three colonies showing fluorescence collected from dLB plates containing no. FIG. 14D is a result of confirming the presence of sensor cells by PCR of 10 selected colonies of FIGS. 14B and 14C.

FIG. 15A shows green fluorescence and bright field images of 36 colonies selected using microscopic analysis with GFP filters after incubating soil samples and sensor cells using the two step protocol of Example 8, FIG. Specific enzyme activity of the candidate colonies in dogs was measured using their crude extracts.

Hereinafter, the present invention will be described in detail by Examples and Experimental Examples.

However, the following Examples and Experimental Examples are only for illustrating the present invention, and the content of the present invention is not limited by the following Examples and Experimental Examples.

< Example  1> microbial prototyping-based enzyme gene screening system ( MP -GESS)

To develop an antibiotic-independent novel biopart screening technique, a D-amino acid aminotransferase (D-) was added to the GESS gene construct using dmpR or dmpR variants, which are transcription regulators of Pseudomonas putida- derived phenol-degrading operons. A dual reporter-type GESS construct was constructed using additional amino-acid aminotransferase (DAAT) gene. The DAAT gene is expressed in the presence of phenol. In addition, the glutamic acid was used auxotrophic E. coli (Escherichia coli, WM335) as a host cell of the MP-GESS construct. A schematic diagram of the MP-GESS configuration is shown in FIG. 1, and Table 1 shows the components of the MP-GESS and the characteristics of each configuration.

Component	designation	characteristic
Transcription regulator	dmpR or dmpR variants	Pseudomonas Derived / Phenolic Compounds
Reporter Protein	DAAT, EGFP	Host cell survival, fluorescence expression including MP-GESS
Control part	Electronic regulator coupling site	Transcription Factor Binding / Reporter Expression Activation
Promoter 1	Promoter for expression of transcriptional regulator (P X )	Transcription Factor Expression
Promoter 2	Reporter Protein Expression Promoter (P R )	Reporter Protein Expression
Ribosomal binding site	RBS	Promote reporter protein expression
Transcription Terminator	rrnBT1T2, tL3 (t)	Warrior Termination
Explode tag	ssrA	DAAT half-life adjustment

The operating aspect of the MP-GESS construct is shown in FIG. Specifically, the MP-GESS construct was introduced into glutamic acid trophic coliform to make sensor cells. Cultured sensor cells are cultured in a medium without glutamic acid, and if killed, cultivated with a phenol-producing strain and a phenol-degradable substrate is added, the phenol produced by the phenol-producing strain is used to control the MP-GESS. Since the DAAT gene of the truck expresses and the sensor cell survives, and the EGFP expresses and fluoresces, it is possible to search for a phenol-producing strain depending on the survival of the sensor cell.

<1-1> Construction of the MP-GESS Construct

The MP-GESS construct is the top of the N-terminus of pGESSv4 (ACS Synthetic Biology (2014) 3 (3): 163-167) or pGESS (E135K) (ACS Synthetic Biology (2014) 3 (3): 163-167) It can be produced by inserting the DAAT gene into. In the present invention, the fragment of 6,185bp was amplified by PCR using pGESSv4 as a template and the following SEQ ID NO: 1 and SEQ ID NO: 2.

The DAAT gene was obtained by the following procedure. DNA of Bacillus subtilis 168 (Microorganism Resource Center, Korean Collection for Type Cultures) was used as a template, and after amplifying the PCR product of about 800 bp using the sequences of SEQ ID NO: 3 and SEQ ID NO: 4, The final 852 bp length PCR product was obtained by performing PCR once more using the 800 bp PCR product as a template and the sequences of SEQ ID NO: 5 and SEQ ID NO: 6 having homology with the vector pGESSv4. In particular, the sequence of SEQ ID NO: 6 contains an ssrA tag (underlined) that controls the life of the DAAT. The ssrA tag is a kind of destruction tag that can control the half-life of the protein when inserted into the C-terminus of the protein, and can control the half-life of the fluorescent protein in Escherichia coli or Pseudomonas. In the present invention, by using the AANDENYALAA amino acid sequence (SEQ ID NO: 7) (ssrA tag; amino acid sequence corresponding to the underline of the sequence of SEQ ID NO: 6) by controlling the half-life of DAAT to reduce the non-specific response of MP-GESS.

SEQ ID NO: 5'-atgtatatctccttctccaggttggcggat

SEQ ID NO: 5'-aaggagatatacatatggtgagcaagggcg

SEQ ID NO: 5'-atgttggaacaaccaataggagtcattgattc

SEQ ID NO: 5'-tcttttaatcggttcttgcagtgagatacatt

SEQ ID NO: 5'-atccgccaacctggagaaggagatatacatatgttggaacaaccaataggag

SEQ ID NO: 5'-cgcccttgctcaccatatgtatatctccttcta agctgctaaagcgtagttttcg tcgtttgctgctcttttaatcggtt

The amplified and secured pGESSv4 vector and DAAT gene were cloned by Gibson assembly method (Gibson Assembly Master Mix, NEB, UK) to complete the production of MP-GESS construct.

<1-2> Active verification of MP-GESS

In order to verify the activity of the MP-GESS construct prepared in Example <1-1>, the MP-GESS plasmid was transformed into E. coli WM335 strain. Escherichia coli WM335 strain is a glutamic acid trophic strain and does not grow unless additional glutamic acid is added to the growth medium (Biosci Biotechnol Biochem. 1998 Jan; 62 (1): 193-5). A single colony of Escherichia coli WM335 strain containing MP-GESS construct was added to LB medium and 0.1 mg / ml of D-glutamic acid, followed by shaking culture at 37 ° C. for 24 hours to be used as a seed. After the microorganisms were washed once with M9 liquid medium, again in the M9 liquid medium _{((1ℓ Na 2 HPO 4 ·} 7H 2 O 6.78g, KH 2 PO 4 3g, NaCl 0.5g, NH 4 Cl 1g, 2mM MgSO 4 , 0.1 mM CaCl ₂ , 0.4% (w / v) Glucose, 0.01% (w / v) thiamine is added to the suspension) to determine whether the reaction to phenol.

As a result, the glutamic acid trophic host cell into which the MP-GESS construct was introduced did not grow when glutamic acid was absent, but it was confirmed that fluorescence was expressed while growing only when the DAAT gene was expressed by phenol (FIG. 3). From the above results, it can be seen that glutamic acid trophic constituent host cells into which the MP-GESS construct of the present invention is introduced, that is, sensor cells, are viable by phenol.

<1-3> pGESS-Cm / Tc / Km Construct Fabrication and Compliance Check

In order to promote the practicality of GESS, the suitability of additional biological components was investigated and antibiotic resistance genes and nutritional constitutive genes were used as phenotypic reporters. For antibiotic resistance genes, the reporter regions of the DmpR-based GESS plasmid (ACS Synthetic Biology (2014) 3 (3): 163-167) were transferred to chloramphenicol (pGESS-Cm)-, tetracycline (pGESS-Tc)-, and kanamycin. (pGESS-Km) -resistant genes were replaced (FIG. 4A). The MP-GESS construct of Example 1-2 was used for the trophic gene (FIG. 4 (D)).

The Cm- (chloramphenicol) and Tc- (tetracycline) resistance genes were amplified by PCR from pACYC184 (New England Biolabs, Ipswitch, MA, USA), and the Km- (kanamycin) resistance gene was pET27b (EMD Millipore, Darmstadt, Germany). Amplified by PCR. PGESSv4, a DmpR-based GESS plasmid (ACS Synthetic Biology (2014) 3 (3): 163-167), was used as a template, and SEQ ID NO: 10 (Vector-F1: aaggagatatacatatggtgagcaagggcg) and SEQ ID NO: 11 (Vector-R1: atgtatatctccttctccaggttggcggat) PCR was performed using the primers to amplify 6,185 bp fragments. PGESS-Cm, pGESS-Tc, and pGESS-Km were introduced into the N-terminus of EGFP in the amplified antibiotic resistance gene using the same cloning method as in pGESS-DAAT of Example <1-1>. Construct was constructed. Next, DH5α Escherichia coli cells containing each plasmid were incubated overnight at 37 ° C., and the preculture was diluted 10 ⁶ fold, with different combinations of phenol (1-1000 μM) and antibiotics (0, 10, 20). , And 30 μg / mL), and spread spread to LB-plate selection medium. pGESS-Tc was investigated for the detection of tyrosine phenolases. DH5α Escherichia coli cells comprising pGESS-Tc transformed with pHCEIIB-TPL were placed on LB solid medium containing 1 mM tyrosine, 10 μM PLP, 30 μg / mL tetracycline and incubated at 30 ° C. for 48 hours.

As a result, the cells with pGESS-Cm and pGESS-Tc increased the survival in proportion to the phenol concentration of the medium, showing very little viability in the absence of phenol (Fig. 5 (A), (B)) . Cells with pGESS-Cm showed similar profiles as cells with pGESS-Tc, whereas cells transformed with pGESS-Km showed the lowest viability among the three tested strains (FIG. 5). In the case of pGESS-Tc, higher fluorescence intensity of colonies was observed at increased phenol concentrations. Cells with pGESS-DAAT increased the number of colonies with increasing phenol concentration.

As such, antibiotic resistance genes can be used to screen for microorganisms with specific enzymatic activity, but by adding antibiotic resistance genes as an additional reporter with green fluorescent protein, any metagenomic gene with antibiotic resistance activity can be expressed in sensor cell colonies. It can lead to formation, which can lead to false positive rates. In addition, unlike E. coli host-based metagenome screening, it is not possible to grow natural microorganisms on plates containing antibiotics. Therefore, in order to screen microorganisms having a specific enzymatic activity in the metagenome microorganisms, it is more efficient to introduce a trophic constitutive gene as in Example <1-2> rather than to use an antibiotic resistance gene. Additional experiments were performed using MP-GESS with genes encoding AAT and fluorescent reporters.

< Example  2> MP - Of GESS  Heterologous Enzyme Activity Verification

<2-1> Validation of enzyme activity based on one-step protocol

The tyrosin-phenol lyase (TPL) enzyme was used to verify whether species can detect enzyme activity among other microorganisms using the MP-GESS construct prepared in Example <1-1>. TPL is an enzyme that decomposes tyrosine to produce pyruvate, ammonia and phenol. It was confirmed that phenol produced by TPL activates MP-GESS of the present invention to express fluorescent proteins (FIG. 6A). Specifically, after smearing and incubating the TPL-producing Citrobacter Freundy cells or TPL-producing E. coli in LB solid medium containing a substrate tyrosine, the MP-GESS vector is as shown in Example <1-2> Introduced glutamic trophyotrophic Escherichia coli cells, ie, sensor cells, were cultured and cultured with 0.75% (w / v) agar solution, and placed in a solid medium in which TPL producing cells were grown. After culturing for 12 hours, survival and fluorescence expression of sensor cells into which MP-GESS constructs were introduced by fluorescence microscopy were observed (one-step protocol of FIG. 6B).

As a result, no sensor cells were present around E. coli cells (colonies) without TPL, which was a negative control, but fluorescence of sensor cell colonies was observed around E. coli expressing Citrobacter preundi or TPL. (FIG. 6C). From the above results, it can be seen that the glutamic acid trophic urea coli into which the MP-GESS construct is introduced is viable and fluorescence not only by TPL expressed in homologous E. coli but also by TPL activity of Citrobacter preoundi.

<2-2> Validation of enzyme activity based on two-step protocol

The treatment time of the sensor cells was the same as in Example <2-1> except that the colony was formed after 12 hours of incubation with TPL-producing Citrobacter preoundi cells or TPL-producing E. coli (Fig. 6b two-step protocol).

As a result, E. coli with TPL activity was clearly fluorescence around the edge of TPL cells, while Citrobacter Freundy showed that sensor cells were widely distributed on the plate due to the rapid growth of cells and strong TPL activity. Sensor cells did not grow and fluoresce at the edge of the plate without the bacter preound (FIG. 6D).

< Example  3> One-step protocol based microbial discovery: microbial discovery with fibrinolytic activity in soil samples Example  <1- 2> of  Coculture with sensor cells and microorganisms to be searched)

Fibrinase breaks down para-nitrophenyl cellobioside (pNPG2) into nitrophenols and cellobiose (FIG. 7A). Since the E. coli introduced with the MP-GESS construct prepared in Example <1-2> survives and exhibits fluorescence in the presence of phenol, the E. coli introduced with the MP-GESS is co-cultured with microorganisms derived from soil. According to the degree of fluorescence expression of E. coli in which MP-GESS was introduced, it was confirmed whether microorganisms having fibrinolytic activity among the microorganisms present in the soil could be detected. Specifically, 1 g of a soil sample of Yasan near Daejeon Research Complex was added to a solution containing 0.1% carboxymethyl cellulose (CMC) in 100 ml 1X PBS buffer, followed by shaking culture at 25 ° C. for 2 hours. The amount of microorganisms in the organism was increased (hereinafter referred to as 'enriched soil sample'). In 1/10 diluted LB solid medium containing 100 μM of the substrate pNPG2, 1 ml of the fortified soil sample was plated together with the MP-GESS containing E. coli WM335 5 × 10 ⁴ cells prepared in Example <1-2>. After incubation at 30 ° C. for about 12 hours, colonies around E. coli, which were activated by fluorescence by fluorescence microscopy (Nikon), were determined to be candidate microorganisms producing fibrinolytic enzymes. To isolate candidate microorganisms producing this fibrinolytic enzyme, cut the colonies with a flame sterilized knife and suspend them in LB liquid medium diluted to 1/10 and smear them on solid medium without substrate or on solid medium without substrate. Select colonies were streaked. Escherichia coli containing MP-GESS constructs could not grow phenols in the substrate without a phenol and cannot express DAAT genes, so it was possible to isolate candidate microorganisms producing fibrinase. (FIG. 7B).

As described above, four colonies of # 25, # 34, # 43, and # 46, in which fluorescence was observed around colonies, were obtained among about 2,500 colonies isolated from soil samples (Fig. 8). Three additional species with different phenotypes were found during the further separation of microorganisms of species, such as # 25-1, # 25-2, # 34-1, # 34-2, # 43, # 46-1 and # 46-2. Candidate microbial strains producing a total of seven fibrinolytic enzymes were obtained.

< Example  4> Example  Confirmation of Fibrinolytic Activity of Candidate Microorganisms Screened in 3

Whether or not the seven candidate microorganisms selected in Example 3 has fibrinolytic activity was confirmed using various substrates. After culturing the selected candidate microorganisms at 30 ℃, and treated with celLyticB, lysozyme, DNase, respectively, the lysate was used as coenzyme solution. After reacting pNPG2 with pNPG3 (para-nitrophenyl cellotrioside) as a substrate for 2 hours at 45 ° C, the degraded pNP (para-nitrophenol) was measured at 405 nm at an optical density (Victor). The negative control group was prepared by adding a substrate to the buffer without coenzyme solution, using no substrate (None) and nothing (NC) in each candidate microbial sample, and 0.02% c-tech as a positive control group. (Changhae Ethanol, PC) and celEdx16 (KC Ko, et al. (20111) Appl. Microbiol. Biotechnol. 89, 1453-1462). In addition, filter paper (1 × 3 cm), 1% (w / v) Avicel and 2% (w / v) CMC were also used as substrates. Each reaction was carried out at 45 ℃, after the enzyme reaction the sample was measured for activity by the DNS reducing sugar quantification method. Among the various substrates, pNPG2, Avicel, and filter paper are substrates of exo fibrinase, and pNPG3 are substrates of endo type fibrinase.

As a result, the # 25-1 and # 46-2 strains reacted with Avicel, and the activities against pNPG2 and pNPG3 were confirmed in samples except for the # 34-1 and # 46-1 strains. In particular, the strain # 46-2 had a high activity on the filter paper, and because of this property may be useful for crystalline fiber breakdown (Fig. 9). From the above results, it was confirmed that the strain of the fibrinase activity can be searched by the E. coli WM335 strain containing MP-GESS sensor cell of the present invention.

< Example  5> Example  Identification of species of candidate microorganisms selected in 3

16s rRNA analysis was performed to identify the microbial species of colonies selected in Example 4. 9F (SEQ ID NO: 8) and 1512R (SEQ ID NO: 9) primers capable of PCR amplification of the 16s rRNA sequence of Escherichia coli to analyze the nucleotide sequence of the bacterial 16s rRNA containing nine variable regions It was. Of the 7 microbial resources isolated, 16s rRNA sequencing was performed on 6 microbial resources except # 34-1 which were not cultured.

SEQ ID NO: 8'-agagtttgatcatggctcag

SEQ ID NO: 5'-tacggttaccttgttacgactt

Table 2 shows the similarity results between each candidate microorganism and previously known microorganisms.

Candidate microorganisms	Close match	Similarity (%)
# 25-1	Bacillus cereus ATCC14579 (T)	97.34
# 25-2	Pseudomonas koreensis Ps 9-14 (T)	99.13
# 34-2	Bacillus cereus ATCC14579 (T)	99.92
# 43	Pseudomonas koreensis Ps 9-14 (T)	98.87
# 46-1	Bacillus cereus ATCC14579 (T)	99.92
# 46-2	Pseudomonas koreensis Ps 9-14 (T)	92.77

As a result, # 25-1 showed more than 97% similarity to Bacillus cereus ATCC14579 (T), and # 34-2 and # 46-1 showed more than 99% similarity to Pseudomonas thringiensis ATCC10792 It was analyzed. In the case of # 46-2, which has a relatively high activity on the filter paper, it was analyzed to be 93% similar to Pseudomonas koreensis Ps 9-14 (T), confirming that strain # 46-2 was a novel microorganism. It was deposited in the microbial resource center with the accession number KCTC32541. Microorganisms # 25-2 and # 43 were found to be more than 98% similar to Pseudomonas koreensis Ps 9-14.

From the above results, the sensor cell of the present invention, MP-GESS-containing E. coli WM335 can be detected strains with fibrinolytic activity, the detected strains are similar to Bacillus cereus, Pseudomonas trigiensis, Pseudomonas corriensis, It was also found that new microorganisms with degrading activity could be explored.

< Example  6> Example  Of new microorganisms selected in 3 NGS  Analysis, whole genome analysis and functional difference analysis with existing microorganisms

<6-1> NGS analysis of new microorganisms, whole genome analysis

In order to verify the new strain through sequence comparison analysis of Pseudomonas, DNA of # 46-2 strain was extracted and two Next Generation DNA sequencer (NGS) (Roche454) was performed. The total number of reads was 1,192,651 and the total number of Contigs found in the GS FLX assembler was 625. The average contiguous size was 10,059bp, indicating that the microorganism had a total length of about 6M. Based on this confirmed config, RAST (http://rast.nmpdr.org/rast.cgi), one of the online tools, was used for annotation analysis of # 46-2 genome. RAST is a tool that takes a continuation as an input value, estimates the ORF, and classifies / analyzes the function of the estimated ORF by a method called 'subsystem technique'. As of May 2015, it has 1,151 validated subsystems, which are divided into three levels with 27 categories. The function of the estimated ORF may belong to one or more subsystems. For strain # 46-2, subsystem classifications were defined in 2,941 ORFs, 52% of a total of 5,692 ORFs, with the remaining 48% not being subsystem classifications. Was not ORF. This ratio and the distribution of 2,941 subsystems are shown in FIG. The most common categories were amino acids and their derivatives, followed by carbohydrates, cofactors, vitamins, prosthetic groups and pigments.

Through the above process, Blast analysis of NCBI was performed using the predicted ORF sequence information for comparative analysis with other strains of strain # 46-2. A total of 5,754 ORFs were aligned to the NCBI nt database using Blastn software, and hits of evalue 10 or less were selected and found an average of about 45 hits per orf. As a result of analyzing the strains derived from the hit sequences identified above, the most frequently found strain was Pseudomonas fluorescein Pf0-1, which showed that 4,829 genes out of 5,754 of the ORFs were similar to those present in P. fluorescence Pf0-1. Confirmed. FIG. 11 shows the Genomic Coverage value obtained by dividing the number of identified genes by the total number of genes of each compared strain. It was confirmed that about 84% of the genes of P. fluorescence Pf0-1 were similar to strain # 46. Thus, the selected strain # 46-2 was found to be a novel microorganism with cellulase enzyme activity but different from the existing Pseudomonas species.

<6-2> Analysis of functional differences with existing microorganisms

For the analysis of gene composition and its function of strain # 46-2, comparative analysis based on gene function and sequence with P. fluorescence Pf0-1 species was analyzed. Using the function-based comparison tool provided by RAST, the functions and presence of constituent genes of # 46-2 and P. fluorescence Pf0-1 were compared with each other, and the results were downloaded to a file.

As a result, of the total 3480 genes analyzed based on subsystems, two strains shared 3,142 genes, 168 gene functions only in strain # 46-2, and 170 gene functions only in P. fluorescence Pf0-1. Confirmed. The functional difference between the two microorganisms is shown in FIG. 12. From the results, it was confirmed that the P. fluorescence Pf0-1 strain found to be the closest in sequence to the # 46-2 strain may show a difference not only in the ORF sequence but also in its function.

< Example  7> Example  Morphological Evaluation through Electron Microscopy Image Analysis of Novel Microorganisms Screened in Section 3

The novel strain # 46-2, which was selected as the E. coli WM335 strain containing MP-GESS, the sensor cell of the present invention, was found to be the most similar genus in P. koreensis sp. It was observed by electron microscopy to confirm whether or not.

As a result, # 46-2 strain was identified as the most similar genus (genus) in 16srRNA Analysis P. koreensis sp . The phenotype with more flagella compared to that shown (Fig. 13). This is similar to that of P. koreensis Ps9-14 (T) with multiple flagella. In addition, the microbial resources were rod-shaped and bulging, which is believed to produce polymer material due to the slime colony form.

< Example  8> Microbial Screening Based on Two-Step Protocol: Screening of Microbes with Phosphatase Activity in Soil Samples (Example 1 after culturing microorganisms to detect enzyme activity, forming colonies Spraying sensor cells of -2)

Since phosphatase has an activity of decomposing phenylphosphate into phenol and phosphate (FIG. 14A), microorganisms having phosphatase activity were searched using sensor cells.

1 g of soil was collected from the river of Daejeon Sintan Oscillation, and 50 mL of 1 × PBS was added to the collected soil. After 24 hours, centrifugation at 1000 rpm for 5 minutes gave 10 mL of the supernatant. The obtained 1 mL soil sample was plated in 1/10 diluted LB medium containing 100 μM phenylphosphate and incubated at 20 ° C. for 12 hours. Sensor cells, which are WM335 cells with pGESS-DAAT prepared in Example 1-2, were separately incubated for 24 hours at 37 ° C. in 10 mL dLB broth containing 10 μM phenol. The cultured sensor cells were centrifuged at 3000 rpm for 15 minutes and then washed by addition of 5 mL of dLB5. After one more wash step, the sensor cell had an OD ₆₀₀ of about 1 before spraying. Thereafter, the sensor cells were sprayed onto a solid plate in which soil microorganisms formed colonies by using an atomizer. After 12 hours of incubation at 37 ° C., the sample was AZ100M fluorescence multi-zoom microscope (Nikon) equipped with a GFP filter. It was observed using. As expected from the TPL results, cyclic colonies that emit green fluorescence were formed around the edges of candidate colonies with phosphatase activity (FIG. 14B). Seven candidate microbial colonies producing phosphatase (when sensor cells were sprayed onto soil microorganisms that produced colonies, FIG. 14b) and three random fluorescent colonies (only when soil microorganisms were cultured without sensor cells, 14c) was selected and PCR was performed using primers of SEQ ID NO: 12 (MP-F1: tgaaacctgcagcaacagcatgcgttgttc) and SEQ ID NO: 13 (MP-R1: ggtgaacagctcctcgcccttgctcaccat). As a result, it was confirmed that all colonies except C7 had mixed sensor cells (cells having MP-GESS) (FIG. 14D). Based on the PCR results, it is estimated that any soil microorganisms C8, C9 and C10 emit autofluorescence rather than contain sensor cells since the genes for the vectors contained in the sensor cells have not been amplified. Compared to the one-step protocol of Example 3, the two-step protocol is characterized by the size of colonies formed by sensor cells and metagenome microorganisms, and between the sensor cells and metagenome microorganisms in colony formation. The difference between can be clearly indicated, and thus, more effective guidelines can be suggested in selecting candidate microorganisms having target enzyme activity.

The seven selected colonies were further examined by 16s rRNA analysis. Seven colonies were floated on sterile toothpicks and streaked in dLB medium without substrate, phenol or D-glutamic acid. At this stage, the sensor cells naturally die off and single colonies were isolated for further 16s rRNA analysis. Table 3 shows the results of 16s rRNA analysis of each colony.

No.	Reference	Strain	Length	Score	Identification (%)
C1	NR _036911.2	Aeromonas media strain RM 16S ribosomal RNA gene, partial sequence	1503	2894	1469/1472 (99%)
C2	NR _024927.1	Pseudomonas migulae strain CIP 105470 16S ribosomal RNA gene, partial	1516	2866	1467/1474 (99%)
C3	NR _113578.1	Pseudomonas fragi strain NBRC 3458 16S ribosomal RNA gene, partial	1462	2876	1458/1461 (99%)
C4	NR _044863.1	Shewanella putrefaciens strain Hammer 95 16S ribosomal RNA gene	1504	2831	1461/1472 (99%)
C5	NR _044863.1	Shewanella putrefaciens strain Hammer 95 16S ribosomal RNA gene,	1504	2734	1406/1415 (99%)
C6	NR _074891.1	Escherichia coli 0157: H7 str. Sakai strain Sakai 16S ribosomal RNA,	1542	2208	1318/1386 (95%)
C7	NR _108852.1	Shewanella seohaensis strain S7-3 16S ribosomal RNA gene, partial	1465	2036	1307/1399 (93%)

As a result, four types of genera, Aeromonas, Pseudomonas, Shewanella, and Escherichia, were identified from seven selected microorganisms. In particular, the genus Shewanella and Aeromonas have been identified in aquatic environments.

< Example  9> Confirmation of phosphatase activity of candidate microorganism

Since phosphatase has an activity of decomposing phenylphosphate into phenol and phosphate, the cells selected by the sensor cells were recovered to confirm whether the selected cells have phosphatase activity.

The selected cells were recovered and suspended in 50 mM HEPES buffer (pH 7.5), and 0.1 mM phenylmethylsulfonyl fluoride (PMSF) was added as a protease inhibitor. Suspended cells were disrupted by sonication on ice (Fisher Scientific, Pittsburgh, Pa.). Cell debris was removed by centrifugation at 15,000 × g for 20 minutes at 4 ° C., and the supernatant was filtered through a 0.45-μm filter. Protein concentrations were quantified according to the methods described in Analytical Biochemistry 72, 248-254, Bradford. The catalytic activity of the crude extract was confirmed based on the amount of pNP released from 0.2 mL HEPES buffer (pH 7.5) containing 1 mM pNP-phosphate in a round bottomed 1.5-ml tube. The crude extract enzyme reaction was carried out at 25 ° C. for 10 minutes and terminated by addition of 1 M Na ₂ CO ₃ . The reaction solution was clarified by centrifugation at 16,300 × g for 15 minutes and the absorbance change was measured at 420 nm using Victor V Multilabel Plate Reader (PerkinElmer Life Sciences, Waltham, Massachusetts, USA). One unit of enzyme was defined as the activity required to produce 1 nmol of pNP as product per minute under specific assay conditions.

36 colonies were selected from 4000 colonies to confirm that phosphatase positive colonies actually have phosphatase activity (FIG. 15A). The phosphatase activity of crude extracts of 36 colonies selected was confirmed. 15B shows the phosphatase activity (U / mg) of the selected colonies with 16s rRNA analysis of the selected colonies. Five major strains ( Shigella sonnei , Shigella flexneri , Rheinheimera tangshanensis , Rheinheimera soli , Escherichia fergusonii ) has been shown to exhibit a clear phosphatase activity in the range of 10-30 U / mg. Shigella flexneri is one of the well-known sources of nonspecific acidic phosphatase of bacteria, which is used for the production of various phosphorylation products. Rheinheimera soli is known to have weak enzymatic activity against acid phosphatase, Escherichia fergusonii has also been reported to have acidic phosphatase activity. But Shigella sonnei and Rheinheimera Since no information on phosphatase activity of tangshanensis has been published, Shigella sonnei and Rheinheimera Further studies of tangshanensis may reveal new phosphatase.

In the above described exemplary embodiments of the present invention by way of example, the scope of the present invention is not limited only to the specific embodiments as described above, those skilled in the art to the scope described in the claims of the present invention It will be possible to change accordingly.

Claims (18)

1. (1) gene expression control site, a first promoter whose activity is regulated by the gene expression control site, and genes whose expression is regulated by activation of the first promoter, and enzymes involved in nutritional and nutritional components A reporter gene comprising a gene encoding a; a first gene construct comprising; And

   (2) a second promoter and a gene of a transcriptional regulator that regulates expression by the second promoter and binds to the gene expression control site only in an environment where a phenolic compound is present to activate the second promoter Including a second gene construct;

   Genetic circuit for detecting the presence of phenolic compounds.
2. The method according to claim 1,

   The phenolic compound is phenol, 2-chlorophenol, 2-iodinephenol, 2-fluorophenol, o-cresol, 2-ethylphenol, m-cresol, 2-nitrophenol, catechol, 2-methoxyphenol, 2-aminophenol, 2,3-dichlorophenol, 3-chlorophenol, 2,3-dimethylphenol, 3-nitrophenol, 4-chlorophenol, p-cresol, 2,5-dichlorophenol and 2,5-dimethyl Genetic circuit selected from the group consisting of phenols.
3. The method according to claim 1,

   Said transcriptional regulator is selected from the group consisting of DmpR, DmpR variant, XylR, MopR, PhhR, PhlR and TbuT.
4. The method according to claim 3,

   The DmpR variant is selected from the group consisting of E172K, D135N, D135N and E172K, F65L, L184I, F42Y, R109C, L113V, D116N, F122L, K6E and F42S, Q10R and K117M, Q10R, D116G and K117R and D116V in the DmpR amino acid sequence Wherein said at least one gene circuit is a mutated amino acid residue.
5. The method according to claim 1,

   The enzyme involved in the nutritional urine composition is a genetic circuit of the DAAT (D-amino acid aminotransferase) enzyme.
6. The method according to claim 1,

   The first and second promoters are genes selected from the group consisting of Pseudomonas dmpR or dmp operon promoter, promoter for general protein expression, trc promoter, T7 promoter, lac promoter, ara promoter and σ ⁵⁴ -dependent promoter (PECO). Circuit.
7. The method according to claim 1,

   The gene expression control region further comprises one or more factors selected from the group consisting of RBS (Ribosome Binding Site) and transcription terminators to facilitate the expression of the reporter protein.
8. The method according to claim 7,

   Wherein said transcription terminator is rrnBT1T2 or tL3.
9. A sensor cell for the detection and detection of a novel microbial strain carrying a target enzyme comprising a gene circuit according to any one of claims 1 to 8.
10. The method according to claim 9,

    The cell is a sensor cell for the detection and detection of a novel microbial strain having a target enzyme selected from the group consisting of bacteria, fungi, plant cells and animal cells.
11. The method according to claim 10,

    The bacterium is a sensor cell for the detection and detection of a novel microbial strain carrying the target enzyme E. coli.
12. The method according to claim 10,

    The fungus is a sensor cell for the detection and detection of a novel microbial strain carrying the desired enzyme yeast.
13. (1) designing a phenol-tag substrate in which a phenolic compound can be produced by the activity of a desired enzyme;

    (2) treating the phenol-tag substrate with a natural microorganism strain or an environmental sample including the same, which is expected to possess the target enzyme, and culturing the same with the sensor cell of claim 9 under an environment deficient in specific nutrients;

    (3) identifying and selecting those in which the reporter protein is expressed among the cultured sensor cells; And

    (4) separating the microbial strain adjacent to the selected sensor cell; a method for detecting and searching for a novel microbial strain carrying a target enzyme using the sensor cell.
14. The method according to claim 13,

    The step (2) is a co-culture of the natural microbial strain that is expected to carry the target enzyme or an environmental sample comprising the same and mixed with the phenol-tag substrate and the sensor cell of claim 9.
15. The method according to claim 13,

    The step (2) may include forming colonies by culturing in an environment in which the phenol-tag substrate is treated in a natural microorganism or an environmental sample including the target microorganisms having the target enzyme; And

    Co-culturing the formed colonies with the sensor cells of claim 9;

    How to include.
16. The method according to any one of claims 13 to 15,

    Wherein said nutrient is glutamic acid.
17. The method according to any one of claims 13 to 15,

    The phenolic compound is phenol, 2-chlorophenol, 2-iodinephenol, 2-fluorophenol, o-cresol, 2-ethylphenol, m-cresol, 2-nitrophenol, catechol, 2-methoxyphenol, 2-aminophenol, 2,3-dichlorophenol, 3-chlorophenol, 2,3-dimethylphenol, 3-nitrophenol, 4-chlorophenol, p-cresol, 2,5-dichlorophenol and 2,5-dimethyl The process is selected from the group consisting of phenols.
18. The method according to any one of claims 13 to 15,

    The phenol-tag substrate is a phenol hydroxyl group (hydroxy, -OH) modified ester (ester, -OOC-), ether (ether, -OC-), glycoside (glycoside, -O-Glc), phosphate ester (phospho-ester, -O-PO3), ortho-, meta-, para- position alkyl (-CH ₃ ), hydroxyl (-OH), carboxyl (-COOH), amino (-NH ₂ ), thiol (-SH), amides (amide, -NH-CO- or -CO-NH-), sulfides (sulfide, -S-SH), phenol derivatives introduced with halogen groups (-Cl, -Br, -F), and A benzene ring compound.

Images