KR101550389B1 - Method for Screening of Useful Enzymes from Metagenome Using Forced Transcription - Google Patents

Abstract

The present invention relates to a method for searching for a useful enzyme from a meta genome library with high efficiency, and more particularly, to a method for forcibly increasing the expression of a foreign gene by using a forced transcription system employing a bi-directional promoter, And more particularly to a method for searching for useful enzymes with high efficiency, which is characterized by being used in conjunction with protein-based redesign gene circuits.
According to the present invention, it is possible to forcibly increase the expression of a foreign gene by using a forced transcription system employing a bi-directional promoter and a metagenome-derived foreign gene, which has a difficulty in directly searching for the activity of a target gene, By using it in conjunction with a redesigned gene circuit based on a transcriptional regulatory protein, even a trace amount of the reaction product produced by the target enzyme can be detected through the expression of a reporter protein such as fluorescence and antibiotic resistance, Screening and quantification of target gene activity is possible.

Description

TECHNICAL FIELD [0001] The present invention relates to a method for screening of useful enzymes derived from a metagenome,

The present invention relates to a method for searching for a useful enzyme from a meta genome library with high efficiency, and more particularly, to a method for forcibly increasing the expression of a metagenome-derived gene by using a forced transcription system employing a bidirectional promoter, And a new method for significantly increasing the search efficiency of the metagenome-derived useful enzyme by applying a novel enzyme activity derived from the same to a high-sensitivity searching system using an artificial gene circuit.

The metagenome is defined by Handelsman et al. As "a genomic set of all microorganisms present in a particular natural environment" (Handelsman et al ., Chem . Biol . 5: R245, 1998). However, in recent years, it has been collectively referred to as a genome extracted from an environmental sample or a clone containing a gene, and a series of studies related to the metagenome is also called metagenomics. The metagenomic study is well suited for the purpose of utilizing microorganisms that are free or incapable of culturing, and if pure isolation by culture is not possible, it is a method of approaching molecular biology by extracting all DNA in a specific environment.

In recent years, besides analyzing microbial genome information, researches are being actively conducted to search for a new biocatalyst in the metagenome. Methods for acquiring new enzyme genes from various genetic resources such as meta-genomes and microbial genomes include sequence-based screening to obtain amplified genes, There is a function-based screening. Sequence-based search technology is becoming more and more useful as genomic information increases, and it is advantageous to specifically select only the desired gene, but it can be used only when the exact information about the sequence of the target gene is known Therefore, there is a disadvantage that applicable objects are limited to a part of genetic resources.

The activity-based search technique is based on the actual activity of the enzyme, so it has the advantage of clearly selecting the gene of the objective function. However, when the host cell has low transcription, translation, expression, protein folding and secretion It is difficult to select the target gene because the protein is not expressed properly or the expression rate is lowered. Indeed, new enzymes derived from genetic resources with high genetic diversity, such as new microbial genomes and metagenomes and unknown genetic characteristics, have a very low expression level in recombinant microorganisms, Also.

In order to measure the enzymatic activity of various foreign genes, attention has been focused on the development of gene circuits using transcription regulatory proteins. The transcription factors derived from other microorganisms are introduced into the host microorganism and the enzyme activity of the foreign gene is detected in the recombinant microorganism Method. For example, when benzoate is produced from benzaldehyde by the enzymatic action of exogenous XylC (benzaldehyde dehydrogenase) using a mutated transcriptional regulatory protein (NahR) derived from P. putida , lacZα or tetracycline resistance gene (Witholt et al. , PNAS 103: 1693, 2006) have been developed. In addition, when trichlorobenzene (TCB) is produced by acting dehydrochlorinase on hexachlorohaxane (HCH or lindane) using a mutated transcription regulatory protein (XylR) derived from P. putida , a novel enzyme activity that activates lacZ expression in E. coli Search techniques have also been reported (Mohn et al ., Environ . Microbiol. 8: 546, 2006).

However, these techniques are limited to search techniques for a few specific enzyme activities that specify the specificity of substrate-products and transcriptional regulatory proteins, and are not universal systems that can be applied to various enzymatic activities. That is, when a particular enzyme activity is required, there is a limitation that a transcriptional regulatory protein suitable for the product of the reaction must be secured.

Another novel enzyme search technique is the substrate-induced gene expression screening (SIGEX) technology reported by the Watanabe research group in 2005 (Watanabe et al. , Nature Biotech . 23: 88, 2005). Although this method has the advantage of being able to process a large amount of samples in a short time because FACS can be used for analysis, it is difficult to apply to a meta genome library containing a large gene of 20 to 30 kb, The active reaction of the protein may not be present and thus it has limitations (Ryu & Yun. Microb . Cell Factories , 4: 8, 2005).

The present inventors have developed and reported a redesign gene circuit using a transcriptional regulatory protein that senses a phenol compound (Korean Patent Application No. 10-2010-0054100), and has found that alpha-glucosidase, beta-glucosidase, cellulase, But are not limited to, glycoconjugate, glicosylceramidase, pisopatase, phytase, estrelase, lipase, uretase, amidase, peptidase, proteinase, oxydorodicta, phenol- In view of the fact that the phenolic compounds are liberated from the reaction of 2,000 enzymes, which account for about 5% of the enzyme species registered in the Brenda database ( www.brenda-enzymes.info ), including monooxygenase and deoxygenase , will be. A variety of phenol-releasing compounds liberated from the reaction of these enzymes are used as substrates and re-designed gene circuits in which the expression of reporter proteins such as fluorescence and antibiotic resistance are induced. By using this gene circuit, it is possible to quantitatively measure the activity of enzymes, And proved that gene activity can be detected at high speed.

Therefore, in the present invention, the expression level is dramatically improved by applying a forced transcription technique to a target gene expressed only in a trace amount in a metagenomic recombination host, and the expressed enzyme activity is detected and separated with high sensitivity using a synthetic biological redesign gene circuit And developed a new technology (Fig. 1).

Therefore, the present inventors have intensively inserted a forced transcription system in which a high-expression T7 promoter is bi-directionally inserted into a metagenomic library by using a transposase derived from bacteria, thereby forcibly increasing the expression amount of a target gene, When used in conjunction with a redesigned gene circuit based on a regulatory protein, it is possible to identify a trace amount of the reaction product produced from the enzyme encoded by the gene of interest, and the expression of the reporter protein, such as fluorescence and antibiotic resistance, It has been confirmed that not only gene selection can be facilitated but also target gene activity can be quantitatively measured, thereby completing the present invention.

It is an object of the present invention to provide an efficient method for searching for a useful enzyme which can be confirmed by amplifying an extremely small amount of enzyme reaction in a meta genome library which is a genome set of all microorganisms existing in a specific natural environment.

(A) a transposase recognition site (Mosaic End, ME), a promoter, an antibiotic resistance gene, a promoter, an antibiotic resistance gene, and a transposase recognition site are inserted into a metagenomic library gene including a gene encoding an enzyme to be searched, Preparing a metagenomic library in which the transposon is randomly inserted by reacting a transposon comprising a reverse promoter and a reverse transposable recognition site sequence with a transposase agent; (b) preparing a recombinant microorganism library by introducing the metagenome library into a host microorganism into which an RNA polymerase capable of promoting the expression of the promoter and the reverse promoter of step (a) is inserted; (c) at least one reporter gene selected from the group consisting of (i) a gene encoding a regulatory protein that recognizes a phenolic compound, (ii) a gene encoding a fluorescent protein, and an antibiotic resistance gene, and (iii) A regulatory protein that recognizes the phenolic compound and binds to the regulator to regulate the expression of downstream reporter gene; and a reporter gene that is operatively associated with the regulatory region, Introducing into the meta genome library of step (b) a genetic circuit for the detection of a phenolic compound, which comprises a gene expression regulatory region composed of a promoter inducing expression of the gene; (d) a step of culturing the recombinant microorganism library by treating the inducer with an inducer so that the promoter can operate during enzyme search; (e) treating the cultured recombinant microorganism library with a phenol-releasing compound which may be advantageous to the phenolic compound by an enzymatic reaction; (f) detecting the phenol-based compound liberated by the enzyme reaction, measuring the activity of the expression-induced reporter protein, and then searching the microorganism having an activity capable of favoring the phenolic compound by an enzyme reaction at a high speed; And (g) recovering the gene of the enzyme capable of favoring the phenolic compound by the enzyme reaction from the searched microorganism, and then identifying the gene by sequence analysis. A method for searching for a target enzyme from a library is provided.

According to the present invention, it is possible to forcibly increase the expression of a foreign gene by using a forced transcription system employing a bi-directional promoter and a metagenome-derived foreign gene, which has a difficulty in directly searching for the activity of a target gene, By using it in conjunction with a redesigned gene circuit based on a transcriptional regulatory protein, even the reaction products based on the target enzyme can be detected through the expression of reporter proteins such as reperfusion and antibiotic resistance, Selection of genes and quantitative measurement of target gene activity is possible.

FIG. 1 is a schematic diagram showing a method for enhancing the expression level by introducing a forced transcription technology into a meta genome library, and detecting and separating the expressed enzyme activity with an ultra-high sensitivity using a synthetic biological redesign gene circuit.
FIG. 2 shows a transposon comprising a Tn5 transposase recognition site (Mosaic End, ME), a T7 promoter (T7 P), a kanamycin resistance gene (Km ^R ), an inverted T7 promoter and a reverse Tn5 transposin recognition site (transposon).
FIG. 3 is a schematic representation of a GESS vector (pGESS) according to the redesigned gene circuit according to the present invention, wherein the gene expression regulatory region is enlarged to show its structure (TRF: transcriptional regulation factor , A phenolic compound decomposing enzyme-regulating protein according to the present invention, OpR: a site which induces reporter gene expression downstream of binding of a phenolic compound-decomposing enzyme regulatory protein which is TRF, P _x : A promoter that regulates the expression of the regulatory protein; and P _R is a promoter that controls the expression of the reporter).
FIG. 4 is a graph showing the results of a forced transcription test by selecting and comparing clones having a lipase activity on a 1% TBN plate in a soil-derived metagenomic library and a transposon-inserted library in which transposon was inserted. (A) is a figure comparing the number of selected hits while searching the library, and (b) is a figure showing dramatically increasing the sorting efficiency of hits on the fourth day due to the introduction of forced transfer. (C) is a comparison of the transparency activity of the clones which had the strongest activity in the two libraries. On the left, the activity of the heat was increased by the introduction of the forced transcription. On the right side, the transposon- Center hit) is again validated.
FIG. 5 is a graph showing the effect of forced transcription by searching for tyrosine phenolase in a tyrosine turbid plate. (A) is to transfer the force is introduced into the tyrosine turbid plate seat frame bakteo undi (C itrobacter the freundii) library or to navigate the enzymatic activity through a clear zone resulting from the plated US introduced library, (b) 1 myeonseon of tyrosine phenol-lyase activity by inoculating (streaking) for the selected heat drive back to the tyrosine turbid plate 2 drive It is confirmed.
Figure 6 is a conceptual view of building a redesigned gene circuit through the genetic modification, (a) is a schematic diagram of the gene circuit (pGESS-EGFP) of the EGFP by the reporter, (b) is a gene circuit for the GFP _UV with a reporter ( pGESS-GFP _UV ).
Fig. 7 shows the result of improving the searching effect of the library by associating the forced transfer system with the redesigned gene circuit search system. Fig. 7 (a) shows a case where the forced transfer is introduced by introducing the forced transfer to the redesigned gene circuit search system (B) shows that hits with increased activity due to the introduction of forced transcription are searched sensitively through the redesign gene circuit, and due to the introduction of forced transcription, (I.e., enzyme activity) was increased.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In general, the nomenclature used herein and the experimental methods described below are well known and commonly used in the art.

In the present invention, the metagenome is defined by Handelsman et al. As "a genome set of all microorganisms present in a specific natural environment" (Handelsman et al ., (1998) Chem . Biol . 5: R245-R249). However, in recent years, it has been collectively referred to as a genome extracted from an environmental sample or a clone containing a gene, and a series of studies related to the metagenome is also called metagenomics. In a related study, Venter et al . (Venter et al ., Science 304: 66, 2004) initiated a new concept called ecosystem sequencing through the support of the US Department of Energy (DOE) Approximately one billion nucleotide sequences were determined by applying whole-genome shotgun sequencing to the metagenomic library constructed from sea water samples. The seawater samples obtained from the sequencing analysis contained at least 1800 genomic species including 148 previously unknown phylotype bacteria and over 1.2 million new genes were found. The metagenomic study is well suited for the purpose of utilizing microorganisms that are free or incapable of culturing, and if pure isolation by culture is not possible, it is a method of approaching molecular biology by extracting all DNA in a specific environment.

Such meta-genomic libraries derived from the environment can be produced by any known method as a population of genes derived from various environments such as soil-derived or seawater-derived.

In the present invention, the metagenomic library is obtained by collecting a microorganism community in a natural or specific area (hot spring, farm, compost, oil contaminated soil), directly extracting the dielectric and introducing it into the vector. The vector may be a plasmid, a fosmid, a cosmid, a bacterial artificial chromosome (BAC), a yeast artificial chromosome (YAC) or the like depending on the purpose of the user. In the case of the plasmid, the expression level and the vector configuration can be optimized according to the user's intention, so that the expression can be optimized. However, since the gene having a small size (less than 10 kb) is introduced, it is impossible to recover the gene of the operon unit . For the introduction of the gene of 37-52 kb in size, a fosmid vector or a cosmid vector can be used. In particular, phosmid vectors are frequently used because of their high transformation efficiency. BAC is capable of large size (150 ~ 350 kb) gene introduction and is used for human genome project and genome analysis of mouse and rice.

(A) a transposase recognition site (Mosaic End, ME), a promoter, an antibiotic resistance gene, an inverse promoter and an inverse transposon gene in a metagenomic library gene containing a gene encoding the enzyme to be sought, Reacting a transposon comprising a recognition site sequence with a transposon to prepare a metagenome library in which the transposon is randomly inserted; (b) preparing a recombinant microorganism library by introducing the metagenome library into a host microorganism into which an RNA polymerase capable of promoting the expression of the promoter and the reverse promoter of step (a) is inserted; (c) at least one reporter gene selected from the group consisting of (i) a gene encoding a regulatory protein that recognizes a phenolic compound, (ii) a gene encoding a fluorescent protein, and an antibiotic resistance gene, and (iii) A regulatory protein that recognizes the phenolic compound and binds to the regulator to regulate the expression of downstream reporter gene; and a reporter gene that is operatively associated with the regulatory region, (D) introducing a genetic circuit for detecting a phenolic compound into a metagenome library of step (d), wherein the genetic circuit comprises a gene expression regulatory region comprising a promoter for inducing expression of the phenolic compound; (d) a step of culturing the recombinant microorganism library by treating the inducer with an inducer so that the promoter can operate during enzyme search; (e) treating the cultured recombinant microorganism library with a phenol-releasing compound which may be advantageous to the phenolic compound by an enzymatic reaction; (f) detecting the phenol-based compound liberated by the enzyme reaction, measuring the activity of the expression-induced reporter protein, and then searching the microorganism having an activity capable of favoring the phenolic compound by an enzyme reaction at a high speed; And (g) recovering the gene of the enzyme capable of favoring the phenolic compound by the enzyme reaction from the searched microorganism, and then identifying the gene by sequence analysis. And a method for searching for a target enzyme from a library.

"Transposon" is a DNA sequence (Wicker, T., PNAS, 36 (6), 344, 1950) that was first discovered as an insertional sequence capable of transferring to multiple locations on a single cell genome And it was found in the process of studying the cause of unstable color of corn grain. Transposons have a transposase enzyme called transposase, which has an activity to detect and insert specific base sequences. Transposons are cut and adhered to the new position with the aid of transposase, which is cut from its original position. Both ends of the transposon are reverse repeatable, and the transposase consists of a sequence recognizable by the transposase, so that the transposase recognizes and cleaves this portion. This part of the DNA will have a sticky end as if it had been cleaved by restriction enzymes. After the transposon is inserted into the DNA, the gap is cleared. Thus, the same repeats are formed at both ends of the transposon (direct repeat). Transposons can be found in bacteria, plants and animals. In the present invention, an in vitro transposition reaction was carried out using a transformant of transposon Tn5 derived from bacteria.

In the present invention, the promoter of the transposon may be any promoter capable of inducing the expression of the target gene by inducing the induction of the target gene and expressing the target gene with high efficiency, preferably a T7 promoter, a lac promoter, an ara promoter , a trc promoter and a P _hce promoter can be used.

In the present invention, the RNA polymerase of step (b) may be a microorganism-derived RNA polymerase and a phage-derived T7 RNA polymerase, and may be used to activate the expression of the promoter and the reverse promoter of step (a) Which is an RNA polymerase.

In the present invention, the transposase recognition site is a transposon selected from the group consisting of Tn5 transposon, IS transposon, Tn3 transposon, Tn7 site-specific transposon, and Mu transposon. It is preferably a transposase recognition site, more preferably a Tn5 transposase recognition site.

In the present invention, the Tn5 transposase recognition site (Mosaic End, ME) may be characterized by having the nucleotide sequence of SEQ ID NO: 1 and using the T7 promoter having the nucleotide sequence of SEQ ID NO: 2 . ≪ / RTI >

In the present invention, the antibiotic resistance gene can be used without limitation as long as it is a resistance gene capable of confirming insertion of a transposon. Preferably, a kanamycin resistance gene, a tetracycline resistance gene or an ampicillin resistance gene can be used.

In one embodiment of the present invention, a transposon comprising a Tn5 transposase recognition site (Mosaic End, ME), a T7 promoter, a kanamycin resistance gene, an inverted T7 promoter sequence and an inverted Tn5 transposin recognition site sequence was prepared And used in a forced transfer system (Fig. 2).

Therefore, in the present invention, the transposon may be characterized by being composed of the nucleotide sequence of SEQ ID NO: 3, and the transposase may be characterized by using Tn5 transposase derived from bacteria.

In the present invention, it is preferable to use isopropyl-D-thiogalactopyranoside (IPTG) or lactose as an inducer for activating the T7 promoter and the reverse T7 promoter.

The term "redesigned genetic circuit" in the present invention refers to (i) a gene encoding a regulatory protein that recognizes a phenolic compound; (ii) one or more reporter genes selected from the group consisting of a gene encoding a fluorescent protein and an antibiotic resistance gene; And (iii) a promoter that induces expression of a regulatory protein that recognizes the phenolic compound, an operator that induces expression of a downstream reporter gene by binding with a regulatory protein that recognizes the phenolic compound, And a promoter that regulates the expression of the reporter gene, and serves to sense a phenol compound produced by the target enzyme.

In the present invention, a gene circuit for the detection of a phenolic compound may be contained in a cytoplasm or inserted into a chromosomal DNA using a plasmid in a microorganism.

In the present invention, a gene circuit for detecting phenol is produced, and a gene circuit for detecting the phenol is sequentially or simultaneously transformed into a recombinant microorganism library prepared from the prepared metagenum library derived from the environment, By measuring the quantitative activity of the reporter such as fluorescence and antibiotic resistance induced by the expression of the phenol produced by the function and activity of the enzyme gene introduced into the cell, the enzyme having the desired activity was searched and recovered.

In the present invention, the "environmental sample" means a sample derived from an environment such as soil or sea water.

In the present invention, the metagenomic library may be prepared by introducing DNA obtained from the soil into a vector selected from the group consisting of plasmid, phosphide, cosmid, BAC and YAC.

In the present invention, the reporter gene and the promoter controlling the expression of the reporter gene may be operatively linked to each other.

In the present invention, an operator that binds to a regulatory protein that recognizes the phenolic compound to induce the expression of a downstream reporter gene may be a promoter that induces expression of a reporter gene in association with the regulatory region And activating the second electrode.

In the present invention, a gene encoding a regulatory protein that recognizes the phenolic compound may be operatively linked to a promoter that regulates the expression of the regulatory protein.

FIG. 3 schematically shows a vector including a genetic enzyme screening system (GESS) according to the present invention, and shows the structure of the gene expression control region enlarged. Herein, TRF is a transcriptional regulation factor. In the present invention, the TRF means a region coding for a regulatory protein recognizing a phenolic compound (for example, dmpR: gene encoding the positive regulator of the phenol catabolic pathway) remind The "gene expression regulatory region" can be divided into three main parts - P _x : lator of the phenol cataboli, and OpR (Operator for reporter): lator of the phenol ca combined to express the downstream reporter gene Regulate the expression of the phenol caP _R : reporter boli regulating promoter. In addition, in addition, the redesigned gene circuit according to the present invention may further comprise a ribosome binding site (RBS), a forward transcriptional terminator (t), a reverse transcriptional terminator (t), etc. . ≪ / RTI >

In view of the fact that various phenol-releasing compounds capable of benefiting phenol can be used as substrates in the enzymatic reaction, the present inventors have designed and introduced a new synthetic biosynthetic gene screening system (GESS) for detecting phenols By adding a phenolic group-containing substrate to a recombinant microorganism, a phenol produced according to the function of the enzyme gene is detected, and the quantitative activity of the reporter such as fluorescence and antibiotic resistance induced by expression is measured, A method for searching an enzyme having an activity was completed.

Therefore, in the present invention, the above-mentioned "target enzyme capable of favoring the phenolic compound by an enzymatic reaction" means a target enzyme capable of producing a desired enzyme by the action of an alpha-glucosidase, a beta-glucosidase, a cellulase, a glycosylseridase, , Estrogen, lipase, uretase, amidase, peptidase, proteinase, oxydorodacid, phenol-lyase, dihalogenase, isomerase, monooxygenase or deoxygenase .

In the present invention, the phenolic compound-degrading enzyme-regulating protein is a protein that regulates expression of a phenolic compound-degrading enzyme. By detecting phenol, a promoter controlling the expression of the phenolic compound-degrading enzyme is activated, Resulting in the expression of the reporter.

Specifically, the phenolic compound-degrading enzyme regulatory protein may be dmpR or a variant thereof.

In the present invention, "gene expression regulatory region" refers to a part regulating the entire redesigned gene circuit, as shown in Fig. 3, and includes (i) a gene encoding a phenol- A promoter, (ii) a site that binds to the phenolase inhibitor protein to induce the expression of downstream reporter gene, and (iii) a promoter that regulates expression of the reporter gene.

In the present invention, a promoter refers to a promoter that regulates the expression of a phenolase-degrading enzyme-regulating protein or regulates the expression of a reporter protein. For example, a promoter for dmpR or dmp operon of Pseudomonas or a promoter for expression of a general protein is used Or high expression promoters including trc, T7 lac and ara promoters can be used for high expression of foreign proteins, and P _{hce, which} is always a high expression vector which does not require an _inducer , can be used.

Specifically, as shown in FIG. 3, promoters controlling the expression of the reporter protein include E. coli , Pseudomonas sigma ^54- dependent promoter of putida or yeast , or a sigma ^54- dependent promoter sequence integrally usable in all strains, such as _PECO , P _PPU , P _YST , and P _UNIV .

In the present invention, the redesigned gene circuit may include not only the promoter but also RBS (Ribosome Binding Site) and / or transcription termination factor which facilitates the expression of the reporter protein. That is, as a site for regulating the expression of the regulatory protein, RBS and / or a transcription termination factor may be contained in addition to the promoter. Here, RBS can use conventional RBS (RBSε) having high expression efficiency in E. coli .

In the present invention, the transcription termination factor may preferably be rrnBT1T2 or tL3, and in addition, any transcription termination agent commonly used in the art may be used to constitute the present invention.

In the present invention, the reporter may be at least one selected from a fluorescent protein and an antibiotic resistance gene. GFP, GFP _UV , or RFP can be preferably used as the fluorescent protein, and the fluorescent protein that can be used in the present invention is not limited to this example as long as the object of the present invention can be achieved. The antibiotic resistance gene may be a common antibiotic resistance gene such as a gene resistant to antibiotics such as kanamycin, chloramphenicol, and tetracycline.

In one embodiment of the invention, the reporter can be a dual reporter consisting of both a fluorescent protein and an antibiotic resistance gene, or multiple reporters composed of two or more reporters.

In the present invention, the enzyme gene can be recovered by restriction enzyme treatment.

According to the present invention, any of the known methods can be used for stepwise transformation of the metagenome library and the phenol sensing redesign gene circuit into a suitable microbial host. Alternatively, the metagenome library can be introduced into cells containing chromosomal DNA or cytoplasmic gene circuits for phenol detection redesign. In order to increase the efficiency of transformation, electroporation can be preferably used.

In the present invention, the cells may preferably be E. coli, yeast, plant cells, animal cells, or the like.

In the present invention, the cells or cell-free extracts obtained from the cells can be used.

According to the present invention, the microorganism transformed with the gene circuit is treated with an enzyme reaction to at least one substrate selected from phenol-releasing compounds which can liberate phenols. Preferably, the timing of substrate addition may be adjusted so as to isolate the activation step of the cell growth-redesign gene circuit in order to optimize the enzyme reaction. For example, the substrate treatment step may comprise recovering healthy microorganisms grown in a nutrient medium and treating the recovered microorganisms with a substrate in a minimal medium.

In the present invention, the phenolic compound liberated by the enzymatic reaction may be at least one selected from the group consisting of phenol, o-chlorophenol, m-chlorophenol, p-chlorophenol, o-nitrophenol, m-nitrophenol, 2-aminophenol, 2-methoxyphenol, catechol, lysocynol, 3-methylcatechol, 2,4-dimethylphenol, 2,5-dimethylphenol, 3,4-dimethylphenol, 2,3-dimethyl Phenol, 3,5-dimethylphenol, 2,4-dichlorophenol, 2,5-dichlorophenol, 2,3-dichlorophenol, 2,6-dichlorophenol, 3,4-dichlorophenol, 3,5-dichlorophenol , 2,4-dinitrophenol, o-cresol, m-cresol, p-cresol, 2-ethylphenol, 3-ethylphenol, 2-chlorophenol, 2-iodophenol and benzene Lt; / RTI >

In the present invention, the phenol-releasing compound may be an ester in which a phenol hydroxyl group is modified; Glycosides; Phosphate esters; A phenol derivative in which an alkyl group, a carboxyl group, an amino group, a thiol group, an amide group, a sulfide group, a nitro group or a halogen group is introduced in an ortho, meta- or para-position; And a benzene ring compound.

According to the present invention, "phenol releasing compound" is a substrate which can be used for the detection of intracellular enzyme activity, and is a compound capable of releasing phenol by an enzymatic reaction. By the enzyme reaction, phenol, 2-chlorophenol, Phenol, 2-fluorophenol, o -cresol, 2-ethylphenol, m -cresol, 2-nitrophenol, catechol, 2-methoxyphenol, 2-aminophenol, Is a compound capable of releasing a phenol compound such as phenol, 2,3-dimethylphenol, 3-nitrophenol, 4-chlorophenol, p -cresol, 2,5-dichlorophenol or 2,5-dimethylphenol. This is also referred to as a "phenol-tag substrate ".

A phenol-releasing compound, that is, a phenol-tagged substrate, which is capable of favoring phenols by an enzymatic reaction, is an ester (ester, -OOC-), an ether (-OC-), a phenol- glycoside (glycoside, -O-Glc), phosphoric acid esters _{(3 phospho-ester, -O-} PO), ortho -, meta -, para - position to the alkyl (-CH _3), hydroxyl (-OH), carboxylic Amide (-NH-CO- or -CO-NH-), sulfide (-S-SH), halogen group (-Cl , -Br, -F), or a benzene ring compound.

Specifically, as the phenol-tag substrate according to the present invention, various phenol derivatives connected with a phenol group by a covalent bond may be used. For example, an ester bond (ester, -OOC-), an ether bond (-OC-), a glycoside bond (glycoside, -O Esterase, lipase, glycosidase, phosphatase, phosphatase, and phosphatase when phospho-ester (-O-PO ₃ ) is used as a substrate, , And phytase activity.

In addition, the phenol-tagged substrate is ortho -, meta -, para - new methyl groups (-CH _3), hydroxyl groups (-OH), carboxy way (-COOH), amino group (-NH ₂₎ at a position, Or a substance prepared by introducing hydrogen sulfide (-SH). When a substance having an amide bond (amide, -NH-CO- or -CO-NH-) or a sulfide bond (sulfide, -S-SH) is used as a substrate at this position, amidase, and peptidase activity, and can be used for the purpose of detecting the intracellular redox level by using a phenol compound linked through a sulfide group. It is also possible to detect the phenol-lyase activity that liberates phenol by decomposing the carbon bond when a phenolic compound linked to a new carbon bond by the phenol-tag substrate, namely, Ph-C- (R) have. As the phenol-tag substrate, a benzene ring material may be used. In this case, it is possible to detect an oxidase activity such as monooxygenase and dioxygenase which are involved in oxidation of an aromatic compound have. Halogen-linked phenol compounds such as chlorine (Cl), bromine (Br), and fluorine (F) can also be used as substrates. In this case, the enzymatic activity which acts on the halogenated phenol compound to dehalogenate or change the position of the halogen can be detected according to the present invention.

The activity of a transferase that transfers a covalent bond to another organic molecule in the various phenolic compounds mentioned above, or a synthase that produces a new covalent bond (ligase) can also be detected by the present invention by the same principle. Thus, the various phenol-tagged substrates provided in the present invention can be used to identify specific hydrolases, oxido-reductases, isomerases, lyases, Transferase and the like can be detected.

According to the present invention, phenol released from a phenol-tagged substrate is detected by enzyme reaction, and the activity of the expression-induced reporter is measured to search for a strain having a desired enzyme activity at a high speed. In the present invention, reporter activity can be measured by various methods such as microorganism colonization image analysis, fluorescence spectrum analysis, fluorescence flow cytometry analysis (FACS), antibiotic resistance determination, and the like.

Identification and identification of useful genes according to the present invention can be accomplished through any known method, sequencing. After analyzing the sequence of DNA and amino acid, information of the recovered gene can be obtained through the analysis of the salt gas phase in Databank (http://blast.ncbi.nlm.nih.gov).

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these examples are for illustrative purposes only and that the scope of the present invention is not construed as being limited by these examples.

Example  1: Bi-directional T7  Developed forced transfer unit with promoter

Fig. 2 shows a transposon in which a bidirectional T7 promoter is present. It contains a kanamycin resistance gene for screening only transposon-inserted clones. The transcriptional enzyme recognition site of Tn5 having 19 base pairs at both ends (Mosaic End, ME) and a T7 promoter sequence capable of inducing forced transcription of a sub gene exist in both directions.

The transposon was prepared in the following manner. Transposons containing the kanamycin resistance gene and the transposase recognition site of Tn5 from the EZ-Tn5 In-Frame Linker Insertion Kit (Epicenter, USA) were obtained by polymerase chain reaction (PCR). The primers used were a forward primer (SEQ ID NO: 4) and a reverse primer (SEQ ID NO: 5) 25 times) and 72 ° C for 5 minutes (once).

SEQ ID NO: 4: 5'-ctgtctcttgtacacatctgagtaaaggagaagaacttttcactggag-3 '

SEQ ID NO: 5: 5'-ctgtctcttgtacacatctggctagctgaagcttgcatgc-3 '

Next, a transposon in which a bidirectional T7 promoter was inserted into the transposon was prepared. The experimental method is as follows. T7 promoter-inserted forward primer (SEQ ID NO: 6) and reverse primer (SEQ ID NO: 7) were prepared and PCR was performed using the two primers to prepare a transposon containing the T7 promoter. The template was prepared by using the transposon produced by the above method. The transposon was conditioned at 98 ° C for 3 minutes (once), 98 ° C for 15 seconds, 55 ° C for 2 seconds, 72 ° C for 20 seconds (25 times), 72 ° C for 5 minutes Lt; / RTI >

SEQ ID NO: 6: 5'- ctgtctcttgtacacatctccctatagtgagtcgtattagctagcatcatgaacaataaaactgtc-3 '

SEQ ID NO: 7: 5'-ctgtctcttgtacacatctccctatagtgagtcgtattagctagctgaagcttgcatgc-3 '

PCR reaction products were confirmed in agarose gel, and 1201 bp DNA of the expected size was generated.

Example  2: Introduced forced transfer unit Meta genome  Library production

T7 RNA polymerase (DE3) derived from the bacteriophage was inserted into the chromosome of EPI300 (epicenter, USA), which is a host microorganism of the metagenome library, so as to bind to the T7 promoter and initiate transcription. Experimental methods were performed according to the method provided in the kit using a DE3 lysogenization kit (Novagen, USA).

The metagenomic library used in the examples was constructed from a microbial community of sweet potato field soil using a phosmid library kit (Cat. No. CCFOS 110, Epicenter, USA) and had a diversity of about 1 x 10 ⁵ . To introduce transposons into the metagenomic library, the following experiment was conducted.

Meta genomic library cell stock (OD ₆₀₀ = 10) an equal volume of LB medium (Luria-Bertani, 1% ( w / v in 1 ㎖) Bacto-trypton, 0.5% (w / v) yeast extract, 1% (w / v) sodium chloride) was added thereto, followed by incubation at 37 占 폚 for 1 hour. After the incubation, the final volume was adjusted to 10 mL using LB medium, and 1 x copy control solution (Epicenter, USA) and 12.5 μg / mL of chloramphenicol were added to increase the number of DNA copies contained in the host microorganism. And shake-cultured at 250 rpm for 5 hours. DNA with increased copy number in the strain was isolated and purified using plasmid midi prep kit (Qiagen, Germany). The transferase enzyme was a Tn5 transferase (Cat No. TNP92110, Epicenter, USA) that was randomly transferred and inserted in DNA. 200 ng of metagenomic library DNA, 137.06 ng of Tn5 transposon, 1 unit of Tn5 transferase and 1X reaction buffer (50 mM Tris-acetate (pH 7.5) buffer supplemented with 150 mM potassium acetate, 10 mM magnesium acetate, The reaction was stopped by adding SDS at 1% (w / v) for 2 hours at 37 ° C and heating at 70 ° C for 10 minutes. The reaction DNA product was purified using a DNA purification kit (Qiagen, Germany), concentrated in ethanol to a volume of 5 시켜 and introduced into host E. coli (EPI300 (DE3)) by electroporation. The cells were allowed to recover at 37 占 폚 for 1 hour in order to maintain the condition of the strain and then cultured on LB solid medium supplemented with 10 占 퐂 / ml of kanamycin (transposon selection marker) and 12.5 占 퐂 / ml of chloramphenicol (metagenome selection marker) And cultured at 37 캜 for 16 hours. After culturing, the resulting colonies were collected in a storage buffer (1 x TY buffer, 15% (v / v) glycerol, 2% (w / v) glucose) and dispensed in a volume of 0.5 ml. The cells were frozen in a cryocooler.

Example  3: High sensitive lipase detection in forced transfer library

TBN (tributyrin) turbid plates were prepared to screen lipase. The production method is as follows. 50 ml of 10 x Gum Arabic solution (5% w / v Gum Arabic, 200 mM NaCl, 10 mM CaCl ₂ ) and 5 ml of Glyceryl tributyrate reagent (Sigma, USA) were placed in a Blender Jar do. Separately, 445 ml of LB medium (Luria-Bertani, 1% (w / v) bacto-tryptone, 0.5% (w / v) yeast extract, 1% (w / v) ) Sodium chloride) are sterilized together. After sterilization, the mixture was stirred vigorously (mixing for 30 seconds, stopped for 30 seconds, and mixed for 5 minutes) using a blender so that the Glyceryl tributyrate reagent and the Gum Arabic solution could be uniformly mixed, and this was mixed with 0.1 mM IPTG and 12.5 μg / ml of chloramphenicol , And the mixture was poured into a petri dish to prepare a turbid plate.

The same meta genomic library in which the metagenomic library (transposon-inserted library) and the transposon-inserted meta genome library of sweet potato field soil were inserted and inserted into the meta genome library by selecting and comparing clones having lipase activity T7 promoter.

For trans poson this library was not inserted navigate ^four library of about 2.5 x10, for the trans poson insertion library search was a 2 x 10 ⁴ library. Each library was plated on a TBN turbid plate and incubated at 37 ° C for 24 hours. After a certain growth of the colonies at 37 ° C, the cells were transferred to room temperature and observed for 9 days to form a transparent ring by enzyme activity. As a result of the experiment, in the library in which the transposon was inserted, a colony with a transparent ring was found on the first day and 24 hits were selected for 9 days. On the other hand, in the library in which the transposon was not inserted, transparent rings were observed from the second day of culture and 20 heat of the same period were selected (Fig. The results of primary screening showed that when the time and number of transparent rings were formed, there was a search effect in the library containing transposon, but the effect was not so great. However, when the first screened clones were tested on the TBN plate, the number of heat was not significantly different when the second round of the assay was performed (transposon-inserted library: 12, transposon-free library: 11). On the fourth day, 11 libraries were found in the library with transposon inserted, compared with 2 in the library where no transposon was inserted, and the results were dramatically different on the fourth day (B in Fig. 4). Next, in order to show the increase in heat activity due to the introduction of transoson, we compared the degree of transparency of the most rapidly selected heat on the 2nd day and 4th day in each library among the TBN plates searched. On the left is a clone selected on day 2 in a library without transposon introduced, and the center is a clone selected on day 1 in a library into which transposon was introduced. On the right side, the result of confirming that the heat shown in the center has a strong lipase activity through secondary verification (FIG. 4).

That is, when the library is cultured for a long time on the TBN plate, the active clone slowly comes out later, and there is little difference in the number of hits finally searched. However, by introducing transposon into the library, There was an effect that a lot of hits could be selected.

Example  4: Seetro Bertha Freundy's  From the Force Transfer Library Transparent ring  Tyrosine by searching Phenolic  quest

The effect of forced transfer system was confirmed by searching tyrosine phenolase by the occurrence of transparent ring in tyrosine turbid plate. The genome of Citrobacter freundii , which is known to contain the gene of tyrosine phenol lyase on the chromosome, was transformed into the genome of Citrobacter freundii by using a phosmid library production kit (Cat. No. CCFOS 110, Epicenter, USA) The library was constructed and a forced transcription system was introduced into the genomic library. The experimental procedure is as follows. In order to isolate the target genomic DNA, 1 ml of a genomic library of cell lines (OD ₆₀₀ / ml = 10) was added to an equal volume of LB medium (Luria-Bertani, 1% (w / v) 1 ml of tryptone, 0.5% (w / v) yeast extract, and 1% (w / v) sodium chloride) was added thereto, followed by incubation at 37 ° C for 1 hour. After the incubation, the final volume was adjusted to 10 ml using LB medium, and 1 x copy control (Epicenter, USA) solution and 12.5 μg / ml solution of genomic library were added to increase the number of genomic library DNA copies contained in the strain containing the genomic library Chloramphenicol was added and cultured at 37 DEG C and 250 rpm for 5 hours with shaking. DNA with increased copy number in the strain was isolated and purified using plasmid midi prep kit (Qiagen, USA). The reaction mixture was randomly inserted into the genomic library. The reaction mixture was prepared by mixing 1 unit of Tn5 transferase (Epicenter, USA) and 1 x reaction buffer (150 mM acetic acid) in a molar ratio of genomic library gene and transposon of 1:10, (50 mM Tris-acetate (pH 7.5) buffer supplemented with 10 mM potassium acetate, 10 mM magnesium acetate and 4 mM spermidine) was added and the mixture was transiently transfected at 37 ° C for 2 hours. SDS was added at 1% Stopped. Reaction DNA products were purified using a DNA purification kit (Qiagen, USA), concentrated in ethanol to a volume of 5 μl, and introduced into E. coli (EPI300 (DE3)) by electroporation. The cells were allowed to recover at 37 占 폚 for 1 hour in order to maintain the condition of the strain and then cultured on LB solid medium supplemented with 10 占 퐂 / ml kanamycin (transposon selection marker) and 12.5 占 퐂 / ml chloramphenicol (metagenome selection marker) Followed by incubation at 37 DEG C for 16 hours. The size of the bacterial library grown in the medium containing the selection marker was 2.3 x 10 ⁴ , which was recovered using a storage buffer (1 x TY buffer, 15% (v / v) glycerol, 2% (w / v) glucose) .

A tyrosine turbid plate was constructed to select tyrosine phenolase. The production method is as follows. Add 1.5% (w / v) agar to the LB medium and sterilize. After sterilization, 20 mM tyrosine, 10 μM PLP, 0.1 mM IPTG and 12.5 μg / ml were added when the medium temperature had cooled to about 60 ° C. The medium was slowly cooled from 60 ° C to 45 ° C with moderate agitation to induce tyrosine crystallization so that sufficient tyrosine microcrystals could be formed in the medium. After the medium was sufficiently turbid, the temperature was raised to 60 ° C again and poured into a petri dish to prepare a turbid plate (Choi, S. et al . , (2006) Cor . J. Microbiol . Biotechnol. , 34 (1), 58-62).

We tried to verify the effect of forced transcription by selecting and comparing clones with the activity of tyrosine phenolase in the same genomic library in which the genomic library and transposon inserted in the Saccharomyces cerevisiae without transposon were inserted.

Approximately 1 x 10 < ⁴ > of the clones in which the transposon was inserted or not inserted were searched. Each library was plated on a tyrosine turbid plate and incubated at 37 ° C to observe whether a transparent ring was formed (Fig. 5A). As a result, four candidate colonies were selected in the library in which the transposon was inserted after 10 days, and no candidate colonies were generated in the library in which the transposon was not inserted. When four candidate colonies were streaked back to the tyrosine turbid plate, it was confirmed that a transparent ring occurred in one clone 5 days later (FIG. 5B). That is, although the activity was weak in the library to which the forced transcription was not introduced, the expression amount was increased to such an extent that a transparent ring was not formed but a transparent ring was formed due to the introduction of the forced transcription.

Example  5: Redesigned gene circuit with fluorescent protein as reporter

The redesign gene circuit consists of one or more reporter sites selected from phenolic compound degrading enzyme control protein sites, gene expression control sites including promoters, fluorescent proteins and antibiotic resistance genes.

The phenolic compound degrading enzyme regulatory protein region that detects phenol is dmpR, a regulatory protein of phenol decomposition dmp operon derived from P. putida , and P. putida Plasmid pUC19-based redesign gene circuit (pGESS-FP) was constructed by using RBS derived from E. coli and a fluorescent protein as a reporter protein.

In the present invention, in order to prepare a phenol sensing redesign gene circuit using an EGFP (green fluorescent protein) gene as a reporter, a pMGFP plasmid (Ha et al . Appl . Environm . Microbiol . 73: 7408, 2007) with EcoR I and Hind III restriction enzyme to obtain a 720 bp EGFP fragment and then introduced into pUC19 vector to construct pUC-EGFP.

In the present invention, by using the forward and reverse primers (SEQ ID NO: 8 and SEQ ID NO 9) P. putida The colonies were PCR amplified and EcoR DNA fragment of 2,157 bp consisting of the dmpR gene (1,692 bp) containing the I restriction enzyme linker, the dmp operator-promoter region and a part of the dmpK gene (42 bp) and the inserted restriction enzyme sequence of 12 bp during the cloning process was prepared. The dmpK gene was located 405 bp away from dmpR (1,693-2,097 bp), and the reporter gene was constructed to be linked to the N-terminal 42 bp of dmpK.

SEQ ID NO: 8: 5'-ccggaattcgagctgatcgaaagtcgg-3 '

SEQ ID NO: 9: 5'-ccggaattcctagccttcgatgccgat-3 '

The N-terminal fragment of dmpK was left to stably maintain the transcription enhancer function of the dmp operator-promoter region even when fluorescent proteins and various antibiotic resistance genes were used as reporters. This PCR product was cloned into the EcoR I site of pUC-EGFP to construct pGESS-EGFP (5,510 bp) (Fig. 6A).

Further, in order to use GFP _UV (ultraviolet excitation green fluorescent protein) gene, which is advantageous for visual observation, as a reporter of the present system, a 717 bp ultraviolet excitation green fluorescent protein gene derived from pGFP _UV (Clontech, USA) (EGFP). For this, PCR was performed with forward and reverse primers (SEQ ID NO: 10 and SEQ ID NO: 11) to amplify the UV-excited green fluorescent protein gene, and gene manipulation was performed by homologous recombination method to introduce it into pGESS-EGFP vector 6 of b). The homologous recombination method was carried out by preparing a host cell and introducing a linearized gene (Zhang et < RTI ID = 0.0 > al ., Nature Biotech . 18: 1314,2000; Zhang et al ., Nature Genetics , 20: 123,1998 ; Korean Patent Application No. 10-2005-0116672). A single colony of E. coli DH5a containing the pKD46 vector encoding the red-recombinase was inoculated in 3 ml of LB liquid medium supplemented with 25 占 퐂 / ml of chloramphenicol and shaken at 30 占 폚 for 16 hours Lt; / RTI > The culture broth was suspended in 100 ml of LB (Luria-Bertani, 1% (w / v) bacto-tryptone, 0.5% (w / v) yeast extract, 1% (OD ₆₀₀ / ml) was inoculated in a 1% (v / v) liquid medium containing 1% (w / v) sodium chloride at 30 ° C until the cell growth (OD ₆₀₀ / ml) reached 0.5-0.6. After the incubation, competent cells for electric shock method were prepared (Molecular Cloning: A Laboratory Manual, Joseph Sambrook, David W. Russell) and BamH (2% (w / v) bacteriophage) after 10 ng of pGESS-EGFP restriction enzyme and 100 ng of PCR product of the UV-excited green fluorescent protein to be replaced, Homologous recombination was induced at 25 占 폚 for 20 hours by adding 1 ml of medium such as tryptone, 0.5% (w / v) yeast extract, 10mM sodium chloride, 2.5mM potassium chloride, 10mM magnesium chloride, 10mM magnesium sulfate, 20mM glucose) . Ampicillin was plated on LB solid medium supplemented with 50 μg / ml and cultured overnight at 37 ° C to select a phenol sensor, pGESS-GFP _UV , in which the green fluorescent protein gene was replaced with an ultraviolet excitation green fluorescent protein gene. For reference, the pKD46 vector contains a temperature-sensitive origin of replication, which can be removed at 37 ° C and cells containing only the pGESS-GFP _UV gene can be obtained.

SEQ ID NO: 10: 5'-acctggagatggccgtgaccaatacccccacaccgactttcgatcagctcatgagtaaaggagaagaact-3 '

SEQ ID NO: 11: 5'-cggataacaatttcacacaggaaacagctatgaccatgattacgccaagcttatttgtagagctcatcca-3 '

Example  6: Seetro Bertha Freundy's  Redesign in forced transcription library Tyrosine by searching gene circuit system Phenolic  quest

We investigated whether the target gene could be selected with high sensitivity by applying the redesigned gene circuit system prepared in Example 5 in the library in which forced transcription was introduced.

 The re-designed gene circuit (pGESS-EGFP) prepared in Example 5 was inserted into the genome library of the Saccharomyces cerevisiae strain introduced with the forced transcription used in Example 4 and the genome library not yet introduced using the electroporation method .

Redesigned clones retaining the tyrosine phenol-lyase gene in two libraries with introduced gene circuits, that is, a genome library with forced transcription introduced or a genome library with no forced transcription introduced. Fluorescence intensity of fluorescent protein (EGFP) was used for fast search. The experimental method is as follows. 200 μl of the cell stock (OD ₆₀₀ / ml = 70) of the library in which the forced transcription was introduced or the library into which the forced transcription was not introduced was mixed with 50 μg / ml of ampicillin (redesign gene circuit selection marker) and 12.5 Was added to 2 mL of LB (Luria-Bertani) medium supplemented with 10 mu g / mL of chloramphenicol (metagenome selection marker) and the library was incubated at 37 DEG C for 2 hours to prepare the library in a healthy state. (12.8 g Na ₂ HPO ₄ -7H ₂ O per liter, 3 g H ₂ PO _{4 ,} 0.5 g NaCl, 1.0 g NH ₄ Cl, 2 mM MgSO _{4 ,} 0.1 mM CaCl ₂ , 1% (v / v) of 0.4% glucose, 0.2% casamino acid, 0.01% thiamine, 1 mM tyrosine and 10 uM PLP) and cultured at 37 ° C. 50 [mu] g / ml of ampicillin, 12.5 [mu] g / ml of chloramphenicol as a selection marker and 0.1 mM IPTG as an inducer were added. The effect of forced transcription was analyzed by a redesigned gene circuit system by analyzing cell fluorescence by sampling the culture medium during the culturing. Fluorescence analysis of cells was carried out by measuring the fluorescence intensity of green fluorescent protein at 1 × 10 ⁴ cells in FL-1 (515-545 nm) using FACSCalibur (BD science, USA) equipment.

As a result, 22 hits were detected in the genomic library containing only the recombinant gene circuit without the forced transcription system, but in the genomic library in which the forced transcription system was introduced, 82 hits were confirmed at 13 hours after the incubation, The sorting rate was increased (Fig. 7A). Also, in comparison of fluorescence values of the selected heat, the fluorescence value of the library into which the forced transcription was introduced was observed to be about 2.2 times higher than that of the library to which the forced transcription was not introduced (FIG.

As a result, when compared with the results of Example 4 (no recombinant gene search system), the number of selected hits was significantly increased (not used: 1, applied: 82) by applying a highly sensitive recombinant gene search system Fast search was possible in short time (not used: 9 days, application: 0.5 days).

The search for useful enzymes through the formation of transparent rings in a commonly used turbid plate can be carried out within 24 hours (1 day) in a single colony for the detection of high expression or high activity enzyme activity (Choi , S. et al . , Kor . J. Microbiol . Biotechnol. , 34:58, 2006), a method of observing a transparent ring on a turbid plate in the case of low expression (or nude expression) or only a trace amount of activity (for example, a meta genome library search) It is obi limited to select the target enzyme. Therefore, it is expected that a highly sensitive recombinant gene search system would be desirable to search and screen for useful enzymes with a very small amount of activity, and a stronger search system would be constructed by simultaneously linking a forced transcription system that increases the expression level .

While the present invention has been particularly shown and described with reference to specific embodiments thereof, those skilled in the art will appreciate that such specific embodiments are merely preferred embodiments and that the scope of the present invention is not limited thereby. something to do. It is therefore intended that the scope of the invention be defined by the claims appended hereto and their equivalents.

<110> Korea Research Institute of Bioscience and Biotechnology <120> Method for Screening of Useful Enzymes from Metagenome Using          Forced Transcription <130> P11-B117 <160> 11 <170> Kopatentin 1.71 <210> 1 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Recognition site of trasposase <400> 1 ctgtctcttg tacacatct 19 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> T7 promoter <400> 2 taatacgact cactataggg 20 <210> 3 <211> 1209 <212> DNA <213> Artificial Sequence <220> <223> transposon <400> 3 ctgtctcttg tacacatctc cctatagtga gtcgtattag ctagcatcat gaacaataaa 60 actgtctgct tacataaaca gtaatacaag gggtgttatg agccatattc aacgggaaac 120 gtcttgctcg aggccgcgat taaattccaa catggatgct gatttatatg ggtataaatg 180 ggctcgcgat aatgtcgggc aatcaggtgc gacaatctat cgattgtatg ggaagcccga 240 tgcgccagag ttgtttctga aacatggcaa aggtagcgtt gccaatgatg ttacagatga 300 gatggtcaga ctaaactggc tgacggaatt tatgcctctt ccgaccatca agcattttat 360 ccgtactcct gatgatgcat ggttactcac cactgcgatc cccggaaaaa cagcattcca 420 ggtattagaa gaatatcctg attcaggtga aaatattgtt gatgcgctgg cagtgttcct 480 gcgccggttg cattcgattc ctgtttgtaa ttgtcctttt aacagcgatc gcgtatttcg 540 tctcgctcag gcgcaatcac gaatgaataa cggtttggtt gatgcgagtg attttgatga 600 cgagcgtaat ggctggcctg ttgaacaagt ctggaaagaa atgcataaac ttttgccatt 660 ctcaccggat tcagtcgtca ctcatggtga tttctcactt gataacctta tttttgacga 720 ggggaaatta ataggttgta ttgatgttgg acgagtcgga atcgcagacc gataccagga 780 tcttgccatc ctatggaact gcctcggtga gttttctcct tcattacaga aacggctttt 840 tcaaaaatat ggtattgata atcctgatat gaataaattg cagtttcatt tgatgctcga 900 tgagtttttc taagcggccg ctcagaattg gttaattggt tgtaacactg gcagagcatt 960 acgctgactt gacgggacgg cggctttgtt gaataaatcg aacttttgct gagttgaagg 1020 atcagatcac gcatcttccc gacaacgcag accgttccgt ggcaaagcaa aagttcaaaa 1080 tcaccaactg gtccacctac aacaaagctc tcatcaaccg tggcggggat cctctagagt 1140 cgacctgcag gcatgcaagc ttcagctagc taatacgact cactataggg agatgtgtac 1200 aagagacag 1209 <210> 4 <211> 48 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 ctgtctcttg tacacatctg agtaaaggag aagaactttt cactggag 48 <210> 5 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 ctgtctcttg tacacatctg gctagctgaa gcttgcatgc 40 <210> 6 <211> 66 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 ctgtctcttg tacacatctc cctatagtga gtcgtattag ctagcatcat gaacaataaa 60 actgtc 66 <210> 7 <211> 59 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 7 ctgtctcttg tacacatctc cctatagtga gtcgtattag ctagctgaag cttgcatgc 59 <210> 8 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 8 ccggaattcg agctgatcga aagtcgg 27 <210> 9 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 9 ccggaattcc tagccttcga tgccgat 27 <210> 10 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 10 acctggagat ggccgtgacc aataccccca caccgacttt cgatcagctc atgagtaaag 60 gagaagaact 70 <210> 11 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 11 cggataacaa tttcacacag gaaacagcta tgaccatgat tacgccaagc ttatttgtag 60 agctcatcca 70

Claims (22)

Forced transcription system and redesign including the following steps: Method for searching target enzyme from meta genome library using gene circuit:
(a) a transposase recognition site (Mosaic End, ME), a promoter, an antibiotic resistance gene, an inverse promoter and a reverse transposase recognition site sequence in a metagenomic library gene containing a gene encoding the enzyme to be sought Reacting a transposon comprising a transposon with a transposon to prepare a metagenomic library into which the transposon is randomly inserted;
(b) preparing a recombinant microorganism library by introducing the metagenome library into a host microorganism into which an RNA polymerase capable of promoting the expression of the promoter and the reverse promoter of step (a) is inserted;
(c) at least one reporter gene selected from the group consisting of (i) a gene encoding a regulatory protein that recognizes a phenolic compound, (ii) a gene encoding a fluorescent protein, and an antibiotic resistance gene, and (iii) A regulatory protein that recognizes the phenolic compound and binds to the regulator to regulate the expression of downstream reporter gene; and a reporter gene that is operatively associated with the regulatory region, Introducing into the meta genome library of step (a) a genetic circuit for the detection of a phenolic compound, which comprises a gene expression regulatory region composed of a promoter inducing the expression of the gene;
(d) a step of culturing the recombinant microorganism library by treating the inducer with an inducer so that the promoter can operate during enzyme search;
(e) treating the cultured recombinant microorganism library with a phenol-releasing compound which may be advantageous to the phenolic compound by an enzymatic reaction;
(f) detecting the phenol-based compound liberated by the enzyme reaction, measuring the activity of the expression-induced reporter protein, and then searching the microorganism having an activity capable of favoring the phenolic compound by an enzyme reaction at a high speed; And
(g) recovering the gene of the enzyme capable of favoring the phenolic compound by the enzyme reaction from the searched microorganism, and then identifying it by sequence analysis.
The method according to claim 1, wherein the promoter of the transposon is selected from the group consisting of a T7 promoter, a lac promoter, an ara promoter, a trc promoter, and a P _hce promoter.
The method according to claim 1, wherein the RNA polymerase of step (b) is a RNA polymerase derived from a microorganism or a T7 RNA polymerase derived from a phage.
2. The transposon of claim 1 wherein the transposase recognition site is selected from the group consisting of Tn5 transposon, IS transposon, Tn3 transposon, Tn7 site-specific transposon, and Mu transposon. Wherein the transposase recognition site is a transposase recognition site.
2. The method according to claim 1, wherein the transposase recognition site (Mosaic End, ME) is a Tn5 transposase recognition site and the Tn5 transposase recognition site is a nucleotide sequence of SEQ ID NO: &Lt; / RTI &gt;
3. The method according to claim 2, wherein the promoter is a T7 promoter and the T7 promoter has a nucleotide sequence of SEQ ID NO: 2.
The method according to claim 1, wherein the antibiotic resistance gene is selected from the group consisting of a kanamycin resistance gene, a tetracycline resistance gene, a chloramphenicol resistance gene, and an ampicillin resistance gene.
2. The method of claim 1, wherein the transposon comprises the nucleotide sequence of SEQ ID NO: 3.
The method according to claim 1, wherein the transposable agent is a bacterial-derived Tn5 transposase.
The method according to claim 6, wherein IPTG (isopropyl-β-D-thiogalactopyranoside) or lactose is used as an inducer for activating the T7 promoter.
The method according to claim 1, wherein the meta genome library is prepared by introducing DNA obtained from the soil into a vector selected from the group consisting of plasmid, fosmid, cosmid, BAC and YAC.
2. The method according to claim 1, wherein the regulatory region that regulates the expression of the downstream reporter gene by binding to the regulatory protein that recognizes the phenolic compound binds to the regulatory protein that recognizes the phenolic compound, Wherein the promoter of the reporter gene is activated.
The method according to claim 1, wherein the enzyme is selected from the group consisting of alpha- glucosidase, beta-glucosidase, cellulase, glycosylceramidase, phosphatase, phytase, estera, lipase, Wherein the peptide is selected from the group consisting of peptidase, proteinase, oxydorudactase, phenol-lyase, dihalogenase, isomerase, monooxygenase and deoxygenase.
The method of claim 1, wherein the phenolic compound liberated by the enzymatic reaction is selected from the group consisting of phenol, o-chlorophenol, m-chlorophenol, p-chlorophenol, o-nitrophenol, m-nitrophenol, 2-aminophenol, 2-methoxyphenol, catechol, lysocynol, 3-methylcatechol, 2,4-dimethylphenol, 2,5-dimethylphenol, 3,4-dimethylphenol, 2,3-dimethyl Phenol, 3,5-dimethylphenol, 2,4-dichlorophenol, 2,5-dichlorophenol, 2,3-dichlorophenol, 2,6-dichlorophenol, 3,4-dichlorophenol, 3,5-dichlorophenol , 2,4-dinitrophenol, o-cresol, m-cresol, p-cresol, 2-ethylphenol, 3-ethylphenol, 2-chlorophenol, 2-iodophenol and benzene &Lt; / RTI &gt;
The method of claim 1, wherein the phenol-releasing compound is an ester in which a phenol hydroxyl group is modified; Glycosides; Phosphate esters; A phenol derivative in which an alkyl group, a carboxyl group, an amino group, a thiol group, an amide group, a sulfide group, a nitro group or a halogen group is introduced in an ortho, meta- or para-position; &Lt; / RTI &gt; and benzene ring compounds.
The method of claim 1, wherein the regulatory protein that recognizes the phenolic compound is DmpR or a variant thereof.
The method of claim 1, wherein the fluorescent protein is selected from the group consisting of GFP, GFP _UV , and RFP.
delete The method according to claim 1, wherein the activity of the reporter protein is selected from microorganism colony image analysis, fluorescence spectrum analysis, fluorescence flow cytometry (FACS) and antibiotic resistance measurement.
The method according to claim 1, wherein the microorganism is selected from the group consisting of E. coli, Pseudomonas and yeast.
The method according to claim 1, wherein the gene circuit comprises RBS (Ribosome binding site) to increase the expression efficiency of a reporter protein.
The method according to claim 1, wherein the reporter gene is a double reporter gene consisting of a gene encoding a fluorescent protein and an antibiotic resistance gene.

Images